WorldWideScience

Sample records for tagged dna fragments

  1. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  2. DNA fragmentation in spermatozoa

    DEFF Research Database (Denmark)

    Rex, A S; Aagaard, J.; Fedder, J

    2017-01-01

    Sperm DNA Fragmentation has been extensively studied for more than a decade. In the 1940s the uniqueness of the spermatozoa protein complex which stabilizes the DNA was discovered. In the fifties and sixties, the association between unstable chromatin structure and subfertility was investigated....... In the seventies, the impact of induced DNA damage was investigated. In the 1980s the concept of sperm DNA fragmentation as related to infertility was introduced as well as the first DNA fragmentation test: the Sperm Chromatin Structure Assay (SCSA). The terminal deoxynucleotidyl transferase nick end labelling...... (TUNEL) test followed by others was introduced in the nineties. The association between DNA fragmentation in spermatozoa and pregnancy loss has been extensively investigated spurring the need for a therapeutic tool for these patients. This gave rise to an increased interest in the aetiology of DNA damage...

  3. DNA tagged microparticles

    Science.gov (United States)

    Farquar, George Roy; Leif, Roald N; Wheeler, Elizabeth

    2015-05-05

    A simulant that includes a carrier and DNA encapsulated in the carrier. Also a method of making a simulant including the steps of providing a carrier and encapsulating DNA in the carrier to produce the simulant.

  4. DNA tagged microparticles

    Science.gov (United States)

    Farquar, George R.; Leif, Roald N.; Wheeler, Elizabeth

    2016-03-22

    In one embodiment, a product includes a plurality of particles, each particle including: a carrier that includes a non-toxic material; and at least one DNA barcode coupled to the carrier, where the particles each have a diameter in a range from about 1 nanometer to about 100 microns.

  5. Multiple tag labeling method for DNA sequencing

    Science.gov (United States)

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  6. Multi-Threaded DNA Tag/Anti-Tag Library Generator for Multi-Core Platforms

    Science.gov (United States)

    2009-05-01

    base pair)  Watson ‐ Crick  strand pairs that bind perfectly within pairs, but poorly across pairs. A variety  of  DNA  strand hybridization metrics...AFRL-RI-RS-TR-2009-131 Final Technical Report May 2009 MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE PLATFORMS...TYPE Final 3. DATES COVERED (From - To) Jun 08 – Feb 09 4. TITLE AND SUBTITLE MULTI-THREADED DNA TAG/ANTI-TAG LIBRARY GENERATOR FOR MULTI-CORE

  7. Nuclear structure via isomer tagging of fission fragments

    Science.gov (United States)

    Wu, C. Y.; Cline, D.; Simon, M. W.; Stoyer, M. A.

    1997-10-01

    The high efficiency for detecting high-fold γ rays by large Ge arrays makes it possible to study the detailed spectroscopy of many neutron-rich nuclei produced by fission. Major progress has been made using sealed spontaneous fission sources. Considerable improvement in selectivity is provided, with an open source, both by gating on isomers and by detection of both fission fragments in coincidence with the deexcitation γ rays (see the preceding contribution). The reconstructed kinematics allows a measure of fragment mass and the Doppler shift correction of γ rays. In a recent experiment, fission fragments were detected using half of the CHICO array and an annular PPAC in coincidence with deexcitation γ rays detected by the Rochester array of eight Compton-suppressed Ge detectors. The annular PPAC was located only 1.0" from a 3.7 μCi ^252Cf source for efficient isomer tagging. The correlation was studied between delayed, within a time window between 150 ns and 10 μs after a fission occurring, and prompt γ rays. Several prominent feeding patterns to isomers in the mass region around 100 and 130 are identified by such correlation study. Experimental details and results will be presented.

  8. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  9. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  10. Supramolecular gel electrophoresis of large DNA fragments.

    Science.gov (United States)

    Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

    2017-10-01

    Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  12. Menadione-induced DNA fragmentation without 8-hydroxy-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, Anne; Corcoran, George B.; Poulsen, Henrik E.

    1995-01-01

    Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade......Farmakologi, frie iltradikaler, menadion, DNA fragmentering, rotteleverceller, oksidativ DNA skade...

  13. High efficiency hydrodynamic DNA fragmentation in a bubbling system

    NARCIS (Netherlands)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; Van Den Berg, Albert; Eijkel, Jan C.T.; Shui, Lingling

    2017-01-01

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling

  14. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Science.gov (United States)

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  15. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  16. Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods

    Directory of Open Access Journals (Sweden)

    Sedlackova Tatiana

    2013-02-01

    Full Text Available Abstract Background Specific applications and modern technologies, like non-invasive prenatal testing, non-invasive cancer diagnostic and next generation sequencing, are currently in the focus of researchers worldwide. These have common characteristics in use of highly fragmented DNA molecules for analysis. Hence, for the performance of molecular methods, DNA concentration is a crucial parameter; we compared the influence of different levels of DNA fragmentation on the accuracy of DNA concentration measurements. Results In our comparison, the performance of the currently most commonly used methods for DNA concentration measurement (spectrophotometric, fluorometric and qPCR based were tested on artificially fragmented DNA samples. In our comparison, unfragmented and three specifically fragmented DNA samples were used. According to our results, the level of fragmentation did not influence the accuracy of spectrophotometric measurements of DNA concentration, while other methods, fluorometric as well as qPCR-based, were significantly influenced and a decrease in measured concentration was observed with more intensive DNA fragmentation. Conclusions Our study has confirmed that the level of fragmentation of DNA has significant impact on accuracy of DNA concentration measurement with two of three mostly used methods (PicoGreen and qPCR. Only spectrophotometric measurement was not influenced by the level of fragmentation, but sensitivity of this method was lowest among the three tested. Therefore if it is possible the DNA quantification should be performed with use of equally fragmented control DNA.

  17. Amplification of deoxyribonucleic acid (DNA) fragment using two ...

    African Journals Online (AJOL)

    user

    2011-04-11

    Apr 11, 2011 ... polymerases on this method, whether different lengths of. DNA fragments could be amplified by two-step PCR and the difference of DNA product quality produced by the two methods. MATERIALS AND METHODS. PCR template and reagents. Enterobacteria phage lambda DNA (GenBank no: V00636) ...

  18. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  19. Bacterial natural transformation by highly fragmented and damaged DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren; Harms, Klaus; Orlando, Ludovic Antoine Alexandre

    2013-01-01

    for microbes, but not as potential substrate for bacterial evolution. Here, we show that fragmented DNA molecules (≥20 bp) that additionally may contain abasic sites, cross-links, or miscoding lesions are acquired by the environmental bacterium Acinetobacter baylyi through natural transformation. With uptake......DNA molecules are continuously released through decomposition of organic matter and are ubiquitous in most environments. Such DNA becomes fragmented and damaged (often DNA is recognized as nutrient source...... of DNA from a 43,000-y-old woolly mammoth bone, we further demonstrate that such natural transformation events include ancient DNA molecules. We find that the DNA recombination is RecA recombinase independent and is directly linked to DNA replication. We show that the adjacent nucleotide variations...

  20. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  1. Sperm DNA fragmentation, recurrent implantation failure and recurrent miscarriage

    Directory of Open Access Journals (Sweden)

    Carol Coughlan

    2015-01-01

    Full Text Available Evidence is increasing that the integrity of sperm DNA may also be related to implantation failure and recurrent miscarriage (RM. To investigate this, the sperm DNA fragmentation in partners of 35 women with recurrent implantation failure (RIF following in vitro fertilization, 16 women diagnosed with RM and seven recent fathers (control were examined. Sperm were examined pre- and post-density centrifugation by the sperm chromatin dispersion (SCD test and the terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL assay. There were no significant differences in the age of either partner or sperm concentration, motility or morphology between three groups. Moreover, there were no obvious differences in sperm DNA fragmentation measured by either test. However, whilst on average sperm DNA fragmentation in all groups was statistically lower in prepared sperm when measured by the SCD test, this was not seen with the results from the TUNEL assay. These results do not support the hypothesis that sperm DNA fragmentation is an important cause of RIF or RM, or that sperm DNA integrity testing has value in such patients. It also highlights significant differences between test methodologies and sperm preparation methods in interpreting the data from sperm DNA fragmentation tests.

  2. Electronic transport in methylated fragments of DNA

    International Nuclear Information System (INIS)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  3. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  4. Optimizing recoil-isomer tagging with the Argonne fragment mass analyzer

    International Nuclear Information System (INIS)

    Garnsworthy, A.B.; Lister, C.J.; Regan, P.H.; Blank, B.B.; Cullen, I.J.; Gros, S.; Henderson, D.J.; Jones, G.A.; Liu, Z.; Seweryniak, D.; Shumard, B.R.; Thompson, N.J.; Williams, S.J.; Zhu, S.

    2008-01-01

    A new focal plane detector arrangement for the Fragment Mass Analyzer (FMA) has been built and tested at Argonne National Laboratory. This set-up is particularly sensitive for performing Recoil-Isomer Tagging on nuclei with isomeric states with lifetimes in the microsecond range. Recoiling nuclei from fusion-evaporation reactions at the target position are dispersed by their ratio of mass to charge (A/q) by the FMA and stopped in low pressure gas (air) at the focal plane. Subsequent gamma decays from isomeric states in the reaction products are observed using Ge detectors. A constant gas flow through the focal plane chamber efficiently removes longer-lived beta-decaying species from sight of the detectors. This set-up has been commissioned successfully with the microsecond isomer in 80 Rb, populated via the 52 Cr( 32 S, 3pn) reaction at 135 MeV

  5. Agarose gel electrophoresis for the separation of DNA fragments.

    Science.gov (United States)

    Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

    2012-04-20

    Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate

  6. The application of PIT tags to measure transport of detrital coral fragments on a fringing reef: Majuro Atoll, Marshall Islands

    Science.gov (United States)

    Ford, Murray R.

    2014-06-01

    Passive integrated transponder (PIT) tags are a radio-frequency identification device widely used as a machine-readable identification tool in fisheries research. PIT tags have also been employed, to a lesser extent, to track the movement of gravel-sized clasts within fluvial and coastal systems. In this study, PIT tags were inserted into detrital coral fragments and used to establish source-sink transport pathways on a fringing reef on Majuro Atoll in the Marshall Islands. Results suggest the transport of gravel-sized material on the inter-tidal reef flat is exclusively across-reef towards the lagoon. Considerable variation in the distance travelled by fragments was observed. Fragments were largely intact and visually recognisable after almost 5 months on the reef flat. However, the branches of some recovered fragments had broken off and corallite abrasion was observed in recovered fragments. This study indicates that PIT tags are an inexpensive and powerful new addition to the suite of sediment transport and taphonomic tools for researchers working within coral reef systems.

  7. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  8. DNA fragments assembly based on nicking enzyme system.

    Directory of Open Access Journals (Sweden)

    Rui-Yan Wang

    Full Text Available A couple of DNA ligation-independent cloning (LIC methods have been reported to meet various requirements in metabolic engineering and synthetic biology. The principle of LIC is the assembly of multiple overlapping DNA fragments by single-stranded (ss DNA overlaps annealing. Here we present a method to generate single-stranded DNA overlaps based on Nicking Endonucleases (NEases for LIC, the method was termed NE-LIC. Factors related to cloning efficiency were optimized in this study. This NE-LIC allows generating 3'-end or 5'-end ss DNA overlaps of various lengths for fragments assembly. We demonstrated that the 10 bp/15 bp overlaps had the highest DNA fragments assembling efficiency, while 5 bp/10 bp overlaps showed the highest efficiency when T4 DNA ligase was added. Its advantage over Sequence and Ligation Independent Cloning (SLIC and Uracil-Specific Excision Reagent (USER was obvious. The mechanism can be applied to many other LIC strategies. Finally, the NEases based LIC (NE-LIC was successfully applied to assemble a pathway of six gene fragments responsible for synthesizing microbial poly-3-hydroxybutyrate (PHB.

  9. Real-time Tracking of DNA Fragment Separation by Smartphone.

    Science.gov (United States)

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  10. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  11. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  12. Sub-wavelength plasmonic readout for direct linear analysis of optically tagged DNA

    Science.gov (United States)

    Varsanik, Jonathan; Teynor, William; LeBlanc, John; Clark, Heather; Krogmeier, Jeffrey; Yang, Tian; Crozier, Kenneth; Bernstein, Jonathan

    2010-02-01

    This work describes the development and fabrication of a novel nanofluidic flow-through sensing chip that utilizes a plasmonic resonator to excite fluorescent tags with sub-wavelength resolution. We cover the design of the microfluidic chip and simulation of the plasmonic resonator using Finite Difference Time Domain (FDTD) software. The fabrication methods are presented, with testing procedures and preliminary results. This research is aimed at improving the resolution limits of the Direct Linear Analysis (DLA) technique developed by US Genomics [1]. In DLA, intercalating dyes which tag a specific 8 base-pair sequence are inserted in a DNA sample. This sample is pumped though a nano-fluidic channel, where it is stretched into a linear geometry and interrogated with light which excites the fluorescent tags. The resulting sequence of optical pulses produces a characteristic "fingerprint" of the sample which uniquely identifies any sample of DNA. Plasmonic confinement of light to a 100 nm wide metallic nano-stripe enables resolution of a higher tag density compared to free space optics. Prototype devices have been fabricated and are being tested with fluorophore solutions and tagged DNA. Preliminary results show evanescent coupling to the plasmonic resonator is occurring with 0.1 micron resolution, however light scattering limits the S/N of the detector. Two methods to reduce scattered light are presented: index matching and curved waveguides.

  13. Fragmentation of sperm DNA using the TUNEL method.

    Science.gov (United States)

    Chenlo, P H; Curi, S M; Pugliese, M N; Ariagno, J I; Sardi-Segovia, M; Furlan, M J; Repetto, H E; Zeitler, E; Cohen, M; Mendeluk, G R

    2014-11-01

    To establish the validity of the TUNEL assay in determining sperm DNA fragmentation, the relationship between the degree of fragmentation and the seminal parameters and the sample needed to conduct the test. We used semen samples from healthy fertile men (n=33), patients who consulted for infertility with a prescription for the TUNEL assay (n=77) and patients with intracytoplasmic sperm injection failure (n=20), analyzed according to the 2010 WHO. The TUNEL/propidium iodide test was performed by flow cytometry, on baseline and post-swim-up samples. The cutoff value for the TUNEL assay (ROC curves) was 26%, with a sensitivity and specificity of 85% and 89%, respectively. The pre-swim-up and post-swim-up medians of the results from the TUNEL assay showed no significant differences (17.0% vs. 12.9%, respectively). However, 39.1% of the samples showed a difference greater than 15 in absolute value between the results of the baseline and post-swim-up TUNEL assays. The linear correlation study of the morphology, mobility and vitality using the post-swim-up TUNEL assay showed a greater correlation than preselection, with significant results (r: -0.394, P<.0001; r: -0.461, P<.0001; r: -0.526, P<.0001). The TUNEL assay is a valid test for clinical use. DNA fragmentation is a factor independent from traditional semen tests. We found a greater susceptibility to damage generated in the laboratory procedures in the samples with lower quality. The sample of choice for evaluating DNA fragmentation will depend on whether the clinician is treating a natural or assisted fertilization. Copyright © 2014 AEU. Published by Elsevier Espana. All rights reserved.

  14. DNA fragmentation and cytotoxicity by recombinant human tumor necrosis factor in L929 fibroblast cells

    International Nuclear Information System (INIS)

    Kosaka, T.; Kuwabara, M.; Koide, F.

    1992-01-01

    Induction of cell DNA fragmentation by treatment of recombinant human Tumor Necrosis Factor alpha (rhTNF alpha) was examined by using mouse L929 cells derived from mouse fibroblast cells. The amount of DNA fragments derived from rhTNF alpha-treated cells, detected by alkaline elution technique, was smaller than that derived from X-irradiated cells. The rhTNF alpha caused the DNA fragmentation depending on its incubation time and concentration. The DNA damage caused by rhTNF alpha treatment correlated with its cytotoxicity. This result suggested that the DNA fragmentation is one of causes of cell death. The treatment with proteinase K of DNA obtained from rhTNF alpha-treated cells did not increase the amount of DNA fragmentation, which indicates that rhTNF alpha causes DNA-fragmentation but not DNA-protein cross-linking

  15. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  16. Immobilization of proteins onto microbeads using a DNA binding tag for enzymatic assays.

    Science.gov (United States)

    Kojima, Takaaki; Mizoguchi, Takuro; Ota, Eri; Hata, Jumpei; Homma, Keisuke; Zhu, Bo; Hitomi, Kiyotaka; Nakano, Hideo

    2016-02-01

    A novel DNA-binding protein tag, scCro-tag, which is a single-chain derivative of the bacteriophage lambda Cro repressor, has been developed to immobilize proteins of interest (POI) on a solid support through binding OR consensus DNA (ORC) that is tightly bound by the scCro protein. The scCro-tag successfully bound a transglutaminase 2 (TGase 2) substrate and manganese peroxidase (MnP) to microbeads via scaffolding DNA. The resulting protein-coated microbeads can be utilized for functional analysis of the enzymatic activity using flow cytometry. The quantity of bead-bound proteins can be enhanced by increasing the number of ORCs. In addition, proteins with the scCro-tag that were synthesized using a cell-free protein synthesis system were also immobilized onto the beads, thus indicating that this bead-based system would be applicable to high-throughput analysis of various enzymatic activities. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  17. Effect of superoxide dismutase supplementation on sperm DNA fragmentation

    Directory of Open Access Journals (Sweden)

    Luciano Negri

    2017-10-01

    Full Text Available Background: antioxidants supplementation improves sperm quality, but few trials have analyzed the effects on sperm DNA fragmentation (SDF. This study compares the effectiveness of SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol in reducing SDF with other antioxidants without SOD, hydroxytyrosol, and carnosol. Materials and methods: men with high SDF at baseline were selected in our clinical database. The patients taken into account had a 2-month control. SDF was measured by Sperm Chromatin Dispersion test (SCD. Untreated men were used as a control group. The remaining subjects received some oral antioxidant supplements (12 different combinations of both hydrophilic and lipophilic antioxidants, with some of them receiving nutritional support with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Results: 118 men were selected for a retrospective study. Mean age 39.3 ± 5.4 years. Fifteen had no treatment, 55 were treated with a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol, and 48 took some antioxidant supplements for 2 months. Clinically, variations of at least 10% in baseline values of classic semen parameters and sperm DNA fragmentation were taken into consideration. Classic seminal parameters did not vary significantly in the three groups, with the exception of viability (p = 0.001. We assessed which of the active substances (no. 19 in different formulations were associated with variations in SDF. In the multivariable analysis of the 7 active substances that passed the univariable analysis, only the SOD molecule appeared to be linked to an improvement in SDF (< 0.0001. In detail, only one patient in the control group showed a spontaneous improvement in SDF (6%, compared to 16/48 (33% of those taking various oral antioxidant supplements, and 31/55 (56% of those taking a SOD-based antioxidant supplementation plus hydroxytyrosol and carnosol. Conclusions: SOD

  18. Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

    Science.gov (United States)

    Cheng, Xin; Ivessa, Andreas S

    2012-10-01

    Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

  19. Subacute Low Dose Nerve Agent Exposure Causes DNA Fragmentation in Guinea Pig Leukocytes

    Science.gov (United States)

    2005-10-01

    1 SUBACUTE LOW DOSE NERVE AGENT EXPOSURE CAUSES DNA FRAGMENTATION IN GUINEA PIG LEUKOCYTES. Jitendra R. Dave1, John R. Moffett1, Sally M...DNA fragmentation in blood leukocytes from guinea pigs by ‘Comet’ assay after exposure to soman at doses ranging from 0.1LD50 to 0.4 LD50, once per...computer. Data obtained for exposure to soman demonstrated significant increases in DNA fragmentation in circulating leukocytes in CWNA treated guinea pigs as

  20. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

    1998-01-01

    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  1. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    International Nuclear Information System (INIS)

    Jackson, Christopher B.; Gallati, Sabina; Schaller, André

    2012-01-01

    Highlights: ► Serial qPCR accurately determines fragmentation state of any given DNA sample. ► Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. ► Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. ► Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze–thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA (λ nDNA ) and mtDNA (λ mtDNA ) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two

  2. qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Gallati, Sabina, E-mail: sabina.gallati@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland); Schaller, Andre, E-mail: andre.schaller@insel.ch [Division of Human Genetics, Departements of Pediatrics and Clinical Research, Inselspital, University of Berne, Freiburgstrasse, CH-3010 Berne (Switzerland)

    2012-07-06

    Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serial qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in

  3. Tagging genes for drought resistance by DNA markers in wheat (abstract)

    International Nuclear Information System (INIS)

    Malik, T.A.; Rahman, S.; Zafar, Y.

    2005-01-01

    Wheat families (F/sub 3) raised from the seed of drought resistant and susceptible F/sub 2/ plants developed from the cross of drought resistant and susceptible parents were grown under greenhouse conditions in polyethylene tubes filled with soil and sand mixture. Drought stress was imposed and monitored at the seedling stage. The relative water content and net photosynthesis was recorded with increasing drought stress until a significant part of the seedling population had zero or negative net photosynthesis. The seedling with zero or negative net photosynthesis were named as drought susceptible and the seedlings at the same drought stress showing net photosynthesis were named as drought resistance. Twenty each of the most susceptible and resistant seedlings were selected for DNA extraction. Random Amplified Polymorphic DNA (RAPD) technique using bulked segregant analysis was used to identify DNA markers linked to drought resistance. The primers OPJ-05, OPJ-14, OPI-20 and OPA-19 produced polymorphic DNA fragments between the contrasting bulks. The polymorphic DNA fragment of 1.55kb produced by the primer OPA-19 was found linked to drought resistance. This DNA marker can be used in markers-assisted selection for drought resistance or to clone drought resistance gene. (author)

  4. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    Science.gov (United States)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  5. Fcγ1 fragment of IgG1 as a powerful affinity tag in recombinant Fc-fusion proteins: immunological, biochemical and therapeutic properties.

    Science.gov (United States)

    Soleimanpour, Saman; Hassannia, Tahereh; Motiee, Mahdieh; Amini, Abbas Ali; Rezaee, S A R

    2017-05-01

    Affinity tags are vital tools for the production of high-throughput recombinant proteins. Several affinity tags, such as the hexahistidine tag, maltose-binding protein, streptavidin-binding peptide tag, calmodulin-binding peptide, c-Myc tag, glutathione S-transferase and FLAG tag, have been introduced for recombinant protein production. The fragment crystallizable (Fc) domain of the IgG1 antibody is one of the useful affinity tags that can facilitate detection, purification and localization of proteins and can improve the immunogenicity, modulatory effects, physicochemical and pharmaceutical properties of proteins. Fcγ recombinant forms a group of recombinant proteins called Fc-fusion proteins (FFPs). FFPs are widely used in drug discovery, drug delivery, vaccine design and experimental research on receptor-ligand interactions. These fusion proteins have become successful alternatives to monoclonal antibodies for drug developments. In this review, the physicochemical, biochemical, immunological, pharmaceutical and therapeutic properties of recombinant FFPs were discussed as a new generation of bioengineering strategies.

  6. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  7. Barcoded DNA-tag reporters for multiplex cis-regulatory analysis.

    Directory of Open Access Journals (Sweden)

    Jongmin Nam

    Full Text Available Cis-regulatory DNA sequences causally mediate patterns of gene expression, but efficient experimental analysis of these control systems has remained challenging. Here we develop a new version of "barcoded" DNA-tag reporters, "Nanotags" that permit simultaneous quantitative analysis of up to 130 distinct cis-regulatory modules (CRMs. The activities of these reporters are measured in single experiments by the NanoString RNA counting method and other quantitative procedures. We demonstrate the efficiency of the Nanotag method by simultaneously measuring hourly temporal activities of 126 CRMs from 46 genes in the developing sea urchin embryo, otherwise a virtually impossible task. Nanotags are also used in gene perturbation experiments to reveal cis-regulatory responses of many CRMs at once. Nanotag methodology can be applied to many research areas, ranging from gene regulatory networks to functional and evolutionary genomics.

  8. DNA fingerprinting tags novel altered chromosomal regions and identifies the involvement of SOX5 in the progression of prostate cancer.

    Science.gov (United States)

    Ma, Stephanie; Chan, Yuen Piu; Woolcock, Bruce; Hu, Liang; Wong, Kai Yau; Ling, Ming Tat; Bainbridge, Terry; Webber, Douglas; Chan, Tim Hon Man; Guan, Xin-Yuan; Lam, Wan; Vielkind, Juergen; Chan, Kwok Wah

    2009-05-15

    Identification of genomic alterations associated with the progression of prostate cancer may facilitate the better understanding of the development of this highly variable disease. Matched normal, premalignant high-grade prostatic intraepithelial neoplasia and invasive prostate carcinoma cells were procured by laser capture microdissection (LCM) from human radical prostatectomy specimens. From these cells, comparative DNA fingerprints were generated by a modified PCR-based technique called scanning of microdissected archival lesion (SMAL)-PCR. Recurrent polymorphic fingerprint fragments were used in tagging altered chromosomal regions. Altered regions were found at cytobands 1p31.3, 1q44, 2p23.1, 3p26.3, 3q22.3, 4q22.3, 4q35.2, 5q23.2, 8q22.3, 8q24.13, 9q21.3, 9q22.32, 10q11.21, 11p13, 12p12.1, 13q12.1, 16q12.2 and 18q21.31. Candidate genes in the surrounding area that may possibly harbor mutations that change normal prostatic cells to progress into their tumor stages were proposed. Of these fragments, a 420 bp alteration, absent in all 26 normal samples screened, was observed in 2 tumors. This fragment was cloned, sequenced and localized to chromosome 12p12.1. Within this region, candidate gene sex determining region Y-box 5 (SOX5) was proposed. Further studies of SOX5 in cell lines, xenografts and human prostate specimens, at both the RNA and protein levels, found overexpression of the gene in tumors. This overexpression was then subsequently found by fluorescent in situ hybridization to be caused by amplification of the region. In conclusion, our results suggest LCM coupled with SMAL-PCR DNA fingerprinting is a useful method for the screening and identification of chromosomal regions and genes associated with cancer development. Further, overexpression of SOX5 is associated with prostate tumor progression and early development of distant metastasis. (c) 2008 Wiley-Liss, Inc.

  9. General method of preparation of uniformly 13C, 15N-labeled DNA fragments for NMR analysis of DNA structures

    International Nuclear Information System (INIS)

    Rene, Brigitte; Masliah, Gregoire; Zargarian, Loussine; Mauffret, Olivier; Fermandjian, Serge

    2006-01-01

    Summary 13 C, 15 N labeling of biomolecules allows easier assignments of NMR resonances and provides a larger number of NMR parameters, which greatly improves the quality of DNA structures. However, there is no general DNA-labeling procedure, like those employed for proteins and RNAs. Here, we describe a general and widely applicable approach designed for preparation of isotopically labeled DNA fragments that can be used for NMR studies. The procedure is based on the PCR amplification of oligonucleotides in the presence of labeled deoxynucleotides triphosphates. It allows great flexibility thanks to insertion of a short DNA sequence (linker) between two repeats of DNA sequence to study. Size and sequence of the linker are designed as to create restriction sites at the junctions with DNA of interest. DNA duplex with desired sequence and size is released upon enzymatic digestion of the PCR product. The suitability of the procedure is validated through the preparation of two biological relevant DNA fragments

  10. Rapid assessment of the effect of ciprofloxacin on chromosomal DNA from Escherichia coli using an in situ DNA fragmentation assay

    Directory of Open Access Journals (Sweden)

    Gosalvez Jaime

    2009-04-01

    Full Text Available Abstract Background Fluoroquinolones are extensively used antibiotics that induce DNA double-strand breaks (DSBs by trapping DNA gyrase and topoisomerase IV on DNA. This effect is usually evaluated using biochemical or molecular procedures, but these are not effective at the single-cell level. We assessed ciprofloxacin (CIP-induced chromosomal DNA breakage in single-cell Escherichia coli by direct visualization of the DNA fragments that diffused from the nucleoid obtained after bacterial lysis in an agarose microgel on a slide. Results Exposing the E. coli strain TG1 to CIP starting at a minimum inhibitory concentration (MIC of 0.012 μg/ml and at increasing doses for 40 min increased the DNA fragmentation progressively. DNA damage started to be detectable at the MIC dose. At a dose of 1 μg/ml of CIP, DNA damage was visualized clearly immediately after processing, and the DNA fragmentation increased progressively with the antibiotic incubation time. The level of DNA damage was much higher when the bacteria were taken from liquid LB broth than from solid LB agar. CIP treatment produced a progressively slower rate of DNA damage in bacteria in the stationary phase than in the exponentially growing phase. Removing the antibiotic after the 40 min incubation resulted in progressive DSB repair activity with time. The magnitude of DNA repair was inversely related to CIP dose and was noticeable after incubation with CIP at 0.1 μg/ml but scarce after 10 μg/ml. The repair activity was not strictly related to viability. Four E. coli strains with identified mechanisms of reduced sensitivity to CIP were assessed using this procedure and produced DNA fragmentation levels that were inversely related to MIC dose, except those with very high MIC dose. Conclusion This procedure for determining DNA fragmentation is a simple and rapid test for studying and evaluating the effect of quinolones.

  11. Quantification of DNA fragmentation in processed foods using real-time PCR.

    Science.gov (United States)

    Mano, Junichi; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Fukudome, Shin-Ichi; Hayashida, Takuya; Kawakami, Hiroyuki; Kurimoto, Youichi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Takabatake, Reona; Kitta, Kazumi

    2017-07-01

    DNA analysis of processed foods is performed widely to detect various targets, such as genetically modified organisms (GMOs). Food processing often causes DNA fragmentation, which consequently affects the results of PCR analysis. In order to assess the effects of DNA fragmentation on the reliability of PCR analysis, we investigated a novel methodology to quantify the degree of DNA fragmentation. We designed four real-time PCR assays that amplified 18S ribosomal RNA gene sequences common to various plants at lengths of approximately 100, 200, 400, and 800 base pairs (bp). Then, we created an indicator value, "DNA fragmentation index (DFI)", which is calculated from the Cq values derived from the real-time PCR assays. Finally, we demonstrated the efficacy of this method for the quality control of GMO detection in processed foods by evaluating the relationship between the DFI and the limit of detection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  13. Determination of size distribution of small DNA fragments by polyacrylamide gel electrophoresis

    International Nuclear Information System (INIS)

    Lau How Mooi

    1998-01-01

    Size distribution determination of DNA fragments can be normally determined by the agarose gel electrophoresis, including the normal DNA banding pattern analysis. However this method is only good for large DNA, such as the DNA of the size of kilo base pairs to mega base pairs range. DNA of size less than kilo base pairs is difficult to be quantified by the agarose gel method. Polyacrylamide gel electrophoresis however can be used to measure the quantity of DNA fragments of size less than kilo base pairs in length, down to less than ten base pairs. This method is good for determining the quantity of the smaller size DNA, single stranded polymers or even some proteins, if the known standards are available. In this report detail description of the method of preparing the polyacrylamide gel, and the experimental set up is discussed. Possible uses of this method, and the comparison with the standard sizes of DNA is also shown. This method is used to determine the distribution of the amount of the fragmented DNA after the Calf-thymus DNA has been exposed to various types of radiation and of different doses. The standards were used to determine the sizes of the fragmented Calf-thymus DNA. The higher the dose the higher is the amount of the smaller size DNA measured

  14. Mitochondrial DNA content in embryo culture medium is significantly associated with human embryo fragmentation.

    Science.gov (United States)

    Stigliani, S; Anserini, P; Venturini, P L; Scaruffi, P

    2013-10-01

    Is the amount of cell-free DNA released by human embryos into culture medium correlated with embryo morphological features? The mitochondrial DNA (mtDNA) content of culture medium is significantly associated with the fragmentation rate on Days 2 and 3 of embryo development, whether the oocyte came from women ≤ 35 or >35 years old. Cellular fragmentation is often utilized as one of the morphological parameters for embryo quality assessment. The amount of cellular fragments is considered to be an important morphological parameter for embryo implantation potential. It has been hypothesized that fragments are apoptotic bodies or anuclear cytoplasmatic pieces of blastomeres, although no definitive conclusion has been drawn about their pathogenesis. Human fertilized oocytes were individually cultured from Day 1 to Days 2 and 3. A total of 800 samples (166 spent media from Day 2 and 634 from Day 3) were enrolled into the present study. Double-stranded DNA (dsDNA) was quantified in 800 spent embryo culture media by Pico Green dye fluorescence assay. After DNA purification, genomic DNA (gDNA) and mtDNA were profiled by specific quantitative PCR. Statistical analyses defined correlations among DNA contents, embryo morphology and maternal age. Different independent tests confirmed the presence of DNA into embryo culture medium and, for the first time, we demonstrate that both gDNA and mtDNA are detectable in the secretome. The amount of DNA is larger in embryos with bad quality cleavage compared with high-grade embryos, suggesting that the DNA profile of culture medium is an objective marker for embryo quality assessment. In particular, DNA profiles are significantly associated with fragmentation feature (total dsDNA: P = 0.0010; mtDNA; P = 0.0247) and advanced maternal age. It is necessary to establish whether DNA profiling of spent embryo culture medium is a robust onsite test that can improve the prediction of blastulation, implantation and/or pregnancy rate. The

  15. Menadione-induced DNA fragmentation without 8-oxo-2'-deoxyguanosine formation in isolated rat hepatocytes

    DEFF Research Database (Denmark)

    Fischer-Nielsen, A; Corcoran, G B; Poulsen, H E

    1995-01-01

    Menadione (2-methyl-1,4-naphthoquinone) induces oxidative stress in cells causing perturbations in the cytoplasm as well as nicking of DNA. The mechanisms by which DNA damage occurs are still unclear, but a widely discussed issue is whether menadione-generated reactive oxygen species (ROS) directly...... damage DNA. In the present study, we measured the effect of menadione on formation of 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxodG), an index of oxidative DNA base modifications, and on DNA fragmentation. Isolated hepatocytes from phenobarbital-pretreated rats were exposed to menadione, 25-400 micro......M, for 15, 90 or 180 min with or without prior depletion of reduced glutathione (GSH) by diethyl maleate. Menadione caused profound GSH depletion and internucleosomal DNA fragmentation, which was demonstrated by a prominent fragmentation ladder on agarose gel electrophoresis. We found no oxidative...

  16. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    International Nuclear Information System (INIS)

    Holley, W.R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and δ rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of circ OH, circ H, e aq , etc.; circ OH attack on sugar molecules leading to strand breaks; circ OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs

  17. Crystallization of DNA fragments from water-salt solutions, containing 2-methylpentane-2,3-diol.

    Science.gov (United States)

    Osica, V D; Sukharevsky, B Y; Vasilchenko, V N; Verkin, B I; Polyvtsev, O F

    1976-09-01

    Fragments of calf thymus DNA have been crystallized by precipitation from water-salt solutions, containing 2-methylpentane-2,3-diol (MPD). DNA crystals usually take the form either of spherulites up to 100 mu in diameter or of needles with the length up to 50 mu. No irreversible denaturation of DNA occurs during the crystallization process. X-ray diffraction from dense slurries of DNA crystals yields crystalline powder patterns.

  18. No increased sperm DNA fragmentation index in semen containing human papillomavirus or herpesvirus

    DEFF Research Database (Denmark)

    Kaspersen, Maja Døvling; Bungum, Mona; Fedder, Jens

    2013-01-01

    It remains unknown whether human papillomaviruses (HPVs) or human herpesviruses (HHVs) in semen affect sperm DNA integrity. We investigated whether the presence of these viruses in semen was associated with an elevated sperm DNA fragmentation index. Semen from 76 sperm donors was examined by a PCR......-based hybridization array that identifies all HHVs and 35 of the most common HPVs. Sperm DNA integrity was determined by the sperm chromatin structure assay. HPVs or HHVs, or both, were found in 57% of semen samples; however, sperm DNA fragmentation index was not increased in semen containing these viruses....

  19. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  20. Simultaneous vitality and DNA-fragmentation measurement in spermatozoa of smokers and non-smokers.

    Science.gov (United States)

    De Bantel, A; Fleury-Feith, J; Poirot, C; Berthaut, I; Garcin, C; Landais, P; Ravel, C

    2015-03-01

    Because cigarette smoke is a powerful ROS producer, we hypothesized that the spermatozoa of smokers would be more at risk of having increased DNA fragmentation than spermatozoa of non-smoking men. A cross-sectional study was performed on consenting smokers and non-smokers, consulting in an infertility clinic for routine sperm analysis. The application of a novel TUNEL assay coupled to a vitality marker, LIVE/DEAD®, allowed both DNA fragmentation and viability measurement within spermatozoa of participants to be analyzed by flow cytometry. The coupled vitality-DNA fragmentation analysis revealed that non-smokers and smokers, respectively presented medians of 3.6% [0.6-36.8] and 3.3% [0.9-9.6] DNA fragmented spermatozoa among the living spermatozoa population (P > 0.05). No deleterious effect of smoking on spermatozoa was found in our study. More studies concerning potential mutagenic capacities of cigarette smoke on spermatozoa are necessary. In addition, the coupled vitality-DNA fragmentation analysis may orient Assisted Reproductive Technology teams when confronted with patients having a high percentage of DNA-fragmented living spermatozoa. © 2014 International Clinical Cytometry Society.

  1. SPERM MORPHOLOGICAL ABNORMALITIES AS INDICATORS OF DNA FRAGMENTATION AND FERTILIZATION IN ASSISTED REPRODUCTION

    Directory of Open Access Journals (Sweden)

    Barbara Dariš

    2018-02-01

    Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.

  2. Lower sperm DNA fragmentation after r-FSH administration in functional hypogonadotropic hypogonadism.

    Science.gov (United States)

    Ruvolo, Giovanni; Roccheri, Maria Carmela; Brucculeri, Anna Maria; Longobardi, Salvatore; Cittadini, Ettore; Bosco, Liana

    2013-04-01

    An observational clinical and molecular study was designed to evaluate the effects of the administration of recombinant human FSH on sperm DNA fragmentation in men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In the study were included 53 men with a non-classical form of hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia. In all patients, sperm DNA fragmentation index (DFI), assessed by terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate (dUTP) in situ DNA nick end-labelling (TUNEL) assay, was evaluated before starting the treatment with 150 IU of recombinant human FSH, given three times a week for at least 3 months. Patients' semen analysis and DNA fragmentation index were re-evaluated after the 3-month treatment period. After recombinant human FSH therapy, we did not find any differences in terms of sperm count, motility and morphology. The average DNA fragmentation index was significantly reduced (21.15 vs 15.2, p15 %), while no significant variation occurred in the patients with DFI values ≤ 15 %. Recombinant human FSH administration improves sperm DNA integrity in hypogonadotropic hypogonadism and idiopathic oligoasthenoteratozoospermia men with DNA fragmentation index value >15 % .

  3. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    Energy Technology Data Exchange (ETDEWEB)

    Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)

    2000-06-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.

  4. Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry

    International Nuclear Information System (INIS)

    Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.

    2000-01-01

    We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America

  5. DNA repair-related genes in sugarcane expressed sequence tags (ESTs

    Directory of Open Access Journals (Sweden)

    R.M.A. Costa

    2001-12-01

    Full Text Available There is much interest in the identification and characterization of genes involved in DNA repair because of their importance in the maintenance of the genome integrity. The high level of conservation of DNA repair genes means that these genetic elements may be used in phylogenetic studies as a source of information on the genetic origin and evolution of species. The mechanisms by which damaged DNA is repaired are well understood in bacteria, yeast and mammals, but much remains to be learned as regards plants. We identified genes involved in DNA repair mechanisms in sugarcane using a similarity search of the Brazilian Sugarcane Expressed Sequence Tag (SUCEST database against known sequences deposited in other public databases (National Center of Biotechnology Information (NCBI database and the Munich Information Center for Protein Sequences (MIPS Arabidopsis thaliana database. This search revealed that most of the various proteins involved in DNA repair in sugarcane are similar to those found in other eukaryotes. However, we also identified certain intriguing features found only in plants, probably due to the independent evolution of this kingdom. The DNA repair mechanisms investigated include photoreactivation, base excision repair, nucleotide excision repair, mismatch repair, non-homologous end joining, homologous recombination repair and DNA lesion tolerance. We report the main differences found in the DNA repair machinery in plant cells as compared to other organisms. These differences point to potentially different strategies plants employ to deal with DNA damage, that deserve further investigation.A identificação e caracterização de genes envolvidos com reparo de DNA são de grande interesse, dada a sua importância na manutenção da integridade genômica. Além disso, a alta conservação dos genes de reparo de DNA faz com que possam ser utilizados como fonte de informação no que diz respeito à origem e evolução das esp

  6. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  7. Luciferase assay to study the activity of a cloned promoter DNA fragment.

    Science.gov (United States)

    Solberg, Nina; Krauss, Stefan

    2013-01-01

    Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

  8. AN IMAGE-ANALYSIS TECHNIQUE FOR DETECTION OF RADIATION-INDUCED DNA FRAGMENTATION AFTER CHEF ELECTROPHORESIS

    NARCIS (Netherlands)

    ROSEMANN, M; KANON, B; KONINGS, AWT; KAMPINGA, HH

    CHEF-electrophoresis was used as a technique to detect radiation-induced DNA breakage with special emphasis to biological relevant X-ray doses (0-10 Gy). Fluorescence detection of DNA-fragments using a sensitive image analysis system was directly compared with conventional scintillation counting of

  9. Particle integrity, sampling, and application of a DNA-tagged tracer for aerosol transport studies

    Energy Technology Data Exchange (ETDEWEB)

    Kaeser, Cynthia Jeanne [Michigan State Univ., East Lansing, MI (United States)

    2017-07-21

    Aerosols are an ever-present part of our daily environment and have extensive effects on both human and environmental health. Particles in the inhalable range (1-10 μm diameter) are of particular concern because their deposition in the lung can lead to a variety of illnesses including allergic reactions, viral or bacterial infections, and cancer. Understanding the transport of inhalable aerosols across both short and long distances is necessary to predict human exposures to aerosols. To assess the transport of hazardous aerosols, surrogate tracer particles are required to measure their transport through occupied spaces. These tracer particles must not only possess similar transport characteristics to those of interest but also be easily distinguished from the background at low levels and survive the environmental conditions of the testing environment. A previously-developed DNA-tagged particle (DNATrax), composed of food-grade sugar and a DNA oligonucleotide as a “barcode” label, shows promise as a new aerosol tracer. Herein, the use of DNATrax material is validated for use in both indoor and outdoor environments. Utilizing passive samplers made of materials commonly found in indoor environments followed by quantitative polymerase chain reaction (qPCR) assay for endpoint particle detection, particles detection was achieved up to 90 m from the aerosolization location and across shorter distances with high spatial resolution. The unique DNA label and PCR assay specificity were leveraged to perform multiple simultaneous experiments. This allowed the assessment of experimental reproducibility, a rare occurrence among aerosol field tests. To transition to outdoor testing, the solid material provides some protection of the DNA label when exposed to ultraviolet (UV) radiation, with 60% of the DNA remaining intact after 60 minutes under a germicidal lamp and the rate of degradation declining with irradiation time. Additionally, exposure of the DNATrax material using

  10. Natural transformation of bacteria by fragmented, damaged and ancient DNA

    DEFF Research Database (Denmark)

    Overballe-Petersen, Søren

    with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...

  11. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  12. Sperm DNA fragmentation in boars is delayed or abolished by using sperm extenders.

    Science.gov (United States)

    Pérez-Llano, Begoña; Enciso, María; García-Casado, Pedro; Sala, Rubén; Gosálvez, Jaime

    2006-12-01

    The semen quality of seven young adult boars was assessed for percentages of sperm motility, normal acrosomes, abnormal sperm, cells positive to sHOST (short Hipoosmotic Swelling Test), HPNA cells (sHOST Positive with Normal Acrosome cells) and the percentage of sperm heads, which exhibited DNA fragmentation using the Sperm Chromatin Dispersion test (SCD). These parameters were analysed in sperm samples both undiluted and diluted using a commercial extender and stored at 15 degrees C for 21 days. Results showed that semen quality decreases faster in the undiluted semen samples from day 0 to day 7 compared to diluted semen samples that remained with a high quality up to day 11. The undiluted semen exhibited a low DNA fragmentation index (DFI) during the first days and then a significant increase from day 7 up to day 21. This increase in the DFI coincided with the lowest levels of the other semen quality parameters. On the contrary, the samples diluted in the commercial extender showed very low levels of DNA fragmentation in all boars during the preservation period. When the evolution of DNA fragmentation was analysed in the undiluted samples, differences were found among boars. These differences were not shown in the samples diluted in the extender where the basal DFI remained stable during the 21 days. The main conclusion of this study was that some sperm extenders delay or partially prevent sperm DNA fragmentation.

  13. A feasibility study of the use of DNA fragmentation as a method for detecting irradiation of food

    International Nuclear Information System (INIS)

    Jones, J.L.; Bulford, B.B.

    1990-07-01

    The main conclusions of the study are: 1. Gamma-irradiation at doses of 1-10 kGy, as recommended for use in food irradiation, causes extensive fragmentation of DNA molecules. The degree of fragmentation increases with increasing doses of irradiation treatment. 2. Irradiation-induced DNA fragments can be rapidly separated from intact DNA using a simple ultra-filtration method. 3. The separated DNA fragments can be detected/quantified rapidly using the simple Invitrogen DNA DipStick procedure. Dot-blot assays based on probes to widely conserved genes (e.g. histone genes) may also prove of value, but will require further development. 4. As DNA is present in a wide range of foods, DNA fragmentation offers a potentially useful marker for the irradiation treatment of foods. The assay now requires assessment with DNA extracts of a variety of foods. (author)

  14. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  15. Synthesis and NMR of {sup 15}N-labeled DNA fragments

    Energy Technology Data Exchange (ETDEWEB)

    Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

    1994-12-01

    DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

  16. Accurate phylogenetic classification of DNA fragments based onsequence composition

    Energy Technology Data Exchange (ETDEWEB)

    McHardy, Alice C.; Garcia Martin, Hector; Tsirigos, Aristotelis; Hugenholtz, Philip; Rigoutsos, Isidore

    2006-05-01

    Metagenome studies have retrieved vast amounts of sequenceout of a variety of environments, leading to novel discoveries and greatinsights into the uncultured microbial world. Except for very simplecommunities, diversity makes sequence assembly and analysis a verychallenging problem. To understand the structure a 5 nd function ofmicrobial communities, a taxonomic characterization of the obtainedsequence fragments is highly desirable, yet currently limited mostly tothose sequences that contain phylogenetic marker genes. We show that forclades at the rank of domain down to genus, sequence composition allowsthe very accurate phylogenetic 10 characterization of genomic sequence.We developed a composition-based classifier, PhyloPythia, for de novophylogenetic sequence characterization and have trained it on adata setof 340 genomes. By extensive evaluation experiments we show that themethodis accurate across all taxonomic ranks considered, even forsequences that originate fromnovel organisms and are as short as 1kb.Application to two metagenome datasets 15 obtained from samples ofphosphorus-removing sludge showed that the method allows the accurateclassification at genus level of most sequence fragments from thedominant populations, while at the same time correctly characterizingeven larger parts of the samples at higher taxonomic levels.

  17. FragIdent – Automatic identification and characterisation of cDNA-fragments

    Directory of Open Access Journals (Sweden)

    Goehler Heike

    2009-03-01

    Full Text Available Abstract Background Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Results Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. Conclusion We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  18. FragIdent--automatic identification and characterisation of cDNA-fragments.

    Science.gov (United States)

    Seelow, Dominik; Goehler, Heike; Hoffmann, Katrin

    2009-03-02

    Many genetic studies and functional assays are based on cDNA fragments. After the generation of cDNA fragments from an mRNA sample, their content is at first unknown and must be assigned by sequencing reactions or hybridisation experiments. Even in characterised libraries, a considerable number of clones are wrongly annotated. Furthermore, mix-ups can happen in the laboratory. It is therefore essential to the relevance of experimental results to confirm or determine the identity of the employed cDNA fragments. However, the manual approach for the characterisation of these fragments using BLAST web interfaces is not suited for larger number of sequences and so far, no user-friendly software is publicly available. Here we present the development of FragIdent, an application for the automatic identification of open reading frames (ORFs) within cDNA-fragments. The software performs BLAST analyses to identify the genes represented by the sequences and suggests primers to complete the sequencing of the whole insert. Gene-specific information as well as the protein domains encoded by the cDNA fragment are retrieved from Internet-based databases and included in the output. The application features an intuitive graphical interface and is designed for researchers without any bioinformatics skills. It is suited for projects comprising up to several hundred different clones. We used FragIdent to identify 84 cDNA clones from a yeast two-hybrid experiment. Furthermore, we identified 131 protein domains within our analysed clones. The source code is freely available from our homepage at http://compbio.charite.de/genetik/FragIdent/.

  19. Development of procedures for the identification of human papilloma virus DNA fragments in laser plume

    Science.gov (United States)

    Woellmer, Wolfgang; Meder, Tom; Jappe, Uta; Gross, Gerd; Riethdorf, Sabine; Riethdorf, Lutz; Kuhler-Obbarius, Christina; Loening, Thomas

    1996-01-01

    For the investigation of laser plume for the existence of HPV DNA fragments, which possibly occur during laser treatment of virus infected tissue, human papillomas and condylomas were treated in vitro with the CO2-laser. For the sampling of the laser plume a new method for the trapping of the material was developed by use of water-soluble gelatine filters. These samples were analyzed with the polymerase chain reaction (PCR) technique, which was optimized in regard of the gelatine filters and the specific primers. Positive PCR results for HPV DNA fragments up to the size of a complete oncogene were obtained and are discussed regarding infectiousity.

  20. Nature of defects produced on thymine fragment by gamma irradiation of DNA

    International Nuclear Information System (INIS)

    Teoule, R.; Bonicel, A.

    1975-01-01

    A study is reported of the nature of the DNA thymine fragment damage induced by gamma radiation in vitro conditions, by a new method involving hydrolysis in mild conditions. It is highly probable that the main lesions observed in vitro on the DNA polynucleotide chain, namely thymine glycol, 5,6-dihydroxy-5,6-dihydrothymine and 1'-(N-formamidol) deoxyribose, are formed in vivo conditions

  1. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Science.gov (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  2. Ionization and fragmentation of DNA-RNA bases: a density functional theory study

    International Nuclear Information System (INIS)

    Sadr-Arani, Leila

    2014-01-01

    Ionizing radiation (IR) cross human tissue, deposit energy and dissipate fragmenting molecules. The resulting fragments may be highlighted by mass spectrometry. Despite the amount of information obtained experimentally by the interpretation of the mass spectrum, experience alone cannot answer all the questions of the mechanism of fragmentation of DNA/RNA bases and a theoretical study is a complement to this information. A theoretical study allows us to know the weakest bonds in the molecule during ionization and thus may help to provide mechanisms of dissociation and produced fragments. The purpose of this work, using the DFT with the PBE functional, is to study the ionization and fragmentation mechanisms of DNA/RNA bases (Uracil, Cytosine, Adenine and Guanine) and to identify the cations corresponding to each peak in mass spectra. For all RNA bases, the retro Diels-Alder reaction (elimination of HNCO or NCO*) is a major route for dissociating, with the exception of adenine for which there is no atom oxygen in its structure. Loss of NH 3 (NH 2 *) molecule is another common way to all bases that contain amine group. The possibility of the loss of hydrogen from the cations is also investigated, as well as the dissociation of dehydrogenated cations and protonated uracil. This work shows the interest of providing DFT calculation in the interpretation of mass spectra of DNA bases. (author)

  3. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

    Science.gov (United States)

    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

    2015-01-01

    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.

  4. Analysis of different DNA fragments of Corynebacterium glutamicum complementing dapE of Escherichia coli.

    Science.gov (United States)

    Wehrmann, A; Eggeling, L; Sahm, H

    1994-12-01

    In Corynebacterium glutamicum L-lysine is synthesized simultaneously via the succinylase and dehydrogenase variant of the diaminopimelate pathway. Starting from a strain with a disrupted dehydrogenase gene, three different-sized DNA fragments were isolated which complemented defective Escherichia coli mutants in the succinylase pathway. Enzyme studies revealed that in one case the dehydrogenase gene had apparently been reconstituted in the heterologous host. The two other fragments resulted in desuccinylase activity; one of them additionally in succinylase activity. However, the physical analysis showed that structural changes had taken place in all fragments. Using a probe derived from one of the fragments we isolated a 3.4 kb BamHI DNA fragment without selective pressure (by colony hybridization). This was structurally intact and proved functionally to result in tenfold desuccinylase overexpression. The nucleotide sequence of a 1966 bp fragment revealed the presence of one truncated open reading frame of unknown function and that of dapE encoding N-succinyl diaminopimelate desuccinylase (EC 3.5.1.18). The deduced amino acid sequence of the dapE gene product shares 23% identical residues with that from E. coli. The C. glutamicum gene now available is the first gene from the succinylase branch of lysine synthesis of this biotechnologically important organism.

  5. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  6. [Cleavage of DNA fragments induced by UV nanosecond laser excitation at 193 nm].

    Science.gov (United States)

    Vtiurina, N N; Grokhovskiĭ, S L; Filimonov, I V; Medvedkov, O I; Nechipurenko, D Iu; Vasil'ev, S A; Nechipurenko, Iu D

    2011-01-01

    The cleavage of dsDNA fragments in aqueous solution after irradiation with UV laser pulses at 193 nm has been studied. Samples were investigated using polyacrylamide gel electrophoresis. The intensity of damage of particular phosphodiester bond after hot alkali treatment was shown to depend on the base pair sequence. It was established that the probability of cleavage is twice higher for sites of DNA containing two or more successively running guanine residues. A possible mechanism of damage to the DNA molecule connected with the migration of holes along the helix is discussed.

  7. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    Science.gov (United States)

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates

  8. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments.

    Science.gov (United States)

    Dabney, Jesse; Knapp, Michael; Glocke, Isabelle; Gansauge, Marie-Theres; Weihmann, Antje; Nickel, Birgit; Valdiosera, Cristina; García, Nuria; Pääbo, Svante; Arsuaga, Juan-Luis; Meyer, Matthias

    2013-09-24

    Although an inverse relationship is expected in ancient DNA samples between the number of surviving DNA fragments and their length, ancient DNA sequencing libraries are strikingly deficient in molecules shorter than 40 bp. We find that a loss of short molecules can occur during DNA extraction and present an improved silica-based extraction protocol that enables their efficient retrieval. In combination with single-stranded DNA library preparation, this method enabled us to reconstruct the mitochondrial genome sequence from a Middle Pleistocene cave bear (Ursus deningeri) bone excavated at Sima de los Huesos in the Sierra de Atapuerca, Spain. Phylogenetic reconstructions indicate that the U. deningeri sequence forms an early diverging sister lineage to all Western European Late Pleistocene cave bears. Our results prove that authentic ancient DNA can be preserved for hundreds of thousand years outside of permafrost. Moreover, the techniques presented enable the retrieval of phylogenetically informative sequences from samples in which virtually all DNA is diminished to fragments shorter than 50 bp.

  9. Prophagic DNA Fragments in Streptococcus agalactiae Strains and Association with Neonatal Meningitis

    Science.gov (United States)

    van der Mee-Marquet, Nathalie; Domelier, Anne-Sophie; Mereghetti, Laurent; Lanotte, Philippe; Rosenau, Agnès; van Leeuwen, Willem; Quentin, Roland

    2006-01-01

    We identified—by randomly amplified polymorphic DNA (RAPD) analysis at the population level followed by DNA differential display, cloning, and sequencing—three prophage DNA fragments (F5, F7, and F10) in Streptococcus agalactiae that displayed significant sequence similarity to the DNA of S. agalactiae and Streptococcus pyogenes. The F5 sequence aligned with a prophagic gene encoding the large subunit of a terminase, F7 aligned with a phage-associated cell wall hydrolase and a phage-associated lysin, and F10 aligned with a transcriptional regulator (ArpU family) and a phage-associated endonuclease. We first determined the prevalence of F5, F7, and F10 by PCR in a collection of 109 strains isolated in the 1980s and divided into two populations: one with a high risk of causing meningitis (HR group) and the other with a lower risk of causing meningitis (LR group). These fragments were significantly more prevalent in the HR group than in the LR group (P S. agalactiae strains to invade the neonatal brain endothelium. We then determined the prevalence of F5, F7, and F10 by PCR in a collection of 40 strains recently isolated from neonatal meningitis cases for comparison with the cerebrospinal fluid (CSF) strains isolated in the 1980s. The prevalence of the three prophage DNA fragments was similar in these two populations isolated 15 years apart. We suggest that the prophage DNA fragments identified have remained stable in many CSF S. agalactiae strains, possibly due to their importance in virulence or fitness. PMID:16517893

  10. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    International Nuclear Information System (INIS)

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  11. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  12. A systematic review on sperm DNA fragmentation in male factor infertility: Laboratory assessment

    Directory of Open Access Journals (Sweden)

    Manesh Kumar Panner Selvam

    2018-03-01

    Full Text Available Objective: To review sperm DNA fragmentation (SDF testing as an important sperm function test in addition to conventional semen analysis. High SDF is negatively associated with semen quality, the fertilisation process, embryo quality, and pregnancy outcome. Over recent decades, different SDF assays have been developed and reviewed extensively to assess their applicability and accuracy as advanced sperm function tests. Amongst them, the standardisation of the terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL assay with a bench top flow cytometer in clinical practice deserves special mention with a threshold value of 16.8% to differentiate infertile men with DNA damage from fertile men. Materials and methods: A systematic literature search was performed through the PubMed, Medline, and ScienceDirect databases using the keywords ‘sperm DNA fragmentation’ and ‘laboratory assessment’. Non-English articles were excluded and studies related to humans were only included. Results: Of the 618 identified, 87 studies (original research and reviews and in addition eight book chapters meeting the selection criteria were included in this review. In all, 366 articles were rejected in the preliminary screening and a further 165 articles related to non-human subjects were excluded. Conclusion: There are pros and cons to all the available SDF assays. TUNEL is a reliable technique with greater accuracy and as an additional diagnostic test in Andrology laboratories along with basic semen analysis can predict fertility outcome, and thus direct the choice of an assisted reproductive technology procedure for infertile couples. Also, the TUNEL assay can be used as a prognostic test and results are beneficial in deciding personalised treatment for infertile men. Keywords: Sperm DNA fragmentation (SDF, Terminal deoxynucleotidyl transferased UTP nick-end labelling (TUNEL, DNA damage, Sperm DNA fragmentation (SDF assay

  13. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    International Nuclear Information System (INIS)

    Focke, Frauke; Schuermann, David; Kuster, Niels; Schaer, Primo

    2010-01-01

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  14. DNA fragmentation in human fibroblasts under extremely low frequency electromagnetic field exposure

    Energy Technology Data Exchange (ETDEWEB)

    Focke, Frauke; Schuermann, David [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland); Kuster, Niels [IT' IS Foundation, Zeughausstrasse 43, CH-8004 Zurich (Switzerland); Schaer, Primo, E-mail: primo.schaer@unibas.ch [Institute of Biochemistry and Genetics, Department of Biomedicine, University of Basel, Mattenstrasse 28, CH-4058 Basel (Switzerland)

    2010-01-05

    Extremely low frequency electromagnetic fields (ELF-EMFs) were reported to affect DNA integrity in human cells with evidence based on the Comet assay. These findings were heavily debated for two main reasons; the lack of reproducibility, and the absence of a plausible scientific rationale for how EMFs could damage DNA. Starting out from a replication of the relevant experiments, we performed this study to clarify the existence and explore origin and nature of ELF-EMF induced DNA effects. Our data confirm that intermittent (but not continuous) exposure of human primary fibroblasts to a 50 Hz EMF at a flux density of 1 mT induces a slight but significant increase of DNA fragmentation in the Comet assay, and we provide first evidence for this to be caused by the magnetic rather than the electric field. Moreover, we show that EMF-induced responses in the Comet assay are dependent on cell proliferation, suggesting that processes of DNA replication rather than the DNA itself may be affected. Consistently, the Comet effects correlated with a reduction of actively replicating cells and a concomitant increase of apoptotic cells in exposed cultures, whereas a combined Fpg-Comet test failed to produce evidence for a notable contribution of oxidative DNA base damage. Hence, ELF-EMF induced effects in the Comet assay are reproducible under specific conditions and can be explained by minor disturbances in S-phase processes and occasional triggering of apoptosis rather than by the generation of DNA damage.

  15. DNA Barcoding for Identification of "Candidatus Phytoplasmas" Using a Fragment of the Elongation Factor Tu Gene

    DEFF Research Database (Denmark)

    Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta

    2012-01-01

    Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...

  16. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  17. Observation of medium induced modifications of jet fragmentation in PbPb collisions using isolated-photon-tagged jets

    Energy Technology Data Exchange (ETDEWEB)

    Sirunyan, Albert M; et al.

    2018-01-15

    Measurements of fragmentation functions for jets associated with an isolated photon are presented for the first time in pp and PbPb collisions. The analysis uses data collected with the CMS detector at the CERN LHC at a nucleon-nucleon center-of-mass energy of 5.02 TeV. Fragmentation functions are obtained for jets with p$_\\mathrm{T}^\\text{jet} >$ 30 GeV in events containing an isolated photon with p$_\\mathrm{T}^\\gamma>$ 60 GeV, using charged tracks with transverse momentum p$_\\mathrm{T}^\\text{trk} >$ 1 GeV in a cone around the jet axis. The association with an isolated photon constrains the initial p$_\\mathrm{T}$ and azimuthal angle of the parton whose shower produced the jet. For central PbPb collisions, modifications of the jet fragmentation functions are observed when compared to those measured in pp collisions, while no significant differences are found in the 50% most peripheral collisions. Jets in central PbPb events show an excess (depletion) of low (high) p$_\\mathrm{T}$ particles, with a transition around 3 GeV.

  18. Observation of medium induced modifications of jet fragmentation in PbPb collisions using isolated-photon-tagged jets

    CERN Document Server

    Sirunyan, Albert M; CMS Collaboration; Adam, Wolfgang; Ambrogi, Federico; Asilar, Ece; Bergauer, Thomas; Brandstetter, Johannes; Brondolin, Erica; Dragicevic, Marko; Erö, Janos; Escalante Del Valle, Alberto; Flechl, Martin; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Grossmann, Johannes; Hrubec, Josef; Jeitler, Manfred; König, Axel; Krammer, Natascha; Krätschmer, Ilse; Liko, Dietrich; Madlener, Thomas; Mikulec, Ivan; Pree, Elias; Rad, Navid; Rohringer, Herbert; Schieck, Jochen; Schöfbeck, Robert; Spanring, Markus; Spitzbart, Daniel; Taurok, Anton; Waltenberger, Wolfgang; Wittmann, Johannes; Wulz, Claudia-Elisabeth; Zarucki, Mateusz; Chekhovsky, Vladimir; Mossolov, Vladimir; Suarez Gonzalez, Juan; De Wolf, Eddi A; Di Croce, Davide; Janssen, Xavier; Lauwers, Jasper; Van De Klundert, Merijn; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Abu Zeid, Shimaa; Blekman, Freya; D'Hondt, Jorgen; De Bruyn, Isabelle; De Clercq, Jarne; Deroover, Kevin; Flouris, Giannis; Lontkovskyi, Denys; Lowette, Steven; Marchesini, Ivan; Moortgat, Seth; Moreels, Lieselotte; Python, Quentin; Skovpen, Kirill; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Parijs, Isis; Beghin, Diego; Bilin, Bugra; Brun, Hugues; Clerbaux, Barbara; De Lentdecker, Gilles; Delannoy, Hugo; Dorney, Brian; Fasanella, Giuseppe; Favart, Laurent; Goldouzian, Reza; Grebenyuk, Anastasia; Kalsi, Amandeep Kaur; Lenzi, Thomas; Luetic, Jelena; Maerschalk, Thierry; Marinov, Andrey; Seva, Tomislav; Starling, Elizabeth; Vander Velde, Catherine; Vanlaer, Pascal; Vannerom, David; Yonamine, Ryo; Zenoni, Florian; Cornelis, Tom; Dobur, Didar; Fagot, Alexis; Gul, Muhammad; Khvastunov, Illia; Poyraz, Deniz; Roskas, Christos; Salva Diblen, Sinem; Trocino, Daniele; Tytgat, Michael; Verbeke, Willem; Vit, Martina; Zaganidis, Nicolas; Bakhshiansohi, Hamed; Bondu, Olivier; Brochet, Sébastien; Bruno, Giacomo; Caputo, Claudio; Caudron, Adrien; David, Pieter; De Visscher, Simon; Delaere, Christophe; Delcourt, Martin; Francois, Brieuc; Giammanco, Andrea; Komm, Matthias; Krintiras, Georgios; Lemaitre, Vincent; Magitteri, Alessio; Mertens, Alexandre; Musich, Marco; Piotrzkowski, Krzysztof; Quertenmont, Loic; Saggio, Alessia; Vidal Marono, Miguel; Wertz, Sébastien; Zobec, Joze; Aldá Júnior, Walter Luiz; Alves, Fábio Lúcio; Alves, Gilvan; Brito, Lucas; Correia Silva, Gilson; Hensel, Carsten; Moraes, Arthur; Pol, Maria Elena; Rebello Teles, Patricia; Belchior Batista Das Chagas, Ewerton; Carvalho, Wagner; Chinellato, Jose; Coelho, Eduardo; Melo Da Costa, Eliza; Da Silveira, Gustavo Gil; De Jesus Damiao, Dilson; Fonseca De Souza, Sandro; Huertas Guativa, Lina Milena; Malbouisson, Helena; Melo De Almeida, Miqueias; Mora Herrera, Clemencia; Mundim, Luiz; Nogima, Helio; Sanchez Rosas, Luis Junior; Santoro, Alberto; Sznajder, Andre; Thiel, Mauricio; Tonelli Manganote, Edmilson José; Torres Da Silva De Araujo, Felipe; Vilela Pereira, Antonio; Ahuja, Sudha; Bernardes, Cesar Augusto; Tomei, Thiago; De Moraes Gregores, Eduardo; Mercadante, Pedro G; Novaes, Sergio F; Padula, Sandra; Romero Abad, David; Ruiz Vargas, José Cupertino; Aleksandrov, Aleksandar; Hadjiiska, Roumyana; Iaydjiev, Plamen; Misheva, Milena; Rodozov, Mircho; Shopova, Mariana; Sultanov, Georgi; Dimitrov, Anton; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Fang, Wenxing; Gao, Xuyang; Yuan, Li; Ahmad, Muhammad; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Chen, Mingshui; Chen, Ye; Jiang, Chun-Hua; Leggat, Duncan; Liao, Hongbo; Liu, Zhenan; Romeo, Francesco; Shaheen, Sarmad Masood; Spiezia, Aniello; Tao, Junquan; Wang, Chunjie; Wang, Zheng; Yazgan, Efe; Zhang, Huaqiao; Zhao, Jingzhou; Ban, Yong; Chen, Geng; Li, Jing; Li, Qiang; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Wang, Dayong; Xu, Zijun; Zhang, Fengwangdong; Wang, Yi; Avila, Carlos; Cabrera, Andrés; Carrillo Montoya, Camilo Andres; Chaparro Sierra, Luisa Fernanda; Florez, Carlos; González Hernández, Carlos Felipe; Ruiz Alvarez, José David; Segura Delgado, Manuel Alejandro; Courbon, Benoit; Godinovic, Nikola; Lelas, Damir; Puljak, Ivica; Ribeiro Cipriano, Pedro M; Sculac, Toni; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Ferencek, Dinko; Kadija, Kreso; Mesic, Benjamin; Starodumov, Andrei; Susa, Tatjana; Ather, Mohsan Waseem; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Rykaczewski, Hans; Finger, Miroslav; Finger Jr, Michael; Carrera Jarrin, Edgar; El-khateeb, Esraa; Ellithi Kamel, Ali; Mahmoud, Mohammed; Bhowmik, Sandeep; Dewanjee, Ram Krishna; Kadastik, Mario; Perrini, Lucia; Raidal, Martti; Veelken, Christian; Eerola, Paula; Kirschenmann, Henning; Pekkanen, Juska; Voutilainen, Mikko; Havukainen, Joona; Heikkilä, Jaana Kristiina; Jarvinen, Terhi; Karimäki, Veikko; Kinnunen, Ritva; Lampén, Tapio; Lassila-Perini, Kati; Laurila, Santeri; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Siikonen, Hannu; Tuominen, Eija; Tuominiemi, Jorma; Tuuva, Tuure; Besancon, Marc; Couderc, Fabrice; Dejardin, Marc; Denegri, Daniel; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Ghosh, Saranya; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Leloup, Clément; Locci, Elizabeth; Machet, Martina; Malcles, Julie; Negro, Giulia; Rander, John; Rosowsky, André; Sahin, Mehmet Özgür; Titov, Maksym; Abdulsalam, Abdulla; Amendola, Chiara; Antropov, Iurii; Baffioni, Stephanie; Beaudette, Florian; Busson, Philippe; Cadamuro, Luca; Charlot, Claude; Granier de Cassagnac, Raphael; Jo, Mihee; Kucher, Inna; Lisniak, Stanislav; Lobanov, Artur; Martin Blanco, Javier; Nguyen, Matthew; Ochando, Christophe; Ortona, Giacomo; Paganini, Pascal; Pigard, Philipp; Salerno, Roberto; Sauvan, Jean-Baptiste; Sirois, Yves; Stahl Leiton, Andre Govinda; Strebler, Thomas; Yilmaz, Yetkin; Zabi, Alexandre; Zghiche, Amina; Agram, Jean-Laurent; Andrea, Jeremy; Bloch, Daniel; Brom, Jean-Marie; Buttignol, Michael; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Coubez, Xavier; Drouhin, Frédéric; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Jansová, Markéta; Juillot, Pierre; Le Bihan, Anne-Catherine; Tonon, Nicolas; Van Hove, Pierre; Gadrat, Sébastien; Beauceron, Stephanie; Bernet, Colin; Boudoul, Gaelle; Chanon, Nicolas; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fay, Jean; Finco, Linda; Gascon, Susan; Gouzevitch, Maxime; Grenier, Gérald; Ille, Bernard; Lagarde, Francois; Laktineh, Imad Baptiste; Lethuillier, Morgan; Mirabito, Laurent; Pequegnot, Anne-Laure; Perries, Stephane; Popov, Andrey; Sordini, Viola; Vander Donckt, Muriel; Viret, Sébastien; Zhang, Sijing; Toriashvili, Tengizi; Tsamalaidze, Zviad; Autermann, Christian; Feld, Lutz; Kiesel, Maximilian Knut; Klein, Katja; Lipinski, Martin; Preuten, Marius; Schomakers, Christian; Schulz, Johannes; Teroerde, Marius; Wittmer, Bruno; Zhukov, Valery; Albert, Andreas; Duchardt, Deborah; Endres, Matthias; Erdmann, Martin; Erdweg, Sören; Esch, Thomas; Fischer, Robert; Güth, Andreas; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Knutzen, Simon; Merschmeyer, Markus; Meyer, Arnd; Millet, Philipp; Mukherjee, Swagata; Pook, Tobias; Radziej, Markus; Reithler, Hans; Rieger, Marcel; Scheuch, Florian; Teyssier, Daniel; Thüer, Sebastian; Flügge, Günter; Kargoll, Bastian; Kress, Thomas; Künsken, Andreas; Müller, Thomas; Nehrkorn, Alexander; Nowack, Andreas; Pistone, Claudia; Pooth, Oliver; Stahl, Achim; Aldaya Martin, Maria; Arndt, Till; Asawatangtrakuldee, Chayanit; Beernaert, Kelly; Behnke, Olaf; Behrens, Ulf; Bermúdez Martínez, Armando; Bin Anuar, Afiq Aizuddin; Borras, Kerstin; Botta, Valeria; Campbell, Alan; Connor, Patrick; Contreras-Campana, Christian; Costanza, Francesco; Diez Pardos, Carmen; Eckerlin, Guenter; Eckstein, Doris; Eichhorn, Thomas; Eren, Engin; Gallo, Elisabetta; Garay Garcia, Jasone; Geiser, Achim; Grados Luyando, Juan Manuel; Grohsjean, Alexander; Gunnellini, Paolo; Guthoff, Moritz; Harb, Ali; Hauk, Johannes; Hempel, Maria; Jung, Hannes; Kasemann, Matthias; Keaveney, James; Kleinwort, Claus; Korol, Ievgen; Krücker, Dirk; Lange, Wolfgang; Lelek, Aleksandra; Lenz, Teresa; Lipka, Katerina; Lohmann, Wolfgang; Mankel, Rainer; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Missiroli, Marino; Mittag, Gregor; Mnich, Joachim; Mussgiller, Andreas; Ntomari, Eleni; Pitzl, Daniel; Raspereza, Alexei; Savitskyi, Mykola; Saxena, Pooja; Shevchenko, Rostyslav; Stefaniuk, Nazar; Van Onsem, Gerrit Patrick; Walsh, Roberval; Wen, Yiwen; Wichmann, Katarzyna; Wissing, Christoph; Zenaiev, Oleksandr; Aggleton, Robin; Bein, Samuel; Blobel, Volker; Centis Vignali, Matteo; Dreyer, Torben; Garutti, Erika; Gonzalez, Daniel; Haller, Johannes; Hinzmann, Andreas; Hoffmann, Malte; Karavdina, Anastasia; Klanner, Robert; Kogler, Roman; Kovalchuk, Nataliia; Kurz, Simon; Marconi, Daniele; Meyer, Mareike; Niedziela, Marek; Nowatschin, Dominik; Pantaleo, Felice; Peiffer, Thomas; Perieanu, Adrian; Scharf, Christian; Schleper, Peter; Schmidt, Alexander; Schumann, Svenja; Schwandt, Joern; Sonneveld, Jory; Stadie, Hartmut; Steinbrück, Georg; Stober, Fred-Markus Helmut; Stöver, Marc; Tholen, Heiner; Troendle, Daniel; Usai, Emanuele; Vanhoefer, Annika; Vormwald, Benedikt; Akbiyik, Melike; Barth, Christian; Baselga, Marta; Baur, Sebastian; Butz, Erik; Caspart, René; Chwalek, Thorsten; Colombo, Fabio; De Boer, Wim; Dierlamm, Alexander; Faltermann, Nils; Freund, Benedikt; Friese, Raphael; Giffels, Manuel; Harrendorf, Marco Alexander; Hartmann, Frank; Heindl, Stefan Michael; Husemann, Ulrich; Kassel, Florian; Kudella, Simon; Mildner, Hannes; Mozer, Matthias Ulrich; Müller, Thomas; Plagge, Michael; Quast, Gunter; Rabbertz, Klaus; Schröder, Matthias; Shvetsov, Ivan; Sieber, Georg; Simonis, Hans-Jürgen; Ulrich, Ralf; Wayand, Stefan; Weber, Marc; Weiler, Thomas; Williamson, Shawn; Wöhrmann, Clemens; Wolf, Roger; Anagnostou, Georgios; Daskalakis, Georgios; Geralis, Theodoros; Kyriakis, Aristotelis; Loukas, Demetrios; Topsis-Giotis, Iasonas; Karathanasis, George; Kesisoglou, Stilianos; Panagiotou, Apostolos; Saoulidou, Niki; Tziaferi, Eirini; Kousouris, Konstantinos; Evangelou, Ioannis; Foudas, Costas; Gianneios, Paraskevas; Katsoulis, Panagiotis; Kokkas, Panagiotis; Mallios, Stavros; Manthos, Nikolaos; Papadopoulos, Ioannis; Paradas, Evangelos; Strologas, John; Triantis, Frixos A; Tsitsonis, Dimitrios; Csanad, Mate; Filipovic, Nicolas; Pasztor, Gabriella; Surányi, Olivér; Veres, Gabor Istvan; Bencze, Gyorgy; Hajdu, Csaba; Horvath, Dezso; Hunyadi, Ádám; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Beni, Noemi; Czellar, Sandor; Karancsi, János; Makovec, Alajos; Molnar, Jozsef; Szillasi, Zoltan; Bartók, Márton; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Choudhury, Somnath; Komaragiri, Jyothsna Rani; Bahinipati, Seema; Mal, Prolay; Mandal, Koushik; Nayak, Aruna; Sahoo, Deepak Kumar; Sahoo, Niladribihari; Swain, Sanjay Kumar; Bansal, Sunil; Beri, Suman Bala; Bhatnagar, Vipin; Chawla, Ridhi; Dhingra, Nitish; Kaur, Anterpreet; Kaur, Manjit; Kaur, Sandeep; Kumar, Ramandeep; Kumari, Priyanka; Mehta, Ankita; Singh, Jasbir; Walia, Genius; Kumar, Ashok; Shah, Aashaq; Bhardwaj, Ashutosh; Chauhan, Sushil; Choudhary, Brajesh C; Garg, Rocky Bala; Keshri, Sumit; Kumar, Ajay; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Sharma, Ramkrishna; Bhardwaj, Rishika; Bhattacharya, Rajarshi; Bhattacharya, Satyaki; Bhawandeep, Bhawandeep; Bhowmik, Debabrata; Dey, Sourav; Dutt, Suneel; Dutta, Suchandra; Ghosh, Shamik; Majumdar, Nayana; Modak, Atanu; Mondal, Kuntal; Mukhopadhyay, Supratik; Nandan, Saswati; Purohit, Arnab; Rout, Prasant Kumar; Roy, Ashim; Roy Chowdhury, Suvankar; Sarkar, Subir; Sharan, Manoj; Singh, Bipen; Thakur, Shalini; Behera, Prafulla Kumar; Chudasama, Ruchi; Dutta, Dipanwita; Jha, Vishwajeet; Kumar, Vineet; Mohanty, Ajit Kumar; Netrakanti, Pawan Kumar; Pant, Lalit Mohan; Shukla, Prashant; Topkar, Anita; Aziz, Tariq; Dugad, Shashikant; Mahakud, Bibhuprasad; Mitra, Soureek; Mohanty, Gagan Bihari; Sur, Nairit; Sutar, Bajrang; Banerjee, Sudeshna; Bhattacharya, Soham; Chatterjee, Suman; Das, Pallabi; Guchait, Monoranjan; Jain, Sandhya; Kumar, Sanjeev; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Sarkar, Tanmay; Wickramage, Nadeesha; Chauhan, Shubhanshu; Dube, Sourabh; Hegde, Vinay; Kapoor, Anshul; Kothekar, Kunal; Pandey, Shubham; Rane, Aditee; Sharma, Seema; Chenarani, Shirin; Eskandari Tadavani, Esmaeel; Etesami, Seyed Mohsen; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Naseri, Mohsen; Paktinat Mehdiabadi, Saeid; Rezaei Hosseinabadi, Ferdos; Safarzadeh, Batool; Zeinali, Maryam; Felcini, Marta; Grunewald, Martin; Abbrescia, Marcello; Calabria, Cesare; Colaleo, Anna; Creanza, Donato; Cristella, Leonardo; De Filippis, Nicola; De Palma, Mauro; Errico, Filippo; Fiore, Luigi; Iaselli, Giuseppe; Lezki, Samet; Maggi, Giorgio; Maggi, Marcello; Marangelli, Bartolomeo; Miniello, Giorgia; My, Salvatore; Nuzzo, Salvatore; Pompili, Alexis; Pugliese, Gabriella; Radogna, Raffaella; Ranieri, Antonio; Selvaggi, Giovanna; Sharma, Archana; Silvestris, Lucia; Venditti, Rosamaria; Verwilligen, Piet; Zito, Giuseppe; Abbiendi, Giovanni; Battilana, Carlo; Bonacorsi, Daniele; Borgonovi, Lisa; Braibant-Giacomelli, Sylvie; Campanini, Renato; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Chhibra, Simranjit Singh; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Iemmi, Fabio; Marcellini, Stefano; Masetti, Gianni; Montanari, Alessandro; Navarria, Francesco; Perrotta, Andrea; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gian Piero; Tosi, Nicolò; Albergo, Sebastiano; Costa, Salvatore; Di Mattia, Alessandro; Giordano, Ferdinando; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Chatterjee, Kalyanmoy; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Russo, Lorenzo; Sguazzoni, Giacomo; Strom, Derek; Viliani, Lorenzo; Benussi, Luigi; Bianco, Stefano; Fabbri, Franco; Piccolo, Davide; Primavera, Federica; Calvelli, Valerio; Ferro, Fabrizio; Ravera, Fabio; Robutti, Enrico; Tosi, Silvano; Benaglia, Andrea; Beschi, Andrea; Brianza, Luca; Brivio, Francesco; Ciriolo, Vincenzo; Dinardo, Mauro Emanuele; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Govoni, Pietro; Malberti, Martina; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pauwels, Kristof; Pedrini, Daniele; Pigazzini, Simone; Ragazzi, Stefano; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Cavallo, Nicola; Di Guida, Salvatore; Fabozzi, Francesco; Fienga, Francesco; Iorio, Alberto Orso Maria; Khan, Wajid Ali; Lista, Luca; Meola, Sabino; Paolucci, Pierluigi; Sciacca, Crisostomo; Thyssen, Filip; Azzi, Patrizia; Bacchetta, Nicola; Benato, Lisa; Bisello, Dario; Boletti, Alessio; Carlin, Roberto; Checchia, Paolo; Dall'Osso, Martino; De Castro Manzano, Pablo; Dorigo, Tommaso; Dosselli, Umberto; Gasparini, Fabrizio; Gasparini, Ugo; Gozzelino, Andrea; Lacaprara, Stefano; Lujan, Paul; Margoni, Martino; Meneguzzo, Anna Teresa; Pozzobon, Nicola; Ronchese, Paolo; Rossin, Roberto; Simonetto, Franco; Tiko, Andres; Torassa, Ezio; Zanetti, Marco; Zotto, Pierluigi; Zumerle, Gianni; Braghieri, Alessandro; Magnani, Alice; Montagna, Paolo; Ratti, Sergio P; Re, Valerio; Ressegotti, Martina; Riccardi, Cristina; Salvini, Paola; Vai, Ilaria; Vitulo, Paolo; Alunni Solestizi, Luisa; Biasini, Maurizio; Bilei, Gian Mario; Cecchi, Claudia; Ciangottini, Diego; Fanò, Livio; Lariccia, Paolo; Leonardi, Roberto; Manoni, Elisa; Mantovani, Giancarlo; Mariani, Valentina; Menichelli, Mauro; Rossi, Alessandro; Santocchia, Attilio; Spiga, Daniele; Androsov, Konstantin; Azzurri, Paolo; Bagliesi, Giuseppe; Bianchini, Lorenzo; Boccali, Tommaso; Borrello, Laura; Castaldi, Rino; Ciocci, Maria Agnese; Dell'Orso, Roberto; Fedi, Giacomo; Giannini, Leonardo; Giassi, Alessandro; Grippo, Maria Teresa; Ligabue, Franco; Lomtadze, Teimuraz; Manca, Elisabetta; Mandorli, Giulio; Messineo, Alberto; Palla, Fabrizio; Rizzi, Andrea; Spagnolo, Paolo; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Barone, Luciano; Cavallari, Francesca; Cipriani, Marco; Daci, Nadir; Del Re, Daniele; Di Marco, Emanuele; Diemoz, Marcella; Gelli, Simone; Longo, Egidio; Margaroli, Fabrizio; Marzocchi, Badder; Meridiani, Paolo; Organtini, Giovanni; Paramatti, Riccardo; Preiato, Federico; Rahatlou, Shahram; Rovelli, Chiara; Santanastasio, Francesco; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Bartosik, Nazar; Bellan, Riccardo; Biino, Cristina; Cartiglia, Nicolo; Cenna, Francesca; Costa, Marco; Covarelli, Roberto; Degano, Alessandro; Demaria, Natale; Kiani, Bilal; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Monteil, Ennio; Monteno, Marco; Obertino, Maria Margherita; Pacher, Luca; Pastrone, Nadia; Pelliccioni, Mario; Pinna Angioni, Gian Luca; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Shchelina, Ksenia; Sola, Valentina; Solano, Ada; Staiano, Amedeo; Traczyk, Piotr; Belforte, Stefano; Casarsa, Massimo; Cossutti, Fabio; Della Ricca, Giuseppe; Zanetti, Anna; Kim, Dong Hee; Kim, Gui Nyun; Kim, Min Suk; Lee, Jeongeun; Lee, Sangeun; Lee, Seh Wook; Moon, Chang-Seong; Oh, Young Do; Sekmen, Sezen; Son, Dong-Chul; Yang, Yu Chul; Kim, Hyunchul; Moon, Dong Ho; Oh, Geonhee; Brochero Cifuentes, Javier Andres; Goh, Junghwan; Kim, Tae Jeong; Cho, Sungwoong; Choi, Suyong; Go, Yeonju; Gyun, Dooyeon; Ha, Seungkyu; Hong, Byung-Sik; Jo, Youngkwon; Kim, Yongsun; Lee, Kisoo; Lee, Kyong Sei; Lee, Songkyo; Lim, Jaehoon; Park, Sung Keun; Roh, Youn; Almond, John; Kim, Junho; Kim, Jae Sung; Lee, Haneol; Lee, Kyeongpil; Nam, Kyungwook; Oh, Sung Bin; Radburn-Smith, Benjamin Charles; Seo, Seon-hee; Yang, Unki; Yoo, Hwi Dong; Yu, Geum Bong; Kim, Hyunyong; Kim, Ji Hyun; Lee, Jason Sang Hun; Park, Inkyu; Choi, Young-Il; Hwang, Chanwook; Lee, Jongseok; Yu, Intae; Dudenas, Vytautas; Juodagalvis, Andrius; Vaitkus, Juozas; Ahmed, Ijaz; Ibrahim, Zainol Abidin; Md Ali, Mohd Adli Bin; Mohamad Idris, Faridah; Wan Abdullah, Wan Ahmad Tajuddin; Yusli, Mohd Nizam; Zolkapli, Zukhaimira; Reyes-Almanza, Rogelio; Ramirez-Sanchez, Gabriel; Duran-Osuna, Cecilia; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-De La Cruz, Ivan; Rabadán-Trejo, Raúl Iraq; Lopez-Fernandez, Ricardo; Mejia Guisao, Jhovanny; Sánchez Hernández, Alberto; Carrillo Moreno, Salvador; Oropeza Barrera, Cristina; Vazquez Valencia, Fabiola; Eysermans, Jan; Pedraza, Isabel; Salazar Ibarguen, Humberto Antonio; Uribe Estrada, Cecilia; Morelos Pineda, Antonio; Krofcheck, David; Butler, Philip H; Ahmad, Ashfaq; Ahmad, Muhammad; Hassan, Qamar; Hoorani, Hafeez R; Saddique, Asif; Shah, Mehar Ali; Shoaib, Muhammad; Waqas, Muhammad; Bialkowska, Helena; Bluj, Michal; Boimska, Bozena; Frueboes, Tomasz; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Szleper, Michal; Zalewski, Piotr; Bunkowski, Karol; Byszuk, Adrian; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Misiura, Maciej; Olszewski, Michal; Pyskir, Andrzej; Walczak, Marek; Bargassa, Pedrame; Beirão Da Cruz E Silva, Cristóvão; Di Francesco, Agostino; Faccioli, Pietro; Galinhas, Bruno; Gallinaro, Michele; Hollar, Jonathan; Leonardo, Nuno; Lloret Iglesias, Lara; Nemallapudi, Mythra Varun; Seixas, Joao; Strong, Giles; Toldaiev, Oleksii; Vadruccio, Daniele; Varela, Joao; Afanasiev, Serguei; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Kamenev, Alexey; Karjavin, Vladimir; Lanev, Alexander; Malakhov, Alexander; Matveev, Viktor; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Shulha, Siarhei; Skatchkov, Nikolai; Smirnov, Vitaly; Voytishin, Nikolay; Zarubin, Anatoli; Ivanov, Yury; Kim, Victor; Kuznetsova, Ekaterina; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sosnov, Dmitry; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Karneyeu, Anton; Kirsanov, Mikhail; Krasnikov, Nikolai; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Gavrilov, Vladimir; Lychkovskaya, Natalia; Popov, Vladimir; Pozdnyakov, Ivan; Safronov, Grigory; Spiridonov, Alexander; Stepennov, Anton; Stolin, Viatcheslav; Toms, Maria; Vlasov, Evgueni; Zhokin, Alexander; Aushev, Tagir; Bylinkin, Alexander; Chadeeva, Marina; Parygin, Pavel; Philippov, Dmitry; Polikarpov, Sergey; Popova, Elena; Rusinov, Vladimir; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Rusakov, Sergey V; Terkulov, Adel; Baskakov, Alexey; Belyaev, Andrey; Boos, Edouard; Demiyanov, Andrey; Ershov, Alexander; Gribushin, Andrey; Kodolova, Olga; Korotkikh, Vladimir; Lokhtin, Igor; Miagkov, Igor; Obraztsov, Stepan; Petrushanko, Sergey; Savrin, Viktor; Snigirev, Alexander; Vardanyan, Irina; Blinov, Vladimir; Shtol, Dmitry; Skovpen, Yuri; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Elumakhov, Dmitry; Godizov, Anton; Kachanov, Vassili; Kalinin, Alexey; Konstantinov, Dmitri; Mandrik, Petr; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Babaev, Anton; Adzic, Petar; Cirkovic, Predrag; Devetak, Damir; Dordevic, Milos; Milosevic, Jovan; Alcaraz Maestre, Juan; Bachiller, Irene; Barrio Luna, Mar; Cerrada, Marcos; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Flix, Jose; Fouz, Maria Cruz; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Moran, Dermot; Pérez-Calero Yzquierdo, Antonio María; Puerta Pelayo, Jesus; Redondo, Ignacio; Romero, Luciano; Senghi Soares, Mara; Triossi, Andrea; Álvarez Fernández, Adrian; Albajar, Carmen; de Trocóniz, Jorge F; Cuevas, Javier; Erice, Carlos; Fernandez Menendez, Javier; Gonzalez Caballero, Isidro; González Fernández, Juan Rodrigo; Palencia Cortezon, Enrique; Sanchez Cruz, Sergio; Vischia, Pietro; Vizan Garcia, Jesus Manuel; Cabrillo, Iban Jose; Calderon, Alicia; Chazin Quero, Barbara; Duarte Campderros, Jordi; Fernandez, Marcos; Fernández Manteca, Pedro José; Garcia-Ferrero, Juan; García Alonso, Andrea; Gomez, Gervasio; Lopez Virto, Amparo; Marco, Jesus; Martinez Rivero, Celso; Martinez Ruiz del Arbol, Pablo; Matorras, Francisco; Piedra Gomez, Jonatan; Prieels, Cédric; Rodrigo, Teresa; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Trevisani, Nicolò; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Akgun, Bora; Auffray, Etiennette; Baillon, Paul; Ball, Austin; Barney, David; Bendavid, Joshua; Bianco, Michele; Bocci, Andrea; Botta, Cristina; Camporesi, Tiziano; Castello, Roberto; Cepeda, Maria; Cerminara, Gianluca; Chapon, Emilien; Chen, Yi; D'Enterria, David; Dabrowski, Anne; Daponte, Vincenzo; David Tinoco Mendes, Andre; De Gruttola, Michele; De Roeck, Albert; Deelen, Nikkie; Dobson, Marc; Du Pree, Tristan; Dünser, Marc; Dupont, Niels; Elliott-Peisert, Anna; Everaerts, Pieter; Fallavollita, Francesco; Franzoni, Giovanni; Fulcher, Jonathan; Funk, Wolfgang; Gigi, Dominique; Gilbert, Andrew; Gill, Karl; Glege, Frank; Gulhan, Doga; Hegeman, Jeroen; Innocente, Vincenzo; Jafari, Abideh; Janot, Patrick; Karacheban, Olena; Kieseler, Jan; Knünz, Valentin; Kornmayer, Andreas; Kortelainen, Matti J; Krammer, Manfred; Lange, Clemens; Lecoq, Paul; Lourenco, Carlos; Lucchini, Marco Toliman; Malgeri, Luca; Mannelli, Marcello; Martelli, Arabella; Meijers, Frans; Merlin, Jeremie Alexandre; Mersi, Stefano; Meschi, Emilio; Milenovic, Predrag; Moortgat, Filip; Mulders, Martijn; Neugebauer, Hannes; Ngadiuba, Jennifer; Orfanelli, Styliani; Orsini, Luciano; Pape, Luc; Perez, Emmanuel; Peruzzi, Marco; Petrilli, Achille; Petrucciani, Giovanni; Pfeiffer, Andreas; Pierini, Maurizio; Pitters, Florian Michael; Rabady, Dinyar; Racz, Attila; Reis, Thomas; Rolandi, Gigi; Rovere, Marco; Sakulin, Hannes; Schäfer, Christoph; Schwick, Christoph; Seidel, Markus; Selvaggi, Michele; Sharma, Archana; Silva, Pedro; Sphicas, Paraskevas; Stakia, Anna; Steggemann, Jan; Stoye, Markus; Tosi, Mia; Treille, Daniel; Tsirou, Andromachi; Veckalns, Viesturs; Verweij, Marta; Zeuner, Wolfram Dietrich; Bertl, Willi; Caminada, Lea; Deiters, Konrad; Erdmann, Wolfram; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; Kotlinski, Danek; Langenegger, Urs; Rohe, Tilman; Wiederkehr, Stephan Albert; Backhaus, Malte; Bäni, Lukas; Berger, Pirmin; Casal, Bruno; Dissertori, Günther; Dittmar, Michael; Donegà, Mauro; Dorfer, Christian; Grab, Christoph; Heidegger, Constantin; Hits, Dmitry; Hoss, Jan; Kasieczka, Gregor; Klijnsma, Thomas; Lustermann, Werner; Mangano, Boris; Marionneau, Matthieu; Meinhard, Maren Tabea; Meister, Daniel; Micheli, Francesco; Musella, Pasquale; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pata, Joosep; Pauss, Felicitas; Perrin, Gaël; Perrozzi, Luca; Quittnat, Milena; Reichmann, Michael; Sanz Becerra, Diego Alejandro; Schönenberger, Myriam; Shchutska, Lesya; Tavolaro, Vittorio Raoul; Theofilatos, Konstantinos; Vesterbacka Olsson, Minna Leonora; Wallny, Rainer; Zhu, De Hua; Aarrestad, Thea Klaeboe; Amsler, Claude; Canelli, Maria Florencia; De Cosa, Annapaola; Del Burgo, Riccardo; Donato, Silvio; Galloni, Camilla; Hreus, Tomas; Kilminster, Benjamin; Pinna, Deborah; Rauco, Giorgia; Robmann, Peter; Salerno, Daniel; Schweiger, Korbinian; Seitz, Claudia; Takahashi, Yuta; Zucchetta, Alberto; Candelise, Vieri; Chang, Yu-Hsiang; Cheng, Kai-yu; Doan, Thi Hien; Jain, Shilpi; Khurana, Raman; Kuo, Chia-Ming; Lin, Willis; Pozdnyakov, Andrey; Yu, Shin-Shan; Kumar, Arun; Chang, Paoti; Chao, Yuan; Chen, Kai-Feng; Chen, Po-Hsun; Fiori, Francesco; Hou, George Wei-Shu; Hsiung, Yee; Liu, Yueh-Feng; Lu, Rong-Shyang; Paganis, Efstathios; Psallidas, Andreas; Steen, Arnaud; Tsai, Jui-fa; Asavapibhop, Burin; Kovitanggoon, Kittikul; Singh, Gurpreet; Srimanobhas, Norraphat; Bakirci, Mustafa Numan; Bat, Ayse; Boran, Fatma; Damarseckin, Serdal; Demiroglu, Zuhal Seyma; Dozen, Candan; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Guler, Yalcin; Hos, Ilknur; Kangal, Evrim Ersin; Kara, Ozgun; Kiminsu, Ugur; Oglakci, Mehmet; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sunar Cerci, Deniz; Tok, Ufuk Guney; Turkcapar, Semra; Zorbakir, Ibrahim Soner; Zorbilmez, Caglar; Karapinar, Guler; Ocalan, Kadir; Yalvac, Metin; Zeyrek, Mehmet; Gülmez, Erhan; Kaya, Mithat; Kaya, Ozlem; Tekten, Sevgi; Yetkin, Elif Asli; Agaras, Merve Nazlim; Atay, Serhat; Cakir, Altan; Cankocak, Kerem; Komurcu, Yildiray; Grynyov, Boris; Levchuk, Leonid; Ball, Fionn; Beck, Lana; Brooke, James John; Burns, Douglas; Clement, Emyr; Cussans, David; Davignon, Olivier; Flacher, Henning; Goldstein, Joel; Heath, Greg P; Heath, Helen F; Kreczko, Lukasz; Newbold, Dave M; Paramesvaran, Sudarshan; Sakuma, Tai; Seif El Nasr-storey, Sarah; Smith, Dominic; Smith, Vincent J; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Calligaris, Luigi; Cieri, Davide; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Linacre, Jacob; Olaiya, Emmanuel; Petyt, David; Shepherd-Themistocleous, Claire; Thea, Alessandro; Tomalin, Ian R; Williams, Thomas; Womersley, William John; Auzinger, Georg; Bainbridge, Robert; Bloch, Philippe; Borg, Johan; Breeze, Shane; Buchmuller, Oliver; Bundock, Aaron; Casasso, Stefano; Citron, Matthew; Colling, David; Corpe, Louie; Dauncey, Paul; Davies, Gavin; Della Negra, Michel; Di Maria, Riccardo; Haddad, Yacine; Hall, Geoffrey; Iles, Gregory; James, Thomas; Lane, Rebecca; Laner, Christian; Lyons, Louis; Magnan, Anne-Marie; Malik, Sarah; Mastrolorenzo, Luca; Matsushita, Takashi; Nash, Jordan; Nikitenko, Alexander; Palladino, Vito; Pesaresi, Mark; Raymond, David Mark; Richards, Alexander; Rose, Andrew; Scott, Edward; Seez, Christopher; Shtipliyski, Antoni; Summers, Sioni; Tapper, Alexander; Uchida, Kirika; Vazquez Acosta, Monica; Virdee, Tejinder; Wardle, Nicholas; Winterbottom, Daniel; Wright, Jack; Zenz, Seth Conrad; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Morton, Alexander; Reid, Ivan; Teodorescu, Liliana; Zahid, Sema; Borzou, Ahmad; Call, Kenneth; Dittmann, Jay; Hatakeyama, Kenichi; Liu, Hongxuan; Pastika, Nathaniel; Smith, Caleb; Bartek, Rachel; Dominguez, Aaron; Buccilli, Andrew; Cooper, Seth; Henderson, Conor; Rumerio, Paolo; West, Christopher; Arcaro, Daniel; Avetisyan, Aram; Bose, Tulika; Gastler, Daniel; Rankin, Dylan; Richardson, Clint; Rohlf, James; Sulak, Lawrence; Zou, David; Benelli, Gabriele; Cutts, David; Hadley, Mary; Hakala, John; Heintz, Ulrich; Hogan, Julie Managan; Kwok, Ka Hei Martin; Laird, Edward; Landsberg, Greg; Lee, Jangbae; Mao, Zaixing; Narain, Meenakshi; Pazzini, Jacopo; Piperov, Stefan; Sagir, Sinan; Syarif, Rizki; Yu, David; Band, Reyer; Brainerd, Christopher; Breedon, Richard; Burns, Dustin; Calderon De La Barca Sanchez, Manuel; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Erbacher, Robin; Flores, Chad; Funk, Garrett; Ko, Winston; Lander, Richard; Mclean, Christine; Mulhearn, Michael; Pellett, Dave; Pilot, Justin; Shalhout, Shalhout; Shi, Mengyao; Smith, John; Stolp, Dustin; Taylor, Devin; Tos, Kyle; Tripathi, Mani; Wang, Zhangqier; Bachtis, Michail; Bravo, Cameron; Cousins, Robert; Dasgupta, Abhigyan; Florent, Alice; Hauser, Jay; Ignatenko, Mikhail; Mccoll, Nickolas; Regnard, Simon; Saltzberg, David; Schnaible, Christian; Valuev, Vyacheslav; Bouvier, Elvire; Burt, Kira; Clare, Robert; Ellison, John Anthony; Gary, J William; Ghiasi Shirazi, Seyyed Mohammad Amin; Hanson, Gail; Karapostoli, Georgia; Kennedy, Elizabeth; Lacroix, Florent; Long, Owen Rosser; Olmedo Negrete, Manuel; Paneva, Mirena Ivova; Si, Weinan; Wang, Long; Wei, Hua; Wimpenny, Stephen; Yates, Brent; Branson, James G; Cittolin, Sergio; Derdzinski, Mark; Gerosa, Raffaele; Gilbert, Dylan; Hashemi, Bobak; Holzner, André; Klein, Daniel; Kole, Gouranga; Krutelyov, Vyacheslav; Letts, James; Masciovecchio, Mario; Olivito, Dominick; Padhi, Sanjay; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Tadel, Matevz; Vartak, Adish; Wasserbaech, Steven; Wood, John; Würthwein, Frank; Yagil, Avraham; Zevi Della Porta, Giovanni; Amin, Nick; Bhandari, Rohan; Bradmiller-Feld, John; Campagnari, Claudio; Dishaw, Adam; Dutta, Valentina; Franco Sevilla, Manuel; Gouskos, Loukas; Heller, Ryan; Incandela, Joe; Ovcharova, Ana; Qu, Huilin; Richman, Jeffrey; Stuart, David; Suarez, Indara; Yoo, Jaehyeok; Anderson, Dustin; Bornheim, Adolf; Bunn, Julian; Dutta, Irene; Lawhorn, Jay Mathew; Newman, Harvey B; Nguyen, Thong; Pena, Cristian; Spiropulu, Maria; Vlimant, Jean-Roch; Wilkinson, Richard; Xie, Si; Zhang, Zhicai; Zhu, Ren-Yuan; Andrews, Michael Benjamin; Ferguson, Thomas; Mudholkar, Tanmay; Paulini, Manfred; Russ, James; Sun, Menglei; Vogel, Helmut; Vorobiev, Igor; Weinberg, Marc; Cumalat, John Perry; Ford, William T; Jensen, Frank; Johnson, Andrew; Krohn, Michael; Leontsinis, Stefanos; MacDonald, Emily; Mulholland, Troy; Stenson, Kevin; Wagner, Stephen Robert; Alexander, James; Chaves, Jorge; Cheng, Yangyang; Chu, Jennifer; Dittmer, Susan; Mcdermott, Kevin; Mirman, Nathan; Patterson, Juliet Ritchie; Quach, Dan; Rinkevicius, Aurelijus; Ryd, Anders; Skinnari, Louise; Soffi, Livia; Tan, Shao Min; Tao, Zhengcheng; Thom, Julia; Tucker, Jordan; Wittich, Peter; Zientek, Margaret; Abdullin, Salavat; Albrow, Michael; Alyari, Maral; Apollinari, Giorgio; Apresyan, Artur; Apyan, Aram; Banerjee, Sunanda; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Bolla, Gino; Burkett, Kevin; Butler, Joel Nathan; Canepa, Anadi; Cerati, Giuseppe Benedetto; Cheung, Harry; Chlebana, Frank; Cremonesi, Matteo; Duarte, Javier; Elvira, Victor Daniel; Freeman, Jim; Gecse, Zoltan; Gottschalk, Erik; Gray, Lindsey; Green, Dan; Grünendahl, Stefan; Gutsche, Oliver; Hanlon, Jim; Harris, Robert M; Hasegawa, Satoshi; Hirschauer, James; Hu, Zhen; Jayatilaka, Bodhitha; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Klima, Boaz; Kreis, Benjamin; Lammel, Stephan; Lincoln, Don; Lipton, Ron; Liu, Miaoyuan; Liu, Tiehui; Lopes De Sá, Rafael; Lykken, Joseph; Maeshima, Kaori; Magini, Nicolo; Marraffino, John Michael; Mason, David; McBride, Patricia; Merkel, Petra; Mrenna, Stephen; Nahn, Steve; O'Dell, Vivian; Pedro, Kevin; Prokofyev, Oleg; Rakness, Gregory; Ristori, Luciano; Savoy-Navarro, Aurore; Schneider, Basil; Sexton-Kennedy, Elizabeth; Soha, Aron; Spalding, William J; Spiegel, Leonard; Stoynev, Stoyan; Strait, James; Strobbe, Nadja; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vernieri, Caterina; Verzocchi, Marco; Vidal, Richard; Wang, Michael; Weber, Hannsjoerg Artur; Whitbeck, Andrew; Wu, Weimin; Acosta, Darin; Avery, Paul; Bortignon, Pierluigi; Bourilkov, Dimitri; Brinkerhoff, Andrew; Carnes, Andrew; Carver, Matthew; Curry, David; Field, Richard D; Furic, Ivan-Kresimir; Gleyzer, Sergei V; Joshi, Bhargav Madhusudan; Konigsberg, Jacobo; Korytov, Andrey; Kotov, Khristian; Ma, Peisen; Matchev, Konstantin; Mei, Hualin; Mitselmakher, Guenakh; Shi, Kun; Sperka, David; Terentyev, Nikolay; Thomas, Laurent; Wang, Jian; Wang, Sean-Jiun; Yelton, John; Joshi, Yagya Raj; Linn, Stephan; Markowitz, Pete; Rodriguez, Jorge Luis; Ackert, Andrew; Adams, Todd; Askew, Andrew; Hagopian, Sharon; Hagopian, Vasken; Johnson, Kurtis F; Kolberg, Ted; Martinez, German; Perry, Thomas; Prosper, Harrison; Saha, Anirban; Santra, Arka; Sharma, Varun; Yohay, Rachel; Baarmand, Marc M; Bhopatkar, Vallary; Colafranceschi, Stefano; Hohlmann, Marcus; Noonan, Daniel; Roy, Titas; Yumiceva, Francisco; Adams, Mark Raymond; Apanasevich, Leonard; Berry, Douglas; Betts, Russell Richard; Cavanaugh, Richard; Chen, Xuan; Evdokimov, Olga; Gerber, Cecilia Elena; Hangal, Dhanush Anil; Hofman, David Jonathan; Jung, Kurt; Kamin, Jason; Sandoval Gonzalez, Irving Daniel; Tonjes, Marguerite; Trauger, Hallie; Varelas, Nikos; Wang, Hui; Wu, Zhenbin; Zhang, Jingyu; Bilki, Burak; Clarida, Warren; Dilsiz, Kamuran; Durgut, Süleyman; Gandrajula, Reddy Pratap; Haytmyradov, Maksat; Khristenko, Viktor; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Ogul, Hasan; Onel, Yasar; Ozok, Ferhat; Penzo, Aldo; Snyder, Christina; Tiras, Emrah; Wetzel, James; Yi, Kai; Blumenfeld, Barry; Cocoros, Alice; Eminizer, Nicholas; Fehling, David; Feng, Lei; Gritsan, Andrei; Maksimovic, Petar; Roskes, Jeffrey; Sarica, Ulascan; Swartz, Morris; Xiao, Meng; You, Can; Al-bataineh, Ayman; Baringer, Philip; Bean, Alice; Boren, Samuel; Bowen, James; Castle, James; Khalil, Sadia; Kropivnitskaya, Anna; Majumder, Devdatta; Mcbrayer, William; Murray, Michael; Rogan, Christopher; Royon, Christophe; Sanders, Stephen; Schmitz, Erich; Tapia Takaki, Daniel; Wang, Quan; Ivanov, Andrew; Kaadze, Ketino; Maravin, Yurii; Mohammadi, Abdollah; Saini, Lovedeep Kaur; Skhirtladze, Nikoloz; Rebassoo, Finn; Wright, Douglas; Baden, Drew; Baron, Owen; Belloni, Alberto; Eno, Sarah Catherine; Feng, Yongbin; Ferraioli, Charles; Hadley, Nicholas John; Jabeen, Shabnam; Jeng, Geng-Yuan; Kellogg, Richard G; Kunkle, Joshua; Mignerey, Alice; Ricci-Tam, Francesca; Shin, Young Ho; Skuja, Andris; Tonwar, Suresh C; Abercrombie, Daniel; Allen, Brandon; Azzolini, Virginia; Barbieri, Richard; Baty, Austin; Bauer, Gerry; Bi, Ran; Brandt, Stephanie; Busza, Wit; Cali, Ivan Amos; D'Alfonso, Mariarosaria; Demiragli, Zeynep; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Harris, Philip; Hsu, Dylan; Hu, Miao; Iiyama, Yutaro; Innocenti, Gian Michele; Klute, Markus; Kovalskyi, Dmytro; Lee, Yen-Jie; Levin, Andrew; Luckey, Paul David; Maier, Benedikt; Marini, Andrea Carlo; Mcginn, Christopher; Mironov, Camelia; Narayanan, Siddharth; Niu, Xinmei; Paus, Christoph; Roland, Christof; Roland, Gunther; Salfeld-Nebgen, Jakob; Stephans, George; Sumorok, Konstanty; Tatar, Kaya; Velicanu, Dragos; Wang, Jing; Wang, Ta-Wei; Wyslouch, Bolek; Benvenuti, Alberto; Chatterjee, Rajdeep Mohan; Evans, Andrew; Hansen, Peter; Hiltbrand, Joshua; Kalafut, Sean; Kubota, Yuichi; Lesko, Zachary; Mans, Jeremy; Nourbakhsh, Shervin; Ruckstuhl, Nicole; Rusack, Roger; Turkewitz, Jared; Wadud, Mohammad Abrar; Acosta, John Gabriel; Oliveros, Sandra; Avdeeva, Ekaterina; Bloom, Kenneth; Claes, Daniel R; Fangmeier, Caleb; Golf, Frank; Gonzalez Suarez, Rebeca; Kamalieddin, Rami; Kravchenko, Ilya; Monroy, Jose; Siado, Joaquin Emilo; Snow, Gregory R; Stieger, Benjamin; Dolen, James; Godshalk, Andrew; Harrington, Charles; Iashvili, Ia; Nguyen, Duong; Parker, Ashley; Rappoccio, Salvatore; Roozbahani, Bahareh; Alverson, George; Barberis, Emanuela; Freer, Chad; Hortiangtham, Apichart; Massironi, Andrea; Morse, David Michael; Orimoto, Toyoko; Teixeira De Lima, Rafael; Wamorkar, Tanvi; Wang, Bingran; Wisecarver, Andrew; Wood, Darien; Bhattacharya, Saptaparna; Charaf, Otman; Hahn, Kristan Allan; Mucia, Nicholas; Odell, Nathaniel; Schmitt, Michael Henry; Sung, Kevin; Trovato, Marco; Velasco, Mayda; Bucci, Rachael; Dev, Nabarun; Hildreth, Michael; Hurtado Anampa, Kenyi; Jessop, Colin; Karmgard, Daniel John; Kellams, Nathan; Lannon, Kevin; Li, Wenzhao; Loukas, Nikitas; Marinelli, Nancy; Meng, Fanbo; Mueller, Charles; Musienko, Yuri; Planer, Michael; Reinsvold, Allison; Ruchti, Randy; Siddireddy, Prasanna; Smith, Geoffrey; Taroni, Silvia; Wayne, Mitchell; Wightman, Andrew; Wolf, Matthias; Woodard, Anna; Alimena, Juliette; Antonelli, Louis; Bylsma, Ben; Durkin, Lloyd Stanley; Flowers, Sean; Francis, Brian; Hart, Andrew; Hill, Christopher; Ji, Weifeng; Ling, Ta-Yung; Liu, Bingxuan; Luo, Wuming; Winer, Brian L; Wulsin, Howard Wells; Cooperstein, Stephane; Driga, Olga; Elmer, Peter; Hardenbrook, Joshua; Hebda, Philip; Higginbotham, Samuel; Kalogeropoulos, Alexis; Lange, David; Luo, Jingyu; Marlow, Daniel; Mei, Kelvin; Ojalvo, Isabel; Olsen, James; Palmer, Christopher; Piroué, Pierre; Stickland, David; Tully, Christopher; Malik, Sudhir; Norberg, Scarlet; Barker, Anthony; Barnes, Virgil E; Das, Souvik; Folgueras, Santiago; Gutay, Laszlo; Jones, Matthew; Jung, Andreas Werner; Khatiwada, Ajeeta; Miller, David Harry; Neumeister, Norbert; Peng, Cheng-Chieh; Qiu, Hao; Schulte, Jan-Frederik; Sun, Jian; Wang, Fuqiang; Xiao, Rui; Xie, Wei; Cheng, Tongguang; Parashar, Neeti; Stupak, John; Chen, Zhenyu; Ecklund, Karl Matthew; Freed, Sarah; Geurts, Frank JM; Guilbaud, Maxime; Kilpatrick, Matthew; Li, Wei; Michlin, Benjamin; Padley, Brian Paul; Roberts, Jay; Rorie, Jamal; Shi, Wei; Tu, Zhoudunming; Zabel, James; Zhang, Aobo; Bodek, Arie; de Barbaro, Pawel; Demina, Regina; Duh, Yi-ting; Ferbel, Thomas; Galanti, Mario; Garcia-Bellido, Aran; Han, Jiyeon; Hindrichs, Otto; Khukhunaishvili, Aleko; Lo, Kin Ho; Tan, Ping; Verzetti, Mauro; Ciesielski, Robert; Goulianos, Konstantin; Mesropian, Christina; Agapitos, Antonis; Chou, John Paul; Gershtein, Yuri; Gómez Espinosa, Tirso Alejandro; Halkiadakis, Eva; Heindl, Maximilian; Hughes, Elliot; Kaplan, Steven; Kunnawalkam Elayavalli, Raghav; Kyriacou, Savvas; Lath, Amitabh; Montalvo, Roy; Nash, Kevin; Osherson, Marc; Saka, Halil; Salur, Sevil; Schnetzer, Steve; Sheffield, David; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Thomassen, Peter; Walker, Matthew; Delannoy, Andrés G; Heideman, Joseph; Riley, Grant; Rose, Keith; Spanier, Stefan; Thapa, Krishna; Bouhali, Othmane; Castaneda Hernandez, Alfredo; Celik, Ali; Dalchenko, Mykhailo; De Mattia, Marco; Delgado, Andrea; Dildick, Sven; Eusebi, Ricardo; Gilmore, Jason; Huang, Tao; Kamon, Teruki; Mueller, Ryan; Pakhotin, Yuriy; Patel, Rishi; Perloff, Alexx; Perniè, Luca; Rathjens, Denis; Safonov, Alexei; Tatarinov, Aysen; Ulmer, Keith; Akchurin, Nural; Damgov, Jordan; De Guio, Federico; Dudero, Phillip Russell; Faulkner, James; Gurpinar, Emine; Kunori, Shuichi; Lamichhane, Kamal; Lee, Sung Won; Mengke, Tielige; Muthumuni, Samila; Peltola, Timo; Undleeb, Sonaina; Volobouev, Igor; Wang, Zhixing; Greene, Senta; Gurrola, Alfredo; Janjam, Ravi; Johns, Willard; Maguire, Charles; Melo, Andrew; Ni, Hong; Padeken, Klaas; Sheldon, Paul; Tuo, Shengquan; Velkovska, Julia; Xu, Qiao; Arenton, Michael Wayne; Barria, Patrizia; Cox, Bradley; Hirosky, Robert; Joyce, Matthew; Ledovskoy, Alexander; Li, Hengne; Neu, Christopher; Sinthuprasith, Tutanon; Wang, Yanchu; Wolfe, Evan; Xia, Fan; Harr, Robert; Karchin, Paul Edmund; Poudyal, Nabin; Sturdy, Jared; Thapa, Prakash; Zaleski, Shawn; Brodski, Michael; Buchanan, James; Caillol, Cécile; Carlsmith, Duncan; Dasu, Sridhara; Dodd, Laura; Duric, Senka; Gomber, Bhawna; Grothe, Monika; Herndon, Matthew; Hervé, Alain; Hussain, Usama; Klabbers, Pamela; Lanaro, Armando; Levine, Aaron; Long, Kenneth; Loveless, Richard; Rekovic, Vladimir; Ruggles, Tyler; Savin, Alexander; Smith, Nicholas; Smith, Wesley H; Woods, Nathaniel

    2018-01-01

    Measurements of fragmentation functions for jets associated with an isolated photon are presented for the first time in pp and PbPb collisions. The analysis uses data collected with the CMS detector at the CERN LHC at a nucleon-nucleon center-of-mass energy of 5.02 TeV. Fragmentation functions are obtained for jets with ${p_{\\mathrm{T}}}^{\\text{jet}} > $ 30 GeV/$c$ in events containing an isolated photon with ${p_{\\mathrm{T}}}^{\\gamma} > $ 60 GeV/$c$, using charged tracks with transverse momentum $ {p_{\\mathrm{T}}}^{\\text{trk}} > $ 1 GeV/$c$ in a cone around the jet axis. The association with an isolated photon constrains the initial ${p_{\\mathrm{T}}}$ and azimuthal angle of the parton whose shower produced the jet. For central PbPb collisions, modifications of the jet fragmentation functions are observed when compared to those measured in pp collisions, while no significant differences are found in the 50\\% most peripheral collisions. Jets in central PbPb events show an excess (depletion) of low (high) $ {p_...

  19. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    Energy Technology Data Exchange (ETDEWEB)

    Tee, Thiam-Tsui, E-mail: thiamtsu@yahoo.com [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Cheah, Yew-Hoong [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Bioassay Unit, Herbal Medicine Research Center, Institute for Medical Research, Jalan Pahang, Kuala Lumpur (Malaysia); Meenakshii, Nallappan [Biology Department, Faculty of Science, Universiti Putra Malaysia, 43400 Serdang, Selangor (Malaysia); Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie [School of Biosciences and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. Black-Right-Pointing-Pointer Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. Black-Right-Pointing-Pointer Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. Black-Right-Pointing-Pointer DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. Black-Right-Pointing-Pointer DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X{sub L} expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  20. Xanthorrhizol induced DNA fragmentation in HepG2 cells involving Bcl-2 family proteins

    International Nuclear Information System (INIS)

    Tee, Thiam-Tsui; Cheah, Yew-Hoong; Meenakshii, Nallappan; Mohd Sharom, Mohd Yusof; Azimahtol Hawariah, Lope Pihie

    2012-01-01

    Highlights: ► We isolated xanthorrhizol, a sesquiterpenoid compound from Curcuma xanthorrhiza. ► Xanthorrhizol induced apoptosis in HepG2 cells as observed using SEM. ► Apoptosis in xanthorrhizol-treated HepG2 cells involved Bcl-2 family proteins. ► DNA fragmentation was observed in xanthorrhizol-treated HepG2 cells. ► DNA fragmentation maybe due to cleavage of PARP and DFF45/ICAD proteins. -- Abstract: Xanthorrhizol is a plant-derived pharmacologically active sesquiterpenoid compound isolated from Curcuma xanthorrhiza. Previously, we have reported that xanthorrhizol inhibited the proliferation of HepG2 human hepatoma cells by inducing apoptotic cell death via caspase activation. Here, we attempt to further elucidate the mode of action of xanthorrhizol. Apoptosis in xanthorrhizol-treated HepG2 cells as observed by scanning electron microscopy was accompanied by truncation of BID; reduction of both anti-apoptotic Bcl-2 and Bcl-X L expression; cleavage of PARP and DFF45/ICAD proteins and DNA fragmentation. Taken together, these results suggest xanthorrhizol as a potent antiproliferative agent on HepG2 cells by inducing apoptosis via Bcl-2 family members. Hence we proposed that xanthorrhizol could be used as an anti-liver cancer drug for future studies.

  1. Parallel Sequencing of Expressed Sequence Tags from Two Complementary DNA Libraries for High and Low Phosphorus Adaptation in Common Beans

    Directory of Open Access Journals (Sweden)

    Matthew W. Blair

    2011-11-01

    Full Text Available Expressed sequence tags (ESTs have proven useful for gene discovery in many crops. In this work, our objective was to construct complementary DNA (cDNA libraries from root tissues of common beans ( L. grown under low and high P hydroponic conditions and to conduct EST sequencing and comparative analyses of the libraries. Expressed sequence tag analysis of 3648 clones identified 2372 unigenes, of which 1591 were annotated as known genes while a total of 465 unigenes were not associated with any known gene. Unigenes with hits were categorized according to biological processes, molecular function, and cellular compartmentalization. Given the young tissue used to make the root libraries, genes for catalytic activity and binding were highly expressed. Comparisons with previous root EST sequencing and between the two libraries made here resulted in a set of genes to study further for differential gene expression and adaptation to low P, such as a 14 kDa praline-rich protein, a metallopeptidase, tonoplast intrinsic protein, adenosine triphosphate (ATP citrate synthase, and cell proliferation genes expressed in the low P treated plants. Given that common beans are often grown on acid soils of the tropics and subtropics that are usually low in P these genes and the two parallel libraries will be useful for selection for better uptake of this essential macronutrient. The importance of EST generation for common bean root tissues under low P and other abiotic soil stresses is also discussed.

  2. DNA barcoding for identification of 'Candidatus Phytoplasmas' using a fragment of the elongation factor Tu gene.

    Directory of Open Access Journals (Sweden)

    Olga Makarova

    Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.

  3. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA[reg])

    International Nuclear Information System (INIS)

    Evenson, Donald P.; Wixon, Regina

    2005-01-01

    Studies over the past two decades have clearly shown that reproductive toxicants cause sperm DNA fragmentation. This DNA fragmentation can usually be detected prior to observing alterations of metaphase chromosomes in embryos. Thus, Sperm Chromatin Structure Assay (SCSA)-detected DNA damage is viewed as the molecular precursor to later gross chromosome damage observed under the light microscope. SCSA measurements of animal or human sperm consist of first obtaining a fresh or flash frozen neat semen sample in LN2 or dry ice. Samples are then sent to a SCSA diagnostic laboratory where the samples are thawed, diluted to ∼1-2 x 106 sperm/ml, treated for 30 s with a pH 1.2 detergent buffer and then stained with acridine orange (AO). The low pH partially denatures DNA at the sites of DNA strand breaks and the AO-ssDNA fluoresces red while the AO-dsDNA fluoresces green. Flow cytometry measurements of 5000 sperm/sample provide statistically robust data on the ratio of red to green sperm, the extent of the DNA fragmentation and the standard deviations of measures. Numerous experiments on rodents treated with reproductive toxicants clearly showed that SCSA measures are highly dose responsive and have a very low CV. Different agents that act on germ cells at various stages of development usually showed sperm DNA fragmentation when that germ cell fraction arrived in the epididymis or ejaculate. Some of these treated samples were capable of successful in vitro fertilization but with frequent embryo failure. A 2-year longitudinal study of men living a valley town with a reported abnormal level of infertility and spontaneous miscarriages and also a seasonal atmospheric smog pollution, showed, for the first time, that SCSA measurements of human sperm DNA fragmentation were detectable and correlated with dosage of air pollution while the classical semen measures were not correlated. Also, young men spraying pesticides without protective gear are at an increased risk for elevated

  4. Multiple Determinations of Sperm DNA Fragmentation Show That Varicocelectomy Is Not Indicated for Infertile Patients with Subclinical Varicocele

    Directory of Open Access Journals (Sweden)

    Agustín García-Peiró

    2014-01-01

    Full Text Available Varicocele is one of the most common causes of low semen quality, which is reflected in high percentages of sperm cells with fragmented DNA. While varicocelectomy is usually performed to ameliorate a patient’s fertility, its impact on sperm DNA integrity in the case of subclinical varicocele is poorly documented. In this study, multiple DNA fragmentation analyses (TUNEL, SCD, and SCSA were performed on semen samples from sixty infertile patients with varicocele (15 clinical varicoceles, 19 clinical varicoceles after surgical treatment, 16 subclinical varicoceles, and 10 subclinical varicoceles after surgical treatment. TUNEL, SCD, and SCSA assays all showed substantial sperm DNA fragmentation levels that were comparable between subclinical and clinical varicocele patients. Importantly, varicocelectomy did improve sperm quality in patients with clinical varicocele; however, this was not the case in patients with subclinical varicocele. In summary, although infertile patients with clinical and subclinical varicocele have similar sperm DNA quality, varicocelectomy should only be advised for patients with clinical varicocele.

  5. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    Science.gov (United States)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  6. Fragmentation of chromatin DNA in mouse thymus cells after whole body γ-irradiation

    International Nuclear Information System (INIS)

    Wei Kang; Liu Xueying; Zhu Xuefen

    1984-01-01

    The characteristics of soluble chromatin in mouse thymus nuclei after whole body γ-irradiation were investigated by means of polyacrylamide gel electrophoresis. After deproteinization and electrophoresis eight regular DNA bands were revealed. The molecular weights of these bands were estimated by comparing their migration rates with those of the standard fragments obtained from PBR 322 digested completely by restrictive endonuclease Hae III. The molecular weight of the first band was calculated to be 186 base pairs corresponding approximately to the size of DNA fragment from a single nucleosome, and those of other bands appeared to be its multiples. The results suggested that the disintegration of chromatin DNA after γ-irradiation might have occurred at the linkage regions of chromatin. The autolysis product of normal thymus chromatin under sterile condition were also analyzed and its electrophoretic pattern was found to be just the same as that of the postirradiation product. It seems, therefore, that the endonuclease existing in normal tissues might be responsible for the postirradiation chromatin degradation. The mechanism of this kind of enzymatic digestion remains to be elucidated in further investigation. (author)

  7. The Effect of Glyphosate on Human Sperm Motility and Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    George Anifandis

    2018-05-01

    Full Text Available Glyphosate is the active ingredient of Roundup®, which is one of the most popular herbicides worldwide. Although many studies have focused on the reproductive toxicity of glyphosate or glyphosate-based herbicides, the majority of them have concluded that the effect of the specific herbicide is negligible, while only a few studies indicate the male reproductive toxicity of glyphosate alone. The aim of the present study was to investigate the effect of 0.36 mg/L glyphosate on sperm motility and sperm DNA fragmentation (SDF. Thirty healthy men volunteered to undergo semen analysis for the purpose of the study. Sperm motility was calculated according to WHO 2010 guidelines at collection time (zero time and 1 h post-treatment with glyphosate. Sperm DNA fragmentation was evaluated with Halosperm® G2 kit for both the control and glyphosate-treated sperm samples. Sperm progressive motility of glyphosate-treated samples was significantly reduced after 1 h post-treatment in comparison to the respective controls, in contrast to the SDF of glyphosate-treated samples, which was comparable to the respective controls. Conclusively, under these in vitro conditions, at high concentrations that greatly exceed environmental exposures, glyphosate exerts toxic effects on sperm progressive motility but not on sperm DNA integrity, meaning that the toxic effect is limited only to motility, at least in the first hour.

  8. DNA fragmentation and nuclear phenotype in tendons exposed to low-intensity infrared laser

    Science.gov (United States)

    de Paoli, Flavia; Ramos Cerqueira, Larissa; Martins Ramos, Mayara; Campos, Vera M.; Ferreira-Machado, Samara C.; Geller, Mauro; de Souza da Fonseca, Adenilson

    2015-03-01

    Clinical protocols are recommended in device guidelines outlined for treating many diseases on empirical basis. However, effects of low-intensity infrared lasers at fluences used in clinical protocols on DNA are controversial. Excitation of endogenous chromophores in tissues and free radicals generation could be described as a consequence of laser used. DNA lesions induced by free radicals cause changes in DNA structure, chromatin organization, ploidy degrees and cell death. In this work, we investigated whether low-intensity infrared laser therapy could alter the fibroblasts nuclei characteristics and induce DNA fragmentation. Tendons of Wistar rats were exposed to low-intensity infrared laser (830 nm), at different fluences (1, 5 and 10 J/cm2), in continuous wave (power output of 10mW, power density of 79.6 mW/cm2). Different frequencies were analyzed for the higher fluence (10 J/cm2), at pulsed emission mode (2.5, 250 and 2500 Hz), with the laser source at surface of skin. Geometric, densitometric and textural parameters obtained for Feulgen-stained nuclei by image analysis were used to define nuclear phenotypes. Significant differences were observed on the nuclear phenotype of tendons after exposure to laser, as well as, high cell death percentages was observed for all fluences and frequencies analyzed here, exception 1 J/cm2 fluence. Our results indicate that low-intensity infrared laser can alter geometric, densitometric and textural parameters in tendon fibroblasts nuclei. Laser can also induce DNA fragmentation, chromatin lost and consequently cell death, using fluences, frequencies and emission modes took out from clinical protocols.

  9. Analysis of human blood plasma cell-free DNA fragment size distribution using EvaGreen chemistry based droplet digital PCR assays.

    Science.gov (United States)

    Fernando, M Rohan; Jiang, Chao; Krzyzanowski, Gary D; Ryan, Wayne L

    2018-04-12

    Plasma cell-free DNA (cfDNA) fragment size distribution provides important information required for diagnostic assay development. We have developed and optimized droplet digital PCR (ddPCR) assays that quantify short and long DNA fragments. These assays were used to analyze plasma cfDNA fragment size distribution in human blood. Assays were designed to amplify 76,135, 490 and 905 base pair fragments of human β-actin gene. These assays were used for fragment size analysis of plasma cell-free, exosome and apoptotic body DNA obtained from normal and pregnant donors. The relative percentages for 76, 135, 490 and 905 bp fragments from non-pregnant plasma and exosome DNA were 100%, 39%, 18%, 5.6% and 100%, 40%, 18%,3.3%, respectively. The relative percentages for pregnant plasma and exosome DNA were 100%, 34%, 14%, 23%, and 100%, 30%, 12%, 18%, respectively. The relative percentages for non-pregnant plasma pellet (obtained after 2nd centrifugation step) were 100%, 100%, 87% and 83%, respectively. Non-pregnant Plasma cell-free and exosome DNA share a unique fragment distribution pattern which is different from pregnant donor plasma and exosome DNA fragment distribution indicating the effect of physiological status on cfDNA fragment size distribution. Fragment distribution pattern for plasma pellet that includes apoptotic bodies and nuclear DNA was greatly different from plasma cell-free and exosome DNA. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  10. Sequence context effects on 8-methoxypsoralen photobinding to defined DNA fragments

    International Nuclear Information System (INIS)

    Sage, E.; Moustacchi, E.

    1987-01-01

    The photoreaction of 8-methoxypsoralen (8-MOP) with DNA fragments of defined sequence was studied. The authors took advantage of the blockage by bulky adducts of the 3'-5'-exonuclease activity associated with the T4 DNA polymerase. The action of the exonuclease is stopped by biadducts as well as by monoadducts. The termination products were analyzed on sequencing gels. A strong sequence specificity was observed in the DNA photobinding of 8-MOP. The exonuclease terminates its digestion near thymine residues, mainly at potentially cross-linkable sites. There is an increasing reactivity of thymine residues in the order T < TT << TTT in a GC environment. For thymine residues in cross-linkable sites, the reactivity follows the order AT << TA ∼ TAT << ATA < ATAT < ATATAA. Repeated A-T sequences are hot spots for the photochemical reaction of 8-MOP with DNA. Both monoadducts and interstrand cross-links are formed preferentially in 5'-TpA sites. The results highlight the role of the sequence and consequently of the conformation around a potential site in the photobinding of 8-MOP to DNA

  11. Electron microscopic observations and DNA chain fragmentation studies on apoptosis in bone tumor cells induced by 153Sm-EDTMP

    International Nuclear Information System (INIS)

    Zhu Shoupeng; Xiao Dong; Han Xiaofeng

    1997-01-01

    The morphological changes observed by electron microscopy indicate that after internal irradiation with 153 Sm-EDTMP bone tumor cells displayed feature of apoptosis, such as margination of condensed chromatin, chromatin fragmentation, as well as the membrane bounded apoptotic bodies formation. The quantification analysis of fragmentation DNA for bone tumor cells induced by 153 Sm-EDTMP shows that the DNA fragmentation is enhanced with the prolongation of internally irradiated time. These characteristics suggest that 153 Sm-EDTMP internal irradiation could induce bone tumor cells to go to apoptosis

  12. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  14. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  15. Long span DNA paired-end-tag (DNA-PET sequencing strategy for the interrogation of genomic structural mutations and fusion-point-guided reconstruction of amplicons.

    Directory of Open Access Journals (Sweden)

    Fei Yao

    Full Text Available Structural variations (SVs contribute significantly to the variability of the human genome and extensive genomic rearrangements are a hallmark of cancer. While genomic DNA paired-end-tag (DNA-PET sequencing is an attractive approach to identify genomic SVs, the current application of PET sequencing with short insert size DNA can be insufficient for the comprehensive mapping of SVs in low complexity and repeat-rich genomic regions. We employed a recently developed procedure to generate PET sequencing data using large DNA inserts of 10-20 kb and compared their characteristics with short insert (1 kb libraries for their ability to identify SVs. Our results suggest that although short insert libraries bear an advantage in identifying small deletions, they do not provide significantly better breakpoint resolution. In contrast, large inserts are superior to short inserts in providing higher physical genome coverage for the same sequencing cost and achieve greater sensitivity, in practice, for the identification of several classes of SVs, such as copy number neutral and complex events. Furthermore, our results confirm that large insert libraries allow for the identification of SVs within repetitive sequences, which cannot be spanned by short inserts. This provides a key advantage in studying rearrangements in cancer, and we show how it can be used in a fusion-point-guided-concatenation algorithm to study focally amplified regions in cancer.

  16. The effect of swim-up and gradient sperm preparation techniques on deoxyribonucleic acid (DNA) fragmentation in subfertile patients.

    Science.gov (United States)

    Oguz, Yuksel; Guler, Ismail; Erdem, Ahmet; Mutlu, Mehmet Firat; Gumuslu, Seyhan; Oktem, Mesut; Bozkurt, Nuray; Erdem, Mehmet

    2018-03-23

    To compare the effect of two different sperm preparation techniques, including swim-up and gradient methods on sperm deoxyribonucleic acid (DNA) fragmentation status of semen samples from unexplained and mild male factor subfertile patients undergoing intrauterine insemination (IUI). A prospective randomized study was conducted in 65 subfertile patients, including 34 unexplained and 31 male factor infertility to compare basal and post-procedure DNA fragmentation rates in swim-up and gradient techniques. Sperm DNA fragmentation rates were evaluated by a sperm chromatin dispersion (SCD) test in two portions of each sample of semen that was prepared with either swim-up or gradient techniques. Sperm motility and morphology were also assessed based on WHO 2010 criteria. Swim-up but not gradient method yielded a statistically significant reduction in the DNA fragmented sperm rate after preparation as compared to basal rates, in the semen samples of both unexplained (41.85 ± 22.04 vs. 28.58 ± 21.93, p gradient) and mild male factor (46.61 ± 19.38 vs. 30.32 ± 18.20, p gradient) subgroups. Swim-up method significantly reduces sperm DNA fragmentation rates and may have some prognostic value on intrauterine insemination in patients with decreased sperm DNA integrity.

  17. A LDR-PCR approach for multiplex polymorphisms genotyping of severely degraded DNA with fragment sizes <100 bp.

    Science.gov (United States)

    Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng

    2009-11-01

    Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.

  18. Seasonal changes of DNA fragmentation and quality of raw and cold-stored stallion spermatozoa.

    Science.gov (United States)

    Wach-Gygax, L; Burger, D; Malama, E; Bollwein, H; Fleisch, A; Jeannerat, E; Thomas, S; Schuler, G; Janett, F

    2017-09-01

    In this study annual fluctuations of DNA fragmentation and quality of cold-stored equine sperm were evaluated. Ejaculates were collected weekly during one year from 15 stallions. Ejaculate volume, sperm concentration and total sperm count were determined and semen was then extended and cold-stored for 48 h. Sperm motility was evaluated by CASA before and after 24 as well as 48 h of cold storage. In addition, the percentages of sperm with intact plasma membrane and acrosome (PMAI %) and with low intracellular Ca 2+ level were determined in cold-stored semen (24 h, 48 h). SCSA™ was performed to assess mean DFI, SD of DFI and % DFI in raw frozen-thawed as well as in extended sperm after 24 and 48 h of storage. The month of semen collection affected (P sperm concentration lower in summer compared to winter and motility lower in July than in any other month of the year (P sperm with low intracellular Ca +2 level (%) after storage for 24 and 48 h, higher values were measured in winter and in October compared to April, June and July (P sperm. Semen quality was impaired in midsummer when low sperm motility and viability were combined with an elevated DNA fragmentation and Ca 2+ level of sperm. Copyright © 2017. Published by Elsevier Inc.

  19. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  20. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  1. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan, E-mail: irfan_rahman@urmc.rochester.edu

    2016-09-02

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  2. Electronic cigarette aerosols and copper nanoparticles induce mitochondrial stress and promote DNA fragmentation in lung fibroblasts

    International Nuclear Information System (INIS)

    Lerner, Chad A.; Rutagarama, Pierrot; Ahmad, Tanveer; Sundar, Isaac K.; Elder, Alison; Rahman, Irfan

    2016-01-01

    Oxidants or nanoparticles have recently been identified as constituents of aerosols released from various styles of electronic cigarettes (E-cigs). Cells in the lung may be directly exposed to these constituents and harbor reactive properties capable of incurring acute cell injury. Our results show mitochondria are sensitive to both E-cig aerosols and aerosol containing copper nanoparticles when exposed to human lung fibroblasts (HFL-1) using an Air-Liquid Interface culture system, evident by elevated levels of mitochondrial ROS (mtROS). Increased mtROS after aerosol exposure is associated with reduced stability of OxPhos electron transport chain (ETC) complex IV subunit and nuclear DNA fragmentation. Increased levels of IL-8 and IL-6 in HFL-1 conditioned media were also observed. These findings reveal both mitochondrial, genotoxic, and inflammatory stresses are features of direct cell exposure to E-cig aerosols which are ensued by inflammatory duress, raising a concern on deleterious effect of vaping. - Graphical abstract: Oxidants and possibly reactive properties of metal particles in E-cig aerosols impart mitochondrial oxidative stress and DNA damage. These biological effects accompany inflammatory response which may raise concern regarding long term E-cig use. Mitochondria may be particularly sensitive to reactive properties of E-cig aerosols in addition to the potential for them to induce genotoxic stress by generating increased ROS. - Highlights: • Mitochondria are sensitive to both E-cig aerosols and metal nanoparticles. • Increased mtROS by E-cig aerosol is associated with disrupted mitochondrial energy. • E-cig causes nuclear DNA fragmentation. • E-cig aerosols induce pro-inflammatory response in human fibroblasts.

  3. Is there a relationship between the chromatin status and DNA fragmentation of boar spermatozoa following freezing-thawing?

    Science.gov (United States)

    Fraser, L; Strzezek, J

    2007-07-15

    In this study a radioisotope method, which is based on the quantitative measurements of tritiated-labeled actinomycin D ((3)H-AMD) incorporation into the sperm nuclei ((3)H-AMD incorporation assay), was used to assess the chromatin status of frozen-thawed boar spermatozoa. This study also tested the hypothesis that frozen-thawed spermatozoa with altered chromatin were susceptible to DNA fragmentation measured with the neutral comet assay (NCA). Boar semen was diluted in lactose-hen egg yolk-glycerol extender (L-HEY) or lactose ostrich egg yolk lipoprotein fractions-glycerol extender (L-LPFo), packaged into aluminum tubes or plastic straws and frozen in a controlled programmable freezer. In Experiment 1, the chromatin status and DNA fragmentation were measured in fresh and frozen-thawed spermatozoa from the same ejaculates. There was a significant increase in sperm chromatin destabilization and DNA fragmentation in frozen-thawed semen as compared with fresh semen. The proportions of spermatozoa labeled with (3)H-AMD were concurrent with elevated levels of sperm DNA fragmentation in K-3 extender, without cryoprotective substances, compared with L-HEY or L-LPFo extender. Regression analysis revealed that the results of the (3)H-AMD incorporation assay and NCA for frozen-thawed spermatozoa were correlated. Boars differed significantly in terms of post-thaw sperm DNA damage. In Experiment 2, the susceptibility of sperm chromatin to decondensation was assessed using a low concentration of heparin. Treatment of frozen-thawed spermatozoa with heparin revealed enhanced (3)H-AMD binding, suggesting nuclear chromatin decondensation. The deterioration in post-thaw sperm viability, such as motility, mitochondrial function and plasma membrane integrity, was concurrent with increased chromatin instability and DNA fragmentation. This is the first report to show that freezing-thawing procedure facilitated destabilization in the chromatin structure of boar spermatozoa, resulting in

  4. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  5. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  6. Construction of cDNA library and preliminary analysis of expressed sequence tags from Siberian tiger

    Science.gov (United States)

    Liu, Chang-Qing; Lu, Tao-Feng; Feng, Bao-Gang; Liu, Dan; Guan, Wei-Jun; Ma, Yue-Hui

    2010-01-01

    In this study we successfully constructed a full-length cDNA library from Siberian tiger, Panthera tigris altaica, the most well-known wild Animal. Total RNA was extracted from cultured Siberian tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.30×106 pfu/ml and 1.62×109 pfu/ml respectively. The proportion of recombinants from unamplified library was 90.5% and average length of exogenous inserts was 1.13 kb. A total of 282 individual ESTs with sizes ranging from 328 to 1,142bps were then analyzed the BLASTX score revealed that 53.9% of the sequences were classified as strong match, 38.6% as nominal and 7.4% as weak match. 28.0% of them were found to be related to enzyme/catalytic protein, 20.9% ESTs to metabolism, 13.1% ESTs to transport, 12.1% ESTs to signal transducer/cell communication, 9.9% ESTs to structure protein, 3.9% ESTs to immunity protein/defense metabolism, 3.2% ESTs to cell cycle, and 8.9 ESTs classified as novel genes. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genomic research of Siberian tigers. PMID:20941376

  7. TbPIF5 is a Trypanosoma brucei mitochondrial DNA helicase involved in processing of minicircle Okazaki fragments.

    Directory of Open Access Journals (Sweden)

    Beiyu Liu

    2009-09-01

    Full Text Available Trypanosoma brucei's mitochondrial genome, kinetoplast DNA (kDNA, is a giant network of catenated DNA rings. The network consists of a few thousand 1 kb minicircles and several dozen 23 kb maxicircles. Here we report that TbPIF5, one of T. brucei's six mitochondrial proteins related to Saccharomyces cerevisiae mitochondrial DNA helicase ScPIF1, is involved in minicircle lagging strand synthesis. Like its yeast homolog, TbPIF5 is a 5' to 3' DNA helicase. Together with other enzymes thought to be involved in Okazaki fragment processing, TbPIF5 localizes in vivo to the antipodal sites flanking the kDNA. Minicircles in wild type cells replicate unidirectionally as theta-structures and are unusual in that Okazaki fragments are not joined until after the progeny minicircles have segregated. We now report that overexpression of TbPIF5 causes premature removal of RNA primers and joining of Okazaki fragments on theta structures. Further elongation of the lagging strand is blocked, but the leading strand is completed and the minicircle progeny, one with a truncated H strand (ranging from 0.1 to 1 kb, are segregated. The minicircles with a truncated H strand electrophorese on an agarose gel as a smear. This replication defect is associated with kinetoplast shrinkage and eventual slowing of cell growth. We propose that TbPIF5 unwinds RNA primers after lagging strand synthesis, thus facilitating processing of Okazaki fragments.

  8. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Science.gov (United States)

    Bertolotto, Jorge A.; Umazano, Juan P.

    2016-06-01

    In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  9. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  10. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  11. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  12. Complementarily addressed modification and cleavage of a single-stranded fragment of DNA with the aid of alkylating derivatives of oligonucleotides

    International Nuclear Information System (INIS)

    Brosalina, E.B.; Vlasov, V.V.; Kutyavin, I.V.; Mamaev, S.V.; Pletnev, A.G.; Podyminogin, M.A.

    1986-01-01

    The chemical modification of a 303-nucleotide single-stranded fragment of DNA by alkylating oligonucleotide derivatives bearing 4-[N-methyl-N-(2-chloroethyl)amino]benzyl groups in the 5'-terminal phosphate of the 3'-terminal ribose residue has been investigated. It has been shown that under the conditions of the formation of a complex with the DNA fragment both types of derivatives specifically alkylate nucleotides of the DNA fragments that are located directly adjacent to the sections complementary to the oligonucleotides bearing the reactive groups. Alkylation takes place with a high efficiency, and the DNA fragment can be cleaved specifically at the position of the alkylated nucleotides

  13. Dietary supplementation with docosahexaenoic acid (DHA) improves seminal antioxidant status and decreases sperm DNA fragmentation.

    Science.gov (United States)

    Martínez-Soto, Juan Carlos; Domingo, Joan Carles; Cordobilla, Begoña; Nicolás, María; Fernández, Laura; Albero, Pilar; Gadea, Joaquín; Landeras, José

    2016-12-01

    The purpose of this study was to evaluate the effect of docosahexaenoic acid (DHA) dietary supplementation on semen quality, fatty acid composition, antioxidant capacity, and DNA fragmentation. In this randomized, double blind, placebo-controlled, parallel-group study, 74 subjects were recruited and randomly assigned to either the placebo group (n=32) or to the DHA group (n=42) to consume three 500-mg capsules of oil per day over 10 weeks. The placebo group received 1,500 mg/day of sunflower oil and the DHA group 1,500 mg/day of DHA-enriched oil. Seminal parameters (semen volume, sperm concentration, motility, morphology, and vitality), total antioxidant capacity, deoxyribonucleic acid fragmentation, and lipid composition were evaluated prior to the treatment and after 10 weeks. Finally, 57 subjects were included in the study with 25 in the placebo group and 32 in the DHA group. No differences were found in traditional sperm parameters or lipid composition of the sperm membrane after treatment. However, an increase in DHA and Omega-3 fatty acid content in seminal plasma, an improvement in antioxidant status, and a reduction in the percentage of spermatozoa with deoxyribonucleic acid damage were observed in the DHA group after 10 weeks of treatment.

  14. A DNA metabarcoding study of a primate dietary diversity and plasticity across its entire fragmented range.

    Directory of Open Access Journals (Sweden)

    Erwan Quéméré

    Full Text Available In tropical regions, most primary ecosystems have been replaced by mosaic landscapes in which species must cope with a large shift in the distribution of their habitat and associated food resources. Primates are particularly vulnerable to habitat modifications. Most species persist in small fragments surrounded by complex human-mediated matrices whose structure and connectivity may strongly influence their dispersal and feeding behavior. Behavioral plasticity appears to be a crucial parameter governing the ability of organisms to exploit the resources offered by new matrix habitats and thus to persist in fragmented habitats. In this study, we were interested in the dietary plasticity of the golden-crowned sifaka (Propithecus tattersalli, an endangered species of lemur, found only in the Daraina region in north-eastern Madagascar. We used a DNA-based approach combining the barcoding concept and Illumina next-generation sequencing to (i describe the species diet across its entire range and (ii evaluate the influence of landscape heterogeneity on diet diversity and composition. Faeces from 96 individuals were sampled across the entire species range and their contents were analyzed using the trnL metabarcoding approach. In parallel, we built a large DNA reference database based on a checklist of the plant species of the Daraina region. Our results suggest that golden-crowned sifakas exhibit remarkable dietary diversity with at least 130 plant species belonging to 80 genera and 49 different families. We highlighted an influence of both habitat type and openness on diet composition suggesting a high flexibility of foraging strategies. Moreover, we observed the presence of numerous cultivated and naturalized plants in the faeces of groups living in forest edge areas. Overall, our findings support our initial expectation that P. tattersalli is able to cope with the current level of alteration of the landscape and confirm our previous results on the

  15. Billfish Tagging

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The SWFSC's constituent-based Billfish Tagging Program began in 1963 and since that time has provided conventional spaghetti type tags and tagging supplies to...

  16. [Real-time quantification to analyze historical Colombian samples detecting a short fragment of hypervariable region II of mitochondrial DNA].

    Science.gov (United States)

    Pérez, Luz Adriana; Rodríguez, Freddy; Langebaek, Carl Henrik; Groot, Helena

    2016-09-01

    Unlike other molecular biology studies, the analysis of ancient DNA (aDNA) requires special infrastructure and methodological conditions to guarantee the quality of the results. One of the main authenticity criteria is DNA quantification, where quantitative real-time PCR is often used given its sensitivity and specificity. Nevertheless, the implementation of these conditions and methodologies to fulfill authenticity criteria imply higher costs. Objective: To develop a simple and less costly method for mitochondrial DNA quantification suitable for highly degraded samples. Materials and methods: The proposed method is based on the use of mini-primers for the specific amplification of short fragments of mitochondrial DNA. The subsequent purification of these amplified fragments allows a standard curve to be constructed with concentrations in accordance to the state of degradation of the samples. Results: The proposed method successfully detected DNA from ancient samples including bone remains and mummified tissue. DNA inhibitory substances were also detected. Conclusion: The proposed method represents a simpler and cost-effective way to detect low amounts of aDNA, and a tool to differentiate DNA-free samples from samples with inhibitory substances.

  17. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  18. Tag questions Tag questions

    Directory of Open Access Journals (Sweden)

    David Brazil

    2008-04-01

    Full Text Available The so-called 'tag' structures of English have received a lot of attention in language teaching programmes, attention that is not hard to justify when one considers the problems and anxiety they can occasion for many foreign learners. Most teachers one speaks to seem fairly willing to agree, however, that traditional treatments of the topic leave much to be desired. It happens, also, that, when considered collectively, the tags and some related phenomena have a special heoretical interest. For they constitute a field in which it seems essential to bring together insights that derive from the study of several aspects of linguistic organisation, aspects which in some recent work have been held to need distinctive kinds of descriptive category to handle. Traditional treatments have found it necessary to recognise different syntactic types (e.g. 'same polarity' and 'reversed polarity' tags and ifferent intonational treatments ("falling'and 'rising' tag; while the way the communicative significance of the various permutations is described normally requires reference to the expectations they signal regarding the immediately following behaviour of the other party (in the common phrase, 'What kind of answer they expect'. This last consideration places the matter squarely in the arena of recent work on the analysis of interactive discourse. The so-called 'tag' structures of English have received a lot of attention in language teaching programmes, attention that is not hard to justify when one considers the problems and anxiety they can occasion for many foreign learners. Most teachers one speaks to seem fairly willing to agree, however, that traditional treatments of the topic leave much to be desired. It happens, also, that, when considered collectively, the tags and some related phenomena have a special heoretical interest. For they constitute a field in which it seems essential to bring together insights that derive from the study of several aspects

  19. The metabolic enhancer piracetam attenuates mitochondrion-specific endonuclease G translocation and oxidative DNA fragmentation.

    Science.gov (United States)

    Gupta, Sonam; Verma, Dinesh Kumar; Biswas, Joyshree; Rama Raju, K Siva; Joshi, Neeraj; Wahajuddin; Singh, Sarika

    2014-08-01

    This study was performed to investigate the involvement of mitochondrion-specific endonuclease G in piracetam (P)-induced protective mechanisms. Studies have shown the antiapoptotic effects of piracetam but the mechanism of action of piracetam is still an enigma. To assess the involvement of endonuclease G in piracetam-induced protective effects, astrocyte glial cells were treated with lipopolysaccharide (LPS) and piracetam. LPS treatment caused significantly decreased viability, mitochondrial activity, oxidative stress, chromatin condensation, and DNA fragmentation, which were attenuated by piracetam cotreatment. Cotreatment of astrocytes with piracetam showed its significantly time-dependent absorption as observed with high-performance liquid chromatography. Astrocytes treated with piracetam alone showed enhanced mitochondrial membrane potential (MMP) in comparison to control astrocytes. However, in LPS-treated cells no significant alteration in MMP was observed in comparison to control cells. Protein and mRNA levels of the terminal executor of the caspase-mediated pathway, caspase-3, were not altered significantly in LPS or LPS + piracetam-treated astrocytes, whereas endonuclease G was significantly translocated to the nucleus in LPS-treated astrocytes. Piracetam cotreatment attenuated the LPS-induced endonuclease G translocation. In conclusion this study indicates that LPS treatment of astrocytes caused decreased viability, oxidative stress, mitochondrial dysfunction, chromatin condensation, DNA damage, and translocation of endonuclease G to the nucleus, which was inhibited by piracetam cotreatment, confirming that the mitochondrion-specific endonuclease G is one of the factors involved in piracetam-induced protective mechanisms. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Graphene Field-Effect Transistors for the Sensitive and Selective Detection of Escherichia coli Using Pyrene-Tagged DNA Aptamer.

    Science.gov (United States)

    Wu, Guangfu; Dai, Ziwen; Tang, Xin; Lin, Zihong; Lo, Pik Kwan; Meyyappan, M; Lai, King Wai Chiu

    2017-10-01

    This study reports biosensing using graphene field-effect transistors with the aid of pyrene-tagged DNA aptamers, which exhibit excellent selectivity, affinity, and stability for Escherichia coli (E. coli) detection. The aptamer is employed as the sensing probe due to its advantages such as high stability and high affinity toward small molecules and even whole cells. The change of the carrier density in the probe-modified graphene due to the attachment of E. coli is discussed theoretically for the first time and also verified experimentally. The conformational change of the aptamer due to the binding of E. coli brings the negatively charged E. coli close to the graphene surface, increasing the hole carrier density efficiently in graphene and achieving electrical detection. The binding of negatively charged E. coli induces holes in graphene, which are pumped into the graphene channel from the contact electrodes. The carrier mobility, which correlates the gate voltage to the electrical signal of the APG-FETs, is analyzed and optimized here. The excellent sensing performance such as low detection limit, high sensitivity, outstanding selectivity and stability of the graphene biosensor for E. coli detection paves the way to develop graphene biosensors for bacterial detection. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  2. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  3. Impact of the Z potential technique on reducing the sperm DNA fragmentation index, fertilization rate and embryo development.

    Science.gov (United States)

    Duarte, Carlos; Núñez, Víctor; Wong, Yat; Vivar, Carlos; Benites, Elder; Rodriguez, Urso; Vergara, Carlos; Ponce, Jorge

    2017-12-01

    In assisted reproduction procedures, we need to develop and enhance new protocols to optimize sperm selection. The aim of this study is to evaluate the ability of the Z potential technique to select sperm with intact DNA in non-normospermic patients and evaluate the impact of this selection on embryonic development. We analyzed a total of 174 human seminal samples with at least one altered parameter. We measured basal, post density gradients, and post density gradients + Z potential DNA fragmentation index. To evaluate the impact of this technique on embryo development, 54 cases were selected. The embryo development parameters evaluated were fertilization rate, cleavage rate, top quality embryos at the third day and blastocysts rate. We found significant differences in the study groups when we compared the sperm fragmentation index by adding the Z potential technique to density gradient selection vs. density gradients alone. Furthermore, there was no significant difference in the embryo development parameters between the low sperm fragmentation index group vs. the moderate and high sperm fragmentation index groups, when selecting sperms with this new technique. The Z potential technique is a very useful tool for sperm selection; it significantly reduces the DNA fragmentation index and improves the parameters of embryo development. This technique could be considered routine for its simplicity and low cost.

  4. Construction of a cDNA library and preliminary analysis of expressed sequence tags in Piper hainanense.

    Science.gov (United States)

    Fan, R; Ling, P; Hao, C Y; Li, F P; Huang, L F; Wu, B D; Wu, H S

    2015-10-19

    Black pepper is a perennial climbing vine. It is widely cultivated because its berries can be utilized not only as a spice in food but also for medicinal use. This study aimed to construct a standardized, high-quality cDNA library to facilitated identification of new Piper hainanense transcripts. For this, 262 unigenes were used to generate raw reads. The average length of these 262 unigenes was 774.8 bp. Of these, 94 genes (35.9%) were newly identified, according to the NCBI protein database. Thus, identification of new genes may broaden the molecular knowledge of P. hainanense on the basis of Clusters of Orthologous Groups and Gene Ontology categories. In addition, certain basic genes linked to physiological processes, which can contribute to disease resistance and thereby to the breeding of black pepper. A total of 26 unigenes were found to be SSR markers. Dinucleotide SSR was the main repeat motif, accounting for 61.54%, followed by trinucleotide SSR (23.07%). Eight primer pairs successfully amplified DNA fragments and detected significant amounts of polymorphism among twenty-one piper germplasm. These results present a novel sequence information of P. hainanense, which can serve as the foundation for further genetic research on this species.

  5. Menadione-Induced DNA Damage Leads to Mitochondrial Dysfunction and Fragmentation During Rosette Formation in Fuchs Endothelial Corneal Dystrophy.

    Science.gov (United States)

    Halilovic, Adna; Schmedt, Thore; Benischke, Anne-Sophie; Hamill, Cecily; Chen, Yuming; Santos, Janine Hertzog; Jurkunas, Ula V

    2016-06-20

    Fuchs endothelial corneal dystrophy (FECD), a leading cause of age-related corneal edema requiring transplantation, is characterized by rosette formation of corneal endothelium with ensuing apoptosis. We sought to determine whether excess of mitochondrial reactive oxygen species leads to chronic accumulation of oxidative DNA damage and mitochondrial dysfunction, instigating cell death. We modeled the pathognomonic rosette formation of postmitotic corneal cells by increasing endogenous cellular oxidative stress with menadione (MN) and performed a temporal analysis of its effect in normal (HCEnC, HCECi) and FECD (FECDi) cells and ex vivo specimens. FECDi and FECD ex vivo specimens exhibited extensive mtDNA and nDNA damage as detected by quantitative PCR. Exposure to MN triggered an increase in mitochondrial superoxide levels and led to mtDNA and nDNA damage, while DNA amplification was restored with NAC pretreatment. Furthermore, MN exposure led to a decrease in ΔΨm and adenosine triphosphate levels in normal cells, while FECDi exhibited mitochondrial dysfunction at baseline. Mitochondrial fragmentation and cytochrome c release were detected in FECD tissue and after MN treatment of HCEnCs. Furthermore, cleavage of caspase-9 and caspase-3 followed MN-induced cytochrome c release in HCEnCs. This study provides the first line of evidence that accumulation of oxidative DNA damage leads to rosette formation, loss of functionally intact mitochondria via fragmentation, and subsequent cell death during postmitotic cell degeneration of ocular tissue. MN induced rosette formation, along with mtDNA and nDNA damage, mitochondrial dysfunction, and fragmentation, leading to activation of the intrinsic apoptosis via caspase cleavage and cytochrome c release. Antioxid. Redox Signal. 24, 1072-1083.

  6. Methyl-CpG island-associated genome signature tags

    Science.gov (United States)

    Dunn, John J

    2014-05-20

    Disclosed is a method for analyzing the organismic complexity of a sample through analysis of the nucleic acid in the sample. In the disclosed method, through a series of steps, including digestion with a type II restriction enzyme, ligation of capture adapters and linkers and digestion with a type IIS restriction enzyme, genome signature tags are produced. The sequences of a statistically significant number of the signature tags are determined and the sequences are used to identify and quantify the organisms in the sample. Various embodiments of the invention described herein include methods for using single point genome signature tags to analyze the related families present in a sample, methods for analyzing sequences associated with hyper- and hypo-methylated CpG islands, methods for visualizing organismic complexity change in a sampling location over time and methods for generating the genome signature tag profile of a sample of fragmented DNA.

  7. DNA-tagged Microparticles for Tracing Water Flows and Travel Times in Natural Systems: The First results from Controlled Laboratory Experiments

    Science.gov (United States)

    Bogaard, T.; Bandyopadhyay, S.; Foppen, J. W.

    2017-12-01

    Societal demand for water safety is continuously increasing, being it resilient against flood/droughts, clean water for ecosystems, recreation or safe drinking water. Robust methods to measure temporal and spatial patterns of water and contaminant pathways are still lacking. Our research project aims to develop and apply (1) innovative, robust, and environmental-friendly silica-protected iron oxide micro-particles tagged with artificial DNA to trace contaminant movement and travel times of water in natural systems and (2) an innovative coupled model approach to capture dynamics in hydrological pathways and their effects on water quality. The exceptional property of DNA-tagging is the infinite number of unique tracers that can be produced and their detectability at extreme low concentrations. The advantage of the iron-core of the particle is the magnetic harvesting of the particles from water-samples. Such tracers are thought to give the water sector a unique tool for in-situ mapping of transport of contaminants and pathogenic microorganisms in water systems. However, the characteristics of the particle like magnetic property of the iron-core and surface potential of the silica layer, are of key importance for the behaviour of the particle in surface water and in soils. Furthermore, the application of such micro-particles requires strict protocols for the experiment, sampling and laboratory handling which are currently not available. We used two different types of silica-protected DNA-tagged micro-particles. We performed batch, column and flow experiments to assess the behaviour of the particles. We will present the first results of the controlled laboratory experiments for hydrological tracing. We will discuss the results and link it to the differences in particles design. Furthermore, we will draw conclusions and discuss knowledge gaps for future application of silica-protected DNA-tagged micro-particles in hydrological research.

  8. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  9. A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

    Science.gov (United States)

    Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

    1986-09-01

    The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

  10. Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

    Science.gov (United States)

    Richardson, Ruth E.; Suzuki, Yo

    2015-01-01

    Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

  11. Flexible bent rod model with a saturating induced dipole moment to study the electric linear dichroism of DNA fragments

    Directory of Open Access Journals (Sweden)

    Jorge A. Bertolotto

    2016-06-01

    Full Text Available In the present work we make a theoretical study of the steady state electric linear dichroism of DNA fragments in aqueous solution. The here developed theoretical approach considers a flexible bent rod model with a saturating induced dipole moment. The electric polarizability tensor of bent DNA fragments is calculated considering a phenomenological model which theoretical and experimental backgroung is presented here. The model has into account the electric polarizability longitudinal and transversal to the macroion. Molecular flexibility is described using an elastic potential. We consider DNA fragments originally bent with bending fluctuations around an average bending angle. The induced dipole moment is supposed constant once the electric field strength grows up at critical value. To calculate the reduced electric linear dichroism we determine the optical factor considering the basis of the bent DNA perpendicular to the molecular axis. The orientational distribution function has into account the anisotropic electric properties and the molecule flexibility. We applied the present theoretical background to fit electric dichroism experimental data of DNA fragments reported in the bibliography in a wide range of molecular weight and electric field. From these fits, values of DNA physical properties are estimated. We compare and discuss the results here obtained with the theoretical and experimental data presented by other authors. The original contributions of this work are: the inclusion of the transversal electric polarizability saturating with the electric field, the description of the electric properties with an electric polarizability tensor dependant on the bending angle and the use of an arc model originally bent.

  12. DNA fragmentation and apoptosis induced by safranal in human prostate cancer cell line

    Directory of Open Access Journals (Sweden)

    Saeed Samarghandian

    2013-01-01

    Full Text Available Objectives: Apoptosis, an important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus (Saffron in different cancer types. However, limited effort has been made to correlate these effects to the active ingredients of saffron. The present study was designed to elucidate cytotoxic and apoptosis induction by safranal, the major coloring compound in saffron, in a human prostate cancer cell line (PC-3. Materials and Methods: PC-3 and human fetal lung fibroblast (MRC-5 cells were cultured and exposed to safranal (5, 10, 15, and 20 μg/ml. The 3-(4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT assay was performed to assess cytotoxicity. DNA fragmentation was assessed by gel electrophoresis. Cells were incubated with different concentrations of safranal, and cell morphologic changes and apoptosis were determined by the normal inverted microscope, Annexin V, and propidium iodide, followed by flow cytometric analysis, respectively. Results: MTT assay revealed a remarkable and concentration-dependent cytotoxic effect of safranal on PC-3 cells in comparison with non-malignant cell line. The morphologic alterations of the cells confirmed the MTT results. The IC 50 values against PC-3 cells were found to be 13.0 ΁ 0.07 and 6.4 ΁ 0.09 μg/ml at 48 and 72 h, respectively. Safranal induced an early and late apoptosis in the flow cytometry histogram of treated cells, indicating apoptosis is involved in this toxicity. DNA analysis revealed typical ladders as early as 48 and 72 h after treatment, indicative of apoptosis. Conclusions: Our preclinical study demonstrated a prostate cancer cell line to be highly sensitive to safranal-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of safranal action are not clearly understood, it appears to have potential as a therapeutic agent.

  13. Characterization of the linkage disequilibrium structure and identification of tagging-SNPs in five DNA repair genes

    International Nuclear Information System (INIS)

    Allen-Brady, Kristina; Camp, Nicola J

    2005-01-01

    Characterization of the linkage disequilibrium (LD) structure of candidate genes is the basis for an effective association study of complex diseases such as cancer. In this study, we report the LD and haplotype architecture and tagging-single nucleotide polymorphisms (tSNPs) for five DNA repair genes: ATM, MRE11A, XRCC4, NBS1 and RAD50. The genes ATM, MRE11A, and XRCC4 were characterized using a panel of 94 unrelated female subjects (47 breast cancer cases, 47 controls) obtained from high-risk breast cancer families. A similar LD structure and tSNP analysis was performed for NBS1 and RAD50, using publicly available genotyping data. We studied a total of 61 SNPs at an average marker density of 10 kb. Using a matrix decomposition algorithm, based on principal component analysis, we captured >90% of the intragenetic variation for each gene. Our results revealed that three of the five genes did not conform to a haplotype block structure (MRE11A, RAD50 and XRCC4). Instead, the data fit a more flexible LD group paradigm, where SNPs in high LD are not required to be contiguous. Traditional haplotype blocks assume recombination is the only dynamic at work. For ATM, MRE11A and XRCC4 we repeated the analysis in cases and controls separately to determine whether LD structure was consistent across breast cancer cases and controls. No substantial difference in LD structures was found. This study suggests that appropriate SNP selection for an association study involving candidate genes should allow for both mutation and recombination, which shape the population-level genomic structure. Furthermore, LD structure characterization in either breast cancer cases or controls appears to be sufficient for future cancer studies utilizing these genes

  14. Large-scale Identification of Expressed Sequence Tags (ESTs from Nicotianatabacum by Normalized cDNA Library Sequencing

    Directory of Open Access Journals (Sweden)

    Alvarez S Perez

    2014-12-01

    Full Text Available An expressed sequence tags (EST resource for tobacco plants (Nicotianatabacum was established using high-throughput sequencing of randomly selected clones from one cDNA library representing a range of plant organs (leaf, stem, root and root base. Over 5000 ESTs were generated from the 3’ ends of 8000 clones, analyzed by BLAST searches and categorized functionally. All annotated ESTs were classified into 18 functional categories, unique transcripts involved in energy were the largest group accounting for 831 (32.32% of the annotated ESTs. After excluding 2450 non-significant tentative unique transcripts (TUTs, 100 unique sequences (1.67% of total TUTs were identified from the N. tabacum database. In the array result two genes strongly related to the tobacco mosaic virus (TMV were obtained, one basic form of pathogenesis-related protein 1 precursor (TBT012G08 and ubiquitin (TBT087G01. Both of them were found in the variety Hongda, some other important genes were classified into two groups, one of these implicated in plant development like those genes related to a photosynthetic process (chlorophyll a-b binding protein, photosystem I, ferredoxin I and III, ATP synthase and a further group including genes related to plant stress response (ubiquitin, ubiquitin-like protein SMT3, glycine-rich RNA binding protein, histones and methallothionein. The interesting finding in this study is that two of these genes have never been reported before in N. tabacum (ubiquitin-like protein SMT3 and methallothionein. The array results were confirmed using quantitative PCR.

  15. Circulating bacterial-derived DNA fragment level is a strong predictor of cardiovascular disease in peritoneal dialysis patients.

    Directory of Open Access Journals (Sweden)

    Cheuk-Chun Szeto

    Full Text Available Circulating bacterial DNA fragment is related to systemic inflammatory state in peritoneal dialysis (PD patients. We hypothesize that plasma bacterial DNA level predicts cardiovascular events in new PD patients.We measured plasma bacterial DNA level in 191 new PD patients, who were then followed for at least a year for the development of cardiovascular event, hospitalization, and patient survival.The average age was 59.3 ± 11.8 years; plasma bacterial DNA level 34.9 ± 1.5 cycles; average follow up 23.2 ± 9.7 months. At 24 months, the event-free survival was 86.1%, 69.8%, 55.4% and 30.8% for plasma bacterial DNA level quartiles I, II, III and IV, respectively (p < 0.0001. After adjusting for confounders, plasma bacterial DNA level, baseline residual renal function and malnutrition-inflammation score were independent predictors of composite cardiovascular end-point; each doubling in plasma bacterial DNA level confers a 26.9% (95% confidence interval, 13.0 - 42.5% excess in risk. Plasma bacterial DNA also correlated with the number of hospital admission (r = -0.379, p < 0.0001 and duration of hospitalization for cardiovascular reasons (r = -0.386, p < 0.0001. Plasma bacterial DNA level did not correlate with baseline arterial pulse wave velocity (PWV, but with the change in carotid-radial PWV in one year (r = -0.238, p = 0.005.Circulating bacterial DNA fragment level is a strong predictor of cardiovascular event, need of hospitalization, as well as the progressive change in arterial stiffness in new PD patients.

  16. Molecular and FISH analyses of a 53-kbp intact DNA fragment inserted by biolistics in wheat (Triticum aestivum L.) genome.

    Science.gov (United States)

    Partier, A; Gay, G; Tassy, C; Beckert, M; Feuillet, C; Barret, P

    2017-10-01

    A large, 53-kbp, intact DNA fragment was inserted into the wheat ( Triticum aestivum L.) genome. FISH analyses of individual transgenic events revealed multiple insertions of intact fragments. Transferring large intact DNA fragments containing clusters of resistance genes or complete metabolic pathways into the wheat genome remains a challenge. In a previous work, we showed that the use of dephosphorylated cassettes for wheat transformation enabled the production of simple integration patterns. Here, we used the same technology to produce a cassette containing a 44-kb Arabidopsis thaliana BAC, flanked by one selection gene and one reporter gene. This 53-kb linear cassette was integrated in the bread wheat (Triticum aestivum L.) genome by biolistic transformation. Our results showed that transgenic plants harboring the entire cassette were generated. The inheritability of the cassette was demonstrated in the T1 and T2 generation. Surprisingly, FISH analysis performed on T1 progeny of independent events identified double genomic insertions of intact fragments in non-homoeologous positions. Inheritability of these double insertions was demonstrated by FISH analysis of the T1 generation. Relative conclusions that can be drawn from molecular or FISH analysis are discussed along with future prospects of the engineering of large fragments for wheat transformation or genome editing.

  17. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    Science.gov (United States)

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  18. Hairpin and duplex formation in DNA fragments CCAATTTTGG, CCAATTTTTTGG, and CCATTTTTGG: a proton NMR study

    International Nuclear Information System (INIS)

    Pramanik, P.; Kanhouwa, N.; Kan, L.

    1988-01-01

    Three DNA fragments, CCAATTTTGG (1), CCAATTTTTTGG (2), AND CCATTTTTGG (3), were studied by proton NMR spectroscopy in aqueous solution. All these oligodeoxyribonucleotides contain common sequences at the 5' and 3' ends (5'-CCA and TGG-3'). 2 as well as 3 forms only hairpin structures with four unpaired thymidylyl units, four and three base pair stems, respectively, in neutral solution under low and high NaCl concentrations. At high salt concentration the oligomer 1 forms a duplex structure with -TT- internal loop. On the other hand, the same oligomer forms a stable hairpin structure at low salt and low strand concentrations at pH 7. The hairpin structure of 1 has a stem containing only three base pairs (CCA x TGG) and a loop containing four nucleotides (-ATTT-) that includes a dissociated A x T base pair. The two secondary structures of 1 coexist in an aqueous solution containing 0.1 M NaCl, at pH 7. The equilibrium shifts to the hairpin side when the temperature is raised. The stabilities and base-stacking modes of all three oligonucleotides in tow different structures are reported

  19. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  20. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  1. Dissecting the salt dependence of the Tus-Ter protein-DNA complexes by high-throughput differential scanning fluorimetry of a GFP-tagged Tus.

    Science.gov (United States)

    Moreau, Morgane J J; Schaeffer, Patrick M

    2013-12-01

    The analysis of the salt dependence of protein-DNA complexes provides useful information about the non-specific electrostatic and sequence-specific parameters driving complex formation and stability. The differential scanning fluorimetry of GFP-tagged protein (DSF-GTP) assay has been geared with an automatic Tm peak recognition system and was applied for the high-throughput (HT) determination of salt-induced effects on the GFP-tagged DNA replication protein Tus in complex with various Ter and Ter-lock sequences. The system was designed to generate two-dimensional heat map profiles of Tus-GFP protein stability allowing for a comparative study of the effect of eight increasing salt concentrations on ten different Ter DNA species at once. The data obtained with the new HT DSF-GTP allowed precise dissection of the non-specific electrostatic and sequence-specific parameters driving Tus-Ter and Tus-Ter-lock complex formation and stability. The major factor increasing the thermal resistance of Tus-Ter-lock complexes in high-salt is the formation of the TT-lock, e.g. a 10-fold higher Kspe was obtained for Tus-GFP:Ter-lockB than for Tus-GFP:TerB. It is anticipated that the system can be easily adapted for the study of other protein-DNA complexes.

  2. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

    Science.gov (United States)

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-12-01

    A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

  3. A Saccharomyces cerevisiae mitochondrial DNA fragment activates Reg1p-dependent glucose-repressible transcription in the nucleus.

    Science.gov (United States)

    Santangelo, G M; Tornow, J

    1997-12-01

    As part of an effort to identify random carbon-source-regulated promoters in the Saccharomyces cerevisiae genome, we discovered that a mitochondrial DNA fragment is capable of directing glucose-repressible expression of a reporter gene. This fragment (CR24) originated from the mitochondrial genome adjacent to a transcription initiation site. Mutational analyses identified a GC cluster within the fragment that is required for transcriptional induction. Repression of nuclear CR24-driven transcription required Reg1p, indicating that this mitochondrially derived promoter is a member of a large group of glucose-repressible nuclear promoters that are similarly regulated by Reg1p. In vivo and in vitro binding assays indicated the presence of factors, located within the nucleus and the mitochondria, that bind to the GC cluster. One or more of these factors may provide a regulatory link between the nucleus and mitochondria.

  4. Fibered confocal fluorescence microscopy for imaging apoptotic DNA fragmentation at the single-cell level in vivo

    International Nuclear Information System (INIS)

    Al-Gubory, Kais H.

    2005-01-01

    The major characteristic of cell death by apoptosis is the loss of nuclear DNA integrity by endonucleases, resulting in the formation of small DNA fragments. The application of confocal imaging to in vivo monitoring of dynamic cellular events, like apoptosis, within internal organs and tissues has been limited by the accessibility to these sites. Therefore, the aim of the present study was to test the feasibility of fibered confocal fluorescence microscopy (FCFM) to image in situ apoptotic DNA fragmentation in surgically exteriorized sheep corpus luteum in the living animal. Following intra-luteal administration of a fluorescent DNA-staining dye, YO-PRO-1, DNA cleavage within nuclei of apoptotic cells was serially imaged at the single-cell level by FCFM. This imaging technology is sufficiently simple and rapid to allow time series in situ detection and visualization of cells undergoing apoptosis in the intact animal. Combined with endoscope, this approach can be used for minimally invasive detection of fluorescent signals and visualization of cellular events within internal organs and tissues and thereby provides the opportunity to study biological processes in the natural physiological environment of the cell in living animals

  5. Sperm DNA fragmentation index does not correlate with blastocyst aneuploidy or morphological grading.

    Directory of Open Access Journals (Sweden)

    Itai Gat

    Full Text Available High DNA fragmentation index (DFI may be associated with poor outcome after IVF. Our aim was to determine whether DFI impacts blastocyst quality or clinical outcome. This retrospective study included 134 couples who underwent 177 IVF-ICSI and pre-implantation genetic screening (PGS cycles during January 1st, 2014-March 31st, 2016 and had documented previous DFI. Group 1 (DFI>30% encompassed 25 couples who underwent 36 cycles; Group 2 (DFI 15-30% included 45 couples and 57 cycles; group 3 (DFI<15% included 64 couples and 83 cycles. Male partners within group 1 were older (45.1 compared to 40.6 and 38.3 years, respectively, p<0.05, had higher BMI (32.4 compared to 26.6 and 25.8 respectively, p<0.05 and lower sperm count and motility (46*106/ml and 35.5%, respectively compared to groups 2 (61.8*106/ml and 46.6%, respectively and 3 (75.8*106/ml and 55.1%, respectively, p<0.05. Female parameters including ovarian reserve and response and embryo development were similar. Total numbers of biopsied blastocysts were 116, 175 and 259 in groups 1, 2 and 3, respectively. PGS for 24 chromosomes revealed comparable euploidy rate of 46-50.4%, with a similar morphological classification. No significant differences were found regarding pregnancy rates or pregnancy loss. It seems that DFI doesn't correlate with blastocyst aneuploidy or morphological grading.

  6. Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

    Science.gov (United States)

    Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

    2013-01-01

    A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

  7. Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

    Directory of Open Access Journals (Sweden)

    Yuming Lu

    Full Text Available A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments based transient expression system (PCR-TES for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

  8. A polymer, random walk model for the size-distribution of large DNA fragments after high linear energy transfer radiation

    Science.gov (United States)

    Ponomarev, A. L.; Brenner, D.; Hlatky, L. R.; Sachs, R. K.

    2000-01-01

    DNA double-strand breaks (DSBs) produced by densely ionizing radiation are not located randomly in the genome: recent data indicate DSB clustering along chromosomes. Stochastic DSB clustering at large scales, from > 100 Mbp down to simulations and analytic equations. A random-walk, coarse-grained polymer model for chromatin is combined with a simple track structure model in Monte Carlo software called DNAbreak and is applied to data on alpha-particle irradiation of V-79 cells. The chromatin model neglects molecular details but systematically incorporates an increase in average spatial separation between two DNA loci as the number of base-pairs between the loci increases. Fragment-size distributions obtained using DNAbreak match data on large fragments about as well as distributions previously obtained with a less mechanistic approach. Dose-response relations, linear at small doses of high linear energy transfer (LET) radiation, are obtained. They are found to be non-linear when the dose becomes so large that there is a significant probability of overlapping or close juxtaposition, along one chromosome, for different DSB clusters from different tracks. The non-linearity is more evident for large fragments than for small. The DNAbreak results furnish an example of the RLC (randomly located clusters) analytic formalism, which generalizes the broken-stick fragment-size distribution of the random-breakage model that is often applied to low-LET data.

  9. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete: case report

    OpenAIRE

    Vaamonde, D.; Silva-Grigoletto, M.E. Da; Fernandez, J.M.; Algar-Santacruz, C.; García-Manso, J.M.

    2014-01-01

    Objective: The present case study analyzes semen quality, nutritional patterns, and hormonal and oxidative status of an international high-level triathlete with a low-volume, high-intensity training load. Method: The athlete was 26 years old, having participated in competitions since he was 13 years old, and practiced professional triathlon for the last five years. The qualitative sperm parameters analyzed were volume, sperm count, motility, morphology, and DNA fragmentation (additional testi...

  10. Findings on sperm alterations and DNA fragmentation, nutritional, hormonal and antioxidant status in an elite triathlete. Case report

    Directory of Open Access Journals (Sweden)

    D. Vaamonde

    2014-12-01

    Conclusions: In this high-intensity endurance athlete, sperm parameters, mainly sperm morphology and DNA fragmentation, are altered. Further knowledge is needed with regards nutritional antioxidant intake and other dietetic strategies oriented toward avoiding oxidative damage in semen of high-performance triathletes. Moreover, adequate nutritional strategies must be found and nutritional advice given to athletes so as to palliate or dampen the effects of exercise on semen quality.

  11. HYPOLIPEDEMIC EFFECT OF CYNODON DACTYLON ON HISTOPATHOLOGICAL STUDY AND DNA FRAGMENTATION ANALYSIS IN EXPERIMENTALLY INDUCED HYPERCHOLESTEREMIC RATS

    OpenAIRE

    C. Selva Kumar

    2011-01-01

    Hypercholesteremia is one of the risk factors for coronary artery disease. The present study highlights the efficacy of Ayurvedic herbal formulation Cynodon dactylon (Bermuda grass) on histopathological study and DNA fragmentation analysis in experimentally induced hypercholesteremic rats. Four groups of rats were employed namely control, hypercholesterolemia rats (4% Cholesterol+1% cholic acid), Cynodon dactylon treatment in hypercholesteremic rats and Cynodon dactylon alone treated rats. Re...

  12. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  13. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  14. Preparation of methacrylate-based anion-exchange monolithic microbore column for chromatographic separation of DNA fragments and oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Sabarudin, Akhmad, E-mail: sabarjpn@ub.ac.id [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Department of Chemistry, Faculty of Science, Brawijaya University, Jl Veteran Malang 65145 (Indonesia); Huang, Junchao; Shu, Shin; Sakagawa, Shinnosuke [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan); Umemura, Tomonari, E-mail: umemura@apchem.nagoya-u.ac.jp [Division of Nano-materials Science, EcoTopia Science Institute, Nagoya University, Furu-Cho, Chikusa-Ku, Nagoya 464-8603 (Japan)

    2012-07-29

    Highlights: Black-Right-Pointing-Pointer Microbore-scale (1 mm i.d.) anion-exchange monolithic column. Black-Right-Pointing-Pointer Potentially preparative applications. Black-Right-Pointing-Pointer Separation of oligodeoxythymidylic acids and DNA fragments. - Abstract: In this paper, we report on the preparation of a microbore-scale (1 mm i.d.) anion-exchange monolithic column suitable not only for analytical purposes but also for potentially preparative applications. In order to meet the conflicting requirements of high permeability and good mechanical strength, the following two-step procedure was applied. First, an epoxy-containing monolith was synthesized by in situ copolymerization of glycidyl methacrylate (GMA) and ethylene dimethacrylate (EDMA) within the confines of a silicosteel tubing of 1.02 mm i.d. and 1/16 Double-Prime o.d. in the presence of a ternary porogenic mixture of 1-propanol, 1,4-butanediol, and water. The monolithic matrix was subsequently converted into weak anion-exchanger via the ring-opening reaction of epoxy group with diethyl amine. The dynamic binding capacity was 21.4 mg mL{sup -1} for bovine serum albumin (BSA) at 10% breakthrough. The morphology and porous structure of this monolith were assessed by scanning electron microscope (SEM) and inverse size exclusion chromatography (ISEC). To optimize the separation efficiency, the effects of various chromatographic parameters upon the separation of DNA fragments were investigated. The resulting monolithic anion exchanger demonstrated good potential for the separation of both single- and double-stranded DNA molecules using a gradient elution with NaCl in Tris-HCl buffer (20 mM). Oligodeoxythymidylic acids (dT{sub 12}-dT{sub 18}) were successfully resolved at pH 8, while the fragments of 20 bp DNA ladder, 100 bp DNA ladder, and pBR322-HaeIII digest were efficiently separated at pH 9.

  15. Screening and identification of male-specific DNA fragments in common carps Cyprinus carpio using suppression subtractive hybridization.

    Science.gov (United States)

    Chen, J J; Du, Q Y; Yue, Y Y; Dang, B J; Chang, Z J

    2010-08-01

    In this study, a sex subtractive genomic DNA library was constructed using suppression subtractive hybridization (SSH) between male and female Cyprinus carpio. Twenty-two clones with distinguishable hybridization signals were selected and sequenced. The specific primers were designed based on the sequence data. Those primers were then used to amplify the sex-specific fragments from the genomic DNA of male and female carp. The amplified fragments from two clones showed specificity to males but not to females, which were named as Ccmf2 [387 base pairs (bp)] and Ccmf3 (183 bp), respectively. The sex-specific pattern was analysed in a total of 40 individuals from three other different C. carpio. stocks and grass carp Ctenopharyngodon idella using Ccmf2 and Ccmf3 as dot-blotting probes. The results revealed that the molecular diversity exists on the Y chromosome of C. carpio. No hybridization signals, however, were detected from individuals of C. idella, suggesting that the two sequences are specific to C. carpio. No significant homologous sequences of Ccmf2 and Ccmf3 were found in GenBank. Therefore, it was interpreted that the results as that Ccmf2 and Ccmf3 are two novel male-specific sequences; and both fragments could be used as markers to rapidly and accurately identify the genetic sex of part of C. carpio. This may provide a very efficient selective tool for practically breeding monosex female populations in aquacultural production.

  16. Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

    Science.gov (United States)

    Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

    1974-01-01

    By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

  17. Candidate DNA Barcode Tags Combined With High Resolution Melting (Bar-HRM Curve Analysis for Authentication of Senna alexandrina Mill. With Validation in Crude Drugs

    Directory of Open Access Journals (Sweden)

    Priyanka Mishra

    2018-03-01

    Full Text Available Senna alexandrina (Fabaceae is a globally recognized medicinal plant for its laxative properties as well as the only source of sennosides, and is highly exported bulk herb from India. Its major procurement is exclusively from limited cultivation, which leads to risks of deliberate or unintended adulteration. The market raw materials are in powdered or finished product form, which lead to difficulties in authentication. Here, DNA barcode tags based on chloroplast genes (rbcL and matK and intergenic spacers (psbA-trnH and ITS were developed for S. alexandrina along with the allied species. The ability and performance of the ITS1 region to discriminate among the Senna species resulted in the present proposal of the ITS1 tags as successful barcode. Further, these tags were coupled with high-resolution melting (HRM curve analysis in a real-time PCR genotyping method to derive Bar-HRM (Barcoding-HRM assays. Suitable HRM primer sets were designed through SNP detection and mutation scanning in genomic signatures of Senna species. The melting profiles of S. alexandrina and S. italica subsp. micrantha were almost identical and the remaining five species were clearly separated so that they can be differentiated by HRM method. The sensitivity of the method was utilized to authenticate market samples [Herbal Sample Assays (HSAs]. HSA01 (S. alexandrina crude drug sample from Bangalore and HSA06 (S. alexandrina crude drug sample from Tuticorin, Tamil Nadu, India were found to be highly contaminated with S. italica subsp. micrantha. Species admixture samples mixed in varying percentage was identified sensitively with detection of contamination as low as 1%. The melting profiles of PCR amplicons are clearly distinct, which enables the authentic differentiation of species by the HRM method. This study reveals that DNA barcoding coupled with HRM is an efficient molecular tool to authenticate Senna herbal products in the market for quality control in the drug

  18. Candidate DNA Barcode Tags Combined With High Resolution Melting (Bar-HRM) Curve Analysis for Authentication of Senna alexandrina Mill. With Validation in Crude Drugs.

    Science.gov (United States)

    Mishra, Priyanka; Shukla, Ashutosh K; Sundaresan, Velusamy

    2018-01-01

    Senna alexandrina (Fabaceae) is a globally recognized medicinal plant for its laxative properties as well as the only source of sennosides, and is highly exported bulk herb from India. Its major procurement is exclusively from limited cultivation, which leads to risks of deliberate or unintended adulteration. The market raw materials are in powdered or finished product form, which lead to difficulties in authentication. Here, DNA barcode tags based on chloroplast genes ( rbcL and matK ) and intergenic spacers ( psbA-trnH and ITS ) were developed for S. alexandrina along with the allied species. The ability and performance of the ITS1 region to discriminate among the Senna species resulted in the present proposal of the ITS1 tags as successful barcode. Further, these tags were coupled with high-resolution melting (HRM) curve analysis in a real-time PCR genotyping method to derive Bar-HRM (Barcoding-HRM) assays. Suitable HRM primer sets were designed through SNP detection and mutation scanning in genomic signatures of Senna species. The melting profiles of S. alexandrina and S . italica subsp. micrantha were almost identical and the remaining five species were clearly separated so that they can be differentiated by HRM method. The sensitivity of the method was utilized to authenticate market samples [Herbal Sample Assays (HSAs)]. HSA01 ( S. alexandrina crude drug sample from Bangalore) and HSA06 ( S. alexandrina crude drug sample from Tuticorin, Tamil Nadu, India) were found to be highly contaminated with S . italica subsp. micrantha . Species admixture samples mixed in varying percentage was identified sensitively with detection of contamination as low as 1%. The melting profiles of PCR amplicons are clearly distinct, which enables the authentic differentiation of species by the HRM method. This study reveals that DNA barcoding coupled with HRM is an efficient molecular tool to authenticate Senna herbal products in the market for quality control in the drug supply

  19. Use of testicular sperm for intracytoplasmic sperm injection in men with high sperm DNA fragmentation: a SWOT analysis.

    Science.gov (United States)

    Esteves, Sandro C; Roque, Matheus; Garrido, Nicolás

    2018-01-01

    Spermatozoa retrieved from the testis of men with high levels of sperm DNA fragmentation (SDF) in the neat semen tend to have better DNA quality. Given the negative impact of SDF on the outcomes of Assisted Reproductive Technology (ART), an increased interest has emerged about the use of testicular sperm for intracytoplasmic sperm injection (Testi-ICSI). In this article, we used a SWOT (strengths, weaknesses, opportunities, and threats) analysis to summarize the advantages and drawbacks of this intervention. The rationale of Testi-ICSI is bypass posttesticular DNA fragmentation caused by oxidative stress during sperm transit through the epididymis. Hence, oocyte fertilization by genomically intact testicular spermatozoa may be optimized, thus increasing the chances of creating a normal embryonic genome and the likelihood of achieving a live birth, as recently demonstrated in men with high SDF. However, there is still limited evidence as regards the clinical efficacy of Testi-ICSI, thus creating opportunities for further confirmatory clinical research as well as investigation of Testi-ICSI in clinical scenarios other than high SDF. Furthermore, Testi-ICSI can be compared to other laboratory preparation methods for deselecting sperm with damaged DNA. At present, the available literature supports the use of testicular sperm when performing ICSI in infertile couples whose male partners have posttesticular SDF. Due to inherent risks of sperm retrieval, Testi-ICSI should be offered when less invasive treatments for alleviating DNA damage have failed. A call for continuous monitoring is nonetheless required concerning the health of generated offspring and the potential complications of sperm retrieval.

  20. EFFECT OF PROSTATILEN® AC ON SPERM DNA FRAGMENTATION DURING TREATMENT OF PATIENTS WITH CHRONIC NONBACTERIAL PROSTATITIS AND CONCOMITANT DISORDERS OF THE REPRODUCTIVE FUNCTION

    Directory of Open Access Journals (Sweden)

    S. Yu. Borovets

    2017-01-01

    Full Text Available The study objective is to analyze the effect of Prostatilen® AC on sperm DNA fragmentation during treatment of patients with chronic nonbacterial prostatitis and concomitant disorders of the reproductive function.Materials and methods. The study is based on the results of treatment of 25 men aged 24 to 45 years (mean age 35.3 ± 4.4 years with a verified diagnosis of chronic nonbacterial prostatitis and complaints of early-stage missed miscarriage in a spouse/sexual partner. All patients received Prostatilen® AC daily in rectal suppositories formulation. The duration of treatment was 10 days with retreatment after 20 days. In all patients before treatment and 20 days after it, spermiogram parameters (5th ed., WHO, 2010 and sperm DNA fragmentation level using SCSA (sperm chromatin structure assay by FACSCantoll with monoclonal antibodies (Roche, Germany were determined, and all patients underwent the MAR (mixed antiglobulin reaction test with normal value considered to be 10 % or less. The normal value of sperm DNA fragmentation was considered to be 15 % or less (low risk of fertility impairment. The analysis of the obtained data was carried out using the IBM SPSS Statistics program 22.Results. Before the treatment, pathologic level of sperm DNA fragmentation was observed in 6 (43 % of 14 patients with normozoospermia and in 7 (63 % of 11 patients with pathozoospermia (χ² = 1.06; p <0.3. Thus, there weren’t any significant difference between the rates of occurrence of increased sperm DNA fragmentation in patients with normo- and pathozoospermia. A correlation was found between the level of sperm DNA fragmentation and the results of MAR test before treatment (r = 0.8, p <0.05, which varied between 0 and 99 % (mean 16.48 ± 31.64 %. Meanwhile, increased sperm DNA fragmentation was observed in 7 (53 % of 13 patients with pathological MAR test results, and in 2 (40 % of 5 patients with normal MAR test results (χ² = 0.67; p <0.01. The level

  1. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.

  2. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  3. Excessive cytosolic DNA fragments as a potential trigger of Graves’ disease: an encrypted message sent by animal models

    Directory of Open Access Journals (Sweden)

    Yuqian Luo

    2016-11-01

    Full Text Available Graves’ hyperthyroidism is caused by autoantibodies directed against the thyroid stimulating hormone receptor (TSHR that mimic the action of TSH. The establishment of Graves’ hyperthyroidism in experimental animals has proven to be an important approach to dissect the mechanisms of self-tolerance breakdown that lead to the production of thyroid-stimulating TSHR autoantibodies (TSAbs. ‘Shimojo’s model was the first successful Graves’ animal model, wherein immunization with fibroblasts cells expressing TSHR and a major histocompatibility complex (MHC class II molecule, but not either alone, induced TSAb production in AKR/N (H-2k mice. This model highlights the importance of coincident MHC class II expression on TSHR-expressing cells in the development of Graves’ hyperthyroidism. These data are also in agreement with the observation that Graves’ thyrocytes often aberrantly express MHC class II antigens via mechanisms that remain unclear. Our group demonstrated that cytosolic self-genomic DNA fragments derived from sterile injured cells can induce aberrant MHC class II expression and production of multiple inflammatory cytokines and chemokines in thyrocytes in vitro, suggesting that severe cell injury may initiate immune responses in a way that is relevant to thyroid autoimmunity mediated by cytosolic DNA signaling. Furthermore, more recent successful Graves’ animal models were primarily established by immunizing mice with TSHR-expressing plasmids or adenovirus. In these models, double-stranded DNA vaccine contents presumably exert similar immune-activating effect in cells at inoculation sites and thus might pave the way toward successful Graves’ animal models. This review focuses on evidence suggesting that cell injury-derived self-DNA fragments could act as Graves’ disease triggers.

  4. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    International Nuclear Information System (INIS)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet

    2014-01-01

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process

  5. Absence of superoxide dismutase activity causes nuclear DNA fragmentation during the aging process

    Energy Technology Data Exchange (ETDEWEB)

    Muid, Khandaker Ashfaqul; Karakaya, Hüseyin Çaglar; Koc, Ahmet, E-mail: ahmetkoc@iyte.edu.tr

    2014-02-07

    Highlights: • Aging process increases ROS accumulation. • Aging process increases DNA damage levels. • Absence of SOD activity does not cause DNA damage in young cells. • Absence of SOD activity accelerate aging and increase oxidative DNA damages during the aging process. - Abstract: Superoxide dismutases (SOD) serve as an important antioxidant defense mechanism in aerobic organisms, and deletion of these genes shortens the replicative life span in the budding yeast Saccharomyces cerevisiae. Even though involvement of superoxide dismutase enzymes in ROS scavenging and the aging process has been studied extensively in different organisms, analyses of DNA damages has not been performed for replicatively old superoxide dismutase deficient cells. In this study, we investigated the roles of SOD1, SOD2 and CCS1 genes in preserving genomic integrity in replicatively old yeast cells using the single cell comet assay. We observed that extend of DNA damage was not significantly different among the young cells of wild type, sod1Δ and sod2Δ strains. However, ccs1Δ mutants showed a 60% higher amount of DNA damage in the young stage compared to that of the wild type cells. The aging process increased the DNA damage rates 3-fold in the wild type and more than 5-fold in sod1Δ, sod2Δ, and ccs1Δ mutant cells. Furthermore, ROS levels of these strains showed a similar pattern to their DNA damage contents. Thus, our results confirm that cells accumulate DNA damages during the aging process and reveal that superoxide dismutase enzymes play a substantial role in preserving the genomic integrity in this process.

  6. Single-Cell-Based Platform for Copy Number Variation Profiling through Digital Counting of Amplified Genomic DNA Fragments.

    Science.gov (United States)

    Li, Chunmei; Yu, Zhilong; Fu, Yusi; Pang, Yuhong; Huang, Yanyi

    2017-04-26

    We develop a novel single-cell-based platform through digital counting of amplified genomic DNA fragments, named multifraction amplification (mfA), to detect the copy number variations (CNVs) in a single cell. Amplification is required to acquire genomic information from a single cell, while introducing unavoidable bias. Unlike prevalent methods that directly infer CNV profiles from the pattern of sequencing depth, our mfA platform denatures and separates the DNA molecules from a single cell into multiple fractions of a reaction mix before amplification. By examining the sequencing result of each fraction for a specific fragment and applying a segment-merge maximum likelihood algorithm to the calculation of copy number, we digitize the sequencing-depth-based CNV identification and thus provide a method that is less sensitive to the amplification bias. In this paper, we demonstrate a mfA platform through multiple displacement amplification (MDA) chemistry. When performing the mfA platform, the noise of MDA is reduced; therefore, the resolution of single-cell CNV identification can be improved to 100 kb. We can also determine the genomic region free of allelic drop-out with mfA platform, which is impossible for conventional single-cell amplification methods.

  7. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by Ruta graveolens in human colon cancer cells.

    Science.gov (United States)

    Arora, Shagun; Tandon, Simran

    2015-01-01

    In the present study, we investigated the anti-cancer effect of various potencies of Ruta graveolens (Ruta) on COLO-205 cell line, as evidenced by cytotoxicity, migration, clonogenecity, morphological and biochemical changes and modification in the levels of genes associated with apoptosis and cell cycle. On treatment of COLO-205 cells maximal effects were seen with mother tincture (MT) and 30C potencies, wherein decrease in cell viability along with reduced clonogenecity and migration capabilities were noted. In addition morphological and biochemical alterations such as nuclear changes (fragmented nuclei with condensed chromatin) and DNA ladder-like pattern (increased amount of fragmented DNA) in COLO-205 cells indicating apoptotic related cell death were seen. The expression of apoptosis and cell-cycle related regulatory genes assessed by reverse transcriptase-PCR revealed an up-regulation of caspase 9, caspase-3, Bax, p21 and p27 expression and down-regulation of Bcl-2 expression in treated cells. The mode of cell death was suggestive of intrinsic apoptotic pathway along with cell cycle arrest at the G2/M of the cell cycle. Our findings indicate that phytochemicals present in Ruta showed potential for natural therapeutic product development for colon carcinoma. Copyright © 2014 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

  8. IRMA iterative relaxation matrix approach for NMR structure determination application to DNA fragments

    International Nuclear Information System (INIS)

    Koning, M.M.G.

    1990-01-01

    The subject of this thesis is the structure determination of DNA molecules in solution with the use of NMR. For this purpose a new relaxation matrix approach is introduced. The emphasis is on the interpretation of nuclear Overhauser effects (NOEs) in terms of proton-proton distances and related three dimensional structures. The DNA molecules studied are obligonucleotides, unmodifief as well as modified molecules bu UV radiation. From comparison with unmodified molecules it turned out that UV irradiation scarcely influences the helical structure of the DNA string. At one place of the string a nucleotide is rotated towards the high-ANTI conformation which results in a slight unwinding of the DNA string but sufficient for blocking of the normal reading of genetic information. (H.W.). 456 refs.; 50 figs.; 30 tabs

  9. Unusual structures are present in DNA fragments containing super-long Huntingtin CAG repeats.

    Directory of Open Access Journals (Sweden)

    Daniel Duzdevich

    2011-02-01

    Full Text Available In the R6/2 mouse model of Huntington's disease (HD, expansion of the CAG trinucleotide repeat length beyond about 300 repeats induces a novel phenotype associated with a reduction in transcription of the transgene.We analysed the structure of polymerase chain reaction (PCR-generated DNA containing up to 585 CAG repeats using atomic force microscopy (AFM. As the number of CAG repeats increased, an increasing proportion of the DNA molecules exhibited unusual structural features, including convolutions and multiple protrusions. At least some of these features are hairpin loops, as judged by cross-sectional analysis and sensitivity to cleavage by mung bean nuclease. Single-molecule force measurements showed that the convoluted DNA was very resistant to untangling. In vitro replication by PCR was markedly reduced, and TseI restriction enzyme digestion was also hindered by the abnormal DNA structures. However, significantly, the DNA gained sensitivity to cleavage by the Type III restriction-modification enzyme, EcoP15I."Super-long" CAG repeats are found in a number of neurological diseases and may also appear through CAG repeat instability. We suggest that unusual DNA structures associated with super-long CAG repeats decrease transcriptional efficiency in vitro. We also raise the possibility that if these structures occur in vivo, they may play a role in the aetiology of CAG repeat diseases such as HD.

  10. Alkaline DNA fragmentation, DNA disentanglement evaluated viscosimetrically and sister chromatid exchanges, after treatment in vivo with nitrofurantoin.

    Science.gov (United States)

    Parodi, S; Pala, M; Russo, P; Balbi, C; Abelmoschi, M L; Taningher, M; Zunino, A; Ottaggio, L; de Ferrari, M; Carbone, A; Santi, L

    1983-07-01

    Nitrofurantoin was not positive as a carcinogen in long term assays. In vitro it was positive in some short term tests and negative in others. We have examined Nitrofurantoin for its capability of inducing DNA damage in vivo. With the alkaline elution technique, Nitrofurantoin appeared clearly positive in all the tissues examined (liver, kidney, lung, spleen and bone marrow). In the liver we also observed some cross-linking effect. In bone marrow cells Nitrofurantoin was also clearly positive in terms of sister chromatid exchanges (SCEs) induction. DNA damage in vivo was also examined with a viscosimetric method, more sensitive than alkaline elution. With this method the results were essentially negative, suggesting that the two methods detect different types of damage. In view of its positivity in many organs and in two short term tests in vivo, the carcinogenic potential of Nitrofurantoin should be reconsidered.

  11. Positive and negative ion mode comparison for the determination of DNA/peptide noncovalent binding sites through the formation of "three-body" noncovalent fragment ions.

    Science.gov (United States)

    Brahim, Bessem; Tabet, Jean-Claude; Alves, Sandra

    2018-02-01

    Gas-phase fragmentation of single strand DNA-peptide noncovalent complexes is investigated in positive and negative electrospray ionization modes.Collision-induced dissociation experiments, performed on the positively charged noncovalent complex precursor ions, have confirmed the trend previously observed in negative ion mode, i.e. a high stability of noncovalent complexes containing very basic peptidic residues (i.e. R > K) and acidic nucleotide units (i.e. Thy units), certainly incoming from the existence of salt bridge interactions. Independent of the ion polarity, stable noncovalent complex precursor ions were found to dissociate preferentially through covalent bond cleavages of the partners without disrupting noncovalent interactions. The resulting DNA fragment ions were found to be still noncovalently linked to the peptides. Additionally, the losses of an internal nucleic fragment producing "three-body" noncovalent fragment ions were also observed in both ion polarities, demonstrating the spectacular salt bridge interaction stability. The identical fragmentation patterns (regardless of the relative fragment ion abundances) observed in both polarities have shown a common location of salt bridge interaction certainly preserved from solution. Nonetheless, most abundant noncovalent fragment ions (and particularly three-body ones) are observed from positively charged noncovalent complexes. Therefore, we assume that, independent of the preexisting salt bridge interaction and zwitterion structures, multiple covalent bond cleavages from single-stranded DNA/peptide complexes rely on an excess of positive charges in both electrospray ionization ion polarities.

  12. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  13. Expansion during PCR of short single-stranded DNA fragments carrying nonselfcomplementary dinucleotide or trinucleotide repeats

    Czech Academy of Sciences Publication Activity Database

    Reichová, Naďa; Kypr, Jaroslav

    2003-01-01

    Roč. 30, č. 3 (2003), s. 155-163 ISSN 0301-4851 R&D Projects: GA ČR GA301/01/0590 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA * PCR * expansion Subject RIV: BO - Biophysics Impact factor: 0.565, year: 2003

  14. Solution structure of a short dna fragment studied by neutron scattering

    DEFF Research Database (Denmark)

    Lederer, H.; May, R. P.; Kjems, Jørgen

    1986-01-01

    -DNA. The neutron scattering curve is well fitted by that of a rigid rod with a length of 44 nm and a diameter of 2 nm. The result were confirmed by quasi-elastic light scattering and analytical centrifugation. The neutron measurements in H2O and D2O buffer reveal a cross-sectional in homogeneity not detected by X...

  15. i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions

    Czech Academy of Sciences Publication Activity Database

    Dvořáková, Zuzana; Renčiuk, Daniel; Kejnovská, Iva; Školáková, Petra; Bednářová, Klára; Sagi, J.; Vorlíčková, Michaela

    2018-01-01

    Roč. 46, č. 4 (2018), s. 1624-1634 ISSN 1362-4962 R&D Projects: GA ČR(CZ) GA15-06785S; GA ČR GA17-12075S; GA ČR(CZ) GJ17-19170Y; GA MŠk EF15_003/0000477 Institutional support: RVO:68081707 Keywords : pair opening kinetics * g-quadruplex dna Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology

  16. [Comet assay of DNA fragmentation: modification of silver staining for obtaining permanent preparations].

    Science.gov (United States)

    Kamins'kyĭ, V O; Lutsyk, M D; Stoĭka, R S

    2005-01-01

    Modification of comet analysis is proposed for obtaining permanent preparations by DNA staining with silver compounds. The sensitivity of staining is similar to that observed at the treatment by ethidium bromide and other fluorochromes. The advantages of the method are stability of slides and possibility of their reinvestigation by light microscopy. The method does not need expensive fluorescent microscope and lacks contacting with carcinogenic compounds and UV light irradiation.

  17. Quantification of apoptotic DNA fragmentation in a transformed uterine epithelial cell line, HRE-H9, using capillary electrophoresis with laser-induced fluorescence detector (CE-LIF).

    Science.gov (United States)

    Fiscus, R R; Leung, C P; Yuen, J P; Chan, H C

    2001-01-01

    Apoptotic cell death of uterine epithelial cells is thought to play an important role in the onset of menstruation and the successful implantation of an embryo during early pregnancy. Abnormal apoptosis in these cells can result in dysmenorrhoea and infertility. In addition, decreased rate of epithelial apoptosis likely contributes to endometriosis. A key step in the onset of apoptosis in these cells is cleavage of the genomic DNA between nucleosomes, resulting in polynucleosomal-sized fragments of DNA. The conventional technique for assessing apoptotic DNA fragmentation uses agarose (slab) gel electrophoresis (i.e. DNA laddering). However, recent technological advances in the use of capillary electrophoresis (CE), particularly the introduction of the laser-induced fluorescence detector (LIF), has made it possible to perform DNA laddering with improved automation and much greater sensitivity. In the present study, we have further developed the CE-LIF technique by using a DNA standard curve to quantify accurately the amount of DNA in the apoptotic DNA fragments and have applied this new quantitative technique to study apoptosis in a transformed uterine epithelial cell line, the HRE-H9 cells. Apoptosis was induced in the HRE-H9 cells by serum deprivation for 5, 7 and 24 h, resulting in increased DNA fragmentation of 2.2-, 3.1- and 6.2-fold, respectively, above the 0 h or plus-serum controls. This ultrasensitive CE-LIF technique provides a novel method for accurately measuring the actions of pro- or anti-apoptotic agents or conditions on uterine epithelial cell lines. Copyright 2001 Academic Press.

  18. [Value of specific 16S rDNA fragment of algae in diagnosis of drowning: an experiment with rabbits].

    Science.gov (United States)

    Li, Peng; Xu, Qu-Yi; Chen, Ling; Liu, Chao; Zhao, Jian; Wang, Yu-Zhong; Yu, Zheng-Liang; Hu, Sun-Lin; Wang, Hui-Jun

    2015-08-01

    To establish a method for amplifying specific 16S rDNA fragment of algae related with drowning and test its value in drowning diagnosis. Thirty-five rabbits were randomly divided into 3 the drowning group (n=15), postmortem water immersion group (n=15, subjected to air embolism before seawater immersion), and control group(n=5, with air embolism only). Twenty samples of the liver tissues from human corpses found in water were also used, including 14 diatom-positive and 6 diatom-negative samples identified by microwave digestion-vacuum filtration-automated scanning electron microscopy (MD-VF-Auto SEM). Seven known species of algae served as the control algae (Melosira sp, Nitzschia sp, Synedra sp, Navicula sp, Microcystis sp, Cyclotella meneghiniana, and Chlorella sp). The total DNA was extracted from the tissues and algae to amplify the specific fragment of algae followed by 8% polyacrylamide gelelectrophoresis and sliver-staining. In the drowning group, algae was detected in the lungs (100%), liver (86%), and kidney (86%); algae was detected in the lungs in 2 rabbits in the postmortem group (13%) and none in the control group. The positivity rates of algae were significantly higher in the drowning group than in the postmortem group (Palgae, including sample that had been identified as diatom-negative by MD-VF-Auto SEM. All the 7 control algae samples yielded positive results in PCR. The PCR-based method has a high sensitivity in algae detection for drowning diagnosis and allows simultaneous detection of multiple algae species related with drowning.

  19. Protective effects of Opuntia ficus-indica extract on ram sperm quality, lipid peroxidation and DNA fragmentation during liquid storage.

    Science.gov (United States)

    Allai, Larbi; Druart, Xavier; Öztürk, Mehmet; BenMoula, Anass; Nasser, Boubker; El Amiri, Bouchra

    2016-12-01

    The present study aimed to assess the phenolic composition of the acetone extract from Opuntia ficus indica cladodes (ACTEX) and its effects on ram semen variables, lipid peroxidation and DNA fragmentation during liquid storage at 5°C for up to 72h in skim milk and Tris egg yolk extenders. Semen samples from five rams were pooled extended with Tris-egg yolk (TEY) or skim milk (SM) extenders containing ACTEX (0%, 1%, 2%, 4% and 8%) at a final concentration of 0.8×10 9 sperm/ml and stored for up to 72h at 5°C. The sperm variables were evaluated at different time periods (8, 24, 48 and 72h). Sperm total motility and viability were superior in TEY than in SM whereas the progressive motility, membrane integrity, abnormality and spontaneous lipid peroxidation were greater in SM compared to TEY (P<0.05). The results also indicated that the inclusion of 1% ACTEX in the SM or TEY extender increased the sperm motility, viability, membrane integrity, and decreased the abnormality, lipids peroxidation up to 72h in storage compared to control group. Similarly, even at 72h of storage, 1% ACTEX can efficiently decrease the negative effects of liquid storage on sperm DNA fragmentation (P<0.05). In conclusion, SM and TEY supplemented with 1% of ACTEX can improve the quality of ram semen. Further studies are required to identify the active components in ACTEX involved in its effect on ram sperm preservation. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. [Applylication of new type combined fragments: nrDNA ITS+ nad 1-intron 2 for identification of Dendrobium species of Fengdous].

    Science.gov (United States)

    Geng, Li-xia; Zheng, Rui; Ren, Jie; Niu, Zhi-tao; Sun, Yu-long; Xue, Qing-yun; Liu, Wei; Ding, Xiao-yu

    2015-08-01

    In this study, 17 kinds of Dendrobium species of Fengdous including 39 individuals were collected from 4 provinces. Mitochondrial gene sequences co I, nad 5, nad 1-intron 2 and chloroplast gene sequences rbcL, matK amd psbA-trnH were amplified from these materials, as well as nrDNA ITS. Furthermore, suitable sequences for identification of Dendrobium species of Fengdous were screened by K-2-P and P-distance. The results showed that during the mentioned 7 sequences, nrDNA ITS, nad 1-intron 2 and psbA-trnH which had a high degree of variability could be used to identify Dendrobium species of Fengdous. However, single fragment could not be used to distinguish D. moniliforme and D. huoshanense. Moreover, compared to other combined fragments, new type combined fragments nrDNA ITS+nad 1-intron 2 was more effective in identifying the original plants of Dendrobium species and could be used to identify D. huoshanense and D. moniliforme. Besides, according to the UPGMA tree constructed with nrDNA ITS+nad 1-intron 2, 3 inspected Dendrobium plants were identified as D. huoshanense, D. moniliforme and D. officinale, respectively. This study identified Dendrobium species of Fengdous by combined fragments nrDNA ITS+nad 1-intron 2 for the first time, which provided a more effective basis for identification of Dendrobium species. And this study will be helpful for regulating the market of Fengdous.

  1. Effects of cyanoacrylate fuming, time after recovery, and location of biological material on the recovery and analysis of DNA from post-blast pipe bomb fragments*.

    Science.gov (United States)

    Bille, Todd W; Cromartie, Carter; Farr, Matthew

    2009-09-01

    This study investigated the effects of time, cyanoacrylate fuming, and location of the biological material on DNA analysis of post-blast pipe bomb fragments. Multiple aliquots of a cell suspension (prepared by soaking buccal swabs in water) were deposited on components of the devices prior to assembly. The pipe bombs were then deflagrated and the fragments recovered. Fragments from half of the devices were cyanoacrylate fumed. The cell spots on the fragments were swabbed and polymerase chain reaction/short tandem repeat analysis was performed 1 week and 3 months after deflagration. A significant decrease in the amount of DNA recovered was observed between samples collected and analyzed within 1 week compared with the samples collected and analyzed 3 months after deflagration. Cyanoacrylate fuming did not have a measurable effect on the success of the DNA analysis at either time point. Greater quantities of DNA were recovered from the pipe nipples than the end caps. Undeflagrated controls showed that the majority (>95%) of the DNA deposited on the devices was not recovered at a week or 3 months.

  2. An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library

    Directory of Open Access Journals (Sweden)

    Wallis James G

    2007-07-01

    Full Text Available Abstract Background Castor seeds are a major source for ricinoleate, an important industrial raw material. Genomics studies of castor plant will provide critical information for understanding seed metabolism, for effectively engineering ricinoleate production in transgenic oilseeds, or for genetically improving castor plants by eliminating toxic and allergic proteins in seeds. Results Full-length cDNAs are useful resources in annotating genes and in providing functional analysis of genes and their products. We constructed a full-length cDNA library from developing castor endosperm, and obtained 4,720 ESTs from 5'-ends of the cDNA clones representing 1,908 unique sequences. The most abundant transcripts are genes encoding storage proteins, ricin, agglutinin and oleosins. Several other sequences are also very numerous, including two acidic triacylglycerol lipases, and the oleate hydroxylase (FAH12 gene that is responsible for ricinoleate biosynthesis. The role(s of the lipases in developing castor seeds are not clear, and co-expressing of a lipase and the FAH12 did not result in significant changes in hydroxy fatty acid accumulation in transgenic Arabidopsis seeds. Only one oleate desaturase (FAD2 gene was identified in our cDNA sequences. Sequence and functional analyses of the castor FAD2 were carried out since it had not been characterized previously. Overexpression of castor FAD2 in a FAH12-expressing Arabidopsis line resulted in decreased accumulation of hydroxy fatty acids in transgenic seeds. Conclusion Our results suggest that transcriptional regulation of FAD2 and FAH12 genes maybe one of the mechanisms that contribute to a high level of ricinoleate accumulation in castor endosperm. The full-length cDNA library will be used to search for additional genes that affect ricinoleate accumulation in seed oils. Our EST sequences will also be useful to annotate the castor genome, which whole sequence is being generated by shotgun sequencing at

  3. Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

    Science.gov (United States)

    Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

    2013-12-01

    Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Science.gov (United States)

    Liu, Changqing; Liu, Dan; Guo, Yu; Lu, Taofeng; Li, Xiangchen; Zhang, Minghai; Ma, Jianzhang; Ma, Yuehui; Guan, Weijun

    2013-01-01

    In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers. PMID:23708105

  5. Construction of a Full-Length Enriched cDNA Library and Preliminary Analysis of Expressed Sequence Tags from Bengal Tiger Panthera tigris tigris

    Directory of Open Access Journals (Sweden)

    Changqing Liu

    2013-05-01

    Full Text Available In this study, a full-length enriched cDNA library was successfully constructed from Bengal tiger, Panthera tigris tigris, the most well-known wild Animal. Total RNA was extracted from cultured Bengal tiger fibroblasts in vitro. The titers of primary and amplified libraries were 1.28 × 106 pfu/mL and 1.56 × 109 pfu/mL respectively. The percentage of recombinants from unamplified library was 90.2% and average length of exogenous inserts was 0.98 kb. A total of 212 individual ESTs with sizes ranging from 356 to 1108 bps were then analyzed. The BLASTX score revealed that 48.1% of the sequences were classified as a strong match, 45.3% as nominal and 6.6% as a weak match. Among the ESTs with known putative function, 26.4% ESTs were found to be related to all kinds of metabolisms, 19.3% ESTs to information storage and processing, 11.3% ESTs to posttranslational modification, protein turnover, chaperones, 11.3% ESTs to transport, 9.9% ESTs to signal transducer/cell communication, 9.0% ESTs to structure protein, 3.8% ESTs to cell cycle, and only 6.6% ESTs classified as novel genes. By EST sequencing, a full-length gene coding ferritin was identified and characterized. The recombinant plasmid pET32a-TAT-Ferritin was constructed, coded for the TAT-Ferritin fusion protein with two 6× His-tags in N and C-terminal. After BCA assay, the concentration of soluble Trx-TAT-Ferritin recombinant protein was 2.32 ± 0.12 mg/mL. These results demonstrated that the reliability and representativeness of the cDNA library attained to the requirements of a standard cDNA library. This library provided a useful platform for the functional genome and transcriptome research of Bengal tigers.

  6. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments.

    Science.gov (United States)

    Schlumbaum, Angela; van Glabeke, Sabine; Roldan-Ruiz, Isabel

    2012-01-20

    Wild apples (Malus sp.) have been a major food source in the northern Alpine region since prehistory and their use is well understood. The onset of deliberate fruit tree growing in the area is, however, less clear. It is generally assumed that horticulture was practised in Roman times, but it might be even earlier. In the archaeological record seed testa and pericarp remains are particularly frequent at sites with waterlogged preservation such as lakeshore settlements or wells, pits and ditches, but the distinction between wild and domestic plants is not morphologically possible. With waterlogged remains being one main source of information about past fruit cultivation, we have tested the feasibility of analysing ancient DNA from waterlogged preserved bulk samples of testa fragments. We studied apple seeds from three Neolithic and three Roman sites with waterlogged preservation in the Alpine foreland. Chloroplast markers failed in all samples, but nuclear ITS1 (internal transcribed spacer region 1) of the ribosomal DNA was successfully typed in two Roman samples from the site Oedenburg/Biesheim-Kunheim (Haut-Rhin, F). The retrieved ITS1 sequences are identical to each other and are shared with wild Malus sylvestris and Malus sieversii, and with domestic apple cultivars, supporting the potential of using waterlogged remains for identifying the genetic status of apple diachronically. Copyright © 2011 Elsevier GmbH. All rights reserved.

  7. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  8. Episodic air pollution is associated with increased DNA fragmentation in human sperm without other changes in semen quality

    Energy Technology Data Exchange (ETDEWEB)

    Rubes, J.; Selevan, S.G.; Evenson, D.P.; Zudova, D.; Vozdova, M.; Zudova, Z.; Robbins, W.A.; Perreault, S.D. [US EPA, Research Triangle Park, NC (United States)

    2005-10-01

    This study examined potential associations between exposure to episodes of air pollution and alterations in semen quality. The air pollution, resulting from combustion of coal for industry and home heating in the Teplice district of the Czech Republic, was much higher during the winter than at other times of year with peaks exceeding US air quality standards. Young men from Teplice were sampled up to seven times over 2 years allowing evaluation of semen quality after periods of exposure to both low and high air pollution. Routine semen analysis (sperm concentration, motility and morphology) and tests for sperm aneuploidy and chromatin integrity were performed, comparing measurements within each subject. Exposure was classified as high or low based on data from ambient air pollution monitoring. Using repeated measures analysis, a significant association was found between exposure to periods of high air pollution (at or above the upper limit of US air quality standards) and the percentage of sperm with DNA fragmentation according to sperm chromatin structure assay (SCSA). Other semen measures were not associated with air pollution. It is concluded that exposure to intermittent air pollution may result in sperm DNA damage and thereby increase the rates of male-mediated infertility, miscarriage, and other adverse reproductive outcomes.

  9. DNA double-strand breaks in mammalian cells exposed to γ-rays and very heavy ions. Fragment-size distributions determined by pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    Kraxenberger, F.; Friedl, A.A.; Eckardt-Schupp, F.; Weber, K.J.; Flentje, M.; Quicken, P.; Kellerer, A.M.; Ludwig-Maximilians University, Munich

    1998-01-01

    The spatial distribution of DNA double-strand breaks (DSB) was assessed after treatment of mammalian cells (V79) with densely ionizing radiation. Cells were exposed to beams of heavy charged particles (calcium ions: 6.9 MeV/u, 2.1.10 3 keV/μm; uranium ions: 9.0 MeV/u, 1.4.10 4 keV/μm) at the linear accelerator UNILAC of GSI, Darmstadt. DNA was isolated in agarose plugs and subjected to pulsed-field gel electrophoresis under conditions that separated DNA fragments of size 50 kbp to 5 Mbp. The measured fragment distributions were compared to those obtained after γ-irradiation and were analyzed by means of a convolution and a deconvolution technique. In contrast to the finding for γ-radiation, the distributions produced by heavy ions do not correspond to the random breakage model. Their marked overdispersion and the observed excess of short fragments reflect spatial clustering of DSB that extends over large regions of the DNA, up to several mega base pairs (Mbp). At fluences of 0.75 and 1.5/μm 2 , calcium ions produce nearly the same shape of fragment spectrum, merely with a difference in the amount of DNA entering the gel; this suggests that the DNA is fragmented by individual calcium ions. At a fluence of 0.8/μm 2 uranium ions produce a profile that is shifted to smaller fragment sizes in comparison to the profile obtained at a fluence of 0.4/μm 2 ; this suggests cumulative action of two separate ions in the formation of fragments. These observations are not consistent with the expectation that the uranium ions, with their much larger LET, should be more likely to produce single particle action than the calcium ions. However, a consideration of the greater lateral extension of the tracks of the faster uranium ions explains the observed differences; it suggests that the DNA is closely coiled so that even DNA locations several Mbp apart are usually not separated by less than 0.1 or 0.2 μm. (orig.)

  10. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  11. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  12. Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon

    Directory of Open Access Journals (Sweden)

    Bendahmane Abdelhafid

    2011-05-01

    Full Text Available Abstract Background Melon (Cucumis melo, an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs and 3,073 single nucleotide polymorphisms (SNPs in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but

  13. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  14. Generation and analysis of large-scale expressed sequence tags (ESTs from a full-length enriched cDNA library of porcine backfat tissue

    Directory of Open Access Journals (Sweden)

    Lee Hae-Young

    2006-02-01

    Full Text Available Abstract Background Genome research in farm animals will expand our basic knowledge of the genetic control of complex traits, and the results will be applied in the livestock industry to improve meat quality and productivity, as well as to reduce the incidence of disease. A combination of quantitative trait locus mapping and microarray analysis is a useful approach to reduce the overall effort needed to identify genes associated with quantitative traits of interest. Results We constructed a full-length enriched cDNA library from porcine backfat tissue. The estimated average size of the cDNA inserts was 1.7 kb, and the cDNA fullness ratio was 70%. In total, we deposited 16,110 high-quality sequences in the dbEST division of GenBank (accession numbers: DT319652-DT335761. For all the expressed sequence tags (ESTs, approximately 10.9 Mb of porcine sequence were generated with an average length of 674 bp per EST (range: 200–952 bp. Clustering and assembly of these ESTs resulted in a total of 5,008 unique sequences with 1,776 contigs (35.46% and 3,232 singleton (65.54% ESTs. From a total of 5,008 unique sequences, 3,154 (62.98% were similar to other sequences, and 1,854 (37.02% were identified as having no hit or low identity (Sus scrofa. Gene ontology (GO annotation of unique sequences showed that approximately 31.7, 32.3, and 30.8% were assigned molecular function, biological process, and cellular component GO terms, respectively. A total of 1,854 putative novel transcripts resulted after comparison and filtering with the TIGR SsGI; these included a large percentage of singletons (80.64% and a small proportion of contigs (13.36%. Conclusion The sequence data generated in this study will provide valuable information for studying expression profiles using EST-based microarrays and assist in the condensation of current pig TCs into clusters representing longer stretches of cDNA sequences. The isolation of genes expressed in backfat tissue is the

  15. Comparison of direct boiling method with commercial kits for extracting fecal microbiome DNA by Illumina sequencing of 16S rRNA tags.

    Science.gov (United States)

    Peng, Xin; Yu, Ke-Qiang; Deng, Guan-Hua; Jiang, Yun-Xia; Wang, Yu; Zhang, Guo-Xia; Zhou, Hong-Wei

    2013-12-01

    Low cost and high throughput capacity are major advantages of using next generation sequencing (NGS) techniques to determine metagenomic 16S rRNA tag sequences. These methods have significantly changed our view of microorganisms in the fields of human health and environmental science. However, DNA extraction using commercial kits has shortcomings of high cost and time constraint. In the present study, we evaluated the determination of fecal microbiomes using a direct boiling method compared with 5 different commercial extraction methods, e.g., Qiagen and MO BIO kits. Principal coordinate analysis (PCoA) using UniFrac distances and clustering showed that direct boiling of a wide range of feces concentrations gave a similar pattern of bacterial communities as those obtained from most of the commercial kits, with the exception of the MO BIO method. Fecal concentration by boiling method affected the estimation of α-diversity indices, otherwise results were generally comparable between boiling and commercial methods. The operational taxonomic units (OTUs) determined through direct boiling showed highly consistent frequencies with those determined through most of the commercial methods. Even those for the MO BIO kit were also obtained by the direct boiling method with high confidence. The present study suggested that direct boiling could be used to determine the fecal microbiome and using this method would significantly reduce the cost and improve the efficiency of the sample preparation for studying gut microbiome diversity. © 2013 Elsevier B.V. All rights reserved.

  16. DNA fragmentation and membrane damage of bocachico Prochilodus magdalenae (Ostariophysi: Prochilodontidae sperm following cryopreservation with dimethylsulfoxide and glucose

    Directory of Open Access Journals (Sweden)

    José Gregorio Martínez

    2012-09-01

    Full Text Available The endangered bocachico Prochilodus magdalenae is a native freshwater fish of Colombia, the most captured species locally and one of the most important species for ex-situ conservation (germplasm banks. The aim of this study was to examine the effect of three concentrations of Dimethylsulfoxide (DMSO (5%, 10%, 15% and three of glucose (305, 333, 361 mM in the extender on spermatic DNA fragmentation (F-DNA (by Halomax®, Chromatin dispersion and membrane damage (D-Me (by eosin-nigrosin staining. After assessment of sperm quality by computer analysis of motility, one part of semen from males was diluted separately with three parts of extender and filled into 0.5 ml straws. Freezing was carried out in liquid nitrogen vapor dry shipper for 30 minutes and thawed at 60ºC for 8 seconds in a water bath and evaluated for the percentage of cells found with F-DNA and D-Me. The results demonstrated that cryopreservation causes greater F-DNA (13.62 ± 1.6% to 28.91 ± 3.25 and D-Me (24.27 ± 1.1% to 58.33 ± 2.81% when compared with pre-freezing semen (PFS (6.71 ± 1.54% and 2.34 ± 0.5%, respectively for F-DNA and D-Me. A significant interaction was found between DMSO and glucose concentration in this experiment. Use of extender: 10% DMSO + 305 mM glucose + 12% chicken egg yolk and, 10% DMSO + 333 mM glucose + 12% chicken egg yolk, allow for lower F-DNA and D-Me during cryopreservation of bocachico semen. A high correlation between F-DNA and D-Me was found (r = 0.771.O curimba Prochilodus magdalenae, é uma espécie nativa de água doce da Colômbia ameaçada de extinção, sendo a mais capturada localmente e uma das mais importantes para a conservação ex-situ (bancos de germoplasma. O objetivo deste estudo foi avaliar o efeito de três concentrações de dimetilsulfóxido (DMSO (5%, 10%, 15% e três de glicose (305, 333, 361 mM no diluente sobre a fragmentação do ADN espermático (F-DNA (através de Halomax®, dispersão da cromatina e danos em

  17. Anethole induces apoptotic cell death accompanied by reactive oxygen species production and DNA fragmentation in Aspergillus fumigatus and Saccharomyces cerevisiae.

    Science.gov (United States)

    Fujita, Ken-Ichi; Tatsumi, Miki; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

    2014-02-01

    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum, and antimicrobial activity that is weaker than that of other antibiotics on the market. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to possess significant synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the antifungal mechanism of anethole has not been completely determined. We found that anethole stimulated cell death of a human opportunistic pathogenic fungus, Aspergillus fumigatus, in addition to S. cerevisiae. The anethole-induced cell death was accompanied by reactive oxygen species production, metacaspase activation, and DNA fragmentation. Several mutants of S. cerevisiae, in which genes related to the apoptosis-initiating execution signals from mitochondria were deleted, were resistant to anethole. These results suggest that anethole-induced cell death could be explained by oxidative stress-dependent apoptosis via typical mitochondrial death cascades in fungi, including A. fumigatus and S. cerevisiae. © 2014 FEBS.

  18. 125IdUrd-induced chromosome fragments, assayed by premature chromosome condensation, and DNA double-strand breaks have similar repair kinetics in G1-phase CHO-cells

    International Nuclear Information System (INIS)

    Iliakis, George; Pantelias, G.E.; Okayasu, Ryuichi; Seaner, Robert

    1987-01-01

    The effect of 125 I-decay on cell lethality, and induction of chromosome and DNA damage, was studied in synchronous non-cycling, G 1 -phase CHO-cells. Neutral filter elution was used to assay repair of DNA double-strand breaks (dsbs), and premature chromosome condensation was used to assay repair of chromosome fragments and induction of ring chromosomes. The results indicate very little repair at the cell survival level (repair of PLD). At the DNA level an efficient repair of DNA dsbs was observed, with kinetics similar to those observed after exposure to X-rays. At the chromosome level a fast repair of prematurely condensed chromosome fragments was observed, with a concomitant increase in the number of ring chromosomes induced. The repair kinetics of chromosome fragments and DNA dsbs were very similar, suggesting that DNA dsbs may underlie chromosome fragmentation. (author)

  19. An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries

    Science.gov (United States)

    Habermann, Bianca; Bebin, Anne-Gaelle; Herklotz, Stephan; Volkmer, Michael; Eckelt, Kay; Pehlke, Kerstin; Epperlein, Hans Henning; Schackert, Hans Konrad; Wiebe, Glenis; Tanaka, Elly M

    2004-01-01

    Background The ambystomatid salamander, Ambystoma mexicanum (axolotl), is an important model organism in evolutionary and regeneration research but relatively little sequence information has so far been available. This is a major limitation for molecular studies on caudate development, regeneration and evolution. To address this lack of sequence information we have generated an expressed sequence tag (EST) database for A. mexicanum. Results Two cDNA libraries, one made from stage 18-22 embryos and the other from day-6 regenerating tail blastemas, generated 17,352 sequences. From the sequenced ESTs, 6,377 contigs were assembled that probably represent 25% of the expressed genes in this organism. Sequence comparison revealed significant homology to entries in the NCBI non-redundant database. Further examination of this gene set revealed the presence of genes involved in important cell and developmental processes, including cell proliferation, cell differentiation and cell-cell communication. On the basis of these data, we have performed phylogenetic analysis of key cell-cycle regulators. Interestingly, while cell-cycle proteins such as the cyclin B family display expected evolutionary relationships, the cyclin-dependent kinase inhibitor 1 gene family shows an unusual evolutionary behavior among the amphibians. Conclusions Our analysis reveals the importance of a comprehensive sequence set from a representative of the Caudata and illustrates that the EST sequence database is a rich source of molecular, developmental and regeneration studies. To aid in data mining, the ESTs have been organized into an easily searchable database that is freely available online. PMID:15345051

  20. A DNA fragment from Xq21 replaces a deleted region containing the entire FVIII gene in a severe hemophilia A patient

    Energy Technology Data Exchange (ETDEWEB)

    Murru, S.; Casula, L.; Moi, P. [Insituto di Clinica e Biologia dell` Eta Evolutiva, Cagliari (Italy)] [and others

    1994-09-15

    In this paper the authors report the molecular characterization of a large deletion that removes the entire Factor VIII gene in a severe hemophilia A patient. Accurate DNA analysis of the breakpoint region revealed that a large DNA fragment replaced the 300-kb one, which was removed by the deletion. Pulsed-field gel electrophoresis analysis revealed that the size of the inserted fragment is about 550 kb. In situ hybridization demonstrated that part of the inserted region normally maps to Xq21 and to the tip of the short arm of the Y chromosome (Yp). In this patient this locus is present both in Xq21 and in Xq28, in addition to the Yp, being thus duplicated in the X chromosome. Sequence analysis of the 3` breakpoint suggested that an illegitimate recombination is probably the cause of this complex rearrangement. 52 refs., 7 figs.

  1. Relationships between sperm DNA fragmentation, sperm apoptotic markers and serum levels of CB-153 and p,p'-DDE in European and Inuit populations

    DEFF Research Database (Denmark)

    Stronati, A; Manicardi, G C; Cecati, M

    2006-01-01

    Persistent organochlorine pollutants (POPs) are suspected to interfere with hormone activity and the normal homeostasis of spermatogenesis. We investigated the relationships between sperm DNA fragmentation, apoptotic markers identified on ejaculated spermatozoa and POP levels in the blood of 652...... adult males (200 Inuits from Greenland, 166 Swedish, 134 Polish and 152 Ukrainian). Serum levels of 2, 2', 4, 4', 5, 5'-hexachlorobiphenyl (CB-153), as a proxy of the total POP burden, and of 1,1-dichloro-2,2-bis(p-chlorophenyl)-ethylene (p,p'-DDE), as a proxy of the total DDT exposure were determined...... neither sperm DNA fragmentation nor apoptotic sperm parameters and the large variations in POPs exposure was observed for the separate study groups. However, considering the European populations taken together, we showed that both %TUNEL positivity and Bcl-xL were related to CB-153 serum levels, whereas...

  2. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  3. Sperm DNA fragmentation induced by cryopreservation: new insights and effect of a natural extract from Opuntia ficus-indica.

    Science.gov (United States)

    Meamar, Mehrdad; Zribi, Nassira; Cambi, Marta; Tamburrino, Lara; Marchiani, Sara; Filimberti, Erminio; Fino, Maria Grazia; Biggeri, Annibale; Menezo, Yves; Forti, Gianni; Baldi, Elisabetta; Muratori, Monica

    2012-08-01

    To analyze the effect of cryopreservation on sperm DNA fragmentation (SDF) in two cytometric sperm populations, PI(brighter) and PI(dimmer), and to test the effects of Opuntia ficus-indica (OFI) extracts, which contain antioxidants and flavanoids, and of resveratrol on cryopreservation of human semen. In vitro prospective study. Institutional study. Twenty-one normozoospermic men undergoing semen analysis for couple infertility. Cryopreservation using the routine method in the presence of OFI extracts or resveratrol. Measurement of SDF by TUNEL/PI flow cytometric method to evaluate sperm motility (by automated motion analysis, CASA system) and viability (by eosin/nigrosin staining) in the two populations of sperm PI(br) and PI(dim). Cryopreservation induced an increase of SDF only in the PI(br) sperm population. The increase was negatively dependent on the basal values of SDF in the same population. Addition of OFI extracts and resveratrol to the cryopreservation medium slightly but statistically significantly reduced SDF in the PI(br) population without affecting the deleterious effect of cryopreservation on sperm motion parameters or viability. The increase of SDF in the PI(br) population, which is unrelated to semen quality, suggests that caution must be taken in using cryopreserved semen, as morphologically normal and motile sperm may be damaged. The addition of substances with multifunctional properties such as OFI extracts to cryopreservation medium is only slightly effective in preventing the dramatic effects on SDF. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  4. The influence of ginger (Zingiber officinale on human sperm quality and DNA fragmentation: A double-blind randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Jalil Hosseini

    2016-08-01

    Full Text Available Background: Although the effectiveness of ginger as an antioxidant agent has been exploited, little human research has been conducted on its activity on male reproductive functions. Objective: This study was designed to investigate the effects of ginger (Zingiber officinale on sperm DNA fragmentation (SDF in infertile men. Materials and Methods: This randomized double-blind, placebo-controlled trial with a 1:1 allocation was performed on 100 infertility treatment candidates who were admitted to Royan Institute for Reproductive Biomedicine, Tehran, Iran. Patients were randomly assigned to receive one of two treatments: ginger and placebo. Patients were given a 3-month oral treatment (members received capsules containing 250 mg of ginger powder twice a day in ginger and a placebo in other group. Before and after treatment, standardized semen samples were obtained to determine sperm concentration, motility, and SDF according to World Health Organization. Results: There was no significant difference between two groups regarding SDF at baseline (53.48. 95%CI: 37.95-69.02 in cases and (56.75, 95%CI: 40.01-73.5 in controls. The average positive percentage of SDF in patients receiving ginger (17.77, 95%CI: 6.16-29.39 was lower compared with placebo (40.54, 95%CI: 23.94-57.13 after three month of treatment (p=0.02. In multivariate analysis, SDF was significantly lower in patients receiving ginger compared with placebo (mean difference: 3.21, 95%CI: 0.78-5.63, p=0.009. There were no significant differences between two groups regarding to semen parameters. Conclusion: The present study has demonstrated that ginger in a controlled study of efficacy was effective in decreasing SDF in infertile men.

  5. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa.

    Science.gov (United States)

    Sadeghi, Sara; García-Molina, Almudena; Celma, Ferran; Valverde, Anthony; Fereidounfar, Sogol; Soler, Carles

    2016-01-01

    DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA) were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained), and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001). In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA). The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  6. Morphometric comparison by the ISAS® CASA-DNAf system of two techniques for the evaluation of DNA fragmentation in human spermatozoa

    Directory of Open Access Journals (Sweden)

    Sara Sadeghi

    2016-01-01

    Full Text Available DNA fragmentation has been shown to be one of the causes of male infertility, particularly related to repeated abortions, and different methods have been developed to analyze it. In the present study, two commercial kits based on the SCD technique (Halosperm ® and SDFA were evaluated by the use of the DNA fragmentation module of the ISAS ® v1 CASA system. Seven semen samples from volunteers were analyzed. To compare the results between techniques, the Kruskal-Wallis test was used. Data were used for calculation of Principal Components (two PCs were obtained, and subsequent subpopulations were identified using the Halo, Halo/Core Ratio, and PC data. Results from both kits were significantly different (P < 0.001. In each case, four subpopulations were obtained, independently of the classification method used. The distribution of subpopulations differed depending on the kit used. From the PC data, a discriminant analysis matrix was obtained and a good a posteriori classification was obtained (97.1% for Halosperm and 96.6% for SDFA. The present results are the first approach on morphometric evaluation of DNA fragmentation from the SCD technique. This approach could be used for the future definition of a classification matrix surpassing the current subjective evaluation of this important sperm factor.

  7. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  8. Apoptotic DNA Degradation into Oligonucleosomal Fragments, but Not Apoptotic Nuclear Morphology, Relies on a Cytosolic Pool of DFF40/CAD Endonuclease*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Gabernet, Gisela; García-Belinchón, Mercè; Sánchez-Osuna, María; Casanelles, Elisenda; Comella, Joan X.; Yuste, Victor J.

    2012-01-01

    Apoptotic cell death is characterized by nuclear fragmentation and oligonucleosomal DNA degradation, mediated by the caspase-dependent specific activation of DFF40/CAD endonuclease. Here, we describe how, upon apoptotic stimuli, SK-N-AS human neuroblastoma-derived cells show apoptotic nuclear morphology without displaying concomitant internucleosomal DNA fragmentation. Cytotoxicity afforded after staurosporine treatment is comparable with that obtained in SH-SY5Y cells, which exhibit a complete apoptotic phenotype. SK-N-AS cell death is a caspase-dependent process that can be impaired by the pan-caspase inhibitor q-VD-OPh. The endogenous inhibitor of DFF40/CAD, ICAD, is correctly processed, and dff40/cad cDNA sequence does not reveal mutations altering its amino acid composition. Biochemical approaches show that both SH-SY5Y and SK-N-AS resting cells express comparable levels of DFF40/CAD. However, the endonuclease is poorly expressed in the cytosolic fraction of healthy SK-N-AS cells. Despite this differential subcellular distribution of DFF40/CAD, we find no differences in the subcellular localization of both pro-caspase-3 and ICAD between the analyzed cell lines. After staurosporine treatment, the preferential processing of ICAD in the cytosolic fraction allows the translocation of DFF40/CAD from this fraction to a chromatin-enriched one. Therefore, the low levels of cytosolic DFF40/CAD detected in SK-N-AS cells determine the absence of DNA laddering after staurosporine treatment. In these cells DFF40/CAD cytosolic levels can be restored by the overexpression of their own endonuclease, which is sufficient to make them proficient at degrading their chromatin into oligonucleosome-size fragments after staurosporine treatment. Altogether, the cytosolic levels of DFF40/CAD are determinants in achieving a complete apoptotic phenotype, including oligonucleosomal DNA degradation. PMID:22253444

  9. DNA fragmentation dynamics allows the assessment of cryptic sperm damage in human: Evaluation of exposure to ionizing radiation, hyperthermia, acidic pH and nitric oxide

    Energy Technology Data Exchange (ETDEWEB)

    Santiso, Rebeca; Tamayo, Maria [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain); Gosalvez, Jaime [Genetics Unit, Facultad de Biologia, Universidad Autonoma de Madrid, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain); Johnston, Steve [School of Agriculture and Food Science, University of Queensland, Gatton 4343 (Australia); Marino, Alfonso [Servicio de Oncologia Radioterapica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Carlos; Losada, Carlos [Servicio de Radiofisica, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Fernandez, Jose Luis, E-mail: Jose.Luis.Fernandez.Garcia@sergas.es [Laboratorio de Genetica Molecular y Radiobiologia, Centro Oncologico de Galicia, Doctor Camilo Veiras 1, 15009-A Coruna (Spain); Genetics Unit, INIBIC-Complejo Hospitalario Universitario A Coruna (CHUAC), As Xubias, 84, 15006-A Coruna (Spain)

    2012-06-01

    Sperm DNA fragmentation (SDF) is not a static seminal parameter, since the longevity of sperm DNA decreases progressively with time following ejaculation or thawing. While the dynamics of SDF is a species-specific characteristic, in the case of humans, there is still significant variation within patients. To evaluate the suitability of the dynamic SDF assay to assess the adverse effects of agents that cause genetic damage, fresh semen samples from different donors were exposed in vitro to (1) increasing acute doses of ionizing radiation, (2) elevated temperature (41 Degree-Sign C and 45 Degree-Sign C), (3) acidic pH (pH 4) and (4) the nitric oxide (NO) donor sodium nitroprusside (SNP). Sperm DNA fragmentation was analyzed after an incubation period of chronic (24 h), or acute (1 h) exposure to each treatment followed by incubation at 37 Degree-Sign C over a period of 24 h. SDF was assessed using the sperm chromatin dispersion (SCD) test. Dynamic SDF for each treatment was analyzed using Kaplan-Meier survival curves. All agents, except for ionizing radiation, accelerated SDF kinetics following chronic exposure over a 24 h period. Transient exposure to NO and heat but not acidic pH increased the basal (T0) level of SDF. Despite the removal of the three toxicants, the remaining sperm following acute exposure showed a decrease in their expected DNA longevity. It is concluded that the assessment of sperm DNA fragmentation dynamics is an effective methodological approach for revealing latent damage associated with toxicants that is not initially expressed following a single initial observation of SDF.

  10. Non PCR-amplified Transcripts and AFLP fragments as reduced representations of the quail genome for 454 Titanium sequencing

    Directory of Open Access Journals (Sweden)

    Leterrier Christine

    2010-07-01

    Full Text Available Abstract Background SNP (Single Nucleotide Polymorphism discovery is now routinely performed using high-throughput sequencing of reduced representation libraries. Our objective was to adapt 454 GS FLX based sequencing methodologies in order to obtain the largest possible dataset from two reduced representations libraries, produced by AFLP (Amplified Fragment Length Polymorphism for genomic DNA, and EST (Expressed Sequence Tag for the transcribed fraction of the genome. Findings The expressed fraction was obtained by preparing cDNA libraries without PCR amplification from quail embryo and brain. To optimize the information content for SNP analyses, libraries were prepared from individuals selected in three quail lines and each individual in the AFLP library was tagged. Sequencing runs produced 399,189 sequence reads from cDNA and 373,484 from genomic fragments, covering close to 250 Mb of sequence in total. Conclusions Both methods used to obtain reduced representations for high-throughput sequencing were successful after several improvements. The protocols may be used for several sequencing applications, such as de novo sequencing, tagged PCR fragments or long fragment sequencing of cDNA.

  11. Yellowtail Tagging Data (MRDBS)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Yellowtail Flounder Tagging Program began in 2003 and works with commercial fishermen to tag and release yellowtaiI flounder with pink and yellow disc tags or...

  12. Cold-inducible RNA-binding protein through TLR4 signaling induces mitochondrial DNA fragmentation and regulates macrophage cell death after trauma.

    Science.gov (United States)

    Li, Zhigang; Fan, Erica K; Liu, Jinghua; Scott, Melanie J; Li, Yuehua; Li, Song; Xie, Wen; Billiar, Timothy R; Wilson, Mark A; Jiang, Yong; Wang, Ping; Fan, Jie

    2017-05-11

    Trauma is a major cause of systemic inflammatory response syndrome and multiple organ dysfunction syndrome. Macrophages (Mφ) direct trauma-induced inflammation, and Mφ death critically influences the progression of the inflammatory response. In the current study, we explored an important role of trauma in inducing mitochondrial DNA (mtDNA) damage in Mφ and the subsequent regulation of Mφ death. Using an animal pseudo-fracture trauma model, we demonstrated that tissue damage induced NADPH oxidase activation and increased the release of reactive oxygen species via cold-inducible RNA-binding protein (CIRP)-TLR4-MyD88 signaling. This in turn, activates endonuclease G, which serves as an executor for the fragmentation of mtDNA in Mφ. We further showed that fragmented mtDNA triggered both p62-related autophagy and necroptosis in Mφ. However, autophagy activation also suppressed Mφ necroptosis and pro-inflammatory responses. This study demonstrates a previously unidentified intracellular regulation of Mφ homeostasis in response to trauma.

  13. Paramecium putrinum (Ciliophora, Protozoa): the first insight into the variation of two DNA fragments - molecular support for the existence of cryptic species.

    Science.gov (United States)

    Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa

    2014-04-01

    Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Individual and combined effects of ochratoxin A and citrinin on viability and DNA fragmentation in cultured Vero cells and on chromosome aberrations in mice bone marrow cells

    International Nuclear Information System (INIS)

    Bouslimi, Amel; Bouaziz, Chayma; Ayed-Boussema, Imen; Hassen, Wafa; Bacha, Hassen

    2008-01-01

    Ochratoxin A (OTA) and citrinin (CTN) are two common contaminant mycotoxins which can occur jointly in a wide range of food commodities. Both mycotoxins have several toxic effects but share a significant nephrotoxic and carcinogenic potential since OTA and CTN were reported to be responsible for naturally occurring human and animal kidney diseases and tumors. Considering the concomitant production of OTA and CTN, it is very likely that humans and animals are always exposed to the mixture rather than to individual compounds. Therefore, the aim of the present study was to investigate, in vivo and in vitro, whether DNA damage is enhanced by combination of both mycotoxins as compared to their effect separately. To this end, we have assessed their effects individually or combined on cell proliferation and DNA fragmentation in cultured Vero cells and in vivo by monitoring the induction of chromosome aberrations. Our results clearly showed that cultured renal cells respond to OTA and CTN exposure by a moderate and weak inhibition of cell proliferation, respectively. However, when combined, they exert a significant increase in inhibition of cell viability. Similar results were found for the investigated genotoxicity endpoints (DNA fragmentation and chromosome aberrations). Altogether, our study showed that OTA and CTN combination effects are clearly synergistic. The synergistic induction of DNA damage observed with OTA and CTN taken concomitantly could be relevant to explain the molecular basis of the renal diseases and tumorogenesis induced by naturally occurring mycotoxins

  15. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    Science.gov (United States)

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  16. Mitochondrial outer membrane permeabilization increases reactive oxygen species production and decreases mean sperm velocity but is not associated with DNA fragmentation in human sperm.

    Science.gov (United States)

    Treulen, F; Uribe, P; Boguen, R; Villegas, J V

    2016-02-01

    Does induction of mitochondrial outer membrane permeabilization (MOMP) in vitro affect specific functional parameters of human spermatozoa? Our findings show that MOMP induction increases intracellular reactive oxygen species (ROS) and decreases mean sperm velocity but does not alter DNA integrity. MOMP in somatic cells is related to a variety of apoptotic traits, such as alteration of mitochondrial membrane potential (ΔΨm), and increase in ROS production and DNA fragmentation. Although the presence of these apoptotic features has been reported in spermatozoa, to date the effects of MOMP on sperm function and DNA integrity have not been analysed. The study included spermatozoa from fertile donors. Motile sperm were obtained using the swim-up method. The highly motile sperm were collected and diluted with human tubal fluid to a final cell concentration of 5 × 10(6) ml(-1). To induce MOMP, selected sperm were treated at 37°C for 4 h with a mimetic of a Bcl-2 pro-apoptotic protein, ABT-737. MOMP was evaluated by relocating of cytochrome c. In addition, the effect of ABT-737 on mitochondrial inner membrane permeabilization was assessed using the calcein-AM/cobalt chloride method. In turn, ΔΨm was evaluated with JC-1 staining, intracellular ROS production with dihydroethidium, sperm motility was analysed by computer-assisted sperm analysis and DNA fragmentation by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labelling (TUNEL) assay. Measurements were performed by flow cytometry. MOMP was associated with ΔΨm dissipation (P < 0.05), increased ROS production (P < 0.05) and decreased mean sperm velocity (P < 0.05), but it was not associated with DNA fragmentation. MOMP did not induce a large increase in ROS, which could explain the negligible effect of MOMP on sperm DNA fragmentation under our experimental conditions. The study was carried out in vitro using highly motile sperm, selected by swim-up, from healthy donors. The results obtained in this

  17. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  18. In vitro and in vivo assay of radio-induced damage in Escherichia Coli, DNA labelled on thymidilic fragment

    International Nuclear Information System (INIS)

    Bonicel, A.

    1977-01-01

    A technique of rapid assay for a particular and very important damage, N-formamido (DNA), is described. Using this technique, the importance of radio-induced DNA damage can be evaluated before the repair enzymatic system takes place [fr

  19. Evaluation of visible implant elastomer tags in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Claudia Hohn

    2013-11-01

    The use of the visible implant elastomer (VIE tagging system in zebrafish (Danio rerio was examined. Two tag orientations (horizontal and vertical at the dorsal fin base were tested for tag retention, tag fragmentation and whether VIE tags affected growth and survival of juvenile zebrafish (1–4 month post hatch. Six tag locations (abdomen, anal fin base, caudal peduncle, dorsal fin base, pectoral fin base, isthmus and 5 tag colors (yellow, red, pink, orange, blue were evaluated for ease of VIE tag application and tag visibility in adult zebrafish. Long-term retention (1 year and multiple tagging sites (right and left of dorsal fin and pectoral fin base were examined in adult zebrafish. Lastly, survival of recombination activation gene 1−/− (rag1−/− zebrafish was evaluated after VIE tagging. The best tag location was the dorsal fin base, and the most visible tag color was pink. Growth rate of juvenile zebrafish was not affected by VIE tagging. Horizontal tagging is recommended in early stages of fish growth (1–2 months post hatch. VIE tags were retained for 1 year and tagging did not interfere with long-term growth and survival. There was no mortality associated with VIE tagging in rag1−/− zebrafish. The VIE tagging system is highly suitable for small-sized zebrafish. When familiar with the procedure, 120 adult zebrafish can be tagged in one hour. It does not increase mortality in adult zebrafish or interfere with growth in juvenile or adult zebrafish.

  20. Biochemical analyses indicate that binding and cleavage specificities define the ordered processing of human Okazaki fragments by Dna2 and FEN1.

    Science.gov (United States)

    Gloor, Jason W; Balakrishnan, Lata; Campbell, Judith L; Bambara, Robert A

    2012-08-01

    In eukaryotic Okazaki fragment processing, the RNA primer is displaced into a single-stranded flap prior to removal. Evidence suggests that some flaps become long before they are cleaved, and that this cleavage involves the sequential action of two nucleases. Strand displacement characteristics of the polymerase show that a short gap precedes the flap during synthesis. Using biochemical techniques, binding and cleavage assays presented here indicate that when the flap is ∼ 30 nt long the nuclease Dna2 can bind with high affinity to the flap and downstream double strand and begin cleavage. When the polymerase idles or dissociates the Dna2 can reorient for additional contacts with the upstream primer region, allowing the nuclease to remain stably bound as the flap is further shortened. The DNA can then equilibrate to a double flap that can bind Dna2 and flap endonuclease (FEN1) simultaneously. When Dna2 shortens the flap even more, FEN1 can displace the Dna2 and cleave at the flap base to make a nick for ligation.

  1. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  2. Accumulation of single-strand breaks doses not result in double-strand DNA breaks: peculiarity of transcribing fragment of human ribosomal operon that allows its detection in biological fluids at the death of various cells in organism

    International Nuclear Information System (INIS)

    Vejko, N.N.; Spitkovskij, D.M.

    2000-01-01

    The evidences of stability of the human ribosomal gene in the transcribing range (TR-rDNA) to fragmentation are presented in two groups of experiments: 1) in the case of availability of the fragments in the cells of sectional corpse material (necrosis and apoptosis) and by pathologies accompanied by the cells death through the apoptosis or necrosis mechanism; 2) in the model experiments, wherein the separated genomes DNA is subjected to the impact of nucleases initiating single-strand breaks (SB), or chemical introduction with a subsequent comparative analysis of stability to fragmentation of various DNA sequences including TR-rDNA. The DNA solutions were subjected to γ-radiation with the dose rate of 4.8 Gy/min. It is shown that in spite of the great number of the SBs the TR-rDNA is characterized by increased stability to fragmentation, which makes it possible to propose this DNA fragment for application as a cell death marker in biological fluids [ru

  3. Identification of DNA Fragments that Showed Linkage to the Radiation-induced Yellow Vein Mosaic Disease Resistance Mutation in Okra

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen; Puripunyavanich, Vichai

    2007-08-01

    Full text: The yellow vein mosaic disease resistant mutant of okra was crossed to Pichit 03, a susceptible variety. Their progeny showed prolonged resistance when compared with Pichit 03. DNA fingerprints of F2 and BC1F1 individuals from the cross indicated that most DNA bands did not segregate with either the resistance or the susceptible characteristics. Nonetheless, polymorphic DNA bands could be identified between the mutant and Okura, the parental variety

  4. The impact of partial manganese superoxide dismutase (SOD2)-deficiency on mitochondrial oxidant stress, DNA fragmentation and liver injury during acetaminophen hepatotoxicity

    International Nuclear Information System (INIS)

    Ramachandran, Anup; Lebofsky, Margitta; Weinman, Steven A.; Jaeschke, Hartmut

    2011-01-01

    Acetaminophen (APAP) hepatotoxicity is the most frequent cause of acute liver failure in many countries. The mechanism of cell death is initiated by formation of a reactive metabolite that binds to mitochondrial proteins and promotes mitochondrial dysfunction and oxidant stress. Manganese superoxide dismutase (SOD2) is a critical defense enzyme located in the mitochondrial matrix. The objective of this investigation was to evaluate the functional consequences of partial SOD2-deficiency (SOD2+/-) on intracellular signaling mechanisms of necrotic cell death after APAP overdose. Treatment of C57Bl/6J wild type animals with 200 mg/kg APAP resulted in liver injury as indicated by elevated plasma alanine aminotransferase activities (2870 ± 180 U/L) and centrilobular necrosis at 6 h. In addition, increased tissue glutathione disulfide (GSSG) levels and GSSG-to-GSH ratios, delayed mitochondrial GSH recovery, and increased mitochondrial protein carbonyls and nitrotyrosine protein adducts indicated mitochondrial oxidant stress. In addition, nuclear DNA fragmentation (TUNEL assay) correlated with translocation of Bax to the mitochondria and release of apoptosis-inducing factor (AIF). Furthermore, activation of c-jun-N-terminal kinase (JNK) was documented by the mitochondrial translocation of phospho-JNK. SOD2+/- mice showed 4-fold higher ALT activities and necrosis, an enhancement of all parameters of the mitochondrial oxidant stress, more AIF release and more extensive DNA fragmentation and more prolonged JNK activation. Conclusions: the impaired defense against mitochondrial superoxide formation in SOD2+/- mice prolongs JNK activation after APAP overdose and consequently further enhances the mitochondrial oxidant stress leading to exaggerated mitochondrial dysfunction, release of intermembrane proteins with nuclear DNA fragmentation and more necrosis.

  5. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Science.gov (United States)

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  6. Toward metrological traceability for DNA fragment ratios in GM quantification. 3. Suitability of DNA calibrants studied with a MON 810 corn model.

    Science.gov (United States)

    Charels, Diana; Broeders, Sylvia; Corbisier, Philippe; Trapmann, Stefanie; Schimmel, Heinz; Emons, Hendrik

    2007-05-02

    The quantification of GMOs by real-time PCR relies on an external calibrant. In this paper the suitability of two DNA calibrants, genomic DNA from plant leaves and plasmidic DNA, was investigated. The PCR efficiencies, the correlation coefficients of the calibration curves, and the ratios between PCR efficiencies of transgenic and endogenous sequences were compared for both calibrants using 59 data sets produced by 43 laboratories. There were no significant differences between plasmidic and genomic DNA except for the PCR efficiencies of the calibration curves for the transgene of the construct-specific real-time PCR method. In the GM system investigated, PCR efficiencies of plasmidic calibrants were slightly closer to the PCR efficiencies observed for the unknowns than those of the genomic DNA calibrant. Therefore, plasmidic DNA was the more suitable calibrant for the PCR measurements on genomic DNA extracted from MON 810 seeds. It is shown that plasmidic DNA is an appropriate choice for the calibration of measurements of MON 810 corn with respect to the DNA copy number ratio.

  7. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  8. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  9. An inexpensive and simple method for thermally stable immobilization of DNA on an unmodified glass surface: UV linking of poly(T)10-poly(C)10-tagged DNA probes

    DEFF Research Database (Denmark)

    Guðnason, Haukur; Dufva, Hans Martin; Bang, Dang Duong

    2008-01-01

    be linked by UV light irradiation onto a plain, unmodified glass surface. Probes immobilized onto unmodified glass microscope slides performed similarly to probes bound to commercial amino-silane-coated slides and had comparable detection limits. The TC-tagged probes linked to unmodified glass did not show...... any significant decrease in hybridization performance after a 20 min incubation in water at 100 degrees C prior to rehybridization, indicating a covalent bond between the TC tag and unmodified glass. The probes were used in thermal minisequencing cycling reactions. Furthermore, the TC tag improved...

  10. How much DNA is lost? Measuring DNA loss of short-tandem-repeat length fragments targeted by the PowerPlex 16® system using the Qiagen MinElute Purification Kit.

    Science.gov (United States)

    Kemp, Brian M; Winters, Misa; Monroe, Cara; Barta, Jodi Lynn

    2014-01-01

    The success in recovering genetic profiles from aged and degraded biological samples is diminished by fundamental aspects of DNA extraction, as well as its long-term preservation, that are not well understood. While numerous studies have been conducted to determine whether one extraction method was superior to others, nearly all of them were initiated with no knowledge of the actual starting DNA quantity in the samples prior to extraction, so they ultimately compared the outcome of all methods relative to the best. Using quantitative PCR to estimate the copy count of synthetic standards before (i.e., "copies in") and after (i.e., "copies out") purification by the Qiagen MinElute PCR Purification Kit, we documented DNA loss within a pool of 16 different-sized fragments ranging from 106 to 409 bp in length, corresponding to those targeted by the PowerPlex 16 System (Promega, Madison, WI). Across all standards from 10(4) to 10(7) copies/μL, loss averaged between 21.75% and 60.56% (mean, 39.03%), which is not congruent with Qiagen's claim that 80% of 70 bp to 4 kb fragments are retained using this product (i.e., 20% loss). Our study also found no clear relationship either between DNA strand length and retention or between starting copy number and retention. This suggests that there is no molecule bias across the MinElute column membrane and highlights the need for manufacturers to clearly and accurately describe on what their claims are based, and should also encourage researchers to document DNA retention efficiencies of their own methods and protocols. Understanding how and where to reduce loss of molecules during extraction and purification will serve to generate clearer and more accurate data, which will enhance the utility of ancient and low-copy-number DNA as a tool for closing forensic cases or in reconstructing the evolutionary history of humans and other organisms.

  11. Differential Gene Expression in Response to Papaya ringspot virus Infection in Cucumis metuliferus Using cDNA- Amplified Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lin, Chia-Wei; Chung, Chien-Hung; Chen, Jo-Chu; Yeh, Shy-Dong; Ku, Hsin-Mei

    2013-01-01

    A better understanding of virus resistance mechanisms can offer more effective strategies to control virus diseases. Papaya ringspot virus (PRSV), Potyviridae, causes severe economical losses in papaya and cucurbit production worldwide. However, no resistance gene against PRSV has been identified to date. This study aimed to identify candidate PRSV resistance genes using cDNA-AFLP analysis and offered an open architecture and transcriptomic method to study those transcripts differentially expressed after virus inoculation. The whole genome expression profile of Cucumis metuliferus inoculated with PRSV was generated using cDNA-amplified fragment length polymorphism (cDNA-AFLP) method. Transcript derived fragments (TDFs) identified from the resistant line PI 292190 may represent genes involved in the mechanism of PRSV resistance. C. metuliferus susceptible Acc. 2459 and resistant PI 292190 lines were inoculated with PRSV and subsequently total RNA was isolated for cDNA-AFLP analysis. More than 400 TDFs were expressed specifically in resistant line PI 292190. A total of 116 TDFs were cloned and their expression patterns and putative functions in the PRSV-resistance mechanism were further characterized. Subsequently, 28 out of 116 candidates which showed two-fold higher expression levels in resistant PI 292190 than those in susceptible Acc. 2459 after virus inoculation were selected from the reverse northern blot and bioinformatic analysis. Furthermore, the time point expression profiles of these candidates by northern blot analysis suggested that they might play roles in resistance against PRSV and could potentially provide valuable information for controlling PRSV disease in the future. PMID:23874746

  12. PCR typing of DNA fragments of the short tandem repeat (STR) system HUMTH01 in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Møller, A; Morling, N

    1994-01-01

    /child pairs were analyzed. Significant differences were observed between the distribution of fragments ('alleles'), whereby allele number 7 was considerably more frequent in Eskimos (0.687) than in Danes (0.201). The distributions of HUMTH01 phenotypes were in Hardy-Weinberg equilibrium in both the Eskimo...

  13. Biological activity of cloned mammary tumor virus DNA fragments that bind purified glucocorticoid receptor protein in vitro

    International Nuclear Information System (INIS)

    Yamamoto, K.R.; Payvar, F.; Firestone, G.L.; Maler, B.A.; Wrange, O.; Carlstedt-Duke, J.; Gustafsson, J.A.; Chandler, V.L.; Karolinska Institutet, Stockholm, Sweden)

    1983-01-01

    To test whether high-affinity receptor:DNA interactions can be correlated with receptor effects on promoter function in vivo, we have mapped in greater detail the receptor-binding regions on murine mammary tumor virus DNA, using both nitrocellulose-filter binding and electron microscopy. Recombinant plasmids bearing these receptor-binding domains have been transfected into cultured cells, and the expression of the plasmid sequences has been monitored for hormonal regulation. The results are considered in terms of a speculative proposal that the glucocorticoid receptor may effect changes in promoter activity via specific alteration of chromatin and/or DNA structure. 37 references, 6 figures, 2 tables

  14. Validation of a new test for Schistosoma haematobium based on detection of Dra1 DNA fragments in urine: evaluation through latent class analysis.

    Directory of Open Access Journals (Sweden)

    Olufunmilola Ibironke

    2012-01-01

    Full Text Available Diagnosis of urogenital schistosomiasis in chronically infected adults is challenging but important, especially because long term infection of the bladder and urinary tract can have dire consequences. We evaluated three tests for viable infection: detection of parasite specific DNA Dra1 fragments, haematuria and presence of parasite eggs for sensitivity (Se and specificity (Sp.Over 400 urine specimens collected from adult volunteers in an endemic area in Western Nigeria were assessed for haematuria then filtered in the field, the filter papers dried and later examined for eggs and DNA. The results were stratified according to sex and age and subjected to Latent Class analysis.Presence of Dra1 in males (Se=100%; Sp=100% exceeded haematuria (Se=87.6%: Sp=34.7% and detection of eggs (Se=70.1%; Sp=100%. In females presence of Dra1 was Se=100%: Sp=100%, exceeding haematuria (Se=86.7%: Sp=77.0% and eggs (Se=70.1%; Sp=100%. Dra1 became undetectable 2 weeks after praziquantel treatment. We conclude detection of Dra1 fragment is a definitive test for the presence of Schistosoma haematobium infection.

  15. Reactive oxygen species levels and DNA fragmentation on astrocytes in primary culture after acute exposure to low intensity microwave electromagnetic field.

    Science.gov (United States)

    Campisi, Agata; Gulino, Marisa; Acquaviva, Rosaria; Bellia, Paolo; Raciti, Giuseppina; Grasso, Rosaria; Musumeci, Francesco; Vanella, Angelo; Triglia, Antonio

    2010-03-31

    The exposure of primary rat neocortical astroglial cell cultures to acute electromagnetic fields (EMF) in the microwave range was studied. Differentiated astroglial cell cultures at 14 days in vitro were exposed for 5, 10, or 20min to either 900MHz continuous waves or 900MHz waves modulated in amplitude at 50Hz using a sinusoidal waveform and 100% modulation index. The strength of the electric field (rms value) at the sample position was 10V/m. No change in cellular viability evaluated by MTT test and lactate dehydrogenase release was observed. A significant increase in ROS levels and DNA fragmentation was found only after exposure of the astrocytes to modulated EMF for 20min. No evident effects were detected when shorter time intervals or continuous waves were used. The irradiation conditions allowed the exclusion of any possible thermal effect. Our data demonstrate, for the first time, that even acute exposure to low intensity EMF induces ROS production and DNA fragmentation in astrocytes in primary cultures, which also represent the principal target of modulated EMF. Our findings also suggest the hypothesis that the effects could be due to hyperstimulation of the glutamate receptors, which play a crucial role in acute and chronic brain damage. Furthermore, the results show the importance of the amplitude modulation in the interaction between EMF and neocortical astrocytes. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  16. Effect of ovarian tissue storage in Morus nigra extract on the morphology and DNA fragmentation of ovine preantral follicles

    Directory of Open Access Journals (Sweden)

    Agnes Yasmin Pitombeira Cavalcante

    2017-08-01

    Full Text Available This study demonstrated the effect of Morus nigra leaf extract during ovine ovarian tissue transportation on the survival and apoptosis of preantral follicles in vitro. High Performance Liquid Chromatography (HPLC was used to determine the fingerprint chromatogram of the crude ethanolic extract. Four pairs of ovaries from four sheep were collected. The ovarian cortex was fragmented and one fragment was fixed in 10% buffered formaldehyde and processed for histological and TUNEL analysis (fresh control. The other fragments were placed in Minimal Essential Medium (MEM – control medium or M. nigra extract (0.025; 0.05 or 0.1 mg/mL and stored (simulating transport at 4ºC for 6, 12 or 24 h. Preserved fragments (6 h were also destined to histological and TUNEL analysis. HPLC analysis confirmed the presence of antioxidant compounds (rutin, isoquercetin e kaempferitrin in the extract. There was a decrease (P 0.05 to 0.1 mg/mL of the extract. Apoptosis increased (P < 0.05 after conservation for 6 h in all treatments compared to the fresh control. Moreover, TUNEL positive cells decreased (P < 0.05 after preservation in 0.05 or 0.1 mg/mL M. nigra compared to MEM or 0.025 mg/mL M. nigra. In conclusion, 0.05 mg/mL M. nigra extract can be used as a preservation medium for ovine ovarian tissue at 4°C for up to 6 h.

  17. Sodium phenylbutyrate ameliorates focal cerebral ischemic/reperfusion injury associated with comorbid type 2 diabetes by reducing endoplasmic reticulum stress and DNA fragmentation.

    Science.gov (United States)

    Srinivasan, Krishnamoorthy; Sharma, Shyam S

    2011-11-20

    Endoplasmic reticulum (ER) stress has been postulated to play a crucial role in the pathophysiology of cerebral ischemic/reperfusion (I/R) injury and diabetes. Diabetes is a major risk factor and also common amongst the people who suffer from stroke. In this study, we have investigated the neuroprotective potential of sodium 4-phenylbutyrate (SPB; 30-300mg/kg), a chemical chaperone by targeting ER stress in a rat model of transient focal cerebral ischemia associated with comorbid type 2 diabetes. Intraperitoneal treatment with SPB (100 and 300mg/kg) significantly ameliorated brain I/R damage as evidenced by reduction in cerebral infarct and edema volume. It also significantly improved the functional recovery of various neurobehavioral impairments (neurological deficit score, grip strength and rota rod) evoked by I/R compared with vehicle-treatment. Further, SPB (100mg/kg) significantly reduced the DNA fragmentation as shown by prominent reduction in terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive cells. This effect was observed concomitantly with significant attenuation in upregulation of 78kDa glucose regulated protein (GRP78), CCAAT/enhancer binding protein homologous protein or growth arrest DNA damage-inducible gene 153 (CHOP/GADD153) and activation of caspase-12, specific markers of ER stress/apoptosis. The neuroprotection observed with SPB was independent of its effect on cerebral blood flow and blood glucose. In conclusion, this study demonstrates the neuroprotective effect of SPB owing to amelioration of ER stress and DNA fragmentation. It also suggest that targeting ER stress might offer a promising therapeutic approach and benefits against ischemic stroke associated with comorbid type 2 diabetes. Copyright © 2011 Elsevier B.V. All rights reserved.

  18. Gillnet Tag Program

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Certain fishery management programs require vessels to obtain gillnet tags to be used with their gillnet gear. Gillnet tag data is a collection of requests and...

  19. Cooperative Tagging Center (CTC)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Cooperative Tagging Center (CTC) began as the Cooperative Game Fish Tagging Program (GTP) at Woods Hole Oceanographic Institute (WHOI) in 1954. The GTP was...

  20. North Pacific Albacore Tagging

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Conventional tagging data are available from 1971 to 1996. Electronic tagging data are available from 2000 to present. The data are managed by SWFSC in Access...

  1. Tagging vs. Controlled Vocabulary

    DEFF Research Database (Denmark)

    Bogers, Toine; Petras, Vivien

    2015-01-01

    The popularity of social tagging has sparked a great deal of debate on whether tags could replace or improve upon professional metadata as descriptors of books and other information objects. In this paper we present a large-scale empirical comparison of the contributions of individual information...... that tags and controlled vocabulary terms do not actually outperform each other consistently, but seem to provide complementary contributions: some information needs are best addressed using controlled vocabulary terms whereas other are best addressed using tags....

  2. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  3. Towards Universal Semantic Tagging

    NARCIS (Netherlands)

    Abzianidze, Lasha; Bos, Johan

    2017-01-01

    The paper proposes the task of universal semantic tagging---tagging word tokens with language-neutral, semantically informative tags. We argue that the task, with its independent nature, contributes to better semantic analysis for wide-coverage multilingual text. We present the initial version of

  4. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  5. Extracting Tag Hierarchies

    Science.gov (United States)

    Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely

    2013-01-01

    Tagging items with descriptive annotations or keywords is a very natural way to compress and highlight information about the properties of the given entity. Over the years several methods have been proposed for extracting a hierarchy between the tags for systems with a "flat", egalitarian organization of the tags, which is very common when the tags correspond to free words given by numerous independent people. Here we present a complete framework for automated tag hierarchy extraction based on tag occurrence statistics. Along with proposing new algorithms, we are also introducing different quality measures enabling the detailed comparison of competing approaches from different aspects. Furthermore, we set up a synthetic, computer generated benchmark providing a versatile tool for testing, with a couple of tunable parameters capable of generating a wide range of test beds. Beside the computer generated input we also use real data in our studies, including a biological example with a pre-defined hierarchy between the tags. The encouraging similarity between the pre-defined and reconstructed hierarchy, as well as the seemingly meaningful hierarchies obtained for other real systems indicate that tag hierarchy extraction is a very promising direction for further research with a great potential for practical applications. Tags have become very prevalent nowadays in various online platforms ranging from blogs through scientific publications to protein databases. Furthermore, tagging systems dedicated for voluntary tagging of photos, films, books, etc. with free words are also becoming popular. The emerging large collections of tags associated with different objects are often referred to as folksonomies, highlighting their collaborative origin and the “flat” organization of the tags opposed to traditional hierarchical categorization. Adding a tag hierarchy corresponding to a given folksonomy can very effectively help narrowing or broadening the scope of search

  6. Extracting tag hierarchies.

    Directory of Open Access Journals (Sweden)

    Gergely Tibély

    Full Text Available Tagging items with descriptive annotations or keywords is a very natural way to compress and highlight information about the properties of the given entity. Over the years several methods have been proposed for extracting a hierarchy between the tags for systems with a "flat", egalitarian organization of the tags, which is very common when the tags correspond to free words given by numerous independent people. Here we present a complete framework for automated tag hierarchy extraction based on tag occurrence statistics. Along with proposing new algorithms, we are also introducing different quality measures enabling the detailed comparison of competing approaches from different aspects. Furthermore, we set up a synthetic, computer generated benchmark providing a versatile tool for testing, with a couple of tunable parameters capable of generating a wide range of test beds. Beside the computer generated input we also use real data in our studies, including a biological example with a pre-defined hierarchy between the tags. The encouraging similarity between the pre-defined and reconstructed hierarchy, as well as the seemingly meaningful hierarchies obtained for other real systems indicate that tag hierarchy extraction is a very promising direction for further research with a great potential for practical applications. Tags have become very prevalent nowadays in various online platforms ranging from blogs through scientific publications to protein databases. Furthermore, tagging systems dedicated for voluntary tagging of photos, films, books, etc. with free words are also becoming popular. The emerging large collections of tags associated with different objects are often referred to as folksonomies, highlighting their collaborative origin and the "flat" organization of the tags opposed to traditional hierarchical categorization. Adding a tag hierarchy corresponding to a given folksonomy can very effectively help narrowing or broadening the scope of

  7. Extracting tag hierarchies.

    Science.gov (United States)

    Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely

    2013-01-01

    Tagging items with descriptive annotations or keywords is a very natural way to compress and highlight information about the properties of the given entity. Over the years several methods have been proposed for extracting a hierarchy between the tags for systems with a "flat", egalitarian organization of the tags, which is very common when the tags correspond to free words given by numerous independent people. Here we present a complete framework for automated tag hierarchy extraction based on tag occurrence statistics. Along with proposing new algorithms, we are also introducing different quality measures enabling the detailed comparison of competing approaches from different aspects. Furthermore, we set up a synthetic, computer generated benchmark providing a versatile tool for testing, with a couple of tunable parameters capable of generating a wide range of test beds. Beside the computer generated input we also use real data in our studies, including a biological example with a pre-defined hierarchy between the tags. The encouraging similarity between the pre-defined and reconstructed hierarchy, as well as the seemingly meaningful hierarchies obtained for other real systems indicate that tag hierarchy extraction is a very promising direction for further research with a great potential for practical applications. Tags have become very prevalent nowadays in various online platforms ranging from blogs through scientific publications to protein databases. Furthermore, tagging systems dedicated for voluntary tagging of photos, films, books, etc. with free words are also becoming popular. The emerging large collections of tags associated with different objects are often referred to as folksonomies, highlighting their collaborative origin and the "flat" organization of the tags opposed to traditional hierarchical categorization. Adding a tag hierarchy corresponding to a given folksonomy can very effectively help narrowing or broadening the scope of search. Moreover

  8. Physical and chemical properties of chromatin and its fragments formed in the rat thymus during postirradiation autolysis and under the influence of DNA-ase and protease on DNP preparations

    International Nuclear Information System (INIS)

    Ermolaeva, N.V.; Vodolazskaya, N.A.

    1978-01-01

    It has been shown that the thymus chromatin degradation 2-8 hr after irradiation is followed by its cross-splitting and accumulation of several types of fragments differing in the degree of DNA association with the protein. Participation of proteases in the formation of fragments is hardly probable. Acid DNAase is involved in the autolysis perhaps in his maximum later 6 hr after irradiation

  9. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  10. Electrochemical sensors based on stationary electrodes and immobilized DNA or its fragments and the assessment of their analytical potentials

    Czech Academy of Sciences Publication Activity Database

    Babkina, S. S.; Paleček, Emil; Jelen, František; Fojta, Miroslav

    2005-01-01

    Roč. 60, č. 6 (2005), s. 567-572 ISSN 1061-9348. [VII All-Russia Conference (with international participation) on Electrochemical Methods of Analysis. Ufa, 23.05.2004-27.05.2004] R&D Projects: GA MPO(CZ) 1H-PK/42 Institutional research plan: CEZ:AV0Z50040507 Keywords : electrochemical biosensor * DNA imobilization * nitrocellulose matrix Subject RIV: BO - Biophysics Impact factor: 0.496, year: 2005

  11. A homicide in the Ukraine: DNA-based identification of a boiled, skeletonized, and varnished human skull, and of bone fragments found in a fireplace.

    Science.gov (United States)

    Sivolap, Y; Krivda, G; Kozhuhova, N; Chebotar, S; Benecke, M

    2001-12-01

    In an apartment, bone fragments were found in a fireplace. Furthermore, a varnished skull was found elsewhere in the same apartment. The tenant confessed to a murder and stated that the head of a victim, a girl, was boiled for 12 hours. He stated that the soft tissue was then removed and the skull was varnished. Other parts of the body were burned to ashes in an open field. Comparison of loci D19S252, CD4, CYAR04, TII01, F13A01, F13B, and D6S366 from the skull and the bone remains to loci of the mother of a missing girl showed that the skull came from that missing child. Biological maternity was calculated as 99.99%. The bone pieces were DNA typed as male and did not share alleles with the mother in several systems. Therefore, they belonged to a different (human) victim.

  12. Nucleolin forms a specific complex with a fragment of the viral (minus) strand of minute virus of mice DNA.

    Science.gov (United States)

    Barrijal, S; Perros, M; Gu, Z; Avalosse, B L; Belenguer, P; Amalric, F; Rommelaere, J

    1992-01-01

    Nucleolin, a major nucleolar protein, forms a specific complex with the genome (a single-stranded DNA molecule of minus polarity) of parvovirus MVMp in vitro. By means of South-western blotting experiments, we mapped the binding site to a 222-nucleotide motif within the non-structural transcription unit, referred to as NUBE (nucleolin-binding element). The specificity of the interaction was confirmed by competitive gel retardation assays. DNaseI and nuclease S1 probing showed that NUBE folds into a secondary structure, in agreement with a computer-assisted conformational prediction. The whole NUBE may be necessary for the interaction with nucleolin, as suggested by the failure of NUBE subfragments to bind the protein and by the nuclease footprinting experiments. The present work extends the previously reported ability of nucleolin to form a specific complex with ribosomal RNA, to a defined DNA substrate. Considering the tropism of MVMp DNA replication for host cell nucleoli, these data raise the possibility that nucleolin may contribute to the regulation of the parvoviral life-cycle. Images PMID:1408821

  13. Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

    Science.gov (United States)

    Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

    1996-05-16

    A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

  14. Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens

    International Nuclear Information System (INIS)

    Murphy, K.E.

    1989-01-01

    In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity

  15. Next-Generation Sequencing of Genomic DNA Fragments Bound to a Transcription Factor in Vitro Reveals Its Regulatory Potential

    Directory of Open Access Journals (Sweden)

    Yukio Kurihara

    2014-12-01

    Full Text Available Several transcription factors (TFs coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant’s transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5 transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq instead of the in vivo chromatin immunoprecipitation (ChIP-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function.

  16. Maternal exposure to a mixture of persistent organic pollutants (POPs) affects testis histology, epididymal sperm count and induces sperm DNA fragmentation in mice.

    Science.gov (United States)

    Khezri, Abdolrahman; Lindeman, Birgitte; Krogenæs, Anette K; Berntsen, Hanne F; Zimmer, Karin E; Ropstad, Erik

    2017-08-15

    Persistent organic pollutants (POPs) are widespread throughout the environment and some are suspected to induce reproductive toxicity. As animals and humans are exposed to complex mixtures of POPs, it is reasonable to assess how such mixtures could interact with the reproductive system. Our aim is to investigate how maternal exposure to a mixture of 29 different persistent organic pollutants, formulated to mimic the relative POP levels in the food basket of the Scandinavian population, could alter reproductive endpoints. Female mice were exposed via feed from weaning, during pregnancy and lactation in 3 exposure groups (control (C), low (L) and high (H)). Testicular morphometric endpoints, epididymal sperm concentration and sperm DNA integrity were assessed in adult male offspring. We found that the number of tubules, proportion of tubule compartments and epididymal sperm concentration significantly decreased in both POP exposed groups. Epididymal sperm from both POP exposed groups showed increased DNA fragmentation. It is concluded that maternal exposure to a defined POP mixture relevant to human exposure can affect testicular development, sperm production and sperm chromatin integrity. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

    Directory of Open Access Journals (Sweden)

    Gusti Ngurah Permana

    2016-11-01

    The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

  18. DNA fragmentation and cell cycle arrest: a hallmark of apoptosis induced by crocin from kashmiri saffron in a human pancreatic cancer cell line.

    Science.gov (United States)

    Bakshi, Hamid; Sam, Smitha; Rozati, Roya; Sultan, Phalisteen; Islam, Tajamul; Rathore, Babita; Lone, Zahoor; Sharma, Manik; Triphati, Jagrati; Saxena, Ramesh Chand

    2010-01-01

    Apoptosis, a widely important mechanism that contributes to cell growth reduction, is reported to be induced by Crocus sativus in different cancer types. The present study was designed to elucidate apoptosis induction by crocin, a main component of Crocus sativus in a human pancreatic cancer cell line (BxPC-3). Cell viability was measured by MTT assay, Hoechest33258 staining was used to detect the chromatin condensation characteristic of apoptosis, and DNA fragmentation was assessed by gel electrophoresis and cell cycle analysis by flow cytometry. Crocin induced apoptosis and G1-phase cell cycle arrest of BxPC-3 cells, while decreasing cell viability in a dose dependent and time dependent manner. Cells treated with 10μg/L crocin exhibited apoptotic morphology (brightly blue-fluorescent condensed nuclei on Hoechst 33258 staining) and reduction of volume. DNA analysis revealed typical ladders as early as 12 hours after treatment indicative of apoptosis. Our preclinical study demonstrated a pancreatic cancer cell line to be highly sensitive to crocin-mediated growth inhibition and apoptotic cell death. Although the molecular mechanisms of crocin action are not yet clearly understood, it appears to have potential as a therapeutic agent.

  19. Porcine transcriptome analysis based on 97 non-normalized cDNA libraries and assembly of 1,021,891 expressed sequence tags

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Cirera, Susanna; Hedegaard, Jacob

    2007-01-01

    public databases. The Sino-Danish ESTs were generated from one normalized and 97 non-normalized cDNA libraries representing 35 different tissues and three developmental stages. RESULTS: Using the Distiller package, the ESTs were assembled to roughly 48,000 contigs and 73,000 singletons, of which...... with the greatest number of different expressed genes, whereas tissues with more specialized function, such as developing liver, have fewer expressed genes. There are at least 65 high confidence housekeeping gene candidates and 876 cDNA library-specific gene candidates. We identified differential expression...

  20. DNA fragmentation: manifestation of target cell destruction mediated by cytotoxic T-cell lines, lymphotoxin-secreting helper T-cell clones, and cell-free lymphotoxin-containing supernatant

    International Nuclear Information System (INIS)

    Schmid, D.S.; Tite, J.P.; Ruddle, N.H.

    1986-01-01

    A Lyt-2 + , trinitrophenyl-specific, lymphotoxin-secreting, cytotoxic T-cell line, PCl 55, mediates the digestion of target cell DNA into discretely sized fragments. This phenomenon manifests itself within 30 min after effector cell encounter as measured by the release of 3 H counts from target cells prelabeled with [ 3 H]deoxythymidine and occurs even at very low effector to target cell ratios (0.25:1). A Lyt-1 + , ovalbumin-specific, lymphotoxin-secreting T-helper cell clone, 5.9.24, is also able to mediate fragmentation of target cell DNA over a time course essentially indistinguishable from the cytotoxic T lymphocyte-mediated hit. Cell-free lymphotoxin-containing supernatants also cause release of DNA from targets, although they require a longer time course, on the order of 24 hr. In contrast, lysis of cells by antibody plus complement or Triton X-100 does not result in DNA release even after extended periods of incubation (24 hr). All three treatments that result in the release of DNA from cells cause fragmentation of that DNA into discretely sized pieces that are multiples of 200 base pairs. The results thus suggest that cytotoxic T cells, lymphotoxin-secreting helper clones with cytolytic activity, and lymphotoxin all effect target cell destruction by means of a similar mechanism and that observed differences in time course and the absence of target cell specificity in killing mediated by lymphotoxin may simply reflect differences in the mode of toxin delivery

  1. Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

    Science.gov (United States)

    Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

    2018-02-01

    Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

  2. Tags on healthcare information websites

    DEFF Research Database (Denmark)

    Lykke, Marianne; Ådland, Marit Kristine

    2018-01-01

    This paper explores tags and tagging behaviour on health information websites using an empirical, user-oriented, exploratory case study. Taggers and editors were interviewed about tags and tagging, while taggers solved tasks that included applying tags to a website. This qualitative data...... articles, request information, and value article content. Some of these show that tags are not only not only topical descriptions, but communicative by intent. This result can potentially inform the design of tagging features....

  3. Internalization of Staphylococcus aureus in Lymphocytes Induces Oxidative Stress and DNA Fragmentation: Possible Ameliorative Role of Nanoconjugated Vancomycin

    Directory of Open Access Journals (Sweden)

    Subhankari Prasad Chakraborty

    2011-01-01

    Full Text Available Staphylococcus aureus is the most frequently isolated pathogen causing bloodstream infections, skin and soft tissue infections and pneumonia. Lymphocyte is an important immune cell. The aim of the present paper was to test the ameliorative role of nanoconjugated vancomycin against Vancomycin-sensitive Staphylococcus aureus (VSSA and vancomycin-resistant Staphylococcus aureus (VRSA infection-induced oxidative stress in lymphocytes. VSSA and VRSA infections were developed in Swiss mice by intraperitoneal injection of 5×106 CFU/mL bacterial solutions. Nanoconjugated vancomycin was adminstrated to VSSA- and VRSA-infected mice at its effective dose for 10 days. Vancomycin was adminstrated to VSSA- and VRSA-infected mice at a similar dose, respectively, for 10 days. Vancomycin and nanoconjugated vancomycin were adminstrated to normal mice at their effective doses for 10 days. The result of this study reveals that in vivo VSSA and VRSA infection significantly increases the level of lipid peroxidation, protein oxidation, oxidized glutathione level, nitrite generation, nitrite release, and DNA damage and decreases the level of reduced glutathione, antioxidant enzyme status, and glutathione-dependent enzymes as compared to control group, which were increased or decreased significantly near to normal in nanoconjugated vancomycin-treated group. These findings suggest the potential use and beneficial role of nanoconjugated vancomycin against VSSA and VRSA infection-induced oxidative stress in lymphocytes.

  4. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  5. DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line.

    Science.gov (United States)

    Takahashi, S; Maecker, H T; Levy, R

    1989-10-01

    An anti-T cell receptor (TcR) monoclonal antibody (mAb), LC4, directed against a human leukemic T cell line, SUP-T13, caused DNA fragmentation ("apoptosis") and cell death upon binding to this cell line. Cross-linking of receptor molecules was necessary for this effect since F(ab')2, but not Fab', fragments of LC4 could induce cell death. Five anti-CD3 mAb tested also caused apoptosis, but only when they were presented on a solid phase. Interestingly, soluble anti-CD3 mAb induced calcium flux and had an additive effect on the calcium flux and interleukin 2 receptor expression induced by LC4, but these anti-CD3 mAb reversed the growth inhibition and apoptosis caused by LC4. The calcium ionophore A23187, but not the protein kinase C activator phorbol 12-myristate 13-acetate (PMA), also induced apoptosis, suggesting that protein kinase C activation alone does not cause apoptosis, although PMA is growth inhibitory. These results suggest that two distinct biological phenomena can accompany stimulation of the TcR/CD3 complex. In both cases, calcium flux and interleukin 2 receptor expression is induced, but only in one case is apoptosis and cell death seen. The signal initiating apoptosis can be selectively prevented by binding CD3 portion of the receptor in this cell line. This difference in signals mediated by the TcR/CD3 complex may be important in explaining the process of thymic selection, as well as in choosing anti-TcR mAb for therapeutic use.

  6. A Strengths-Weaknesses-Opportunities-Threats (SWOT) analysis on the clinical utility of sperm DNA fragmentation testing in specific male infertility scenarios.

    Science.gov (United States)

    Esteves, Sandro C; Agarwal, Ashok; Cho, Chak-Lam; Majzoub, Ahmad

    2017-09-01

    Sperm DNA fragmentation (SDF) is recognized as a leading cause of male infertility because it can impair the paternal genome through distinct pathophysiological mechanisms. Current evidence supports SDF as a major factor in the pathophysiology of several conditions, including varicocele, unexplained infertility, assisted reproductive technology failure, and environmental lifestyle factors, although the mechanisms involved have not been fully described yet. Measurement of the levels of DNA fragmentation in semen provides valuable information on the integrity of paternal chromatin and may guide therapeutic strategies. A recently published clinical practice guideline (CPG) highlighted how to use the information provided by SDF testing in daily practice, which triggered a series of commentaries by leading infertility experts. These commentaries contained an abundance of information and conflicting views about the clinical utility of SDF testing, which underline the complex nature of SDF. A search of papers published in response to the CPG entitled "Clinical utility of sperm DNA fragmentation testing: practice recommendations based on clinical scenarios" was performed within the Translational Andrology and Urology ( TAU ) website (http://tau.amegroups.com/). The start and end dates for the search were May 2017 and August 2017, respectively. Each commentary meeting our inclusion criteria was rated as "supportive without reservation", "supportive with reservation", "not supportive" or "neutral". We recorded whether articles discussed either SDF characteristics as a laboratory test method or clinical scenarios, or both. Subsequently, we extracted the particulars from each commentary and utilized the 'Strengths-Weaknesses-Opportunities-Threats' (SWOT) analysis to understand the perceived advantages and drawbacks of SDF as a specialized sperm function method in clinical practice. Fifty-eight fertility experts from six continents and twenty-two countries contributed

  7. Coupled aggregation of mitochondrial single-strand DNA-binding protein tagged with Eos fluorescent protein visualizes synchronized activity of mitochondrial nucleoids

    Czech Academy of Sciences Publication Activity Database

    Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr

    2015-01-01

    Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single-stranded DNA-binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015

  8. Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

    Science.gov (United States)

    Stevens, Mark; Viganó, Felicita

    2007-04-01

    The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

  9. Characterization of primary biogenic aerosol particles in urban, rural, and high-alpine air by DNA sequence and restriction fragment analysis of ribosomal RNA genes

    Directory of Open Access Journals (Sweden)

    V. R. Després

    2007-12-01

    Full Text Available This study explores the applicability of DNA analyses for the characterization of primary biogenic aerosol (PBA particles in the atmosphere. Samples of fine particulate matter (PM2.5 and total suspended particulates (TSP have been collected on different types of filter materials at urban, rural, and high-alpine locations along an altitude transect in the south of Germany (Munich, Hohenpeissenberg, Mt. Zugspitze.

    From filter segments loaded with about one milligram of air particulate matter, DNA could be extracted and DNA sequences could be determined for bacteria, fungi, plants and animals. Sequence analyses were used to determine the identity of biological organisms, and terminal restriction fragment length polymorphism analyses (T-RFLP were applied to estimate diversities and relative abundances of bacteria. Investigations of blank and background samples showed that filter materials have to be decontaminated prior to use, and that the sampling and handling procedures have to be carefully controlled to avoid artifacts in the analyses.

    Mass fractions of DNA in PM2.5 were found to be around 0.05% in urban, rural, and high-alpine aerosols. The average concentration of DNA determined for urban air was on the order of ~7 ng m−3, indicating that human adults may inhale about one microgram of DNA per day (corresponding to ~108 haploid bacterial genomes or ~105 haploid human genomes, respectively.

    Most of the bacterial sequences found in PM2.5 were from Proteobacteria (42 and some from Actinobacteria (10 and Firmicutes (1. The fungal sequences were characteristic for Ascomycota (3 and Basidiomycota (1, which are known to actively discharge spores into the atmosphere. The plant sequences could be attributed to green plants (2 and moss spores (2, while animal DNA was found only for one unicellular eukaryote (protist.

  10. PIT Tagging Anurans

    Science.gov (United States)

    McCreary, Brome

    2008-01-01

    The following video demonstrates a procedure to insert a passive integrated transponder (PIT) tag under the skin of an anuran (frog or toad) for research and monitoring purposes. Typically, a 12.5 mm tag (0.5 in.) is used to uniquely identify individual anurans as smal as 40 mm (1.6 in.) in length from snout to vent. Smaller tags are also available and allow smaller anurans to be tagged. The procedure does not differ for other sizes of tages or other sizes of anurans. Anyone using this procedure should ensure that the tag is small enough to fit easily behind the sacral hump of the anuran, as shown in this video.

  11. Jet fragmentation

    International Nuclear Information System (INIS)

    Saxon, D.H.

    1985-10-01

    The paper reviews studies on jet fragmentation. The subject is discussed under the topic headings: fragmentation models, charged particle multiplicity, bose-einstein correlations, identified hadrons in jets, heavy quark fragmentation, baryon production, gluon and quark jets compared, the string effect, and two successful models. (U.K.)

  12. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  13. An efficient system for deletion of large DNA fragments in Escherichia coli via introduction of both Cas9 and the non-homologous end joining system from Mycobacterium smegmatis.

    Science.gov (United States)

    Zheng, Xuan; Li, Shi-Yuan; Zhao, Guo-Ping; Wang, Jin

    2017-04-15

    Accompanied with the internal non-homologous end joining (NHEJ) system, Cas9 can be used to easily inactivate a gene or delete a fragment through introduction of DNA double-stranded breaks (DSBs) in eukaryotic cells. While in most prokaryotes (e.g. Escherichia coli), due to the lack of NHEJ, homologous recombination (HR) is required for repair of DSBs, which is less convenient. Here, a markerless system was developed for rapid gene inactivation or fragment deletion in E. coli via introduction of both Cas9 and a bacterial NHEJ system. Three bacterial NHEJ systems, i.e. Mycobacterium smegmatis (Msm), Mycobacterium tuberculosis (Mtb) and Bacillus subtilis (Bs), were tested in E. coli, and the MsmNHEJ system showed the best efficiency. With the employment of Cas9 and MsmNHEJ, we efficiently mutated lacZ gene, deleted glnALG operon and two large DNA fragments (67 kb and 123 kb) in E. coli, respectively. Moreover, the system was further designed to allow for continuous inactivation of genes or deletion of DNA fragments in E. coli. We envision this system can be extended to other bacteria, especially those with low HR efficiency. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Comprehensive analysis of sperm DNA fragmentation by five different assays: TUNEL assay, SCSA, SCD test and alkaline and neutral Comet assay.

    Science.gov (United States)

    Ribas-Maynou, J; García-Peiró, A; Fernández-Encinas, A; Abad, C; Amengual, M J; Prada, E; Navarro, J; Benet, J

    2013-09-01

    Sperm DNA fragmentation (SDF) is becoming an important test to assess male infertility. Several different tests are available, but no consensus has yet been reached as to which tests are most predictive of infertility. Few publications have reported a comprehensive analysis comparing these methods within the same population. The objective of this study was to analyze the differences between the five most common methodologies, to study their correlations and to establish their cut-off values, sensitivity and specificity in predicting male infertility. We found differences in SDF between fertile donors and infertile patients in TUNEL, SCSA, SCD and alkaline Comet assays, but none with the neutral Comet assay. The alkaline COMET assay was the best in predicting male infertility followed by TUNEL, SCD and SCSA, whereas the neutral COMET assay had no predictive power. For our patient population, threshold values for infertility were 20.05% for TUNEL assay, 18.90% for SCSA, 22.75% for the SCD test, 45.37% for alkaline Comet and 34.37% for neutral Comet. This work establishes in a comprehensive study that the all techniques except neutral Comet are useful to distinguish fertile and infertile men. © 2013 American Society of Andrology and European Academy of Andrology.

  15. The innate immunity adaptor SARM translocates to the nucleus to stabilize lamins and prevent DNA fragmentation in response to pro-apoptotic signaling.

    Directory of Open Access Journals (Sweden)

    Chad R Sethman

    Full Text Available Sterile alpha and armadillo-motif containing protein (SARM, a highly conserved and structurally unique member of the MyD88 family of Toll-like receptor adaptors, plays an important role in innate immunity signaling and apoptosis. Its exact mechanism of intracellular action remains unclear. Apoptosis is an ancient and ubiquitous process of programmed cell death that results in disruption of the nuclear lamina and, ultimately, dismantling of the nucleus. In addition to supporting the nuclear membrane, lamins serve important roles in chromatin organization, epigenetic regulation, transcription, nuclear transport, and mitosis. Mutations and other damage that destabilize nuclear lamins (laminopathies underlie a number of intractable human diseases. Here, we report that SARM translocates to the nucleus of human embryonic kidney cells by using its amino-terminal Armadillo repeat region. Within the nucleus, SARM forms a previously unreported lattice akin to the nuclear lamina scaffold. Moreover, we show that SARM protects lamins from apoptotic degradation and reduces internucleosomal DNA fragmentation in response to signaling induced by the proinflammatory cytokine Tumor Necrosis Factor alpha. These findings indicate an important link between the innate immunity adaptor SARM and stabilization of nuclear lamins during inflammation-driven apoptosis in human cells.

  16. Flavour Tagging at LHCb

    CERN Multimedia

    Grabalosa Gandara, M

    2009-01-01

    To do precise CP violation measurements, the most possible accurate knowledge of the flavour at production of the reconstructed B meson is required. This poster summarizes the flavour tagging performances for the LHCb experiment. We use same side an opposite side algorithms to establish wheter the meson contained a b or a b\\bar quark. The final decision is obtained through a combination of several methods. The use of control channels, decays to a flavour specific final state, will allow to determine the wrong tag fraction \\omega (the probability of a tag to be wrong), which can be used as input for the determination of CKM unitary triangle angles.

  17. Experience in the use of docosahexaenoic acid (BrudiPlus in patients with increased sperm DNA fragmentation index in Acad. V.I. Kulakov Research Center for Obstetrics, Gynecology and Perinatology

    Directory of Open Access Journals (Sweden)

    A. Yu. Popova

    2015-01-01

    Full Text Available Male factor is the reason of infertility in almost half of marriages. Infertile men have the percentage of sperm with violations of DNA integrity of over 30 %; with that, healthy fertile men have that indicator of less than 15 %. Understanding of importance of damages of sperm DNA is growing with distribution ofauxiliary reproductive technologies. As of today, these consequences have not been studies yet, and the therapeutic effect of intake of antioxidants has not direct correlation with the sperm DNA fragmentation level. Docosahexaenoic acid is one of the most valuable omega-3 polyunsaturated fatty acids for human health. Docosahexaenoic acid is the main component of the brain gray matter, retina, testes, and sperm cell membranes. In connection with that, a study was held the purpose of which was to assess the effect of the nutraceutical enzymatic docosahexaenoic acid triglyceride (BrudiPlus in high concentrations on damaged sperm DNA of patients with idiopathic pathozoospermia. 40 patients with idiopathic pathozoospermia and the level of DNA fragmentation over the statutory value took part in this study. The following positive results were received: intake of BrudiPlus allowed decreasing sperm DNA damages and improving of antioxidant system of sperm. 

  18. Tagged Vector Contour (TVC)

    Data.gov (United States)

    Kansas Data Access and Support Center — The Kansas Tagged Vector Contour (TVC) dataset consists of digitized contours from the 7.5 minute topographic quadrangle maps. Coverage for the state is incomplete....

  19. Polymer fragmentation in extensional flow

    Energy Technology Data Exchange (ETDEWEB)

    Maroja, Armando M.; Oliveira, Fernando A.; Ciesla, Michal; Longa, Lech

    2001-06-01

    In this paper we present an analysis of fragmentation of dilute polymer solutions in extensional flow. The transition rate is investigated both from theoretical and computational approaches, where the existence of a Gaussian distribution for the breaking bonds has been controversial. We give as well an explanation for the low fragmentation frequency found in DNA experiments.

  20. A Novel Recombinant DNA System for High Efficiency Affinity Purification of Proteins in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Brian H. Carrick

    2016-03-01

    Full Text Available Isolation of endogenous proteins from Saccharomyces cerevisiae has been facilitated by inserting encoding polypeptide affinity tags at the C-termini of chromosomal open reading frames (ORFs using homologous recombination of DNA fragments. Tagged protein isolation is limited by a number of factors, including high cost of affinity resins for bulk isolation and low concentration of ligands on the resin surface, leading to low isolation efficiencies and trapping of contaminants. To address this, we have created a recombinant “CelTag” DNA construct from which PCR fragments can be created to easily tag C-termini of S. cerevisiae ORFs using selection for a nat1 marker. The tag has a C-terminal cellulose binding module to be used in the first affinity step. Microgranular cellulose is very inexpensive and has an effectively continuous ligand on its surface, allowing rapid, highly efficient purification with minimal background. Cellulose-bound proteins are released by specific cleavage of an included site for TEV protease, giving nearly pure product. The tag can be lifted from the recombinant DNA construct either with or without a 13x myc epitope tag between the target ORF and the TEV protease site. Binding of CelTag protein fusions to cellulose is stable to high salt, nonionic detergents, and 1 M urea, allowing stringent washing conditions to remove loosely associated components, as needed, before specific elution. It is anticipated that this reagent could allow isolation of protein complexes from large quantities of yeast extract, including soluble, membrane-bound, or nucleic acid-associated assemblies.

  1. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    Science.gov (United States)

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  2. Short communication: Evaluation of the microbiota of kefir samples using metagenetic analysis targeting the 16S and 26S ribosomal DNA fragments.

    Science.gov (United States)

    Korsak, N; Taminiau, B; Leclercq, M; Nezer, C; Crevecoeur, S; Ferauche, C; Detry, E; Delcenserie, V; Daube, G

    2015-06-01

    Milk kefir is produced by fermenting milk in the presence of kefir grains. This beverage has several benefits for human health. The aim of this experiment was to analyze 5 kefir grains (and their products) using a targeted metagenetic approach. Of the 5 kefir grains analyzed, 1 was purchased in a supermarket, 2 were provided by the Ministry of Agriculture (Namur, Belgium), and 2 were provided by individuals. The metagenetic approach targeted the V1-V3 fragment of the 16S ribosomal (r)DNA for the grains and the resulting beverages at 2 levels of grain incorporation (5 and 10%) to identify the bacterial species population. In contrast, the 26S rDNA pyrosequencing was performed only on kefir grains with the aim of assessing the yeast populations. In parallel, pH measurements were performed on the kefir obtained from the kefir grains using 2 incorporation rates. Regarding the bacterial population, 16S pyrosequencing revealed the presence of 20 main bacterial species, with a dominance of the following: Lactobacillus kefiranofaciens, Lactococcus lactis ssp. cremoris, Gluconobacter frateurii, Lactobacillus kefiri, Acetobacter orientalis, and Acetobacter lovaniensis. An important difference was noticed between the kefir samples: kefir grain purchased from a supermarket (sample E) harbored a much higher proportion of several operational taxonomic units of Lactococcus lactis and Leuconostoc mesenteroides. This sample of grain was macroscopically different from the others in terms of size, apparent cohesion of the grains, structure, and texture, probably associated with a lower level of Lactobacillus kefiranofaciens. The kefir (at an incorporation rate of 5%) produced from this sample of grain was characterized by a lower pH value (4.5) than the others. The other 4 samples of kefir (5%) had pH values above 5. Comparing the kefir grain and the kefir, an increase in the population of Gluconobacter in grain sample B was observed. This was also the case for Acetobacter orientalis

  3. Relationship of leptin administration with production of reactive oxygen species, sperm DNA fragmentation, sperm parameters and hormone profile in the adult rat.

    Science.gov (United States)

    Abbasihormozi, Shima; Shahverdi, Abdolhossein; Kouhkan, Azam; Cheraghi, Javad; Akhlaghi, Ali Asghar; Kheimeh, Abolfazl

    2013-06-01

    Leptin, an adipose tissue-derived hormone, plays an important role in energy homeostasis and metabolism, and in the neuroendocrine and reproductive systems. The function of leptin in male reproduction is unclear; however, it is known to affect sex hormones, sperm motility and its parameters. Leptin induces mitochondrial superoxide production in aortic endothelia and may increase oxidative stress and abnormal sperm production in leptin-treated rats. This study aims to evaluate whether exogenous leptin affects sperm parameters, hormone profiles, and the production of reactive oxygen species (ROS) in adult rats. A total of 65 Sprague-Dawley rats were divided into three treated groups and a control group. Treated rats received daily intraperitoneal injections of 5, 10 and 30 μg/kg of leptin administered for a duration of 7, 15, and 42 days. Control rats were given 0.1 mL of 0.9 % normal saline for the same period. One day after final drug administration, we evaluated serum specimens for follicle-stimulating hormone (FSH), leutinizing hormone (LH), free testosterone (FT), and total testosterone (TT) levels. Samples from the rat epididymis were also evaluated for sperm parameters and motility characteristics by a Computer-Aided Semen Analysis (CASA) system. Samples were treated with 2',7'-dichlorofluorescein-diacetate (DCFH-DA) and analyzed using flow cytometry and TUNEL to determine the impact of leptin administration on sperm DNA fragmentation. According to CASA, significant differences in all sperm parameters in leptin-treated rats and their age-matched controls were detected, except for TM, ALH and BCF. Serum FSH and LH levels were significantly higher in rats that received 10 and 30 μg/kg of leptin compared to those treated with 5 μg/kg of leptin in the same group and control rats (P control group (P hormone profile modulation.

  4. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Directory of Open Access Journals (Sweden)

    Hong Wei Yang

    2001-01-01

    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  5. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  6. Melatonin sensitizes human cervical cancer HeLa cells to cisplatin-induced cytotoxicity and apoptosis: effects on oxidative stress and DNA fragmentation.

    Science.gov (United States)

    Pariente, Roberto; Pariente, José A; Rodríguez, Ana B; Espino, Javier

    2016-01-01

    Melatonin has antitumor activity via several mechanisms including its antiproliferative and pro-apoptotic effects as well as its potent antioxidant actions, although recent evidence has indicated that melatonin may perform pro-oxidant actions in tumor cells. Therefore, melatonin may be useful in the treatment of tumors in association with chemotherapy drugs. This study was intended to evaluate the in vitro effect of melatonin on the cytotoxic and pro-apoptotic actions of various chemotherapeutic agents in cervical cancer HeLa cells. Herein, we found that both melatonin and three of the chemotherapeutic drugs tested, namely cisplatin (CIS), 5-fluorouracil (5-FU), and doxorubicin, induced a decrease in HeLa cell viability. Furthermore, melatonin significantly increased the cytotoxic effect of such chemotherapeutic agents. Consistently, costimulation of HeLa cells with any chemotherapeutic agent in the presence of melatonin further increased caspase-3 activation, particularly in CIS- and 5-FU-challenged cells. Likewise, concomitant treatments with melatonin and CIS significantly enhanced the ratio of cells entering mitochondrial apoptosis due to reactive oxygen species (ROS) overproduction, substantially augmented the population of apoptotic cells, and markedly enlarged DNA fragmentation compared to the treatments with CIS alone. Nonetheless, melatonin only displayed moderate chemosensitizing effects in 5-FU-stimulated HeLa cells, as suggested by slight increments in the percentage of cells stimulated for ROS production and in the proportion of early apoptotic cells compared to the treatments with 5-FU alone. In summary, our findings provided evidence that in vitro melatonin strongly enhances CIS-induced cytotoxicity and apoptosis in HeLa cells and, hence, the indoleamine could be potentially applied to cervical cancer treatment as a powerful synergistic agent. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Certain amplified genomic-DNA fragments (AGFs) may be involved in cell cycle progression and chloroquine is found to induce the production of cell-cycle-associated AGFs (CAGFs) in Plasmodium falciparum

    OpenAIRE

    Li, Gao-De

    2015-01-01

    It is well known that cyclins are a family of proteins that control cell-cycle progression by activating cyclin-dependent kinase. Based on our experimental results, we propose here a novel hypothesis that certain amplified genomic-DNA fragments (AGFs) may also be required for the cell cycle progression of eukaryotic cells and thus can be named as cell-cycle-associated AGFs (CAGFs). Like fluctuation in cyclin levels during cell cycle progression, these CAGFs are amplified and degraded at diffe...

  8. Nuclear fragmentation

    International Nuclear Information System (INIS)

    Chung, K.C.

    1989-01-01

    An introduction to nuclear fragmentation, with emphasis in percolation ideas, is presented. The main theoretical models are discussed and as an application, the uniform expansion approximation is presented and the statistical multifragmentation model is used to calculate the fragment energy spectra. (L.C.)

  9. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    Science.gov (United States)

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  10. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  11. A putative non-hr origin of DNA replication in the HindIII-K fragment of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus

    NARCIS (Netherlands)

    Kool, M.; Goldbach, R. W.; Vlak, J. M.

    1994-01-01

    In addition to the seven known homologous regions (hrs) of Autographa californica multiple nucleocapsid polyhedrosis virus (AcMNPV) the HindIII-K fragment was also found to carry a putative ori, although this fragment does not contain an hr. Deletion analysis showed that this ori contains several

  12. Inclusive Flavour Tagging Algorithm

    International Nuclear Information System (INIS)

    Likhomanenko, Tatiana; Derkach, Denis; Rogozhnikov, Alex

    2016-01-01

    Identifying the flavour of neutral B mesons production is one of the most important components needed in the study of time-dependent CP violation. The harsh environment of the Large Hadron Collider makes it particularly hard to succeed in this task. We present an inclusive flavour-tagging algorithm as an upgrade of the algorithms currently used by the LHCb experiment. Specifically, a probabilistic model which efficiently combines information from reconstructed vertices and tracks using machine learning is proposed. The algorithm does not use information about underlying physics process. It reduces the dependence on the performance of lower level identification capacities and thus increases the overall performance. The proposed inclusive flavour-tagging algorithm is applicable to tag the flavour of B mesons in any proton-proton experiment. (paper)

  13. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  14. Personalization of tagging systems

    NARCIS (Netherlands)

    J. Wang (Jun); M. Clements (Maarten); J. Yang; A.P. de Vries (Arjen); M.J.T. Reinders

    2010-01-01

    htmlabstractSocial media systems have encouraged end user participation in the Internet, for the purpose of storing and distributing Internet content, sharing opinions and maintaining relationships. Collaborative tagging allows users to annotate the resulting user-generated content, and enables

  15. TagPad

    DEFF Research Database (Denmark)

    Bornoe, Nis; Barkhuus, Louise

    2013-01-01

    The area of cyberinfrastructures has looked extensively at research within the natural sciences, however, the social sciences have been largely overlooked in terms of novel data collection and analysis systems. We developed a probe tool, TagPad, to look at the process for social science data...

  16. Ontologies and tag-statistics

    Science.gov (United States)

    Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely

    2012-05-01

    Due to the increasing popularity of collaborative tagging systems, the research on tagged networks, hypergraphs, ontologies, folksonomies and other related concepts is becoming an important interdisciplinary area with great potential and relevance for practical applications. In most collaborative tagging systems the tagging by the users is completely ‘flat’, while in some cases they are allowed to define a shallow hierarchy for their own tags. However, usually no overall hierarchical organization of the tags is given, and one of the interesting challenges of this area is to provide an algorithm generating the ontology of the tags from the available data. In contrast, there are also other types of tagged networks available for research, where the tags are already organized into a directed acyclic graph (DAG), encapsulating the ‘is a sub-category of’ type of hierarchy between each other. In this paper, we study how this DAG affects the statistical distribution of tags on the nodes marked by the tags in various real networks. The motivation for this research was the fact that understanding the tagging based on a known hierarchy can help in revealing the hidden hierarchy of tags in collaborative tagging systems. We analyse the relation between the tag-frequency and the position of the tag in the DAG in two large sub-networks of the English Wikipedia and a protein-protein interaction network. We also study the tag co-occurrence statistics by introducing a two-dimensional (2D) tag-distance distribution preserving both the difference in the levels and the absolute distance in the DAG for the co-occurring pairs of tags. Our most interesting finding is that the local relevance of tags in the DAG (i.e. their rank or significance as characterized by, e.g., the length of the branches starting from them) is much more important than their global distance from the root. Furthermore, we also introduce a simple tagging model based on random walks on the DAG, capable of

  17. Ontologies and tag-statistics

    International Nuclear Information System (INIS)

    Tibély, Gergely; Vicsek, Tamás; Pollner, Péter; Palla, Gergely

    2012-01-01

    Due to the increasing popularity of collaborative tagging systems, the research on tagged networks, hypergraphs, ontologies, folksonomies and other related concepts is becoming an important interdisciplinary area with great potential and relevance for practical applications. In most collaborative tagging systems the tagging by the users is completely ‘flat’, while in some cases they are allowed to define a shallow hierarchy for their own tags. However, usually no overall hierarchical organization of the tags is given, and one of the interesting challenges of this area is to provide an algorithm generating the ontology of the tags from the available data. In contrast, there are also other types of tagged networks available for research, where the tags are already organized into a directed acyclic graph (DAG), encapsulating the ‘is a sub-category of’ type of hierarchy between each other. In this paper, we study how this DAG affects the statistical distribution of tags on the nodes marked by the tags in various real networks. The motivation for this research was the fact that understanding the tagging based on a known hierarchy can help in revealing the hidden hierarchy of tags in collaborative tagging systems. We analyse the relation between the tag-frequency and the position of the tag in the DAG in two large sub-networks of the English Wikipedia and a protein-protein interaction network. We also study the tag co-occurrence statistics by introducing a two-dimensional (2D) tag-distance distribution preserving both the difference in the levels and the absolute distance in the DAG for the co-occurring pairs of tags. Our most interesting finding is that the local relevance of tags in the DAG (i.e. their rank or significance as characterized by, e.g., the length of the branches starting from them) is much more important than their global distance from the root. Furthermore, we also introduce a simple tagging model based on random walks on the DAG, capable of

  18. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...... an inverse correlation between anti-dsDNA antibodies and the DNA concentration in the circulation in both murine and human serum samples. High titer of anti-DNA antibodies in human sera correlated with reduced levels of circulating chromatin, and in lupus prone mice with deposition within glomeruli....... The inverse correlation between DNA concentration and anti-dsDNA antibodies may reflect antibody-dependent deposition of immune complexes during the development of lupus nephritis in autoimmune lupus prone mice. The measurement of circulating DNA in SLE sera by using qPCR may indicate and detect...

  19. Controlled fragmentation

    International Nuclear Information System (INIS)

    Arnold, Werner

    2002-01-01

    Contrary to natural fragmentation, controlled fragmentation offers the possibility to adapt fragment parameters like size and mass to the performance requirements in a very flexible way. Known mechanisms like grooves inside the casing, weaken the structure. This is, however, excluded for applications with high accelerations during launch or piercing requirements for example on a semi armor piercing penetrator. Another method to achieve controlled fragmentation with an additional grid layer is presented with which the required grooves are produced 'just in time' inside the casing during detonation of the high explosive. The process of generating the grooves aided by the grid layer was studied using the hydrocode HULL with respect to varying grid designs and material combinations. Subsequent to this, a large range of these theoretically investigated combinations was contemplated in substantial experimental tests. With an optimised grid design and a suitable material selection, the controlled fragment admits a very flexible adaptation to the set requirements. Additional advantages like the increase of perforation performance or incendiary amplification can be realized with the grid layer

  20. Identifying novel genes in C. elegans using SAGE tags

    Directory of Open Access Journals (Sweden)

    Chen Nansheng

    2010-12-01

    Full Text Available Abstract Background Despite extensive efforts devoted to predicting protein-coding genes in genome sequences, many bona fide genes have not been found and many existing gene models are not accurate in all sequenced eukaryote genomes. This situation is partly explained by the fact that gene prediction programs have been developed based on our incomplete understanding of gene feature information such as splicing and promoter characteristics. Additionally, full-length cDNAs of many genes and their isoforms are hard to obtain due to their low level or rare expression. In order to obtain full-length sequences of all protein-coding genes, alternative approaches are required. Results In this project, we have developed a method of reconstructing full-length cDNA sequences based on short expressed sequence tags which is called sequence tag-based amplification of cDNA ends (STACE. Expressed tags are used as anchors for retrieving full-length transcripts in two rounds of PCR amplification. We have demonstrated the application of STACE in reconstructing full-length cDNA sequences using expressed tags mined in an array of serial analysis of gene expression (SAGE of C. elegans cDNA libraries. We have successfully applied STACE to recover sequence information for 12 genes, for two of which we found isoforms. STACE was used to successfully recover full-length cDNA sequences for seven of these genes. Conclusions The STACE method can be used to effectively reconstruct full-length cDNA sequences of genes that are under-represented in cDNA sequencing projects and have been missed by existing gene prediction methods, but their existence has been suggested by short sequence tags such as SAGE tags.

  1. Survey of transposable elements in sugarcane expressed sequence tags (ESTs

    Directory of Open Access Journals (Sweden)

    Rossi Magdalena

    2001-01-01

    Full Text Available The sugarcane expressed sequence tag (SUCEST project has produced a large number of cDNA sequences from several plant tissues submitted or not to different conditions of stress. In this paper we report the result of a search for transposable elements (TEs revealing a surprising amount of expressed TEs homologues. Of the 260,781 sequences grouped in 81,223 fragment assembly program (Phrap clusters, a total of 276 clones showed homology to previously reported TEs using a stringent cut-off value of e-50 or better. Homologous clones to Copia/Ty1 and Gypsy/Ty3 groups of long terminal repeat (LTR retrotransposons were found but no non-LTR retroelements were identified. All major transposon families were represented in sugarcane including Activator (Ac, Mutator (MuDR, Suppressor-mutator (En/Spm and Mariner. In order to compare the TE diversity in grasses genomes, we carried out a search for TEs described in sugarcane related species O.sativa, Z. mays and S. bicolor. We also present preliminary results showing the potential use of TEs insertion pattern polymorphism as molecular markers for cultivar identification.

  2. Fragmentation and flow in central collisions

    International Nuclear Information System (INIS)

    Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

    1987-01-01

    Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

  3. Chameleon fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brax, Philippe [Institut de Physique Théorique, CEA, IPhT, CNRS, URA 2306, F-91191Gif/Yvette Cedex (France); Upadhye, Amol, E-mail: philippe.brax@cea.fr, E-mail: aupadhye@anl.gov [Institute for the Early Universe, Ewha University, International Education, Building #601, 11-1, Daehyun-Dong Seodaemun-Gu, Seoul 120-750 (Korea, Republic of)

    2014-02-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ{sup 4} and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments.

  4. Chameleon fragmentation

    International Nuclear Information System (INIS)

    Brax, Philippe; Upadhye, Amol

    2014-01-01

    A scalar field dark energy candidate could couple to ordinary matter and photons, enabling its detection in laboratory experiments. Here we study the quantum properties of the chameleon field, one such dark energy candidate, in an ''afterglow'' experiment designed to produce, trap, and detect chameleon particles. In particular, we investigate the possible fragmentation of a beam of chameleon particles into multiple particle states due to the highly non-linear interaction terms in the chameleon Lagrangian. Fragmentation could weaken the constraints of an afterglow experiment by reducing the energy of the regenerated photons, but this energy reduction also provides a unique signature which could be detected by a properly-designed experiment. We show that constraints from the CHASE experiment are essentially unaffected by fragmentation for φ 4 and 1/φ potentials, but are weakened for steeper potentials, and we discuss possible future afterglow experiments

  5. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    . Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  6. Metabolic Enhancer Piracetam Attenuates the Translocation of Mitochondrion-Specific Proteins of Caspase-Independent Pathway, Poly [ADP-Ribose] Polymerase 1 Up-regulation and Oxidative DNA Fragmentation.

    Science.gov (United States)

    Verma, Dinesh Kumar; Gupta, Sonam; Biswas, Joyshree; Joshi, Neeraj; Sivarama Raju, K; Wahajuddin, Mu; Singh, Sarika

    2018-03-12

    Piracetam, a nootropic drug, has been clinically used for decades; however, its mechanism of action still remains enigmatic. The present study was undertaken to evaluate the role of mitochondrion-specific factors of caspase-independent pathway like apoptotic-inducing factor (AIF) and endonuclease-G (endo-G) in piracetam-induced neuroprotection. N2A cells treated with lipopolysaccharide (LPS) exhibited significant cytotoxicity, impaired mitochondrial activity, and reactive oxygen species generation which was significantly attenuated with piracetam co-treatment. Cells co-treated with LPS and piracetam exhibited significant uptake of piracetam in comparison to only piracetam-treated cells as estimated by liquid chromatography-mass spectrometry (LC-MSMS). LPS treatment caused significant translocation of AIF and endonuclease-G in neuronal N2A cells which were significantly attenuated with piracetam co-treatment. Significant over-expression of proinflammatory cytokines was also observed after treatment of LPS to cells which was inhibited with piracetam co-treatment demonstrating its anti-inflammatory property. LPS-treated cells exhibited significant oxidative DNA fragmentation and poly [ADP-ribose] polymerase-1 (PARP-1) up-regulation in nucleus, both of which were attenuated with piracetam treatment. Antioxidant melatonin but not z-VAD offered the inhibited LPS-induced DNA fragmentation indicating the involvement of oxidative DNA fragmentation. Further, we did not observe the altered caspase-3 level after LPS treatment initially while at a later time point, significantly augmented level of caspase-3 was observed which was not inhibited with piracetam treatment. In total, our findings indicate the interference of piracetam in mitochondrion-mediated caspase-independent pathway, as well as its anti-inflammatory and antioxidative properties. Graphical Abstract Graphical abstract indicating the novel interference of metabolic enhancer piracetam (P) in neuronal death

  7. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2017-01-01

    The PhD project Bespoke Fragments is investigating the space emerging in the exploration of the relationship between digital drawing and fabrication, and the field of materials and their properties and capacities. Through a series of different experiments, the project situates itself in a shuttli...

  8. Rock fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Brown, W.S.; Green, S.J.; Hakala, W.W.; Hustrulid, W.A.; Maurer, W.C. (eds.)

    1976-01-01

    Experts in rock mechanics, mining, excavation, drilling, tunneling and use of underground space met to discuss the relative merits of a wide variety of rock fragmentation schemes. Information is presented on novel rock fracturing techniques; tunneling using electron beams, thermocorer, electric spark drills, water jets, and diamond drills; and rock fracturing research needs for mining and underground construction. (LCL)

  9. The role of tag suggestions in folksonomies

    NARCIS (Netherlands)

    Bollen, D.G.F.M.; Halpin, H.

    2009-01-01

    Most tagging systems support the user in the tag selection process by providing tag suggestions, or recommendations, based on a popularity measurement of tags other users provided when tagging the same resource. The majority of theories and mathematical models of tagging found in the literature

  10. Tag-elese or The Language of Tags

    Directory of Open Access Journals (Sweden)

    Jan Simons

    2008-01-01

    Full Text Available The core "meme" of Web 2.0 from which almost all other memes radiated was: 'You control your own data' (O'Reilly, 2005, 3. Key instruments for this user control are tagging systems that allow users to freely assign keywords of their own choosing to Internet resources of their own making as well as to documents produced by others. Of course, freely chosen keywords tags do not necessarily follow prefixed taxonomies or classification systems. But going by the maxim that interaction creates similarity and similarity creates interaction, the idea - or hope - is, however, that the tagging practices of individual users will eventually converge into an emergent common vocabulary or folksonomy (Merholz, 2004; Shirky, 2005; Vander Wal, 2005b; Mika, 2007. It is far from clear, however, that free tagging systems will eventually yield controlled vocabularies, and there are many incentives for idiosyncratic, ambiguous, and inconsistent uses of tags. Left to themselves, free tagging systems seem to be too wild and too chaotic for any order to emerge. But are these free tagging systems really as "feral" as they seem to be, or do they only look uncontrolled because one has been looking for order in the wrong place? I have done a quick-and-dirty" analysis of Flickr's tag cloud. The concept was: if folksonomies encourage users to tap on their own vernacular, everyday natural language must somehow "guide" the tagging practices of users of tagging systems. Flickr's tag cloud has been choosen because it may teach us something about tagging systems and folksonomies, and not - or not primarily - because of what tags may tell us about pictures.

  11. The combi-targeting concept: in vitro and in vivo fragmentation of a stable combi-nitrosourea engineered to interact with the epidermal growth factor receptor while remaining DNA reactive.

    Science.gov (United States)

    Qiu, Qiyu; Domarkas, Juozas; Banerjee, Ranjita; Merayo, Nuria; Brahimi, Fouad; McNamee, James P; Gibbs, Bernard F; Jean-Claude, Bertrand J

    2007-01-01

    JDA58 (NSC 741282), a "combi-molecule" optimized in the context of the "combi-targeting concept," is a nitrosourea moiety tethered to an anilinoquinazoline. Here, we sought to show its binary epidermal growth factor receptor (EGFR)/DNA targeting property and to study its fragmentation in vitro and in vivo. The fragmentation of JDA58 was detected in cells in vitro and in vivo by fluorescence microscopy and tandem mass spectrometry. EGFR phosphorylation and DNA damage were determined by Western blotting and comet assay, respectively. Tumor data were examined for statistical significance using the Student's t test. JDA58 inhibited EGFR tyrosine kinase (IC(50), 0.2 micromol/L) and blocked EGFR phosphorylation in human DU145 prostate cancer cells. It induced significant levels of DNA damage in DU145 cells in vitro or in vivo and showed potent antiproliferative activity both in vitro and in a DU145 xenograft model. In cell-free medium, JDA58 was hydrolyzed to JDA35, a fluorescent amine that could be observed in tumor cells both in vitro and in vivo. In tumor cells in vitro or in vivo, or in plasma collected from mice, the denitrosated species JDA41 was the predominant metabolite. However, mass spectrometric analysis revealed detectable levels of the hydrolytic product JDA35 in tumor cells both in vitro and in vivo. The results in toto suggest that growth inhibition in vitro and in vivo may be sustained by the intact combi-molecule plus JDA35 plus JDA41, three inhibitors of EGFR, and the concomitantly released DNA-damaging species. This leads to a model wherein a single molecule carries a complex multitargeted-multidrug combination.

  12. The use of external electronic tags on fish: an evaluation of tag retention and tagging effects

    DEFF Research Database (Denmark)

    Jepsen, Niels; Thorstad, Eva B.; Havn, Torgeir

    2015-01-01

    External tagging of fish with electronic tags has been used for decades for a wide range of marine and freshwater species. In the early years of fish telemetry research, it was the most commonly used attachment method, but later internal implants became preferred. Recently, the number of telemetry...... unsuitable for surgical implantation, or when using tags with sensors recording the external environment. The most commonly reported problems with external tags are tissue damage, premature tag loss, and decreased swimming capacity, but the effects are highly context dependent and species specific. Reduced......, but particularly there are few studies on predation risk, social interactions, and studies distinguishing capture and handling effects from tagging effects. For PSATs, especially those that are large relative to fish size, there are particular problems with a high proportion of premature tag losses, reduced...

  13. Architectural fragments

    DEFF Research Database (Denmark)

    Bang, Jacob Sebastian

    2018-01-01

    I have created a large collection of plaster models: a collection of Obstructions, errors and opportunities that may develop into architecture. The models are fragments of different complex shapes as well as more simple circular models with different profiling and diameters. In this contect I have....... I try to invent the ways of drawing the models - that decode and unfold them into architectural fragments- into future buildings or constructions in the landscape. [1] Luigi Moretti: Italian architect, 1907 - 1973 [2] Man Ray: American artist, 1890 - 1976. in 2015, I saw the wonderful exhibition...... "Man Ray - Human Equations" at the Glyptotek in Copenhagen, organized by the Philips Collection in Washington D.C. and the Israel Museum in Jerusalem (in 2013). See also: "Man Ray - Human Equations" catalogue published by Hatje Cantz Verlag, Germany, 2014....

  14. Social Tagging of Mission Data

    Science.gov (United States)

    Norris, Jeffrey S.; Wallick, Michael N.; Joswig, Joseph C.; Powell, Mark W.; Torres, Recaredo J.; Mittman, David S.; Abramyan, Lucy; Crockett, Thomas M.; Shams, Khawaja S.; Fox, Jason M.; hide

    2010-01-01

    Mars missions will generate a large amount of data in various forms, such as daily plans, images, and scientific information. Often, there is a semantic linkage between images that cannot be captured automatically. Software is needed that will provide a method for creating arbitrary tags for this mission data so that items with a similar tag can be related to each other. The tags should be visible and searchable for all users. A new routine was written to offer a new and more flexible search option over previous applications. This software allows users of the MSLICE program to apply any number of arbitrary tags to a piece of mission data through a MSLICE search interface. The application of tags creates relationships between data that did not previously exist. These tags can be easily removed and changed, and contain enough flexibility to be specifically configured for any mission. This gives users the ability to quickly recall or draw attention to particular pieces of mission data, for example: Give a semantic and meaningful description to mission data; for example, tag all images with a rock in them with the tag "rock." Rapidly recall specific and useful pieces of data; for example, tag a plan as"driving template." Call specific data to a user s attention; for example, tag a plan as "for:User." This software is part of the MSLICE release, which was written in Java. It will run on any current Windows, Macintosh, or Linux system.

  15. The AT-Hook motif as a versatile minor groove anchor for promoting DNA binding of transcription factor fragments? ?Electronic supplementary information (ESI) available: Peptide synthesis, full experimental procedures and analytical data of the peptides and products obtained. See DOI: 10.1039/c5sc01415h Click here for additional data file.

    OpenAIRE

    Rodr?guez, J?ssica; Mosquera, Jes?s; Couceiro, Jose R.; V?zquez, M. Eugenio; Mascare?as, Jos? L.

    2015-01-01

    We report the development of chimeric DNA binding peptides comprising a DNA binding fragment of natural transcription factors (the basic region of a bZIP protein or a monomeric zinc finger module) and an AT-Hook peptide motif. The resulting peptide conjugates display high DNA affinity and excellent sequence selectivity. Furthermore, the AT-Hook motif also favors the cell internalization of the conjugates.

  16. Insulin-like growth factor-1 (IGF-1) promotes primordial follicle growth and reduces DNA fragmentation through the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) signalling pathway.

    Science.gov (United States)

    Bezerra, Maria É S; Barberino, Ricássio S; Menezes, Vanúzia G; Gouveia, Bruna B; Macedo, Taís J S; Santos, Jamile M S; Monte, Alane P O; Barros, Vanessa R P; Matos, Maria H T

    2018-05-30

    We investigated the effects of insulin-like growth factor 1 (IGF-1) on the morphology and follicular activation of ovine preantral follicles cultured in situ and whether the phosphatidylinositol 3-kinase/protein kinase B (PI3K/AKT) pathway is involved in IGF-1 action in the sheep ovary. Ovine ovarian fragments were fixed for histological and terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) analyses (fresh control) or cultured in supplemented alpha-minimum essential medium (α-MEM+; control) or α-MEM+ with IGF-1 (1, 10, 50, 100 or 200ngmL-1) for 7 days. Follicles were classified as normal or atretic, primordial or growing and the oocyte and follicle diameters were measured. DNA fragmentation was evaluated by TUNEL assay. Proliferating cell nuclear antigen (PCNA) immunohistochemistry was performed on the fresh control, α-MEM+ and 100ngmL-1 IGF-1 samples. Inhibition of PI3K activity was performed through pretreatment with the PI3K inhibitor LY294002 and phosphorylated AKT (pAKT) expression was analysed after culture in the absence or presence of LY294002. IGF-1 at 100ngmL-1 increased (PIGF-1. LY294002 significantly inhibited follicular activation stimulated by α-MEM+ and 100ngmL-1 IGF-1 and reduced pAKT expression in follicles. Overall, IGF-1 at 100ngmL-1 promoted primordial follicle activation, cell proliferation and reduced DNA fragmentation after in situ culture through the PI3K/AKT pathway.

  17. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  19. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  20. Antenna for passive RFID tags

    Science.gov (United States)

    Schiopu, Paul; Manea, Adrian; Cristea, Ionica; Grosu, Neculai; Vladescu, Marian; Craciun, Anca-Ileana; Craciun, Alexandru

    2015-02-01

    Minuscule devices, called RFID tags are attached to objects and persons and emit information which positioned readers may capture wirelessly. Many methods of identification have been used, but that of most common is to use a unique serial number for identification of person or object. RFID tags can be characterized as either active or passive [1,2]. Traditional passive tags are typically in "sleep" state until awakened by the reader's emitted field. In passive tags, the reader's field acts to charge the capacitor that powers the badge and this can be a combination of antenna and barcodes obtained with SAW( Surface Acoustic Wave) devices [1,2,3] . The antenna in an RFID tag is a conductive element that permits the tag to exchange data with the reader. The paper contribution are targeted to antenna for passive RFID tags. The electromagnetic field generated by the reader is somehow oriented by the reader antenna and power is induced in the tag only if the orientation of the tag antenna is appropriate. A tag placed orthogonal to the reader yield field will not be read. This is the reason that guided manufacturers to build circular polarized antenna capable of propagating a field that is alternatively polarized on all planes passing on the diffusion axis. Passive RFID tags are operated at the UHF frequencies of 868MHz (Europe) and 915MHz (USA) and at the microwave frequencies of 2,45 GHz and 5,8 GHz . Because the tags are small dimensions, in paper, we present the possibility to use circular polarization microstrip antenna with fractal edge [2].

  1. Nuclear studies with tagged photons

    International Nuclear Information System (INIS)

    Axel, P.

    1979-01-01

    First, the photon tagging technique will be described schematically, and a brief history of photon tagging will be given, including the 20 year development of this technique at Illinois. In the second part some typical operating conditions will be indicated for our tagged photon facility. The final section of this paper will illustrate some types of experiments by showing data obtained recently. (KBE) 891 KBE/KBE 892 ARA

  2. Buddy Tag CONOPS and Requirements.

    Energy Technology Data Exchange (ETDEWEB)

    Brotz, Jay Kristoffer [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Deland, Sharon M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    This document defines the concept of operations (CONOPS) and the requirements for the Buddy Tag, which is conceived and designed in collaboration between Sandia National Laboratories and Princeton University under the Department of State Key VerificationAssets Fund. The CONOPS describe how the tags are used to support verification of treaty limitations and is only defined to the extent necessary to support a tag design. The requirements define the necessary functions and desired non-functional features of the Buddy Tag at a high level

  3. Flavour tagging performance in LHCb

    International Nuclear Information System (INIS)

    Grabalosa Gandara, Marc

    2009-01-01

    To do precise CP violation measurements, the best possible determination of the flavour of the B-meson is necessary. This report summarizes the flavour tagging performances for the LHCb experiment. The flavour tagging is obtained through a combination of several methods, based on different signatures. The use of control channels, which are decays to flavour-specific final states, will allow to determine the wrong tag fraction ω (the probability of a tag to be wrong), which can be used as an input for the determination of CKM unitarity triangle angles.

  4. Intermediate Fragment

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2015-01-01

    This text and its connected exhibition are aiming to reflect both on the thoughts, the processes and the outcome of the design and production of the artefact ‘Intermediate Fragment’ and making as a contemporary architectural tool in general. Intermediate Fragment was made for the exhibition ‘Enga...... of realising an exhibition object was conceived, but expanded, refined and concretised through this process. The context of the work shown here is an interest in a tighter, deeper connection between experimentally obtained material knowledge and architectural design....

  5. Fragmentation based

    Directory of Open Access Journals (Sweden)

    Shashank Srivastava

    2014-01-01

    Gaining the understanding of mobile agent architecture and the security concerns, in this paper, we proposed a security protocol which addresses security with mitigated computational cost. The protocol is a combination of self decryption, co-operation and obfuscation technique. To circumvent the risk of malicious code execution in attacking environment, we have proposed fragmentation based encryption technique. Our encryption technique suits the general mobile agent size and provides hard and thorny obfuscation increasing attacker’s challenge on the same plane providing better performance with respect to computational cost as compared to existing AES encryption.

  6. Bespoke Fragments

    DEFF Research Database (Denmark)

    Kruse Aagaard, Anders

    2016-01-01

    , investigating levels of control and uncertainty encountering with these. Through tangible experiments, the project discusses materiality and digitally controlled fabrications tools as direct expansions of the architect's digital drawing and workflow. The project sees this expansion as an opportunity to connect...... architectural designs, tectonics and aesthetics. In this Ph.D.-project a series a physical, but conceptual, experiment plays the central role in the knowledge production. The experiments result in materialised architectural fragments and tangible experiences. However, these creations also become the driving...

  7. LHCb Tag Collector

    International Nuclear Information System (INIS)

    Fernández, Paloma Fuente; Clemencic, Marco; Cousin, Nicolas

    2011-01-01

    The LHCb physics software consists of hundreds of packages, each of which is developed by one or more physicists. When the developers have some code changes that they would like released, they commit them to the version control system, and enter the revision number into a database. These changes have to be integrated into a new release of each of the physics analysis applications. Tests are then performed by a nightly build system, which rebuilds various configurations of the whole software stack and executes a suite of run-time functionality tests. A Tag Collector system has been developed using solid standard technologies to cover both the use cases of developers and integration managers. A simple Web interface, based on an AJAX-like technology, is available. Integration with SVN and Nightly Build System, is possible via a Python API. Data are stored in a relational database with the help of an ORM (Object-Relational Mapping) library.

  8. Internally readable identifying tag

    International Nuclear Information System (INIS)

    Jefferts, K.B.; Jefferts, E.R.

    1980-01-01

    A method of identifying non-metallic objects by means of X-ray equipment is described in detail. A small metal pin with a number of grooves cut in a pre-determined equi-spaced pattern is implanted into the non-metallic object and by decoding the groove patterns using X-ray equipment, the object is uniquely identified. A specific example of such an application is in studying the migratory habits of fish. The pin inserted into the snout of the fish is 0.010 inch in diameter, 0.040 inch in length with 8 possible positions for grooves if spaced 0.005 inch apart. With 6 of the groove positions available for data, the capacity is 2 6 or 64 combinations; clearly longer pins would increase the data capacity. This method of identification is a major advance over previous techniques which necessitated destruction of the fish in order to recover the identification tag. (UK)

  9. Crystallization and preliminary X-ray diffraction analysis of two N-terminal fragments of the DNA-cleavage domain of topoisomerase IV from Staphylococcus aureus

    Energy Technology Data Exchange (ETDEWEB)

    Carr, Stephen B., E-mail: bmbsbc@bmb.leeds.ac.uk [Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT (United Kingdom); Makris, George [Omega Mediation Hellas Ltd, Clinical and Pharma Consulting, 11525 N. Psychiko, Athens (Greece); Phillips, Simon E. V.; Thomas, Christopher D. [Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds LS2 9JT (United Kingdom)

    2006-11-01

    The crystallization and data collection of topoisomerase IV from S. aureus is described. Phasing by molecular replacement proved difficult owing to the presence of translational NCS and strategies used to overcome this are discussed. DNA topoisomerase IV removes undesirable topological features from DNA molecules in order to help maintain chromosome stability. Two constructs of 56 and 59 kDa spanning the DNA-cleavage domain of the A subunit of topoisomerase IV from Staphylococcus aureus (termed GrlA56 and GrlA59) have been crystallized. Crystals were grown at 291 K using the sitting-drop vapour-diffusion technique with PEG 3350 as a precipitant. Preliminary X-ray analysis revealed that GrlA56 crystals belong to space group P2{sub 1}, diffract to a resolution of 2.9 Å and possess unit-cell parameters a = 83.6, b = 171.5, c = 87.8 Å, β = 90.1°, while crystals of GrlA59 belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 41.5, b = 171.89, c = 87.9 Å. These crystals diffract to a resolution of 2.8 Å. This is the first report of the crystallization and preliminary X-ray analysis of the DNA-cleavage domain of a topoisomerase IV from a Gram-positive organism.

  10. Crystallization and preliminary X-ray diffraction analysis of two N-terminal fragments of the DNA-cleavage domain of topoisomerase IV from Staphylococcus aureus

    International Nuclear Information System (INIS)

    Carr, Stephen B.; Makris, George; Phillips, Simon E. V.; Thomas, Christopher D.

    2006-01-01

    The crystallization and data collection of topoisomerase IV from S. aureus is described. Phasing by molecular replacement proved difficult owing to the presence of translational NCS and strategies used to overcome this are discussed. DNA topoisomerase IV removes undesirable topological features from DNA molecules in order to help maintain chromosome stability. Two constructs of 56 and 59 kDa spanning the DNA-cleavage domain of the A subunit of topoisomerase IV from Staphylococcus aureus (termed GrlA56 and GrlA59) have been crystallized. Crystals were grown at 291 K using the sitting-drop vapour-diffusion technique with PEG 3350 as a precipitant. Preliminary X-ray analysis revealed that GrlA56 crystals belong to space group P2 1 , diffract to a resolution of 2.9 Å and possess unit-cell parameters a = 83.6, b = 171.5, c = 87.8 Å, β = 90.1°, while crystals of GrlA59 belong to space group P2 1 2 1 2, with unit-cell parameters a = 41.5, b = 171.89, c = 87.9 Å. These crystals diffract to a resolution of 2.8 Å. This is the first report of the crystallization and preliminary X-ray analysis of the DNA-cleavage domain of a topoisomerase IV from a Gram-positive organism

  11. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  12. Analysis of endophytic bacterial communities of potato by plating and denaturing gradient gel electrophoresis (DGGE) of 16S rDNA based PCR fragments

    NARCIS (Netherlands)

    Garbeva, P.; Overbeek, van L.S.; Vuurde, van J.W.L.; Elsas, van J.D.

    2001-01-01

    The diversity of endophytic bacterial populations of potato (Solanum tuberosum cv Desiree) was assessed using a combination of dilution plating of plant macerates followed by isolation and characterization of isolates, and direct PCR-DGGE on the basis of DNA extracted from plants. The culturable

  13. PCR typing of DNA fragments of the two short tandem repeat (STR) systems upstream of the human myelin basic protein (MBP) gene in Danes and Greenland Eskimos

    DEFF Research Database (Denmark)

    Nellemann, L J; Frederiksen, J; Morling, N

    1996-01-01

    -A and MBP-B were analyzed by vertical electrophoresis in polyacrylamide gels followed by silver staining. DNA samples from 112 unrelated Danes, 140 unrelated Greenland Eskimos, and 88 Danish mother/child pairs were analyzed. The distributions of MBP phenotypes were in Hardy-Weinberg equilibrium in both...

  14. Circulating levels of chromatin fragments are inversely correlated with anti-dsDNA antibody levels in human and murine systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Jørgensen, Mariann H; Rekvig, Ole Petter; Jacobsen, Rasmus S

    2011-01-01

    Anti-dsDNA antibodies represent a central pathogenic factor in Lupus nephritis. Together with nucleosomes they deposit as immune complexes in the mesangial matrix and along basement membranes within the glomeruli. The origin of the nucleosomes and when they appear e.g. in circulation is not known...

  15. Framing Fragmentation

    DEFF Research Database (Denmark)

    Bundgaard, Charlotte

    2009-01-01

    Contemporary industrialized architecture based on advanced information technology and highly technological production processes, implies a radically different approach to architecture than what we have experienced in the past. Works of architecture composed of prefabricated building components......, contain distinctive architectural traits, not only based on rational repetition, but also supporting composition and montage as dynamic concepts. Prefab architecture is an architecture of fragmentation, individualization and changeability, and this sets up new challenges for the architect. This paper...... tries to develop a strategy for the architect dealing with industrially based architecture; a strategy which exploits architectural potentials in industrial building, which recognizes the rules of mass production and which redefines the architect’s position among the agents of building. If recent...

  16. Engineering the ATLAS TAG Browser

    CERN Document Server

    Zhang, Q; The ATLAS collaboration

    2011-01-01

    ELSSI is a web-based event metadata (TAG) browser and event-level selection service for ATLAS. TAGs from all ATLAS physics and Monte Carlo data sets are routinely loaded into Oracle databases as an integral part of event processing. As data volumes increase, more and more sites are joining the distributed TAG data hosting topology[1]. Meanwhile, TAG content and database schemata continue to evolve as new user requirements and additional sources of metadata emerge. All of this has posed many challenges to the development of ELSSI, which must support vast amounts of TAG data while source, content, geographic locations, and user query patterns may change over time. In this paper, we describe some of the challenges encountered in the process of developing ELSSI, and the software engineering strategies adopted to address those challenges. Approaches to management of access to data, browsing, data rendering, query building, query validation, execution, connection management, and communication with auxiliary service...

  17. Engineering the ATLAS TAG Browser

    CERN Document Server

    Zhang, Q; The ATLAS collaboration

    2011-01-01

    ELSSI is a web-based event metadata (TAG) browser and event-level selection service for ATLAS. TAGs from all ATLAS physics and Monte Carlo data sets are routinely loaded into Oracle databases as an integral part of event processing. As data volumes increase, more and more sites are joining the distributed TAG data hosting topology. Meanwhile, TAG content and database schemata continue to evolve as new user requirements and additional sources of metadata emerge. All of this has posed many challenges to the development of ELSSI, which must support vast amounts of TAG data while source, content, geographic locations, and user query patterns may change over time. In this paper, we describe some of the challenges encountered in the process of developing ELSSI, and the software engineering strategies adopted to address those challenges. Approaches to management of access to data, browsing, data rendering, query building, query validation, execution, connection management, and communication with auxiliary services a...

  18. NAD-Dependent DNA-Binding Activity of the Bifunctional NadR Regulator of Salmonella typhimurium

    OpenAIRE

    Penfound, Thomas; Foster, John W.

    1999-01-01

    NadR is a 45-kDa bifunctional regulator protein. In vivo genetic studies indicate that NadR represses three genes involved in the biosynthesis of NAD. It also participates with an integral membrane protein (PnuC) in the import of nicotinamide mononucleotide, an NAD precursor. NadR was overexpressed and purified as a His-tagged fusion in order to study its DNA-binding properties. The protein bound to DNA fragments containing NAD box consensus sequences. NAD proved to be the relevant in vivo co...

  19. Endometrial Polyps and Benign Endometrial Hyperplasia Present Increased Prevalence of DNA Fragmentation Factors 40 and 45 (DFF40 and DFF45) Together With the Antiapoptotic B-Cell Lymphoma (Bcl-2) Protein Compared With Normal Human Endometria.

    Science.gov (United States)

    Banas, Tomasz; Pitynski, Kazimierz; Mikos, Marcin; Cielecka-Kuszyk, Joanna

    2017-09-13

    DNA fragmentation factor 40 (DFF40) is a key executor of apoptosis. It localizes to the nucleus together with DNA fragmentation factor 45 (DFF45), which acts as a DFF40 inhibitor and chaperone. B-cell lymphoma (Bcl-2) protein is a proven antiapoptotic factor present in the cytoplasm. In this study, we aimed to investigate DFF40, DFF45, and Bcl-2 immunoexpression in endometrial polyps (EPs) and benign endometrial hyperplasia (BEH) tissue compared with that in normal proliferative endometrium (NPE) and normal secretory endometrium (NSE) as well as normal post menopausal endometrium (NAE). This study used archived samples from 65 and 62 cases of EPs and BEH, respectively. The control group consisted of 52 NPE, 54 NSE, and 54 NAE specimens. Immunohistochemistry was used to detect DFF40, DFF45, and Bcl-2. DFF40, DFF45, and Bcl-2 were more highly expressed in the glandular layer of EPs and BEH compared with the stroma, and this was not influenced by menopausal status. Both glandular and stromal expression of DFF40, DFF45, and Bcl-2 were significantly higher in EPs compared with NPE, NSE, and NAE. Glandular BEH tissue showed significantly higher DFF40, DFF45, and Bcl-2 expression than in NPE, NSE, and NAE. No differences in the glandular expression of DFF40, DFF45, and Bcl-2 were observed between EP and BEH tissues, while Bcl-2 stromal expression in BEH was significantly lower than in EPs. Glandular, menopause-independent DFF40, DFF45, and Bcl-2 overexpression may play an important role in the pathogenesis of EPs and BEH.

  20. CtGEM typing: Discrimination of Chlamydia trachomatis ocular and urogenital strains and major evolutionary lineages by high resolution melting analysis of two amplified DNA fragments.

    Science.gov (United States)

    Giffard, Philip M; Andersson, Patiyan; Wilson, Judith; Buckley, Cameron; Lilliebridge, Rachael; Harris, Tegan M; Kleinecke, Mariana; O'Grady, Kerry-Ann F; Huston, Wilhelmina M; Lambert, Stephen B; Whiley, David M; Holt, Deborah C

    2018-01-01

    Chlamydia trachomatis infects the urogenital tract (UGT) and eyes. Anatomical tropism is correlated with variation in the major outer membrane protein encoded by ompA. Strains possessing the ocular ompA variants A, B, Ba and C are typically found within the phylogenetically coherent "classical ocular lineage". However, variants B, Ba and C have also been found within three distinct strains in Australia, all associated with ocular disease in children and outside the classical ocular lineage. CtGEM genotyping is a method for detecting and discriminating ocular strains and also the major phylogenetic lineages. The rationale was facilitation of surveillance to inform responses to C. trachomatis detection in UGT specimens from young children. CtGEM typing is based on high resolution melting analysis (HRMA) of two PCR amplified fragments with high combinatorial resolving power, as defined by computerised comparison of 65 whole genomes. One fragment is from the hypothetical gene defined by Jali-1891 in the C. trachomatis B_Jali20 genome, while the other is from ompA. Twenty combinatorial CtGEM types have been shown to exist, and these encompass unique genotypes for all known ocular strains, and also delineate the TI and T2 major phylogenetic lineages, identify LGV strains and provide additional resolution beyond this. CtGEM typing and Sanger sequencing were compared with 42 C. trachomatis positive clinical specimens, and there were no disjunctions. CtGEM typing is a highly efficient method designed and tested using large scale comparative genomics. It divides C. trachomatis into clinically and biologically meaningful groups, and may have broad application in surveillance.

  1. Polarized tagged photons

    International Nuclear Information System (INIS)

    Maximon, L.C.; Ganz, Eric; Aniel, Thierry; Miniac, Arlette de.

    1982-03-01

    We consider in detail the differential cross section for polarized bremsstrahlung for angles and energies in the range of interest for a tagging system and derive a high energy, small angle approximation for this cross section. We use these approximations to determine the maxima and minima of the cross sections for these two polarization states, dσperpendicular and dσparallel, and to evaluate these cross sections at the extrema. It is shown that both dσperpendicular and dσparallel have a very sharp dip in the region of small momentum transfers. However, their behavior in the region of the dip, as a function of the azimuthal angle phi, is quite different over most of the photon spectrum. The cross section dσperpendicular behaves similarly to the cross section for unpolarized photons in that as phi increases, the sharp dip vanishes, the minimum fuses with the second maximum, and the cross section then has only a single maximum. In contrast, the sharp dip in the cross section dσparallel remains as phi increases. Coulomb corrections to the Born approximation are considered, and do not fill in these dips

  2. Quantum tagging for tags containing secret classical data

    International Nuclear Information System (INIS)

    Kent, Adrian

    2011-01-01

    Various authors have considered schemes for quantum tagging, that is, authenticating the classical location of a classical tagging device by sending and receiving quantum signals from suitably located distant sites, in an environment controlled by an adversary whose quantum information processing and transmitting power is potentially unbounded. All of the schemes proposed elsewhere in the literature assume that the adversary is able to inspect the interior of the tagging device. All of these schemes have been shown to be breakable if the adversary has unbounded predistributed entanglement. We consider here the case in which the tagging device contains a finite key string shared with distant sites but kept secret from the adversary, and show this allows the location of the tagging device to be authenticated securely and indefinitely. Our protocol relies on quantum key distribution between the tagging device and at least one distant site, and demonstrates a new practical application of quantum key distribution. It also illustrates that the attainable security in position-based cryptography can depend crucially on apparently subtle details in the security scenario considered.

  3. Effect of a pre-freezing treatment with cholesterol-loaded cyclodextrins on boar sperm longevity, capacitation dynamics, ability to adhere to porcine oviductal epithelial cells in vitro and DNA fragmentation dynamics.

    Science.gov (United States)

    Tomás, C; Blanch, E; Fazeli, A; Mocé, E

    2013-01-01

    The aim of this work was to examine how a pre-freezing treatment with cholesterol-loaded cyclodextrins (CLC) affects boar sperm longevity, capacitation dynamics, ability to bind to a porcine telomerase-immortalised oviductal epithelial cell line (TERT-OPEC) in vitro and DNA integrity dynamics after freeze-thawing. Although the samples treated with CLC exhibited lower sperm quality than the control samples (P0.05) after long-term incubation (26h at 37 or 16°C). Additionally, the CLC-treated spermatozoa underwent similar capacitation and DNA fragmentation dynamics as the control spermatozoa (P>0.05). However, CLC-treated spermatozoa were better able to bind to TERT-OPEC in vitro (POPEC in vitro, which could have an effect on the establishment of the sperm reservoir in the ampullary--isthmic junction in vivo. Additionally, frozen-thawed spermatozoa can be stored at 16°C for at least 6h without a significant observable decline in sperm quality, which could be beneficial for the transport of thawed diluted doses of spermatozoa from the laboratory to the farm.

  4. Heavy-Quark Production in the Target Fragmentation Region

    CERN Document Server

    Graudenz, Dirk

    1997-01-01

    Fixed-target experiments permit the study of hadron production in the target fragmentation region. It is expected that the tagging of specific particles in the target fragments can be employed to introduce a bias in the hard scattering process towards a specific flavour content. The case of hadrons containing a heavy quark is particularly attractive because of the clear experimental signatures and the applicability of perturbative QCD. The standard approach to one-particle inclusive processes based on fragmentation functions is valid in the current fragmentation region and for large transverse momenta $p_T$ in the target fragmentation region, but it fails for particle production at small $p_T$ in the target fragmentation region. A collinear singularity, which cannot be absorbed in the standard way into the phenomenological distribution functions, prohibits the application of this procedure. This situation is remedied by the introduction of a new set of distribution functions, the target fragmentation function...

  5. Behavioral tagging of extinction learning.

    Science.gov (United States)

    de Carvalho Myskiw, Jociane; Benetti, Fernando; Izquierdo, Iván

    2013-01-15

    Extinction of contextual fear in rats is enhanced by exposure to a novel environment at 1-2 h before or 1 h after extinction training. This effect is antagonized by administration of protein synthesis inhibitors anisomycin and rapamycin into the hippocampus, but not into the amygdala, immediately after either novelty or extinction training, as well as by the gene expression blocker 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole administered after novelty training, but not after extinction training. Thus, this effect can be attributed to a mechanism similar to synaptic tagging, through which long-term potentiation can be enhanced by other long-term potentiations or by exposure to a novel environment in a protein synthesis-dependent fashion. Extinction learning produces a tag at the appropriate synapses, whereas novelty learning causes the synthesis of plasticity-related proteins that are captured by the tag, strengthening the synapses that generated this tag.

  6. Strep-Tagged Protein Purification.

    Science.gov (United States)

    Maertens, Barbara; Spriestersbach, Anne; Kubicek, Jan; Schäfer, Frank

    2015-01-01

    The Strep-tag system can be used to purify recombinant proteins from any expression system. Here, protocols for lysis and affinity purification of Strep-tagged proteins from E. coli, baculovirus-infected insect cells, and transfected mammalian cells are given. Depending on the amount of Strep-tagged protein in the lysate, a protocol for batch binding and subsequent washing and eluting by gravity flow can be used. Agarose-based matrices with the coupled Strep-Tactin ligand are the resins of choice, with a binding capacity of up to 9 mg ml(-1). For purification of lower amounts of Strep-tagged proteins, the use of Strep-Tactin magnetic beads is suitable. In addition, Strep-tagged protein purification can also be automated using prepacked columns for FPLC or other liquid-handling chromatography instrumentation, but automated purification is not discussed in this protocol. The protocols described here can be regarded as an update of the Strep-Tag Protein Handbook (Qiagen, 2009). © 2015 Elsevier Inc. All rights reserved.

  7. DNA restriction fragment length polymorphism analysis of Mycobacterium tuberculosis isolates from HIV-seropositive and HIV-seronegative patients in Kampala, Uganda

    Directory of Open Access Journals (Sweden)

    Katabazi Fred A

    2009-02-01

    Full Text Available Abstract Background The identification and differentiation of strains of Mycobacterium tuberculosis by DNA fingerprinting has provided a better understanding of the epidemiology and tracing the transmission of tuberculosis. We set out to determine if there was a relationship between the risk of belonging to a group of tuberculosis patients with identical mycobacterial DNA fingerprint patterns and the HIV sero-status of the individuals in a high TB incidence peri-urban setting of Kampala, Uganda. Methods One hundred eighty three isolates of Mycobacterium tuberculosis from 80 HIV seropositive and 103 HIV seronegative patients were fingerprinted by standard IS6110-RFLP. Using the BioNumerics software, strains were considered to be clustered if at least one other patient had an isolate with identical RFLP pattern. Results One hundred and eighteen different fingerprint patterns were obtained from the 183 isolates. There were 34 clusters containing 54% (99/183 of the patients (average cluster size of 2.9, and a majority (96.2% of the strains possessed a high copy number (≥ 5 copies of the IS6110 element. When strains with P = 0.615, patients aged P = 0.100, and sex (aOR 1.12, 95%CI 0.60–2.06, P = 0.715. Conclusion The sample showed evidence of a high prevalence of recent transmission with a high average cluster size, but infection with an isolate with a fingerprint found to be part of a cluster was not associated with any demographic or clinical characteristics, including HIV status.

  8. Random Tagging Genotyping by Sequencing (rtGBS, an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome.

    Directory of Open Access Journals (Sweden)

    Elena Hilario

    Full Text Available Genotyping by sequencing (GBS is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al.some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS. By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145 of BamH I sites shared with the reference genome, compared to only 14% (11,513 by stdGBS.

  9. Editorial Tag Endogeneity for News Websites

    OpenAIRE

    Bruno Ribeiro; Ricardo Morla; Amílcar Correia

    2013-01-01

    Editors and journalists at some news websites label their articles with structure and content-related editorial tags. Each article can have more than one tag and each tag can be used in more than one article. A network of tags can be defined whose edges are all possible pairs of tags in each article. Because editorial tags relate to structure and content rather than individual articles, the analysis of a network of editorial tags could assist editorial decisions to prioritize types of content...

  10. 利用 DDRT-PCR 鉴定芸芥自交不亲和系与自交亲和系的差异表达 cDNA%Identification of cDNA Fragments in Self-incompatible and Self-compatible Lines of Eruca sativa Mill.by DDRT-PCR

    Institute of Scientific and Technical Information of China (English)

    范惠玲; 白生文; 李华清; 孙万仓

    2016-01-01

    Yunjie is closely related to important vegetables an d oil seed crops,and can be considered a genetic resource for all Brassiceae crops.Self compatibility is an important variant traits to Yunjie.This study aimed to probe the expression organ of self-compatible gene and isolate cDNA fragments related to self-compatibility of Yunjie. Leaf,anther and stigma from self-incompatible (SI)and self-compatible (SC)lines of Yunjie were examined by DDRT-PCR.The results showed that the amplification pattern of leaves and anthers were the same in SI and SC lines.However,different bands were obtained in stigmas of SI and SC lines before and after flowering.SC gene of E. sativa was not showing constitutive expression but showed tissue-specific expression in stigma.Only two fragments were amplified in SC lines before flowering,the one was less than 100 bp,the other was 750 -1 000 bp.A 300 bp fragment was found unique to self-compatible line after flowering.These three cDNA fragments might be closely re-lated to the self-compatibility in Yunjie.In addition,two cDNA fragments were generated in SI line before flowering, one was 500 bp,the other was 750 bp.One band of 500 -600 bp was identified in SI line after flowering.These cDNA fragments could efficiently distinguish self-compatible and self-incompatible lines,and could also be useful for cloning self-compatible gene of Yunjie.%芸芥与芸薹属植物具有亲缘关系,也是芸薹属植物的重要育种资源。自交亲和性是芸芥的一种重要变异性状。为了探明芸芥自交亲和基因的表达器官,并分离与自交亲和性有关的 cDNA 片段,以芸芥的一对近等基因系,自交亲和系(SC)与自交不亲和系(SI)为试材,利用差异显示 RT-PCR 技术分别对开花前和开花后的叶片、花药和柱头进行鉴定。结果表明,不论开花前还是开花后,芸芥自交亲和系与自交不亲和系的叶片或花药间的扩增带型是一样的,但在

  11. Tempting To Tag: An Experimental Comparison Of Four Tagging Input Mechanisms

    Directory of Open Access Journals (Sweden)

    Mark Melenhorst

    2010-01-01

    Full Text Available Tagging helps achieve improved indexing and recommendation of resources (e.g., videos or pictures in large data collections. In order to reap the benefits of tagging, people must be persuaded to label the resources they consume. This paper reports on a study in which four different tagging input mechanisms and their effect on users' motivation to tag were compared. The mechanisms consisted of a standard tag input box, a chatbot-like environment, a bookmarking mechanism, and a "tag and vote" game. The results of our experiment show that the use of the nonstandard tagging input mechanisms does not affect users' motivation to tag. In some instances tagging mechanisms were found to distract users from their primary task: consuming resources. Persuading people to tag might be accomplished more effectively by using other motivating tagging mechanisms (e.g., tagging games, or motivation could be created by explaining the usefulness of tagging.

  12. Molecular phylogeny and systematics of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with a special reference to the genus Musa.

    Science.gov (United States)

    Li, Lin-Feng; Häkkinen, Markku; Yuan, Yong-Ming; Hao, Gang; Ge, Xue-Jun

    2010-10-01

    Musaceae is a small paleotropical family. Three genera have been recognised within this family although the generic delimitations remain controversial. Most species of the family (around 65 species) have been placed under the genus Musa and its infrageneric classification has long been disputed. In this study, we obtained nuclear ribosomal ITS and chloroplast (atpB-rbcL, rps16, and trnL-F) DNA sequences of 36 species (42 accessions of ingroups representing three genera) together with 10 accessions of ingroups retrieved from GenBank database and 4 accessions of outgroups, to construct the phylogeny of the family, with a special reference to the infrageneric classification of the genus Musa. Our phylogenetic analyses elaborated previous results in supporting the monophyly of the family and suggested that Musella and Ensete may be congeneric or at least closely related, but refuted the previous infrageneric classification of Musa. None of the five sections of Musa previously defined based on morphology was recovered as monophyletic group in the molecular phylogeny. Two infrageneric clades were identified, which corresponded well to the basic chromosome numbers of x=11 and 10/9/7, respectively: the former clade comprises species from the sections Musa and Rhodochlamys while the latter contains sections of Callimusa, Australimusa, and Ingentimusa. Copyright 2010 Elsevier Inc. All rights reserved.

  13. High Aneuploidy Rates Observed in Embryos Derived from Donated Oocytes are Related to Male Aging and High Percentages of Sperm DNA Fragmentation

    Directory of Open Access Journals (Sweden)

    Javier García-Ferreyra

    2015-01-01

    Full Text Available Capsule Male aging effects on aneuploidy rates in embryos. Objective Paternal age is associated with decreasing sperm quality; however, it is unknown if it influences chromosomal abnormalities in embryos. The objective of this study is to evaluate if the aneuploidy rates in embryos are affected by advanced paternal age. Methods A total of 286 embryos, obtained from 32 in vitro fertilization/intracytoplasmic sperm injection cycles with donated oocytes in conjunction with preimplantation genetic diagnosis, were allocated according to paternal age in three groups: Group A: ≤39 years (n = 44 embryos; Group B: 40-49 years (n = 154 embryos; and Group C: ≥50 years (n = 88 embryos. Fertilization rates, embryo quality at day 3, blastocyst development, and aneuploidy embryo rates were then compared. Results There was no difference in the seminal parameters (volume, concentration, and motility in the studied groups. Fertilization rate, percentages of zygotes underwent cleavage, and good quality embryos on day 3 were similar between the three evaluated groups. The group of men ≥50 years had significantly more sperm with damaged DNA, low blastocyst development rate, and higher aneuploidy rates in embryos compared to the other two evaluated groups ( P 50 years old.

  14. Tagging the European eel Anguilla anguilla (L.) with coded wire tags

    DEFF Research Database (Denmark)

    Thomassen, S.; Pedersen, Michael Ingemann; Holdensgaard, G.

    2000-01-01

    The coded wire tag (CWT) system was examined as a possible tool for tagging European eels (Anguilla anguilla). Two size groups of eels (3.8 and 10.2 g) were tagged with CWTs in the dorsal musculature, Tag loss 28 days after tagging was 3.1% for the small and 0.7% for the large groups of eels...

  15. Diphtheria toxin- and Pseudomonas A toxin-mediated apoptosis. ADP ribosylation of elongation factor-2 is required for DNA fragmentation and cell lysis and synergy with tumor necrosis factor-alpha.

    Science.gov (United States)

    Morimoto, H; Bonavida, B

    1992-09-15

    We have reported that diphtheria toxin (DTX) mediates target cell lysis and intranucleosomal DNA fragmentation (apoptosis) and also synergizes with TNF-alpha. In this paper, we examined which step in the pathway of DTX-mediated inhibition of protein synthesis was important for induction of cytolytic activity and for synergy. Using a DTX-sensitive tumor cell line, we first examined the activity of the mutant CRM 197, which does not catalyze the ADP ribosylation of elongation factor-2 (EF-2). CRM 197 was not cytolytic for target cells and did not mediate intranucleosomal DNA fragmentation of viable cells. The failure of CRM 197 to mediate target cell lysis suggested that the catalytic activity of DTX is prerequisite for target cell lysis. This was corroborated by demonstrating that MeSAdo, which blocks the biosynthesis of diphthamide, inhibited DTX-mediated protein synthesis inhibition and also blocked target cell lysis. Furthermore, the addition of nicotinamide, which competes with NAD+ on the DTX action site of EF-2, also blocked DTX-mediated lysis. These findings suggest that ADP-ribosylation of EF-2 may be a necessary step in the pathway leading to target cell lysis. In contrast to the sensitive line, the SKOV-3 tumor cell line is sensitive to protein synthesis inhibition by DTX but is not susceptible to cytolysis and apoptosis by DTX. Thus, protein synthesis inhibition by DTX is not sufficient to mediate target cell lysis. The synergy in cytotoxicity obtained with the combination of DTX and TNF-alpha was examined in order to determine the pathway mediated by DTX in synergy. Like the direct lysis by DTX, synergy was significantly reduced by MeSAdo and by nicotinamide. Furthermore, synergy was not observed with combination of CRM 197 and TNF-alpha. These results demonstrate that, in synergy, DTX may utilize the same pathway required for its cytolytic activity. Pseudomonas aeruginosa exotoxin shared most the properties shown for DTX. Altogether, these findings

  16. Tagging, Encoding, and Jones Optimality

    DEFF Research Database (Denmark)

    Danvy, Olivier; Lopez, Pablo E. Martinez

    2003-01-01

    A partial evaluator is said to be Jones-optimal if the result of specializing a self-interpreter with respect to a source program is textually identical to the source program, modulo renaming. Jones optimality has already been obtained if the self-interpreter is untyped. If the selfinterpreter...... is typed, however, residual programs are cluttered with type tags. To obtain the original source program, these tags must be removed. A number of sophisticated solutions have already been proposed. We observe, however, that with a simple representation shift, ordinary partial evaluation is already Jones......-optimal, modulo an encoding. The representation shift amounts to reading the type tags as constructors for higherorder abstract syntax. We substantiate our observation by considering a typed self-interpreter whose input syntax is higher-order. Specializing this interpreter with respect to a source program yields...

  17. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  18. Use of fragmentation beams at LNS with CHIMERA detector

    Directory of Open Access Journals (Sweden)

    Gianí R.

    2012-07-01

    Full Text Available The recent intensity upgrade of the LNS fragmentation beam is discussed. The available beams, the tagging procedures and details on the beam quality are reported. The experimental program started with the CHIMERA detector using such beams is also discussed with preliminary results and future perspectives.

  19. Tagging, Encoding, and Jones Optimality

    DEFF Research Database (Denmark)

    Danvy, Olivier; López, Pablo Ernesto Martínes

    2003-01-01

    A partial evaluator is said to be Jones-optimal if the result of specializing a self-interpreter with respect to a source program is textually identical to the source program, modulo renaming. Jones optimality has already been obtained if the self-interpreter is untyped. If the selfinterpreter...... is typed, however, residual programs are cluttered with type tags. To obtain the original source program, these tags must be removed. A number of sophisticated solutions have already been proposed. We observe, however, that with a simple representation shift, ordinary partial evaluation is already Jones...

  20. WebTag: Web browsing into sensor tags over NFC.

    Science.gov (United States)

    Echevarria, Juan Jose; Ruiz-de-Garibay, Jonathan; Legarda, Jon; Alvarez, Maite; Ayerbe, Ana; Vazquez, Juan Ignacio

    2012-01-01

    Information and Communication Technologies (ICTs) continue to overcome many of the challenges related to wireless sensor monitoring, such as for example the design of smarter embedded processors, the improvement of the network architectures, the development of efficient communication protocols or the maximization of the life cycle autonomy. This work tries to improve the communication link of the data transmission in wireless sensor monitoring. The upstream communication link is usually based on standard IP technologies, but the downstream side is always masked with the proprietary protocols used for the wireless link (like ZigBee, Bluetooth, RFID, etc.). This work presents a novel solution (WebTag) for a direct IP based access to a sensor tag over the Near Field Communication (NFC) technology for secure applications. WebTag allows a direct web access to the sensor tag by means of a standard web browser, it reads the sensor data, configures the sampling rate and implements IP based security policies. It is, definitely, a new step towards the evolution of the Internet of Things paradigm.

  1. Development of a PCR/LDR/flow-through hybridization assay using a capillary tube, probe DNA-immobilized magnetic beads and chemiluminescence detection.

    Science.gov (United States)

    Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko

    2013-01-01

    A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.

  2. Crystal structure of an Okazaki fragment at 2-A resolution

    Science.gov (United States)

    Egli, M.; Usman, N.; Zhang, S. G.; Rich, A.

    1992-01-01

    In DNA replication, Okazaki fragments are formed as double-stranded intermediates during synthesis of the lagging strand. They are composed of the growing DNA strand primed by RNA and the template strand. The DNA oligonucleotide d(GGGTATACGC) and the chimeric RNA-DNA oligonucleotide r(GCG)d(TATACCC) were combined to form a synthetic Okazaki fragment and its three-dimensional structure was determined by x-ray crystallography. The fragment adopts an overall A-type conformation with 11 residues per turn. Although the base-pair geometry, particularly in the central TATA part, is distorted, there is no evidence for a transition from the A- to the B-type conformation at the junction between RNA.DNA hybrid and DNA duplex. The RNA trimer may, therefore, lock the complete fragment in an A-type conformation.

  3. Tempting to Tag : An Experimental Comparison of Four Tagging Input Mechanisms

    OpenAIRE

    Melenhorst, Mark; van Velsen, Lex

    2010-01-01

    Tagging helps achieve improved indexing and recommendation of resources (e.g., videos or pictures) in large data collections. In order to reap the benefits of tagging, people must be persuaded to label the resources they consume. This paper reports on a study in which four different tagging input mechanisms and their effect on users' motivation to tag were compared. The mechanisms consisted of a standard tag input box, a chatbot-like environment, a bookmarking mechanism, and a "tag and v...

  4. Multidimensional analysis: B-tagging at LEP

    International Nuclear Information System (INIS)

    de la Vaissiere, C.; Palma-Lopes, S.

    1989-01-01

    At the Z 0 , the cross-section for e + e - → b anti b is large (6.5 nb), as is the fraction of hadronic events leading to b anti b (22%). A jet topology allows to distinguish naturally the products of the b and anti b fragmentation and decays. The Z 0 looks therefore an attractive place to pursue B physics. Techniques previously used at PEP and PETRA to tag the b-flavor, have provided reasonable b-purities, at the cost of poor efficiencies. A first technique originally proposed to measure the b-lifetime was to use leptonic decays, but the corresponding branching ratios are at the 10% level. At Z 0 energies, P. Roudeau shows that a 91% purity and 6% efficiency can be obtained. The TASSO collaboration was the first to use a vertex detector for b-enrichment. They achieved a b-purity of about 68%, with a 16%-efficiency. The best way to increase these low yields is to improve the resolution of vertex detectors on impact parameters. DELPHI will be equipped with a silicon microstrip vertex detector which will provide an asymptotic accuracy of 20 μm on impact parameters in the plane transverse to the beam, to be compared with the 150 μm quoted by TASSO. However this 20 μm, combined with limited coverage, can not disentangle the multiple decays occurring in a b anti b event. In this intermediate situation multidimensional analysis may provide tagging of b anti b events with high purity and good efficiency. 11 refs., 2 figs., 2 tabs

  5. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  6. Fragman: an R package for fragment analysis.

    Science.gov (United States)

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  7. Bone fragments a body can make

    Energy Technology Data Exchange (ETDEWEB)

    Stout, S.D.; Ross, L.M. Jr. (Department of Anthropology, University of Missouri, Columbia (USA))

    1991-05-01

    Data obtained from various analytical techniques applied to a number of small bone fragments recovered from a crime scene were used to provide evidence for the occurrence of a fatality. Microscopic and histomorphometric analyses confirmed that the fragments were from a human skull. X-ray microanalysis of darkened areas on the bone fragments revealed a chemical signature that matched the chemical signature of a shotgun pellet recovered at the scene of the crime. The above findings supported the deoxyribonucleic acid (DNA) fingerprint evidence which, along with other evidence, was used to convict a man for the murder of his wife, even though her body was never recovered.

  8. Satellite Tags- Guam/CNMI EEZ

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Satellite tagging was implemented in 2013. Satellite tagging is conducted using a Dan Inject air rifle and deployment arrows designed by Wildlife Computers. Two...

  9. HMSRP Hawaiian Monk Seal Tag Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains records for all tags applied to Hawaiian monk seals since 1981. These tags were applied by PSD personnel and cooperating scientists as part of...

  10. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... development, 3 ESTs may play a role in energy production and photosynthesis, 2 ESTs are related to ... Environmental stress always affects plant growth, leading to changes in .... electrophoresis and the trend of expression changes in differential ..... nical strength, can affect cell growth rate, transportation.

  11. ATLAS boosted object tagging 2

    CERN Document Server

    Caudron, Julien; The ATLAS collaboration

    2015-01-01

    A detailed study into the optimal techniques for identifying boosted hadronically decaying W or Z bosons is presented. Various algorithms for reconstructing, grooming and tagging bosonic jets are compared for W bosons with a wide range of transverse momenta using 8 TeV data and 8 TeV and 13 TeV MC simulations. In addition, given that a hadronic jet has been identified as resulting from the hadronic decay of a W or Z, a technique is developed to discriminate between W and Z bosons. The modeling of the tagging variables used in this technique is studied using 8 TeV pp collision data and systematic uncertainties for the tagger efficiency and fake rates are evaluated.

  12. Deciding Security for a Fragment of ASLan

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander

    situations in security such as the interaction between the work ow of a system with its access control policies. While even the transition relation is undecidable for ASLan in general, we show the security problem is decidable for a large and useful fragment that we call TASLan, as long as we bound...... the number of steps of honest participants. The restriction of TASLan is that all messages and predicates must be in a certain sense unambiguous in their interpretation, excluding \\type-confusions" similar to some tagging results for security protocols....

  13. The examination of Hevea brasiliensis plants produced by in vitro culture and mutagenesis by DNA fingerprinting techniques

    International Nuclear Information System (INIS)

    Low, F.C.; Atan, S.; Jaafar, H.

    1998-01-01

    Rubber (Hevea brasiliensis) plants derived from anther and ovule culture as well as gamma-irradiated plants were examined by several DNA marker techniques. These include restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), sequence tagged microsatellite sites (STMS), DNA amplification fingerprinting (DAF) and amplified fragment length polymorphisms (AFLPs). Compared to control plants produced by vegetative propagation (cutting and budding), plants produced by in vitro culture appeared to have a reduction in the number of rDNA loci. Two RAPD protocols were compared and found to be similar in amplification of the major DNA bands. After confirmation that the RAPD method adopted was reproducible, the technique was applied to the present studies. Eight out of the 60 primers screened were able to elicit polymorphisms between pooled DNA from in vitro culture plants. Variations in DNA patterns were observed between pooled DNA samples of anther-derived plants as well as between anther-derived and ovule-derived plants. Comparisons of RAPD patterns obtained between anther-derived plants exposed to increasing dosages of gamma-irradiation with non irradiated anther-derived plants revealed distinct DNA polymorphisms. The changes in DNA profiles did not appear to be correlated to the dosage of irradiation. Since somaclonal variation was detected, it was difficult to identify changes which were specifically caused by irradiation. Application of the STMS technique to tag micro satellite sequences (GA) n , (TA) n and (TTA) n in the hydroxymethylglutaryl coenzyme A reductase-1 (hmgr-1) gene failed to detect differences between plants derived from anther and ovule culture. Although restriction endonuclease digestions with methylation sensitive enzymes suggested that four in vitro culture plants examined exhibited similar digestion patterns as the controls, a change in cytosine methylation in one anther-derived plant was detected. Examination of

  14. Universal elements of fragmentation

    International Nuclear Information System (INIS)

    Yanovsky, V. V.; Tur, A. V.; Kuklina, O. V.

    2010-01-01

    A fragmentation theory is proposed that explains the universal asymptotic behavior of the fragment-size distribution in the large-size range, based on simple physical principles. The basic principles of the theory are the total mass conservation in a fragmentation process and a balance condition for the energy expended in increasing the surface of fragments during their breakup. A flux-based approach is used that makes it possible to supplement the basic principles and develop a minimal theory of fragmentation. Such a supplementary principle is that of decreasing fragment-volume flux with increasing energy expended in fragmentation. It is shown that the behavior of the decreasing flux is directly related to the form of a power-law fragment-size distribution. The minimal theory is used to find universal asymptotic fragment-size distributions and to develop a natural physical classification of fragmentation models. A more general, nonlinear theory of strong fragmentation is also developed. It is demonstrated that solutions to a nonlinear kinetic equation consistent with both basic principles approach a universal asymptotic size distribution. Agreement between the predicted asymptotic fragment-size distributions and experimental observations is discussed.

  15. Scar-less multi-part DNA assembly design automation

    Science.gov (United States)

    Hillson, Nathan J.

    2016-06-07

    The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.

  16. Predicting floods with Flickr tags.

    Science.gov (United States)

    Tkachenko, Nataliya; Jarvis, Stephen; Procter, Rob

    2017-01-01

    Increasingly, user generated content (UGC) in social media postings and their associated metadata such as time and location stamps are being used to provide useful operational information during natural hazard events such as hurricanes, storms and floods. The main advantage of these new sources of data are twofold. First, in a purely additive sense, they can provide much denser geographical coverage of the hazard as compared to traditional sensor networks. Second, they provide what physical sensors are not able to do: By documenting personal observations and experiences, they directly record the impact of a hazard on the human environment. For this reason interpretation of the content (e.g., hashtags, images, text, emojis, etc) and metadata (e.g., keywords, tags, geolocation) have been a focus of much research into social media analytics. However, as choices of semantic tags in the current methods are usually reduced to the exact name or type of the event (e.g., hashtags '#Sandy' or '#flooding'), the main limitation of such approaches remains their mere nowcasting capacity. In this study we make use of polysemous tags of images posted during several recent flood events and demonstrate how such volunteered geographic data can be used to provide early warning of an event before its outbreak.

  17. Approximation properties of haplotype tagging

    Directory of Open Access Journals (Sweden)

    Dreiseitl Stephan

    2006-01-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs are locations at which the genomic sequences of population members differ. Since these differences are known to follow patterns, disease association studies are facilitated by identifying SNPs that allow the unique identification of such patterns. This process, known as haplotype tagging, is formulated as a combinatorial optimization problem and analyzed in terms of complexity and approximation properties. Results It is shown that the tagging problem is NP-hard but approximable within 1 + ln((n2 - n/2 for n haplotypes but not approximable within (1 - ε ln(n/2 for any ε > 0 unless NP ⊂ DTIME(nlog log n. A simple, very easily implementable algorithm that exhibits the above upper bound on solution quality is presented. This algorithm has running time O((2m - p + 1 ≤ O(m(n2 - n/2 where p ≤ min(n, m for n haplotypes of size m. As we show that the approximation bound is asymptotically tight, the algorithm presented is optimal with respect to this asymptotic bound. Conclusion The haplotype tagging problem is hard, but approachable with a fast, practical, and surprisingly simple algorithm that cannot be significantly improved upon on a single processor machine. Hence, significant improvement in computatational efforts expended can only be expected if the computational effort is distributed and done in parallel.

  18. b-tagging in DELPHI at LEP

    CERN Document Server

    Abdallah, J; Adam, W; Adye, T; Adzic, P; Albrecht, T; Alderweireld, T; Alemany-Fernandez, R; Allmendinger, T; Allport, P P; Almehed, S; Amaldi, Ugo; Amapane, N; Amato, S; Anashkin, E; Andreazza, A; Andringa, S; Anjos, N; Antilogus, P; Apel, W D; Arnoud, Y; Ask, S; Åsman, B; Augustin, J E; Augustinus, A; Baillon, Paul; Ballestrero, A; Bambade, P; Barbier, R; Bardin, Dimitri Yuri; Barker, G; Baroncelli, A; Bates, M; Battaglia, Marco; Baubillier, M; Becks, K H; Begalli, M; Behrmann, A; Benekos, N C; Benvenuti, Alberto C; Bérat, C; Berggren, M; Berntzon, L; Bertrand, D; Besançon, M; Besson, N; Bibby, J; Biffi, P; Bloch, D; Blom, M; Bonesini, M; Boonekamp, M; Booth, P S L; Borisov, G; Botner, O; Bouquet, B; Bowcock, T J V; Boyko, I; Bracko, M; Branchini, P; Brenner, R; Brodet, E; Brückman, P; Brunet, J M; Bugge, L; Buschmann, P; Caccia, M; Calvi, M; Camporesi, T; Canale, V; Carena, F; Castro, N; Cavallo, F R; Chabaud, V; Chapkin, M M; Charpentier, P; Checchia, P; Chierici, R; Shlyapnikov, P; Chudoba, J; Chung, S U; Cieslik, K; Collins, P; Contri, R; Cosme, G; Cossutti, F; Costa, M J; Couchot, F; Crawley, B; Crennell, D J; Cuevas-Maestro, J; D'Almagne, B; D'Hondt, J; Dalmau, J; Da Silva, T; Da Silva, W; Della Ricca, G; De Angelis, A; de Boer, Wim; De Clercq, C; De Lotto, B; De Maria, N; De Min, A; De Paula, L S; Di Ciaccio, Lucia; Dijkstra, H; Di Simone, A; Doroba, K; Drees, J; Dris, M; Eigen, G; Ekelöf, T J C; Ellert, M; Elsing, M; Espirito-Santo, M C; Fanourakis, G K; Fassouliotis, D; Feindt, M; Fernández, J; Ferrer, A; Ferro, F; Flagmeyer, U; Föth, H; Fokitis, E; Fulda-Quenzer, F; Fuster, J A; Gandelman, M; García, C; Gavillet, P; Gazis, E N; Geralis, T; Gokieli, R; Golob, B; Gómez-Cadenas, J J; Gómez-Ceballos, G; Gonçalves, P; Graziani, E; Grosdidier, G; Grzelak, K; Guy, J; Haag, C; Hallgren, A; Hamacher, K; Hamilton, K; Hansen, J; Haug, S; Hauler, F; Hedberg, V; Hennecke, M; Hernando, J A; Herr, H; Heuser, J M; Holmgren, S O; Holt, P J; Houlden, M A; Hultqvist, K; Jackson, J N; Jalocha, P; Jarlskog, C; Jarlskog, G; Jarry, P; Jeans, D; Johansson, E K; Johansson, P D; Jonsson, P; Joram, C; Jungermann, L; Kapusta, F; Karlsson, M; Katsanevas, S; Katsoufis, E C; Keränen, R; Kernel, G; Kersevan, Borut P; Kiiskinen, A P; King, B T; Kjaer, N J; Kluit, P; Kokkinias, P; Kourkoumelis, C; Kuznetsov, O; Krumshtein, Z; Kucharczyk, M; Kucewicz, W; Kurowska, J; Lamsa, J; Leder, G; Ledroit, F; Leinonen, L; Leitner, R; Lemonne, J; Lepeltier, V; Lesiak, T; Liebig, W; Liko, D; Lipniacka, A; Lopes, J H; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J; Malek, A; Maltezos, S; Mandl, F; Marco, J; Marco, R; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Martínez-Vidal, F; Masik, J; Mastroyiannopoulos, N; Matorras, F; Matteuzzi, C; Mazzucato, F; Mazzucato, M; McNulty, R; Meroni, C; Meyer, W T; Migliore, E; Mitaroff, W A; Mjörnmark, U; Moa, T; Moch, M; Mönig, K; Monge, R; Montenegro, J; Moraes, D; Moreno, S; Morettini, P; Müller, U; Münich, K; Mulders, M; Mundim, L; Murray, W; Muryn, B; Myatt, Gerald; Myklebust, T; Nassiakou, M; Navarria, Francesco Luigi; Nawrocki, K; Nicolaidou, R; Niezurawski, P; Nikolenko, M; Nomerotski, A; Norman, A; Nygren, A; Oblakowska-Mucha, A; Obraztsov, V F; Olshevskii, A G; Onofre, A; Orava, Risto; Österberg, K; Ouraou, A; Oyanguren, A; Paganoni, M; Paiano, S; Palacios, J P; Palka, H; Papadopoulou, T D; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Passon, O; Peralta, L; Perepelitsa, V F; Perrotta, A; Petrolini, A; Piedra, J; Pieri, L; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Poireau, V; Pol, M E; Polok, G; Poropat, P; Pozdnyakov, V; Pukhaeva, N; Pullia, Antonio; Rames, J; Ramler, L; Read, A; Rebecchi, P; Rehn, J; Reid, D; Reinhardt, R; Renton, P B; Richard, F; Rídky, J; Rivero, M; Rodríguez, D; Romero, A; Ronchese, P; Rosenberg, E I; Roudeau, Patrick; Rovelli, T; Ruhlmann-Kleider, V; Ryabtchikov, D; Sadovskii, A; Salmi, L; Salt, J; Savoy-Navarro, A; Schwickerath, U; Segar, A; Sekulin, R L; Siebel, M; Sissakian, A N; Smadja, G; Smirnova, O G; Sokolov, A; Sopczak, A; Sosnowski, R; Spassoff, Tz; Stanitzki, M; Stavitski, I; Stocchi, A; Strauss, J; Stugu, B; Szczekowski, M; Szeptycka, M; Szumlak, T; Tabarelli de Fatis, T; Taffard, A C; Tegenfeldt, F; Timmermans, J; Tinti, N; Tkatchev, L G; Tobin, M; Todorovova, S; Tomaradze, A G; Tomé, B; Tonazzo, A; Tortosa, P; Travnicek, P; Treille, D; Trischuk, W; Tristram, G; Trochimczuk, M; Troncon, C; Turluer, M L; Tyapkin, I A; Tyapkin, P; Tyndel, M; Tzamarias, S; Uvarov, V; Valenti, G; van Dam, P; Van Eldik, J; Van Lysebetten, A; Van Remortel, N; Van Vulpen, I B; Vegni, G; Veloso, F; Venus, W A; Verbeure, F; Verdier, P; Verzi, V; Vilanova, D; Vitale, L; Vrba, V; Wahlen, H; Washbrook, A J; Weilhammer, Peter; Weiser, C; Wicke, D; Wickens, J H; Wilkinson, G; Winter, M; Witek, M; Yushchenko, O P; Zalewska-Bak, A; Zalewski, Piotr; Zavrtanik, D; Zimin, N I; Zinchenko, A I; Zupan, M

    2004-01-01

    The standard method used for tagging b-hadrons in the DELPHI experiment at the CERN LEP Collider is discussed in detail. The main ingredient of b-tagging is the impact parameters of tracks, which relies mostly on the vertex detector. Additional information, such as the mass of particles associated to a secondary vertex, significantly improves the selection efficiency and the background suppression. The paper describes various discriminating variables used for the tagging and the procedure of their combination. In addition, applications of b-tagging to some physics analyses, which depend crucially on the performance and reliability of b-tagging, are described briefly.

  19. A simple and robust approach to immobilization of antibody fragments.

    Science.gov (United States)

    Ikonomova, Svetlana P; He, Ziming; Karlsson, Amy J

    2016-08-01

    Antibody fragments, such as the single-chain variable fragment (scFv), have much potential in research and diagnostics because of their antigen-binding ability similar to a full-sized antibody and their ease of production in microorganisms. Some applications of antibody fragments require immobilization on a surface, and we have established a simple immobilization method that is based on the biotin-streptavidin interaction and does not require a separate purification step. We genetically fused two biotinylation tags-the biotin carboxyl carrier protein (BCCP) or the AviTag minimal sequence-to six different scFvs (scFv13R4, scFvD10, scFv26-10, scFv3, scFv5, and scFv12) for site-specific biotinylation in vivo by endogenous biotin ligases produced by Escherichia coli. The biotinylated scFvs were immobilized onto streptavidin-coated plates directly from cell lysates, and immobilization was detected through enzyme-linked immunosorbent assays. All scFvs fusions were successfully immobilized, and scFvs biotinylated via the BCCP tag tended to immobilize better than those biotinylated via the AviTag, even when biotinylation efficiency was improved with the biotin ligase BirA. The ability of immobilized scFvs to bind antigens was confirmed using scFv13R4 and scFvD10 with their respective targets β-galactosidase and bacteriophage lambda head protein D (gpD). The immobilized scFv13R4 bound to β-galactosidase at the same level for both biotinylation tags when the surface was saturated with the scFv, and immobilized scFvs retained their functionality for at least 100days after immobilization. The simplicity and robustness of our method make it a promising approach for future applications that require antibody fragment immobilization. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Gas tagging system development in Japan

    International Nuclear Information System (INIS)

    Sekiguchi, N.; Rindo, H.; Akiyama, T.; Miyazawa, T.; Heki, H.

    1981-05-01

    The Gas tagging method has been considered to be most desirable for a failed fuel location system for the fast breeder reactor, regarding the component reduction in the reactor vessel and rapid location during reactor operation. The gas tagging system has been designed by referring to R and D results obtained in Japan and other countries. The designed system is comprised of tag gas filling pins, cover gas sampling system, tag gas recovery and enrichment system, tag gas analyzer and system control and data handling computers. The main specifications for this system have been decided as follows; 1) Main function is location of failed fuels in core and a part of blanket region, 2) Identification capability is each subassembly, 3) Time for identification is within a few days, 4) Continuous operation with automatic start at fuel failure, 5) Detection sensitivity must cover both gas leak and pin burst. In designing the gas tagging system, the following R and D items were selected; 1) System design study, 2) Tag gas capsule development, 3) Modeling the tag gas behavior in reactor primary cooling system, 4) Tag gas recovery and enrichment system, 5) Computer code development for tag gas isotope ratio change estimation. Details of the Japanese gas tagging system development appear in this paper. (author)

  1. Secure passive RFID tag with seal

    Science.gov (United States)

    Nekoogar, Faranak; Reynolds, Matthew; Lefton, Scott; Dowla, Farid; Twogood, Richard

    2017-11-14

    A secure passive RFID tag system comprises at least one base station and at least one passive RFID tag. The tag includes a fiber optic cable with the cable ends sealed within the tag and the middle portion forming an external loop. The loop may be secured to at least portions of an object. The tag transmits and receives an optical signal through the fiber optic cable, and the cable is configured to be damaged or broken in response to removal or tampering attempts, wherein the optical signal is significantly altered if the cable is damaged or broken. The tag transmits the optical signal in response to receiving a radio signal from the base station and compares the transmitted optical signal to the received optical signal. If the transmitted optical signal and the received optical signal are identical, the tag transmits an affirmative radio signal to the base station.

  2. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  3. Universality of fragment shapes.

    Science.gov (United States)

    Domokos, Gábor; Kun, Ferenc; Sipos, András Árpád; Szabó, Tímea

    2015-03-16

    The shape of fragments generated by the breakup of solids is central to a wide variety of problems ranging from the geomorphic evolution of boulders to the accumulation of space debris orbiting Earth. Although the statistics of the mass of fragments has been found to show a universal scaling behavior, the comprehensive characterization of fragment shapes still remained a fundamental challenge. We performed a thorough experimental study of the problem fragmenting various types of materials by slowly proceeding weathering and by rapid breakup due to explosion and hammering. We demonstrate that the shape of fragments obeys an astonishing universality having the same generic evolution with the fragment size irrespective of materials details and loading conditions. There exists a cutoff size below which fragments have an isotropic shape, however, as the size increases an exponential convergence is obtained to a unique elongated form. We show that a discrete stochastic model of fragmentation reproduces both the size and shape of fragments tuning only a single parameter which strengthens the general validity of the scaling laws. The dependence of the probability of the crack plan orientation on the linear extension of fragments proved to be essential for the shape selection mechanism.

  4. Anomalous nuclear fragments

    International Nuclear Information System (INIS)

    Karmanov, V.A.

    1983-01-01

    Experimental data are given, the status of anomalon problem is discussed, theoretical approaches to this problem are outlined. Anomalons are exotic objects formed following fragmentation of nuclei-targets under the effect of nuclei - a beam at the energy of several GeV/nucleon. These nuclear fragments have an anomalously large cross section of interaction and respectively, small free path, considerably shorter than primary nuclei have. The experimental daa are obtained in accelerators following irradiation of nuclear emulsions by 16 O, 56 Fe, 40 Ar beams, as well as propane by 12 C beams. The experimental data testify to dependence of fragment free path on the distance L from the point of the fragment formation. A decrease in the fragment free path is established more reliably than its dependence on L. The problem of the anomalon existence cannot be yet considered resolved. Theoretical models suggested for explanation of anomalously large cross sections of nuclear fragment interaction are variable and rather speculative

  5. Scalable Faceted Ranking in Tagging Systems

    Science.gov (United States)

    Orlicki, José I.; Alvarez-Hamelin, J. Ignacio; Fierens, Pablo I.

    Nowadays, web collaborative tagging systems which allow users to upload, comment on and recommend contents, are growing. Such systems can be represented as graphs where nodes correspond to users and tagged-links to recommendations. In this paper we analyze the problem of computing a ranking of users with respect to a facet described as a set of tags. A straightforward solution is to compute a PageRank-like algorithm on a facet-related graph, but it is not feasible for online computation. We propose an alternative: (i) a ranking for each tag is computed offline on the basis of tag-related subgraphs; (ii) a faceted order is generated online by merging rankings corresponding to all the tags in the facet. Based on the graph analysis of YouTube and Flickr, we show that step (i) is scalable. We also present efficient algorithms for step (ii), which are evaluated by comparing their results with two gold standards.

  6. Building Tag Clouds in Perl and PHP

    CERN Document Server

    Bumgardner, Jim

    2006-01-01

    Tag clouds are everywhere on the web these days. First popularized by the web sites Flickr, Technorati, and del.icio.us, these amorphous clumps of words now appear on a slew of web sites as visual evidence of their membership in the elite corps of "Web 2.0." This PDF analyzes what is and isn't a tag cloud, offers design tips for using them effectively, and then goes on to show how to collect tags and display them in the tag cloud format. Scripts are provided in Perl and PHP. Yes, some have said tag clouds are a fad. But as you will see, tag clouds, when used properly, have real merits. More

  7. Understanding why users tag: A survey of tagging motivation literature and results from an empirical study.

    Science.gov (United States)

    Strohmaier, Markus; Körner, Christian; Kern, Roman

    2012-12-01

    While recent progress has been achieved in understanding the structure and dynamics of social tagging systems, we know little about the underlying user motivations for tagging, and how they influence resulting folksonomies and tags. This paper addresses three issues related to this question. (1) What distinctions of user motivations are identified by previous research, and in what ways are the motivations of users amenable to quantitative analysis? (2) To what extent does tagging motivation vary across different social tagging systems? (3) How does variability in user motivation influence resulting tags and folksonomies? In this paper, we present measures to detect whether a tagger is primarily motivated by categorizing or describing resources, and apply these measures to datasets from seven different tagging systems. Our results show that (a) users' motivation for tagging varies not only across, but also within tagging systems, and that (b) tag agreement among users who are motivated by categorizing resources is significantly lower than among users who are motivated by describing resources . Our findings are relevant for (1) the development of tag-based user interfaces, (2) the analysis of tag semantics and (3) the design of search algorithms for social tagging systems.

  8. Learner Corpora without Error Tagging

    Directory of Open Access Journals (Sweden)

    Rastelli, Stefano

    2009-01-01

    Full Text Available The article explores the possibility of adopting a form-to-function perspective when annotating learner corpora in order to get deeper insights about systematic features of interlanguage. A split between forms and functions (or categories is desirable in order to avoid the "comparative fallacy" and because – especially in basic varieties – forms may precede functions (e.g., what resembles to a "noun" might have a different function or a function may show up in unexpected forms. In the computer-aided error analysis tradition, all items produced by learners are traced to a grid of error tags which is based on the categories of the target language. Differently, we believe it is possible to record and make retrievable both words and sequence of characters independently from their functional-grammatical label in the target language. For this purpose at the University of Pavia we adapted a probabilistic POS tagger designed for L1 on L2 data. Despite the criticism that this operation can raise, we found that it is better to work with "virtual categories" rather than with errors. The article outlines the theoretical background of the project and shows some examples in which some potential of SLA-oriented (non error-based tagging will be possibly made clearer.

  9. B-tagging in CMS at LHC

    CERN Document Server

    Cucciarelli, S

    2003-01-01

    This report provides a review of the main algorithms for offline inclusive b-tagging developed within the CMS community. Two b-tag algorithms, one based on the impact parameter measurement and the other based on the secondary vertices are discussed. The performance of these algorithms are presented for several jet transverse energies and pseudorapidity regions. An additional decay length based b-tag is also described and its preliminary performance is presented. (4 refs) .

  10. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  11. DNA-based species detection capabilities using laser transmission spectroscopy.

    Science.gov (United States)

    Mahon, A R; Barnes, M A; Li, F; Egan, S P; Tanner, C E; Ruggiero, S T; Feder, J L; Lodge, D M

    2013-01-06

    Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications.

  12. trieFinder: an efficient program for annotating Digital Gene Expression (DGE) tags.

    Science.gov (United States)

    Renaud, Gabriel; LaFave, Matthew C; Liang, Jin; Wolfsberg, Tyra G; Burgess, Shawn M

    2014-10-13

    Quantification of a transcriptional profile is a useful way to evaluate the activity of a cell at a given point in time. Although RNA-Seq has revolutionized transcriptional profiling, the costs of RNA-Seq are still significantly higher than microarrays, and often the depth of data delivered from RNA-Seq is in excess of what is needed for simple transcript quantification. Digital Gene Expression (DGE) is a cost-effective, sequence-based approach for simple transcript quantification: by sequencing one read per molecule of RNA, this technique can be used to efficiently count transcripts while obviating the need for transcript-length normalization and reducing the total numbers of reads necessary for accurate quantification. Here, we present trieFinder, a program specifically designed to rapidly map, parse, and annotate DGE tags of various lengths against cDNA and/or genomic sequence databases. The trieFinder algorithm maps DGE tags in a two-step process. First, it scans FASTA files of RefSeq, UniGene, and genomic DNA sequences to create a database of all tags that can be derived from a predefined restriction site. Next, it compares the experimental DGE tags to this tag database, taking advantage of the fact that the tags are stored as a prefix tree, or "trie", which allows for linear-time searches for exact matches. DGE tags with mismatches are analyzed by recursive calls in the data structure. We find that, in terms of alignment speed, the mapping functionality of trieFinder compares favorably with Bowtie. trieFinder can quickly provide the user an annotation of the DGE tags from three sources simultaneously, simplifying transcript quantification and novel transcript detection, delivering the data in a simple parsed format, obviating the need to post-process the alignment results. trieFinder is available at http://research.nhgri.nih.gov/software/trieFinder/.

  13. Sensor-based material tagging system

    International Nuclear Information System (INIS)

    Vercellotti, L.C.; Cox, R.W.; Ravas, R.J.; Schlotterer, J.C.

    1991-01-01

    Electronic identification tags are being developed for tracking material and personnel. In applying electronic identification tags to radioactive materials safeguards, it is important to measure attributes of the material to ensure that the tag remains with the material. The addition of a microcontroller with an on-board analog-to-digital converter to an electronic identification tag application-specific integrated-circuit has been demonstrated as means to provide the tag with sensor data. Each tag is assembled into a housing, which serves as a scale for measuring the weight of a paint-can-sized container and its contents. Temperature rise of the can above ambient is also measured, and a piezoelectric detector detects disturbances and immediately puts the tag into its alarm and beacon mode. Radiation measurement was also considered, but the background from nearby containers was found to be excessive. The sensor-based tagging system allows tracking of the material in cans as it is stored in vaults or is moved through the manufacturing process. The paper presents details of the sensor-based material tagging system and describes a demonstration system

  14. Graph based techniques for tag cloud generation

    DEFF Research Database (Denmark)

    Leginus, Martin; Dolog, Peter; Lage, Ricardo Gomes

    2013-01-01

    Tag cloud is one of the navigation aids for exploring documents. Tag cloud also link documents through the user defined terms. We explore various graph based techniques to improve the tag cloud generation. Moreover, we introduce relevance measures based on underlying data such as ratings...... or citation counts for improved measurement of relevance of tag clouds. We show, that on the given data sets, our approach outperforms the state of the art baseline methods with respect to such relevance by 41 % on Movielens dataset and by 11 % on Bibsonomy data set....

  15. Flavour Tagging developments within the LHCb experiment

    CERN Document Server

    Grabalosa, Marc

    Flavour Tagging at the LHCb experiment is a fundamental tool for the measurement of B oscillations and the study of CP violation. This document explains the development of different tagging techniques and the different strategies used to combine them to determine the flavour of the B meson as precisely as possible. The response of the tagging algorithms also needs to be optimized and calibrated. Both procedures are described using the available LHCb datasets corresponding to various integrated luminosities. First results on the tagging performances are shown for different control channels and physics measurements.

  16. Using Interference to Block RFID Tags

    DEFF Research Database (Denmark)

    Krigslund, Rasmus; Popovski, Petar; Pedersen, Gert Frølund

    We propose a novel method to block RFID tags from responding, using intentional interference. We focus on the experimental evaluation, where we impose interference on the download and uplink, respectively. The results are positive, where modulated CCI shows most effective to block a tag.......We propose a novel method to block RFID tags from responding, using intentional interference. We focus on the experimental evaluation, where we impose interference on the download and uplink, respectively. The results are positive, where modulated CCI shows most effective to block a tag....

  17. Discharge residence of TLD tagged fish

    International Nuclear Information System (INIS)

    Romberg, G.P.; Prepejchal, W.

    1974-01-01

    Although visual observations suggested that fish remained in the discharge for considerable periods, temperature-sensitive tags indicated the majority of fish spend less than 50 hr or 10 percent of the time at discharge temperatures. During 1974 a second fish tagging study was conducted, using temperature-sensitive tags to yield discharge residence times of Lake Michigan salmonids at Point Beach thermal discharge. Preliminary results revealed that many fish tag values were close to Unit I line indicating that calculated maximum discharge residence times for these fish will be nearly 100 percent of the elapsed time

  18. Fission fragment angular momentum

    International Nuclear Information System (INIS)

    Frenne, D. De

    1991-01-01

    Most of the energy released in fission is converted into translational kinetic energy of the fragments. The remaining excitation energy will be distributed among neutrons and gammas. An important parameter characterizing the scission configuration is the primary angular momentum of the nascent fragments. Neutron emission is not expected to decrease the spin of the fragments by more than one unit of angular momentum and is as such of less importance in the determination of the initial fragment spins. Gamma emission is a suitable tool in studying initial fragment spins because the emission time, number, energy, and multipolarity of the gammas strongly depend on the value of the primary angular momentum. The main conclusions of experiments on gamma emission were that the initial angular momentum of the fragments is large compared to the ground state spin and oriented perpendicular to the fission axis. Most of the recent information concerning initial fragment spin distributions comes from the measurement of isomeric ratios for isomeric pairs produced in fission. Although in nearly every mass chain isomers are known, only a small number are suitable for initial fission fragment spin studies. Yield and half-life considerations strongly limit the number of candidates. This has the advantage that the behavior of a specific isomeric pair can be investigated for a number of fissioning systems at different excitation energies of the fragments and fissioning nuclei. Because most of the recent information on primary angular momenta comes from measurements of isomeric ratios, the global deexcitation process of the fragments and the calculation of the initial fragment spin distribution from measured isomeric ratios are discussed here. The most important results on primary angular momentum determinations are reviewed and some theoretical approaches are given. 45 refs., 7 figs., 2 tabs

  19. Synchronization of DNA array replication kinetics

    Science.gov (United States)

    Manturov, Alexey O.; Grigoryev, Anton V.

    2016-04-01

    In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.

  20. Bag3-induced autophagy is associated with degradation of JCV oncoprotein, T-Ag.

    Directory of Open Access Journals (Sweden)

    Ilker Kudret Sariyer

    Full Text Available JC virus, JCV, is a human neurotropic polyomavirus whose replication in glial cells causes the fatal demyelinating disease progressive multifocal leukoencephalopathy (PML. In addition, JCV possesses oncogenic activity and expression of its transforming protein, large T-antigen (T-Ag, in several experimental animals induces tumors of neural origin. Further, the presence of JCV DNA and T-Ag have been repeatedly observed in several human malignant tissues including primitive neuroectodermal tumors and glioblastomas. Earlier studies have demonstrated that Bag3, a member of the Bcl-2-associated athanogene (Bag family of proteins, which is implicated in autophagy and apoptosis, is downregulated upon JCV infection of glial cells and that JCV T-Ag is responsible for suppressing the activity of the BAG3 promoter. Here, we investigated the possible impact of Bag3 on T-Ag expression in JCV-infected human primary glial cells as well as in cells derived from T-Ag-induced medulloblastoma in transgenic animals. Results from these studies revealed that overexpression of Bag3 drastically decreases the level of T-Ag expression by inducing the autophagic degradation of the viral protein. Interestingly, this event leads to the inhibition of JCV infection of glial cells, suggesting that the reduced levels of T-antigen seen upon the overexpression of Bag3 has a biological impact on the viral lytic cycle. Results from protein-protein interaction studies showed that T-Ag and Bag3 physically interact with each other through the zinc-finger of T-Ag and the proline rich domains of Bag3, and this interaction is important for the autophagic degradation of T-Ag. Our observations open a new avenue of research for better understanding of virus-host interaction by investigating the interplay between T-Ag and Bag3, and their impact on the development of JCV-associated diseases.

  1. Bag3-induced autophagy is associated with degradation of JCV oncoprotein, T-Ag.

    Science.gov (United States)

    Sariyer, Ilker Kudret; Merabova, Nana; Patel, Prem Kumer; Knezevic, Tijana; Rosati, Alessandra; Turco, Maria C; Khalili, Kamel

    2012-01-01

    JC virus, JCV, is a human neurotropic polyomavirus whose replication in glial cells causes the fatal demyelinating disease progressive multifocal leukoencephalopathy (PML). In addition, JCV possesses oncogenic activity and expression of its transforming protein, large T-antigen (T-Ag), in several experimental animals induces tumors of neural origin. Further, the presence of JCV DNA and T-Ag have been repeatedly observed in several human malignant tissues including primitive neuroectodermal tumors and glioblastomas. Earlier studies have demonstrated that Bag3, a member of the Bcl-2-associated athanogene (Bag) family of proteins, which is implicated in autophagy and apoptosis, is downregulated upon JCV infection of glial cells and that JCV T-Ag is responsible for suppressing the activity of the BAG3 promoter. Here, we investigated the possible impact of Bag3 on T-Ag expression in JCV-infected human primary glial cells as well as in cells derived from T-Ag-induced medulloblastoma in transgenic animals. Results from these studies revealed that overexpression of Bag3 drastically decreases the level of T-Ag expression by inducing the autophagic degradation of the viral protein. Interestingly, this event leads to the inhibition of JCV infection of glial cells, suggesting that the reduced levels of T-antigen seen upon the overexpression of Bag3 has a biological impact on the viral lytic cycle. Results from protein-protein interaction studies showed that T-Ag and Bag3 physically interact with each other through the zinc-finger of T-Ag and the proline rich domains of Bag3, and this interaction is important for the autophagic degradation of T-Ag. Our observations open a new avenue of research for better understanding of virus-host interaction by investigating the interplay between T-Ag and Bag3, and their impact on the development of JCV-associated diseases.

  2. Evaluating genome-wide DNA methylation changes in mice by Methylation Specific Digital Karyotyping

    Directory of Open Access Journals (Sweden)

    Maruoka Shuichiro

    2008-12-01

    Full Text Available Abstract Background The study of genome-wide DNA methylation changes has become more accessible with the development of various array-based technologies though when studying species other than human the choice of applications are limited and not always within reach. In this study, we adapted and tested the applicability of Methylation Specific Digital Karyotyping (MSDK, a non-array based method, for the prospective analysis of epigenetic changes after perinatal nutritional modifications in a mouse model of allergic airway disease. MSDK is a sequenced based method that allows a comprehensive and unbiased methylation profiling. The method generates 21 base pairs long sequence tags derived from specific locations in the genome. The resulting tag frequencies determine in a quantitative manner the methylation level of the corresponding loci. Results Genomic DNA from whole lung was isolated and subjected to MSDK analysis using the methylation-sensitive enzyme Not I as the mapping enzyme and Nla III as the fragmenting enzyme. In a pair wise comparison of the generated mouse MSDK libraries we identified 158 loci that are significantly differentially methylated (P-value = 0.05 after perinatal dietary changes in our mouse model. Quantitative methylation specific PCR and sequence analysis of bisulfate modified genomic DNA confirmed changes in methylation at specific loci. Differences in genomic MSDK tag counts for a selected set of genes, correlated well with changes in transcription levels as measured by real-time PCR. Furthermore serial analysis of gene expression profiling demonstrated a dramatic difference in expressed transcripts in mice exposed to perinatal nutritional changes. Conclusion The genome-wide methylation survey applied in this study allowed for an unbiased methylation profiling revealing subtle changes in DNA methylation in mice maternally exposed to dietary changes in methyl-donor content. The MSDK method is applicable for mouse models

  3. Engineering the ATLAS TAG Browser

    International Nuclear Information System (INIS)

    Zhang Qizhi

    2011-01-01

    ELSSI is a web-based event metadata (TAG) browser and event-level selection service for ATLAS. In this paper, we describe some of the challenges encountered in the process of developing ELSSI, and the software engineering strategies adopted to address those challenges. Approaches to management of access to data, browsing, data rendering, query building, query validation, execution, connection management, and communication with auxiliary services are discussed. We also describe strategies for dealing with data that may vary over time, such as run-dependent trigger decision decoding. Along with examples, we illustrate how programming techniques in multiple languages (PHP, JAVASCRIPT, XML, AJAX, and PL/SQL) have been blended to achieve the required results. Finally, we evaluate features of the ELSSI service in terms of functionality, scalability, and performance.

  4. To tag or not to tag: animal welfare, conservation and stakeholder considerations in fish tracking studies that use electronic tags

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, Steven J.; Nguyen, Vivian M.; Murchie, Karen J.; Thiem, Jason D.; Donaldson, Michael R.; Hinch, Scott G.; Brown, Richard S.; Fisk, Aaron

    2013-11-01

    The advent and widespread adoption of electronic tags (including biotelemetry and biologging devices) for tracking animals has provided unprecedented information on the biology, management, and conservation of fish in the world’s oceans and inland waters. However, use of these tools is not without controversy. Even when scientific and management objectives may best be achieved using electronic tags, it is increasingly important to further consider other factors such as the welfare of tagged animals (i.e., the role of training and science-based surgical guidelines, anesthetic use, inability to maintain sterile conditions in field environments), the ethics of tagging threatened species vs. using surrogates, stakeholder perspectives on tagging (including aboriginals), as well as use of data emanating from such studies (e.g., by fishers to facilitate exploitation). Failure to do so will have the potential to create conflict and undermine scientific, management and public confidence in the use of this powerful tool. Indeed, there are already a number of examples of where tracking studies using electronic tags have been halted based on concerns raised by researchers, authorities, or stakeholders. Here we present a candid evaluation of several factors that should be considered when determining when to tag or not to tag fish with electronic devices. It is not our objective to judge the merit of previous studies. Rather, we hope to stimulate debate and discussion regarding the use of electronic tags to study fish. Relatedly, there is a need for more research to address these questions (e.g., what level of cleanliness is needed when conducting surgeries, what type of training should be required for fish surgery) including human dimensions studies to understand perspectives of different actors including society as a whole with respect to tagging and tracking studies.

  5. Expression, purification, and DNA-binding activity of the solubilized NtrC protein of Herbaspirillum seropedicae.

    Science.gov (United States)

    Twerdochlib, Adriana L; Chubatsu, Leda S; Souza, Emanuel M; Pedrosa, Fábio O; Steffens, M Berenice R; Yates, M Geoffrey; Rigo, Liu U

    2003-07-01

    NtrC is a bacterial enhancer-binding protein (EBP) that activates transcription by the sigma54 RNA polymerase holoenzyme. NtrC has a three domain structure typical of EBP family. In Herbaspirillum seropedicae, an endophytic diazotroph, NtrC regulates several operons involved in nitrogen assimilation, including glnAntrBC. In order to over-express and purify the NtrC protein, DNA fragments containing the complete structural gene for the whole protein, and for the N-terminal+Central and Central+C-terminal domains were cloned into expression vectors. The NtrC and NtrC(N-terminal+Central) proteins were over-expressed as His-tag fusion proteins upon IPTG addition, solubilized using N-lauryl-sarcosyl and purified by metal affinity chromatography. The over-expressed His-tag-NtrC(Central+C-terminal) fusion protein was partially soluble and was also purified by affinity chromatography. DNA band-shift assays showed that the NtrC protein and the Central+C-terminal domains bound specifically to the H. seropedicae glnA promoter region. The C-terminal domain is presumably necessary for DNA-protein interaction and DNA-binding does not require a phosphorylated protein.

  6. Exploring the Long Tail of Social Media Tags

    NARCIS (Netherlands)

    Kordumova, S.; van Gemert, J.; Snoek, C.G.M.; Tian, Q.; Sebe, N.; Qi, G.-J.; Huet, B.; Hong, R.; Liu, X.

    2016-01-01

    There are millions of users who tag multimedia content, generating a large vocabulary of tags. Some tags are frequent, while other tags are rarely used following a long tail distribution. For frequent tags, most of the multimedia methods that aim to automatically understand audio-visual content,

  7. Method and apparatus for manufacturing gas tags

    International Nuclear Information System (INIS)

    Gross, K.C.; Laug, M.T.

    1996-01-01

    For use in the manufacture of gas tags employed in a gas tagging failure detection system for a nuclear reactor, a plurality of commercial feed gases each having a respective noble gas isotopic composition are blended under computer control to provide various tag gas mixtures having selected isotopic ratios which are optimized for specified defined conditions such as cost. Using a new approach employing a discrete variable structure rather than the known continuous-variable optimization problem, the computer controlled gas tag manufacturing process employs an analytical formalism from condensed matter physics known as stochastic relaxation, which is a special case of simulated annealing, for input feed gas selection. For a tag blending process involving M tag isotopes with N distinct feed gas mixtures commercially available from an enriched gas supplier, the manufacturing process calculates the cost difference between multiple combinations and specifies gas mixtures which approach the optimum defined conditions. The manufacturing process is then used to control tag blending apparatus incorporating tag gas canisters connected by stainless-steel tubing with computer controlled valves, with the canisters automatically filled with metered quantities of the required feed gases. 4 figs

  8. Flavour Tagging Algorithms and Performances in LHCb

    CERN Document Server

    Calvi, M; Musy, M

    2007-01-01

    In this note we describe the general characteristics of the LHCb flavour tagging algorithms and summarize the tagging performances on the Monte Carlo samples generated for the Data Challenge 2004 in different decay channels. We also discuss some systematics effects and possible methods to extract the mistag fraction in real data.

  9. Evaluation of PIT-tagging in cyprinids

    DEFF Research Database (Denmark)

    Skov, Christian; Brodersen, J.; Brönmark, C.

    2005-01-01

    Laboratory and field experiments were used to investigate how different marking procedures, with 23 mm PIT (passive integrated transponders) - tags. affected mortality, body condition and tag expulsion in small roach Rutilus rutilus and rudd Scardinus erythrophthalmus (117 to 163 mm total length...

  10. Tagging behaviour with support from controlled vocabulary

    DEFF Research Database (Denmark)

    Lykke, Marianne; Høj, Anne Lyhne; Madsen, Line Nørgaard

    2011-01-01

    ) and an enhanced tagging system (experimental system) that additionally offers suggestions from the Dewey Decimal Classification system (DDC). In the experimental study twenty-eight political students completed four tagging tasks, each comprising fifteen documents. The focus was to examine how suggestions from...

  11. Notes on SAW Tag Interrogation Techniques

    Science.gov (United States)

    Barton, Richard J.

    2010-01-01

    We consider the problem of interrogating a single SAW RFID tag with a known ID and known range in the presence of multiple interfering tags under the following assumptions: (1) The RF propagation environment is well approximated as a simple delay channel with geometric power-decay constant alpha >/= 2. (2) The interfering tag IDs are unknown but well approximated as independent, identically distributed random samples from a probability distribution of tag ID waveforms with known second-order properties, and the tag of interest is drawn independently from the same distribution. (3) The ranges of the interfering tags are unknown but well approximated as independent, identically distributed realizations of a random variable rho with a known probability distribution f(sub rho) , and the tag ranges are independent of the tag ID waveforms. In particular, we model the tag waveforms as random impulse responses from a wide-sense-stationary, uncorrelated-scattering (WSSUS) fading channel with known bandwidth and scattering function. A brief discussion of the properties of such channels and the notation used to describe them in this document is given in the Appendix. Under these assumptions, we derive the expression for the output signal-to-noise ratio (SNR) for an arbitrary combination of transmitted interrogation signal and linear receiver filter. Based on this expression, we derive the optimal interrogator configuration (i.e., transmitted signal/receiver filter combination) in the two extreme noise/interference regimes, i.e., noise-limited and interference-limited, under the additional assumption that the coherence bandwidth of the tags is much smaller than the total tag bandwidth. Finally, we evaluate the performance of both optimal interrogators over a broad range of operating scenarios using both numerical simulation based on the assumed model and Monte Carlo simulation based on a small sample of measured tag waveforms. The performance evaluation results not only

  12. Sentiment topic mining based on comment tags

    Science.gov (United States)

    Zhang, Daohai; Liu, Xue; Li, Juan; Fan, Mingyue

    2018-03-01

    With the development of e-commerce, various comments based on tags are generated, how to extract valuable information from these comment tags has become an important content of business management decisions. This study takes HUAWEI mobile phone tags as an example using the sentiment analysis and topic LDA mining method. The first step is data preprocessing and classification of comment tag topic mining. And then make the sentiment classification for comment tags. Finally, mine the comments again and analyze the emotional theme distribution under different sentiment classification. The results show that HUAWEI mobile phone has a good user experience in terms of fluency, cost performance, appearance, etc. Meanwhile, it should pay more attention to independent research and development, product design and development. In addition, battery and speed performance should be enhanced.

  13. String fragmentation; La fragmentation des cordes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J.; Werner, K. [Laboratoire de Physique Subatomique et des Technologies Associees - SUBATECH, Centre National de la Recherche Scientifique, 44 - Nantes (France)

    1997-10-01

    The classical string model is used in VENUS as a fragmentation model. For the soft domain simple 2-parton strings were sufficient, whereas for higher energies up to LHC, the perturbative regime of the QCD gives additional soft gluons, which are mapped on the string as so called kinks, energy singularities between the leading partons. The kinky string model is chosen to handle fragmentation of these strings by application of the Lorentz invariant area law. The `kinky strings` model, corresponding to the perturbative gluons coming from pQCD, takes into consideration this effect by treating the partons and gluons on the same footing. The decay law is always the Artru-Menessier area law which is the most realistic since it is invariant to the Lorentz and gauge transformations. For low mass strings a manipulation of the rupture point is necessary if the string corresponds already to an elementary particle determined by the mass and the flavor content. By means of the fragmentation model it will be possible to simulate the data from future experiments at LHC and RHIC 3 refs.

  14. Tagged at first listen: an examination of social tagging practices in a music recommender system

    Directory of Open Access Journals (Sweden)

    Audrey Laplante

    2015-01-01

    Full Text Available http://dx.doi.org/10.5007/1518-2924.2015v20nesp1p33 Social tagging has become a very common way to index different types of resources on the web. Less prevalent in music than in other domains, social tagging is nevertheless used in a popular recommender system, Last.fm. Although the number of publications on tagging and folksonomies has exploded in the last few years, music tagging is still not well studied. In this paper, we present a study of tagging practices of Last.fm users. We examine the social tagging of songs during the first three months after their release. Our analysis shows that the release of a song triggers a burst in tagging activity that lasts two weeks, after what it decreases sharply and then remains fairly constant for the next ten weeks. We also find that a majority of songs do not get tagged during the first week and that tagging was positively related to popularity. Finally, we find that tags that have been frequently applied to a given song are more likely to be genre related, shorter in length, and relatively objective than tags that have been applied only once.

  15. Dimensional crossover in fragmentation

    Science.gov (United States)

    Sotolongo-Costa, Oscar; Rodriguez, Arezky H.; Rodgers, G. J.

    2000-11-01

    Experiments in which thick clay plates and glass rods are fractured have revealed different behavior of fragment mass distribution function in the small and large fragment regions. In this paper we explain this behavior using non-extensive Tsallis statistics and show how the crossover between the two regions is caused by the change in the fragments’ dimensionality during the fracture process. We obtain a physical criterion for the position of this crossover and an expression for the change in the power-law exponent between the small and large fragment regions. These predictions are in good agreement with the experiments on thick clay plates.

  16. Instantaneous characterization of vegetable oils via TAG and FFA profiles by easy ambient sonic-spray ionization mass spectrometry.

    Science.gov (United States)

    Simas, Rosineide C; Catharino, Rodrigo R; Cunha, Ildenize B S; Cabral, Elaine C; Barrera-Arellano, Daniel; Eberlin, Marcos N; Alberici, Rosana M

    2010-04-01

    A fast and reliable method is presented for the analysis of vegetable oils. Easy ambient sonic-spray ionization mass spectrometry (EASI-MS) is shown to efficiently desorb and ionize the main oil constituents from an inert surface under ambient conditions and to provide comprehensive triacylglyceride (TAG) and free fatty acid (FFA) profiles detected mainly as either [TAG + Na](+) or [FFA-H](-) ions. EASI(+/-)-MS analysis is simple, easily implemented, requires just a tiny droplet of the oil and is performed without any pre-separation or chemical manipulation. It also causes no fragmentation of TAG ions hence diacylglyceride (DAG) and monoacylglyceride (MAG) profiles and contents can also be measured. The EASI(+/-)-MS profiles of TAG and FFA permit authentication and quality control and can be used, for instance, to access levels of adulteration, acidity, oxidation or hydrolysis of vegetable oils in general.

  17. The construction and use of bacterial DNA microarrays based on an optimized two-stage PCR strategy

    Directory of Open Access Journals (Sweden)

    Pesta David

    2003-06-01

    here minimizes the cost and effort to replicate a PCR-generated DNA gene fragment library and facilitates several downstream processes (e.g. directional cloning of fragments and gene expression as affinity-tagged fusion proteins beyond the primary objective of producing DNA microarrays for global gene expression profiling.

  18. Pop-up Archival Transmitting (PAT) fish tag data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The cooperative tagging center (CTC) began deploying electronic tags in 2002. To date over 300 tags have been deployed. The following species have been monitored:...

  19. Embedded Fragments Registry (EFR)

    Data.gov (United States)

    Department of Veterans Affairs — In 2009, the Department of Defense estimated that approximately 40,000 service members who served in OEF/OIF may have embedded fragment wounds as the result of small...

  20. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  1. Fragmentation Main Model

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — The fragmentation model combines patch size and patch continuity with diversity of vegetation types per patch and rarity of vegetation types per patch. A patch was...

  2. Stone fragmentation by ultrasound

    Indian Academy of Sciences (India)

    Unknown

    In the present work, enhancement of the kidney stone fragmentation by using ultrasound is studied. The cavi- ... ment system like radiation pressure balance, the power is given by ... Thus the bubble size has direct relationship with its life and.

  3. Fragment capture device

    Science.gov (United States)

    Payne, Lloyd R.; Cole, David L.

    2010-03-30

    A fragment capture device for use in explosive containment. The device comprises an assembly of at least two rows of bars positioned to eliminate line-of-sight trajectories between the generation point of fragments and a surrounding containment vessel or asset. The device comprises an array of at least two rows of bars, wherein each row is staggered with respect to the adjacent row, and wherein a lateral dimension of each bar and a relative position of each bar in combination provides blockage of a straight-line passage of a solid fragment through the adjacent rows of bars, wherein a generation point of the solid fragment is located within a cavity at least partially enclosed by the array of bars.

  4. Fragment Impact Toolkit (FIT)

    Energy Technology Data Exchange (ETDEWEB)

    Shevitz, Daniel Wolf [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Key, Brian P. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garcia, Daniel B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-05

    The Fragment Impact Toolkit (FIT) is a software package used for probabilistic consequence evaluation of fragmenting sources. The typical use case for FIT is to simulate an exploding shell and evaluate the consequence on nearby objects. FIT is written in the programming language Python and is designed as a collection of interacting software modules. Each module has a function that interacts with the other modules to produce desired results.

  5. Blood extracellular DNA after irradiation

    International Nuclear Information System (INIS)

    Vladimirov, V.G.; Tishchenko, L.I.; Surkova, E.A.; Vasil'eva, I.N.

    1993-01-01

    It has been shown that blood extracellular DNA of irradiated rats largely consists of the low-molecular DNA and its oligomers. Molecular masses of oligomers are multiple to molecular mass of monomer fragment with nucleosome size. The low-molecular DNA has linear form. The average content of GC-pairs in low-molecular DNA is higher than in total rat's DNA (48.5% against 41.5%). The low-molecular DNA is a part of complex containing RNA, acidic proteins and lipids. It is assumed that the formation of low-molecular DNA is a result of Ca/Mg - dependent nuclear endonuclease action

  6. Comparative Genomics in Switchgrass Using 61,585 High-Quality Expressed Sequence Tags

    Directory of Open Access Journals (Sweden)

    Christian M. Tobias

    2008-11-01

    Full Text Available The development of genomic resources for switchgrass ( L., a perennial NAD-malic enzyme type C grass, is required to enable molecular breeding and biotechnological approaches for improving its value as a forage and bioenergy crop. Expressed sequence tag (EST sequencing is one method that can quickly sample gene inventories and produce data suitable for marker development or analysis of tissue-specific patterns of expression. Toward this goal, three cDNA libraries from callus, crown, and seedling tissues of ‘Kanlow’ switchgrass were end-sequenced to generate a total of 61,585 high-quality ESTs from 36,565 separate clones. Seventy-three percent of the assembled consensus sequences could be aligned with the sorghum [ (L. Moench] genome at a -value of <1 × 10, indicating a high degree of similarity. Sixty-five percent of the ESTs matched with gene ontology molecular terms, and 3.3% of the sequences were matched with genes that play potential roles in cell-wall biogenesis. The representation in the three libraries of gene families known to be associated with C photosynthesis, cellulose and β-glucan synthesis, phenylpropanoid biosynthesis, and peroxidase activity indicated likely roles for individual family members. Pairwise comparisons of synonymous codon substitutions were used to assess genome sequence diversity and indicated an overall similarity between the two genome copies present in the tetraploid. Identification of EST–simple sequence repeat markers and amplification on two individual parents of a mapping population yielded an average of 2.18 amplicons per individual, and 35% of the markers produced fragment length polymorphisms.

  7. Expression sequence tag library derived from peripheral blood mononuclear cells of the chlorocebus sabaeus

    Directory of Open Access Journals (Sweden)

    Tchitchek Nicolas

    2012-06-01

    Full Text Available Abstract Background African Green Monkeys (AGM are amongst the most frequently used nonhuman primate models in clinical and biomedical research, nevertheless only few genomic resources exist for this species. Such information would be essential for the development of dedicated new generation technologies in fundamental and pre-clinical research using this model, and would deliver new insights into primate evolution. Results We have exhaustively sequenced an Expression Sequence Tag (EST library made from a pool of Peripheral Blood Mononuclear Cells from sixteen Chlorocebus sabaeus monkeys. Twelve of them were infected with the Simian Immunodeficiency Virus. The mononuclear cells were or not stimulated in vitro with Concanavalin A, with lipopolysacharrides, or through mixed lymphocyte reaction in order to generate a representative and broad library of expressed sequences in immune cells. We report here 37,787 sequences, which were assembled into 14,410 contigs representing an estimated 12% of the C. sabaeus transcriptome. Using data from primate genome databases, 9,029 assembled sequences from C. sabaeus could be annotated. Sequences have been systematically aligned with ten cDNA references of primate species including Homo sapiens, Pan troglodytes, and Macaca mulatta to identify ortholog transcripts. For 506 transcripts, sequences were quasi-complete. In addition, 6,576 transcript fragments are potentially specific to the C. sabaeus or corresponding to not yet described primate genes. Conclusions The EST library we provide here will prove useful in gene annotation efforts for future sequencing of the African Green Monkey genomes. Furthermore, this library, which particularly well represents immunological and hematological gene expression, will be an important resource for the comparative analysis of gene expression in clinically relevant nonhuman primate and human research.

  8. DICOM involving XML path-tag

    Science.gov (United States)

    Zeng, Qiang; Yao, Zhihong; Liu, Lei

    2011-03-01

    Digital Imaging and Communications in Medicine (DICOM) is a standard for handling, storing, printing, and transmitting information in medical imaging. XML (Extensible Markup Language) is a set of rules for encoding documents in machine-readable form which has become more and more popular. The combination of these two is very necessary and promising. Using XML tags instead of numeric labels in DICOM files will effectively increase the readability and enhance the clear hierarchical structure of DICOM files. However, due to the fact that the XML tags rely heavily on the orders of the tags, the strong data dependency has a lot of influence on the flexibility of inserting and exchanging data. In order to improve the extensibility and sharing of DICOM files, this paper introduces XML Path-Tag to DICOM. When a DICOM file is converted to XML format, adding simple Path-Tag into the DICOM file in place of complex tags will keep the flexibility of a DICOM file while inserting data elements and give full play to the advantages of the structure and readability of an XML file. Our method can solve the weak readability problem of DICOM files and the tedious work of inserting data into an XML file. In addition, we set up a conversion engine that can transform among traditional DICOM files, XML-DCM and XML-DCM files involving XML Path-Tag efficiently.

  9. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  10. Folksonomia: a linguagem das tags

    Directory of Open Access Journals (Sweden)

    Juliana de Assis

    2013-01-01

    Full Text Available A radicalização do potencial colaborativo da web atual aponta uma tendência de personalização da recuperação da informação através de ferramentas que exploram a linguagem natural na representação e no compartilhamento de conteúdos ao longo das redes sociais. Tal configuração sócio-técnica traz desafios aos profissionais da informação tanto para a descrição e compreensão dos fenômenos informacionais que ocorrem neste âmbito, quanto para a elaboração de produtos e serviços voltados para um usuário que se apresenta cada vez mais como sujeito informacional ao assumir um papel ativo diante da complexidade que caracteriza a organização da informação em contextos digitais. Este artigo apresenta conclusões de pesquisa, relacionadas às analises da linguagem utilizada em três ambientes colaborativos que utilizam a folksonomia (Social Tagging Systems. A partir de uma perspectiva fundamentada na Semiótica e na Análise de Redes Sociais, são identificadas e descritas as principais manifestações da linguagem gerada e compartilhada pelas redes sociais através destes ambientes.

  11. W/Top/Higgs-tagging in ATLAS

    CERN Document Server

    Norjoharuddeen, Nurfikri; The ATLAS collaboration

    2017-01-01

    We present updates of W, Top and Higgs tagging studies with the ATLAS detector. The performance of 2 variable taggers, HEPTopTagger and shower deconstruction are compared in Monte Carlo simulations. To asses the modelling of the taggers’ performance, the tagging efficiencies are measured, with the full 2015+2016 dataset, in semi-leptonic top quark pair events and the background rejections are measured in dijet and photon+jet topologies. Recent developments in subjet reconstruction techniques for high transverse momentum Higgs->bb tagging are also presented.

  12. Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

    Science.gov (United States)

    Hammond, Maria; Nong, Rachel Yuan; Ericsson, Olle; Pardali, Katerina; Landegren, Ulf

    2012-01-01

    Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

  13. Cys-Ph-TAHA: a lanthanide binding tag for RDC and PCS enhanced protein NMR

    International Nuclear Information System (INIS)

    Peters, Fabian; Maestre-Martinez, Mitcheell; Leonov, Andrei; Kovačič, Lidija; Becker, Stefan; Boelens, Rolf; Griesinger, Christian

    2011-01-01

    Here we present Cys-Ph-TAHA, a new nonadentate lanthanide tag for the paramagnetic labelling of proteins. The tag can be easily synthesized and is stereochemically homogenous over a wide range of temperatures, yielding NMR spectra with a single set of peaks. Bound to ubiquitin, it induced large residual dipolar couplings and pseudocontact shifts that could be measured easily and agreed very well with the protein structure. We show that Cys-Ph-TAHA can be used to label large proteins that are biochemically challenging such as the Lac repressor in a 90 kDa ternary complex with DNA and inducer.

  14. Identification of expressed genes in cDNA library of hemocytes from the RLO-challenged oyster, Crassostrea ariakensis Gould with special functional implication of three complement-related fragments (CaC1q1, CaC1q2 and CaC3).

    Science.gov (United States)

    Xu, Ting; Xie, Jiasong; Li, Jianming; Luo, Ming; Ye, Shigen; Wu, Xinzhong

    2012-06-01

    A SMARTer™ cDNA library of hemocyte from Rickettsia-like organism (RLO) challenged oyster, Crassostrea ariakensis Gould was constructed. Random clones (400) were selected and single-pass sequenced, resulted in 200 unique sequences containing 96 known genes and 104 unknown genes. The 96 known genes were categorized into 11 groups based on their biological process. Furthermore, we identified and characterized three complement-related fragments (CaC1q1, CaC1q2 and CaC3). Tissue distribution analysis revealed that all of three fragments were ubiquitously expressed in all tissues studied including hemocyte, gills, mantle, digestive glands, gonads and adductor muscle, while the highest level was seen in the hemocyte. Temporal expression profile in the hemocyte monolayers reveled that the mRNA expression levels of three fragments presented huge increase after the RLO incubation at 3 h and 6 h in post-challenge, respectively. And the maximal expression levels at 3 h in post-challenge are about 256, 104 and 64 times higher than the values detected in the control of CaC1q1, CaC1q2 and CaC3, respectively. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. SINGLE CHAIN VARIABLE FRAGMENTS OF ANTIBODIES AGAINST DIPHTHERIA TOXIN B-SUBUNIT ISOLATED FROM PHAGE DISPLAY HUMAN ANTIBODY LIBRARY

    Directory of Open Access Journals (Sweden)

    Oliinyk O. S.

    2014-02-01

    Full Text Available Diphtheria toxin is an exoantigen of Corynebacterium diphtheriae that inhibits protein synthesis and kills sensitive cells. The aim of this study was to obtain human recombinant single-chain variable fragment (scFv antibodies against receptor-binding B subunit of diphtheria toxin. 12 specific clones were selected after three rounds of a phage display naїve (unimmunized human antibody library against recombinant B-subunit. scFv DNA inserts from these 12 clones were digested with MvaI, and 6 unique restriction patterns were found. Single-chain antibodies were expressed in Escherichia coli XL1-blue. The recombinant proteins were characterized by immunoblotting of bacterial extracts and detection with an anti-E-tag antibody. The toxin B-subunit-binding function of the single-chain antibody was shown by ELISA. The affinity constants for different clones were found to be from 106 to 108 М–1. Due to the fact, that these antibody fragments recognized epitopes in the receptor-binding Bsubunit of diphtheria toxin, further studies are interesting to evaluate their toxin neutralization properties and potential for therapeutic applications. Obtained scFv-antibodies can also be used for detection and investigation of biological properties of diphtheria toxin.

  16. Comparative Performance of Acoustic-tagged and PIT-tagged Juvenile Salmonids

    Energy Technology Data Exchange (ETDEWEB)

    Hockersmith, Eric E.; Brown, Richard S.; Liedtke, Theresa L.

    2008-02-01

    Numerous research tools and technologies are currently being used to evaluate fish passage and survival to determine the impacts of the Federal Columbia River Power System (FCRPS) on endangered and threatened juvenile salmonids, including PIT tags, balloon tags, hydroacoustic evaluations, radio telemetry, and acoustic telemetry. Each has advantages and disadvantages, but options are restricted in some situations because of limited capabilities of a specific technology, lack of detection capability downstream, or availability of adequate numbers of fish. However, there remains concern about the comparative effects of the tag or the tagging procedure on fish performance. The recently developed Juvenile Salmonid Acoustic Telemetry System (JSATS) acoustic transmitter is the smallest active acoustic tag currently available. The goal of this study was to determine whether fish tagged with the JSATS acoustic-telemetry tag can provide unbiased estimates of passage behavior and survival within the performance life of the tag. We conducted both field and laboratory studies to assess tag effects. For the field evaluation we released a total of 996 acoustic-tagged fish in conjunction with 21,026 PIT-tagged fish into the tailrace of Lower Granite Dam on 6 and 13 May. Travel times between release and downstream dams were not significantly different for the majority of the reaches between acoustic-tagged and PIT-tagged fish. In addition to the field evaluation, a series of laboratory experiments were conducted to determine if growth and survival of juvenile Chinook salmon surgically implanted with acoustic transmitters is different than untagged or PIT tagged juvenile Chinook salmon. Only yearling fish with integrated and non-integrated transmitters experienced mortalities, and these were low (<4.5%). Mortality among sub-yearling control and PIT-tag treatments ranged up to 7.7% while integrated and non-integrated treatments had slightly higher rates (up to 8.3% and 7

  17. Development and application of sequence-tagged microsatellite site (STMS) markers in chickpea (Cicer arietinum), banana (Musa spp.) and their major pathogens, Ascochyta rabiei and Mycosphaerella fijiensis

    International Nuclear Information System (INIS)

    Winter, P.; Kaemmer, D.; Paff, T.; Geistlinger, J.; Neu, C.; Kahl, G.

    2001-01-01

    DNA markers of various kinds have found widespread application in many facets of plant breeding and plant pathogen control. Yet another marker type, sequence-tagged microsatellite (STMS) markers, provides the markers of choice for nearly every crop because of their co-dominant nature, reliability, ease of application and high polymorphic information content. We report here on the development of a whole set of STMS markers and the respective, selected primer sequences for two important crops, chickpea (Cicer arietinum L.) and banana (Musa acuminata), and for their most devastating fungal pathogens, Ascochyta rabiei and Mycosphaerella fijiensis, respectively. These markers were generated either by direct screening of size-selected genomic libraries with microsatellite-complementary oligonucleotides, or by enrichment of DNA fragments containing microsatellite sequences. A total of 69 markers for chickpea, 15 markers for M. acuminata, 19 markers for A rabiei and 11 markers for M. fijiensis, selected on the basis of their high information content and ease of use are presented here. These can be applied for mapping of the respective genomes, for various population studies, and cultivar and isolate identification. We further demonstrate that several of these markers can potentially be applied across species boundaries and thus could increase the marker repertoire also for other species of the genus Cicer, Musa and for Ascochyta-type pathogens of bean, and potentially also of lentil and pea. (author)

  18. Deciding Security for a Fragment of ASLan

    DEFF Research Database (Denmark)

    Mödersheim, Sebastian Alexander

    2012-01-01

    situations in security such as the interaction between the workflow of a system with its access control policies. While even the transition relation is undecidable for ASLan in general, we show the security problem is decidable for a large and useful fragment that we call TASLan, as long as we bound......ASLan is the input language of the verification tools of the AVANTSSAR platform, and an extension of the AVISPA Intermediate Format IF. One of ASLan's core features over IF is to integrate a transition system with Horn clauses that are evaluated at every state. This allows for modeling many common...... the number of steps of honest participants. The restriction of TASLan is that all messages and predicates must be in a certain sense unambiguous in their interpretation, excluding “type-confusions” similar to some tagging results for security protocols....

  19. Comparing the hierarchy of author given tags and repository given tags in a large document archive

    Science.gov (United States)

    Tibély, Gergely; Pollner, Péter; Palla, Gergely

    2016-10-01

    Folksonomies - large databases arising from collaborative tagging of items by independent users - are becoming an increasingly important way of categorizing information. In these systems users can tag items with free words, resulting in a tripartite item-tag-user network. Although there are no prescribed relations between tags, the way users think about the different categories presumably has some built in hierarchy, in which more special concepts are descendants of some more general categories. Several applications would benefit from the knowledge of this hierarchy. Here we apply a recent method to check the differences and similarities of hierarchies resulting from tags given by independent individuals and from tags given by a centrally managed repository system. The results from our method showed substantial differences between the lower part of the hierarchies, and in contrast, a relatively high similarity at the top of the hierarchies.

  20. User Interface Program for secure electronic tags

    International Nuclear Information System (INIS)

    Cai, Y.; Koehl, E.R.; Carlson, R.D.; Raptis, A.C.

    1995-05-01

    This report summarizes and documents the efforts of Argonne National Laboratory (ANL) in developing a secure tag communication user interface program comprising a tag monitor and a communication tool. This program can perform the same functions as the software that was developed at the Lawrence Livermore National Laboratory (LLNL), but it is enhanced with a user-friendly screen. It represents the first step in updating the TRANSCOM Tracking System (TRANSCOM) by incorporating a tag communication screen menu into the main menu of the TRANSCOM user program. A working version of TRANSCOM, enhanced with ANL secure-tag graphics, will strongly support the Department of Energy Warhead Dismantlement/Special Nuclear Materials Control initiatives. It will allow commercial satellite tracking of the movements and operational activities of treaty-limited items and transportation vehicles throughout Europe and the former USSR, as well as the continental US

  1. Flavour Tagging with the LHCb experiment

    CERN Multimedia

    Birnkraut, Alex

    2015-01-01

    Measurements of flavour oscillations and time-dependent CP asymmetries in neutral B meson systems require knowledge of the b quark production flavour. This identification is performed by the Flavour Tagging.

  2. Magnetic vector field tag and seal

    Science.gov (United States)

    Johnston, Roger G.; Garcia, Anthony R.

    2004-08-31

    One or more magnets are placed in a container (preferably on objects inside the container) and the magnetic field strength and vector direction are measured with a magnetometer from at least one location near the container to provide the container with a magnetic vector field tag and seal. The location(s) of the magnetometer relative to the container are also noted. If the position of any magnet inside the container changes, then the measured vector fields at the these locations also change, indicating that the tag has been removed, the seal has broken, and therefore that the container and objects inside may have been tampered with. A hollow wheel with magnets inside may also provide a similar magnetic vector field tag and seal. As the wheel turns, the magnets tumble randomly inside, removing the tag and breaking the seal.

  3. 50 CFR 635.33 - Archival tags.

    Science.gov (United States)

    2010-10-01

    ... landing; furnish all requested information regarding the location and method of capture; and, as... recovery of the tag by a NMFS scientist, enforcement agent, or other person designated in writing by NMFS...

  4. Folksonomia: a linguagem das tags

    Directory of Open Access Journals (Sweden)

    Juliana de Assis

    2013-04-01

    Full Text Available http://dx.doi.org/10.5007/1518-2924.2013v18n36p85   A radicalização do potencial colaborativo da web atual aponta uma tendência de personalização da recuperação da informação através de ferramentas que exploram a linguagem natural na representação e no compartilhamento de conteúdos ao longo das redes sociais. Tal configuração sócio-técnica traz desafios aos profissionais da informação tanto para a descrição e compreensão dos fenômenos informacionais que ocorrem neste âmbito, quanto para a elaboração de produtos e serviços voltados para um usuário que se apresenta cada vez mais como sujeito informacional ao assumir um papel ativo diante da complexidade que caracteriza a organização da informação em contextos digitais. Este artigo apresenta conclusões de pesquisa, relacionadas às analises da linguagem utilizada em três ambientes colaborativos que utilizam a folksonomia (Social Tagging Systems. A partir de uma perspectiva fundamentada na Semiótica e na Análise de Redes Sociais, são identificadas e descritas as principais manifestações da linguagem gerada e compartilhada pelas redes sociais através destes ambientes.

  5. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Science.gov (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  6. Fragmentation of relativistic nuclei

    International Nuclear Information System (INIS)

    Cork, B.

    1975-06-01

    Nuclei with energies of several GeV/n interact with hadrons and produce fragments that encompass the fields of nuclear physics, meson physics, and particle physics. Experimental results are now available to explore problems in nuclear physics such as the validity of the shell model to explain the momentum distribution of fragments, the contribution of giant dipole resonances to fragment production cross sections, the effective Coulomb barrier, and nuclear temperatures. A new approach to meson physics is possible by exploring the nucleon charge-exchange process. Particle physics problems are explored by measuring the energy and target dependence of isotope production cross sections, thus determining if limiting fragmentation and target factorization are valid, and measuring total cross sections to determine if the factorization relation, sigma/sub AB/ 2 = sigma/sub AA/ . sigma/sub BB/, is violated. Also, new experiments have been done to measure the angular distribution of fragments that could be explained as nuclear shock waves, and to explore for ultradense matter produced by very heavy ions incident on heavy atoms. (12 figures, 2 tables)

  7. Statistical Approaches for DNA Barcoding

    DEFF Research Database (Denmark)

    Nielsen, Rasmus; Matz, M.

    2006-01-01

    The use of DNA as a tool for species identification has become known as "DNA barcoding" (Floyd et al., 2002; Hebert et al., 2003; Remigio and Hebert, 2003). The basic idea is straightforward: a small amount of DNA is extracted from the specimen, amplified and sequenced. The gene region sequenced...... is chosen so that it is nearly identical among individuals of the same species, but different between species, and therefore its sequence, can serve as an identification tag for the species ("DNA barcode"). By matching the sequence obtained from an unidentified specimen ("query" sequence) to the database...

  8. b-flavour tagging in pp collisions

    CERN Multimedia

    Birnkraut, Alex

    2015-01-01

    An essential ingredient of all time-dependent CP violation studies of B mesons is the ability to tag the initial flavour of the B meson. The harsh environment of 7 and 8 TeV pp collisions makes this a particularly difficult enterprise. We report progresses in the flavour tagging of B0 and Bs mesons, including developments of novel techniques like the use of an opposite side charm tagger.

  9. Comprehensive preimplantation genetic screening and sperm deoxyribonucleic acid fragmentation from three males carrying balanced chromosome rearrangements.

    Science.gov (United States)

    Ramos, Laia; Daina, Gemma; Del Rey, Javier; Ribas-Maynou, Jordi; Fernández-Encinas, Alba; Martinez-Passarell, Olga; Boada, Montserrat; Benet, Jordi; Navarro, Joaquima

    2015-09-01

    To assess whether preimplantation genetic screening can successfully identify cytogenetically normal embryos in couples carrying balanced chromosome rearrangements in addition to increased sperm DNA fragmentation. Comprehensive preimplantation genetic screening was performed on three couples carrying chromosome rearrangements. Sperm DNA fragmentation was assessed for each patient. Academic center. One couple with the male partner carrying a chromosome 2 pericentric inversion and two couples with the male partners carrying a Robertsonian translocation (13:14 and 14:21, respectively). A single blastomere from each of the 18 cleavage-stage embryos obtained was analysed by metaphase comparative genomic hybridization. Single- and double-strand sperm DNA fragmentation was determined by the alkaline and neutral Comet assays. Single- and double-strand sperm DNA fragmentation values and incidence of chromosome imbalances in the blastomeres were analyzed. The obtained values of single-strand sperm DNA fragmentation were between 47% and 59%, and the double-strand sperm DNA fragmentation values were between 43% and 54%. No euploid embryos were observed in the couple showing the highest single-strand sperm DNA fragmentation. However, euploid embryos were observed in the other two couples: embryo transfer was performed, and pregnancy was achieved by the couple showing the lowest sperm DNA fragmentation values. Preimplantation genetic screening enables the detection of euploid embryos in couples affected by balanced chromosome rearrangements and increased sperm DNA fragmentation. Even though sperm DNA fragmentation may potentially have clinical consequences on fertility, comprehensive preimplantation genetic screening allows for the identification and transfer of euploid embryos. Copyright © 2015. Published by Elsevier Inc.

  10. Laser desorption mass spectrometry for high-throughput DNA analysis and its applications

    Science.gov (United States)

    Chen, C. H. Winston; Golovlev, Valeri V.; Taranenko, N. I.; Allman, S. L.; Isola, Narayana R.; Potter, N. T.; Matteson, K. J.; Chang, Linus Y.

    1999-05-01

    Laser desorption mass spectrometry (LDMS) has been developed for DNA sequencing, disease diagnosis, and DNA fingerprinting for forensic applications. With LDMS, the speed of DNA analysis can be much faster than conventional gel electrophoresis. No dye or radioactive tagging to DNA segments for detection is needed. LDMS is emerging as a new alternative technology for DNA analysis.

  11. Vector boson tagged jets and jet substructure

    Directory of Open Access Journals (Sweden)

    Vitev Ivan

    2018-01-01

    Full Text Available In these proceedings, we report on recent results related to vector boson-tagged jet production in heavy ion collisions and the related modification of jet substructure, such as jet shapes and jet momentum sharing distributions. Z0-tagging and γ-tagging of jets provides new opportunities to study parton shower formation and propagation in the quark-gluon plasma and has been argued to provide tight constrains on the energy loss of reconstructed jets. We present theoretical predictions for isolated photon-tagged and electroweak boson-tagged jet production in Pb+Pb collisions at √sNN = 5.02 TeV at the LHC, addressing the modification of their transverse momentum and transverse momentum imbalance distributions. Comparison to recent ATLAS and CMS experimental measurements is performed that can shed light on the medium-induced radiative corrections and energy dissipation due to collisional processes of predominantly quark-initiated jets. The modification of parton splitting functions in the QGP further implies that the substructure of jets in heavy ion collisions may differ significantly from the corresponding substructure in proton-proton collisions. Two such observables and the implication of tagging on their evaluation is also discussed.

  12. Clone tag detection in distributed RFID systems

    Science.gov (United States)

    Kamaludin, Hazalila; Mahdin, Hairulnizam

    2018-01-01