Safety, immunogenicity and duration of protection of the RTS,S/AS02(D malaria vaccine: one year follow-up of a randomized controlled phase I/IIb trial.

Directory of Open Access Journals (Sweden)

Pedro Aide

2010-11-01

Full Text Available The RTS,S/AS02(D vaccine has been shown to have a promising safety profile, to be immunogenic and to confer protection against malaria in children and infants.We did a randomized, controlled, phase I/IIb trial of RTS,S/AS02(D given at 10, 14 and 18 weeks of age staggered with routine immunization vaccines in 214 Mozambican infants. The study was double-blind until the young child completed 6 months of follow-up over which period vaccine efficacy against new Plasmodium falciparum infections was estimated at 65.9% (95% CI 42.6-79.8, p<0.0001. We now report safety, immunogenicity and estimated efficacy against clinical malaria up to 14 months after study start. Vaccine efficacy was assessed using Cox regression models. The frequency of serious adverse events was 32.7% in the RTS,S/AS02(D and 31.8% in the control group. The geometric mean titers of anti-circumsporozoite antibodies declined from 199.9 to 7.3 EU/mL from one to 12 months post dose three of RTS,S/AS02(D, remaining 15-fold higher than in the control group. Vaccine efficacy against clinical malaria was 33% (95% CI: -4.3-56.9, p = 0.076 over 14 months of follow-up. The hazard rate of disease per 2-fold increase in anti-CS titters was reduced by 84% (95% CI 35.1-88.2, p = 0.003.The RTS,S/AS02(D malaria vaccine administered to young infants has a good safety profile and remains efficacious over 14 months. A strong association between anti-CS antibodies and risk of clinical malaria has been described for the first time. The results also suggest a decrease of both anti-CS antibodies and vaccine efficacy over time.ClinicalTrials.gov NCT00197028.

A randomized trial assessing the safety and immunogenicity of AS01 and AS02 adjuvanted RTS,S malaria vaccine candidates in children in Gabon.

Directory of Open Access Journals (Sweden)

Bertrand Lell

2009-10-01

Full Text Available The malaria vaccine candidate antigen RTS,S includes parts of the pre-erythrocytic stage circumsporozoite protein fused to the Hepatitis B surface antigen. Two Adjuvant Systems are in development for this vaccine, an oil-in water emulsion--based formulation (AS02 and a formulation based on liposomes (AS01.In this Phase II, double-blind study (NCT00307021, 180 healthy Gabonese children aged 18 months to 4 years were randomized to receive either RTS,S/AS01(E or RTS,S/AS02(D, on a 0-1-2 month vaccination schedule. The children were followed-up daily for six days after each vaccination and monthly for 14 months. Blood samples were collected at 4 time-points. Both vaccines were well tolerated. Safety parameters were distributed similarly between the two groups. Both vaccines elicited a strong specific immune response after Doses 2 and 3 with a ratio of anti-CS GMT titers (AS02(D/AS01(E of 0.88 (95% CI: 0.68-1.15 post-Dose 3. After Doses 2 and 3 of experimental vaccines, anti-CS and anti-HBs antibody GMTs were higher in children who had been previously vaccinated with at least one dose of hepatitis B vaccine compared to those not previously vaccinated.RTS,S/AS01(E proved similarly as well tolerated and immunogenic as RTS,S/AS02(D, completing an essential step in the age de-escalation process within the RTS,S clinical development plan.ClinicalTrials.gov. NCT00307021.

A closed cabinet system with water flushers and a blender for breeding small animal administered 3HHO

International Nuclear Information System (INIS)

Yamamoto, O.; Takeoka, S.; Tsujimura, T.; Kuroda, T.; Iwashita, T.; Amme, T.

1984-01-01

A closed cabinet system was developed for breeding small animals administered 3 HHO. 3 HHO vapor released from the animals in the chamber was absorbed with water in a water bubbler. Feces and urine which were washed out with water were ground in a blender, diluted, and then released. With this cabinet system we were successful in safely breeding mice even given a total single injection of 15.5 GBq (420 mCi) of 3 HHO without storing the 3 H-slops for a long time and without any significant leakage of 3 H from the cabinet. (author)

Safety and immunogenicity of a recombinant Plasmodium falciparum AMA1 malaria vaccine adjuvanted with Alhydrogel, Montanide ISA 720 or AS02.

Directory of Open Access Journals (Sweden)

Meta Roestenberg

Full Text Available Plasmodium falciparum Apical Membrane Antigen 1 (PfAMA1 is a candidate vaccine antigen expressed by merozoites and sporozoites. It plays a key role in red blood cell and hepatocyte invasion that can be blocked by antibodies.We assessed the safety and immunogenicity of recombinant PfAMA1 in a dose-escalating, phase Ia trial. PfAMA1 FVO strain, produced in Pichia pastoris, was reconstituted at 10 microg and 50 microg doses with three different adjuvants, Alhydrogel, Montanide ISA720 and AS02 Adjuvant System. Six randomised groups of healthy male volunteers, 8-10 volunteers each, were scheduled to receive three immunisations at 4-week intervals. Safety and immunogenicity data were collected over one year. Transient pain was the predominant injection site reaction (80-100%. Induration occurred in the Montanide 50 microg group, resulting in a sterile abscess in two volunteers. Systemic adverse events occurred mainly in the AS02 groups lasting for 1-2 days. Erythema was observed in 22% of Montanide and 59% of AS02 group volunteers. After the second dose, six volunteers in the AS02 group and one in the Montanide group who reported grade 3 erythema (>50 mm were withdrawn as they met the stopping criteria. All adverse events resolved. There were no vaccine-related serious adverse events. Humoral responses were highest in the AS02 groups. Antibodies showed activity in an in vitro growth inhibition assay up to 80%. Upon stimulation with the vaccine, peripheral mononuclear cells from all groups proliferated and secreted IFNgamma and IL-5 cytokines.All formulations showed distinct reactogenicity profiles. All formulations with PfAMA1 were immunogenic and induced functional antibodies.(Clinicaltrials.gov NCT00730782.

The Effect on Treatment Adherence of Administering Drugs as Fixed-Dose Combinations versus as Separate Pills: Systematic Review and Meta-Analysis.

Science.gov (United States)

van Galen, Katy A; Nellen, Jeannine F; Nieuwkerk, Pythia T

2014-01-01

Administering drugs as fixed-dose combinations (FDCs) versus the same active drugs administered as separate pills is assumed to enhance treatment adherence. We synthesized evidence from randomized controlled trials (RCTs) about the effect of FDCs versus separate pills on adherence. We searched PubMed for RCTs comparing a FDC with the same active drugs administered as separate pills, including a quantitative estimate of treatment adherence, without restriction to medical condition. The odds ratio (OR) of optimal adherence with FDCs versus separate pills was used as common effect size and aggregated into a pooled effect estimate using a random effect model with inverse variance weights. Out of 1258 articles screened, only six studies fulfilled inclusion criteria. Across medical conditions, administering drugs as FDC significantly increased the likelihood of optimal adherence (OR 1.33 (95% CI, 1.03-1.71)). Within subgroups of specific medical conditions, the favourable effect of FDCs on adherence was of borderline statistical significance for HIV infection only (OR 1.46 (95% CI, 1.00-2.13)). We observed a remarkable paucity of RCTs comparing the effect on adherence of administering drugs as FDC versus as separate pills. Administering drugs as FDC improved medication adherence. However, this conclusion is based on a limited number of RCTs only.

Is a video-based cognitive behavioral therapy for insomnia as efficacious as a professionally administered treatment in breast cancer? Results of a randomized controlled trial.

Science.gov (United States)

Savard, Josée; Ivers, Hans; Savard, Marie-Hélène; Morin, Charles M

2014-08-01

To assess the short-term efficacy of a video-based cognitive behavioral therapy for insomnia (CBT-I) as compared to a professionally administered CBT-I and to a no-treatment group. Randomized controlled trial. Radio-oncology department of a public hospital affiliated with Université Laval (CHU de Québec). Two hundred forty-two women with breast cancer who had received radiation therapy in the past 18 mo and who had insomnia symptoms or were using hypnotic medications were randomized to: (1) professionally administered CBT-I (PCBT-I; n = 81); (2) video-based CBT-I (VCBT-I; n = 80); and (3) no treatment (CTL; n = 81). PCBT-I composed of six weekly, individual sessions of approximately 50 min; VCBT-I composed of a 60-min animated video + six booklets. Insomnia Severity Index (ISI) total score and sleep parameters derived from a daily sleep diary and actigraphy, collected at pretreatment and posttreatment. PCBT-I and VCBT-I were associated with significantly greater sleep improvements, assessed subjectively, as compared to CTL. However, relative to VCBT-I, PCBT-I was associated with significantly greater improvements of insomnia severity, early morning awakenings, depression, fatigue, and dysfunctional beliefs about sleep. The remission rates of insomnia (ISI insomnia (CBT-I) using a video format appears to be a valuable treatment option, but face-to-face sessions remain the optimal format for administering CBT-I efficaciously in patients with breast cancer. Self-help interventions for insomnia may constitute an appropriate entry level as part of a stepped care model. ClinicalTrials.gov Identifier: NCT00674830. Savard J, Ivers H, Savard MH, Morin CM. Is a video-based cognitive behavioral therapy for insomnia as efficacious as a professionally administered treatment in breast cancer? Results of a randomized controlled trial.

Analysis of infusion-site reactions in renal transplant recipients receiving peripherally administered rabbit antithymocyte globulin as compared with basiliximab.

Science.gov (United States)

Erickson, Abbie L; Roberts, Keri; Malek, Sayeed K; Chandraker, Anil K; Tullius, Stefan G; Gabardi, Steven

2010-06-01

Antithymocyte globulin rabbit (r-ATG) has been used for the treatment and prevention of acute rejection in renal transplant recipients (RTR). Current manufacturer recommendations for r-ATG dictate the need for administration through a high-flow vein (central line). Previous studies have shown peripheral administration of r-ATG to be safe; however, these studies suggest the co-administration of heparin and hydrocortisone and did not compare the infusion-site reaction rates to a control group. A retrospective analysis was conducted of adult RTR receiving r-ATG or basiliximab between January 2004 and October 2006. Each agent was administered through a dedicated peripheral line. The primary endpoint was the incidence of infusion-site reactions. Other endpoints included the need to replace the intravenous catheter and the incidence of systemic thrombosis within 1 month of transplantation. During the study period, 152 peripheral infusions of r-ATG and 92 peripheral infusions of basiliximab were administered. No difference in infusion-site reactions was noted between the groups. There was also no difference either in the need for peripheral line replacement or the rates of systemic thrombosis. Peripheral administration of r-ATG is safe and can be infused without concomitant heparin and hydrocortisone. This method of r-ATG infusion was shown to be as safe as peripherally administered basiliximab.

Investigating the Binarity of S0-2: Implications for Its Origins and Robustness as a Probe of the Laws of Gravity around a Supermassive Black Hole

Science.gov (United States)

Chu, Devin S.; Do, Tuan; Hees, Aurelien; Ghez, Andrea; Naoz, Smadar; Witzel, Gunther; Sakai, Shoko; Chappell, Samantha; Gautam, Abhimat K.; Lu, Jessica R.; Matthews, Keith

2018-02-01

The star S0-2, which orbits the supermassive black hole (SMBH) in our Galaxy with a period of 16 years, provides the strongest constraint on both the mass of the SMBH and the distance to the Galactic center. S0-2 will soon provide the first measurement of relativistic effects near a SMBH. We report the first limits on the binarity of S0-2 from radial velocity (RV) monitoring, which has implications for both understanding its origin and robustness as a probe of the central gravitational field. With 87 RV measurements, which include 12 new observations that we present, we have the requisite data set to look for RV variations from S0-2‧s orbital model. Using a Lomb–Scargle analysis and orbit-fitting for potential binaries, we detect no RV variation beyond S0-2‧s orbital motion and do not find any significant periodic signal. The lack of a binary companion does not currently distinguish different formation scenarios for S0-2. The upper limit on the mass of a companion star ({M}{comp}) still allowed by our results has a median upper limit of {M}{comp} sin i ≤ 1.6 M ⊙ for periods between 1 and 150 days, the longest period to avoid tidal break-up of the binary. We also investigate the impact of the remaining allowed binary system on the measurement of the relativistic redshift at S0-2‧s closest approach in 2018. While binary star systems are important to consider for this experiment, we find that plausible binaries for S0-2 will not alter a 5σ detection of the relativistic redshift.

A Retrospective Analysis of Clinical Laboratory Interferences Caused by Frequently Administered Medications in Burn Patients.

Science.gov (United States)

Godwin, Zachary; Lima, Kelly; Greenhalgh, David; Palmieri, Tina; Sen, Soman; Tran, Nam K

2016-01-01

The goal of this study is to quantify the number of medications administered to burn patients and identify potential drugs interfering with laboratory testing. The authors reviewed the medical records of 12 adult (age ≥ 18 years) burn patients with more than 20% TBSA burns from an existing glucose control database at our institution. Dose, interval, and route of medications administered from admission to discontinuation of intensive insulin therapy were recorded. Interfering drugs were identified based on established clinical chemistry literature. The retrospective cohort of adult burn patients exhibited a mean (SD) age of 37.9 (3.0) years. Mean TBSA burn was 51.3 (9.3)%. Disease severity determined by the average multiple organ dysfunction score was 5.4 (0.2). Mean and median medications administered per day were 42.1 (9.5) and 49 (with a daily range of 0-65), respectively. A total of 666 potential laboratory test interferences caused by medications were identified. There were 261 different effects (eg, increased glucose, decreased potassium). Multiple interferences, 71.0% (475/666), were caused by more than one medication. Investigation of the number of medications administered to a burn patient and delineation of potential laboratory test interferences has not been conducted in burn patients. Given the substantial number of medications administered to burn patients, physicians and laboratory personnel should work together to identify potential interferences and define appropriate countermeasures while enhancing the laboratorians understanding of this unique population. This synergistic partnership can lead to intelligent support tools and potentially autocorrecting instruments.

76 FR 22412 - Fellowship Placement Pilot Program Requests for Expressions of Interests To Administer Pilot...

Science.gov (United States)

2011-04-21

... DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT [Docket No. FR-5514-C-02] Fellowship Placement Pilot Program Requests for Expressions of Interests To Administer Pilot Contact Information Correction AGENCY... published a notice announcing HUD's proposal to conduct a Fellowship Placement Pilot (fellowship program...

Telephone-administered psychotherapy in combination with antidepressant medication for the acute treatment of major depressive disorder.

Science.gov (United States)

Corruble, Emmanuelle; Swartz, Holly A; Bottai, Thierry; Vaiva, Guillaume; Bayle, Frank; Llorca, Pierre-Michel; Courtet, Philippe; Frank, Ellen; Gorwood, Philip

2016-01-15

Telephone-administered psychotherapies (T-P) provided as an adjunct to antidepressant medication may improve response rates in major depressive disorder (MDD). The goal of this study was to compare telephone-administered social rhythm therapy (T-SRT) and telephone-administered intensive clinical management (T-ICM) as adjuncts to antidepressant medication for MDD. A secondary goal was to compare T-P with Treatment as Usual (TAU) as adjunctive treatment to medication for MDD. 221 adult out-patients with MDD, currently depressed, were randomly assigned to 8 sessions of weekly T-SRT (n=110) or T-ICM (n=111), administered as an adjunct to agomelatine. Both psychotherapies were administered entirely by telephone, by trained psychologists who were blind to other aspects of treatment. The 221 patients were a posteriori matched with 221 depressed outpatients receiving TAU (controls). The primary outcome measure was the percentage of responders at 8 weeks post-treatment. No significant differences were found between T-SRT and T-ICM. But T-P was associated with higher response rates (65.4% vs 54.8%, p=0.02) and a trend toward higher remission rates (33.2% vs 25.1%; p=0.06) compared to TAU. Short term study. This study is the first assessing the short-term effects of an add-on, brief, telephone-administered psychotherapy in depressed patients treated with antidepressant medication. Eight sessions of weekly telephone-delivered psychotherapy as an adjunct to antidepressant medication resulted in improved response rates relative to medication alone. Copyright © 2015 Elsevier B.V. All rights reserved.

78 FR 32294 - DeltaPoint Capital IV, L.P., DeltaPoint Capital IV (New York), L.P., License No. 02/02-0662,02/02...

Science.gov (United States)

2013-05-29

... Small Business Investment Act of 1958, as amended (``the Act''), in connection with the financing of a... SMALL BUSINESS ADMINISTRATION DeltaPoint Capital IV, L.P., DeltaPoint Capital IV (New York), L.P., License No. 02/02-0662,02/02-0661; Notice Seeking Exemption Under Section 312 of the Small Business...

47 CFR 63.02 - Exemptions for extensions of lines and for systems for the delivery of video programming.

Science.gov (United States)

2010-10-01

... systems for the delivery of video programming. 63.02 Section 63.02 Telecommunication FEDERAL... systems for the delivery of video programming. (a) Any common carrier is exempt from the requirements of... with respect to the establishment or operation of a system for the delivery of video programming. [64...

RETRAN-02 installation and verification for the CRAY computer

International Nuclear Information System (INIS)

1990-03-01

The RETRAN-02 transient thermal-hydraulic analysis program developed by the Electric Power Research Institute (EPRI) has been selected as a tool for use in assessing the operation and safety of the SP-100 space reactor system being developed at Los Alamos National Laboratory (LANL). The released versions of RETRAN-02 are not operational on CRAY computer systems which are the primary mainframes in use at LANL requiring that the code be converted to the CRAY system. This document describes the code conversion, installation, and validation of the RETRAN-02/MOD004 code on the LANL CRAY computer system

131I radiocapsules as a means of administering iodide to patients for diagnoses and/or therapy

International Nuclear Information System (INIS)

Pillay, M.; Li Jun; Berghout, A.; Cox, P.H.

1994-01-01

The use of radioiodide solution either for intravenous (sterile), or for oral use carries a risk of spillage and contamination (3). In addition, the amount of activity administered is seldom complete in terms of the absolute amount dispensed so that there always is 'left-over' activity in the syringe or beaker. This is particularly important when determining the 24 hour uptake of radioiodide in the thyroid. The use of encapsulated forms of iodide-131 excludes errors due to 'left-over' activity, and is certainly preferred from the radiation hygiene point of view. Radiocapsules are easy to administer and may even be used in uncooperative patients as described by Lowry et al (2). The widespread use of radiocapsules has been restricted because of concern about the speed of dissolution of the radiocapsules in the stomach (4). In this study we investigated the speed of the capsule disintegration in in-vitro, as well as in patients. (orig.) [de

Design and validation of a self-administered questionnaire as an aid to detection of occupational exposure to lung carcinogens.

Science.gov (United States)

Pélissier, C; Dutertre, V; Fournel, P; Gendre, I; Michel Vergnon, J; Kalecinski, J; Tinquaut, F; Fontana, L; Chauvin, F

2017-02-01

Ten to thirty percent of lung cancer is thought to be of occupational origin. Lung cancer is under-declared as an occupational disease in Europe, and most declarations of occupational disease concern asbestos. The purpose of this study was to design and validate a short, sensitive self-administered questionnaire, as an aid for physicians in detecting occupational exposure to asbestos and other lung carcinogens in order to remedy occupational lung cancer under-declaration. Cross-sectional study. A short (30-question) self-administered questionnaire was drawn up by oncologist-pneumologists and occupational physicians, covering situations of exposure to proven and probable lung carcinogens. Understanding and acceptability were assessed on 15 lung cancer patients. Validity and reliability were assessed on 70 lung cancer patients by comparison against a semi-directive questionnaire considered as gold standard. Sensitivity and specificity were assessed by comparing responses to items on the two questionnaires. Reliability was assessed by analysing the kappa concordance coefficient for items on the two questionnaires. Sensitivity was 0.85 and specificity 0.875. Concordance between responses on the two questionnaires was 85.7%, with a kappa coefficient of 0.695 [0.52-0.87]. Mean self-administration time was 3.1 min (versus 8.12 min to administer the gold-standard questionnaire). In 16 patients, the self-administered questionnaire detected lung carcinogen exposure meeting the criteria for occupational disease. The present short, easy-to-use self-administered questionnaire should facilitate detection of occupational exposure to lung carcinogens. It could be used in occupational lung cancer screening and increase the presently low rate of application for recognition of lung cancer as an occupational disease. Copyright © 2016 The Royal Society for Public Health. Published by Elsevier Ltd. All rights reserved.

Association between systemically administered radioisotopes and subsequent malignant disease

International Nuclear Information System (INIS)

Berlin, N.I.; Wasserman, L.R.

1976-01-01

There is a long history recording the association of x radiation and the subsequent development of malignant tumors. For systemically administered isotopes this came into prominence when Martland discovered the association between cancer, particularly of the bone, and ingestion of radioactive isotopes by radium dial painters. This association was amplified by the development of cancer in patients given thorotrast as a contrast medium for diagnostic radiologic examination. Acute leukemia was reported 30 years ago in patients with polycythemia vera treated with 32 P. Acute leukemia also occurs in patients with polycythemia vera treated only with phlebotomy or drugs. A controlled study is now underway to provide a more definite answer to question what is the incidence of acute leukemia in patients with polycythemia vera treated by phlebotomy alone, chlorambucil, or 32 P. 131 I for the treatment of hyperthyroidism probably does not induce cancer, but in the doses used for thyroid cancer there was an increased incidence of neoplasms (12/200 in one study). This was higher than the expected incidence of neoplasms. The doses of radioactive isotopes used currently for diagnostic purposes have not induced cancer, but it is difficult and probably impossible to verify this with absolute certainty

Experimental Conditions: SE3_S02_M02_D02 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M02_D02 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M02 6.7 mg [MassBase ID] MDLC1_25530 SE3_MS1 LC-FT-ICR-M

Synthesis and characterization of Cu0.3Zn0.5Mg0.2Fe2O4 nanoparticles as a magnetic drug delivery system

Science.gov (United States)

Ansari, Mohammad; Bigham, Ashkan; Hassanzadeh-Tabrizi, S. A.; Abbastabar Ahangar, H.

2017-10-01

Mixed spinel ferrite nanoparticles are being applied in biomedical applications due to their biocompatibility, antibacterial activity, particular magnetic and electronic properties with chemical and thermal stabilities. The Cu0.3Zn0.5Mg0.2Fe2O4 nanoparticles are synthesized through the thermal treatment method. Polyvinyl alcohol (PVA) is used as the capping agent to stabilize the particles and prevent their agglomeration. The synthesized nanoparticles are characterized through X-ray diffractometer (XRD), Fourier transform infrared spectroscopy (FTIR), N2 adsorption-desorption, field emission scanning electron microscopy (FESEM), and transmission electron microscope (TEM). The magnetic characterization is made on a vibrating sample magnetometer (VSM), which displayed super-paramagnetic behavior of the synthesized sample. Potential application of the Cu0.3Zn0.5Mg0.2Fe2O4 nanoparticles as a drug delivery agent is assessed in vitro by estimating their release properties. The obtained results indicate that the amount of ibuprofen (IBU) adsorbed into the nanocarrier of Cu0.3Zn0.5Mg0.2Fe2O4 is 104 mg/g and the drug release is sustained up to 72 h.

Ocular pharmacokinetics comparison between 0.2% olopatadine and 0.77% olopatadine hydrochloride ophthalmic solutions administered to male New Zealand white rabbits.

Science.gov (United States)

Iyer, Ganesh R; Cason, Marita M; Womble, Scott W; Li, Guangming; Chastain, James E

2015-05-01

The primary objective of this study was to compare uptake and distribution of the commercially available formulation of 0.2% olopatadine and the newly developed 0.77% olopatadine hydrochloride ophthalmic solution formulation with improved solubility following a single (30 μL), bilateral topical ocular dose in male New Zealand white rabbits. Each animal received a single 30-μL topical ocular dose (0.2% olopatadine or 0.77% olopatadine hydrochloride ophthalmic solution) to the right (OD) eye followed by the left (OS) eye for a total dose of 60 μL. Olopatadine concentrations were measured in ocular tissues (cornea, bulbar, conjunctiva, choroid, iris-ciliary body, whole lens, retina), aqueous humor, and plasma at prespecified time points over 24 h using a qualified liquid chromatography coupled with mass spectrometry (LC-MS/MS) analytical method. Olopatadine was absorbed into the eye and reached maximal levels (Cmax) within 30 min (0.5 h) to 2 h (Tmax) in ocular tissues and plasma for both treatment groups, except for the lens in which the Tmax was 4 h in the 0.2% olopatadine group and 8 h in the 0.77% olopatadine hydrochloride group, respectively. Tissues associated with the site of dosing, that is, the conjunctiva and cornea, had the highest concentrations of olopatadine in both the 0.2% olopatadine (609 and 720 ng/g) and 0.77% olopatadine hydrochloride (3,000 and 2,230 ng/g) dose groups. The greatest differences between 0.2% olopatadine and 0.77% olopatadine hydrochloride were associated with the overall duration and level of ocular exposures. The newly developed 0.77% olopatadine hydrochloride ophthalmic solution formulation resulted in a higher and more prolonged olopatadine concentration in the target tissue, that is, conjunctiva compared to the commercial formulation of 0.2% olopatadine ophthalmic solution.

The Effect on Treatment Adherence of Administering Drugs as Fixed-Dose Combinations versus as Separate Pills: Systematic Review and Meta-Analysis

NARCIS (Netherlands)

van Galen, Katy A.; Nellen, Jeannine F.; Nieuwkerk, Pythia T.

2014-01-01

Administering drugs as fixed-dose combinations (FDCs) versus the same active drugs administered as separate pills is assumed to enhance treatment adherence. We synthesized evidence from randomized controlled trials (RCTs) about the effect of FDCs versus separate pills on adherence. We searched

Efficacy of ketamine hydrochloride administered as a basilar sesamoid nerve block in alleviating foot pain in horses caused by natural disease.

Science.gov (United States)

Schumacher, J; DeGraves, F; Cesar, F; Duran, S

2014-09-01

A local anaesthetic agent capable of temporarily resolving lameness after being administered perineurally would be helpful because rapid return of lameness would allow for other analgesic techniques to be performed within a short period of time. To determine if a 3% solution of ketamine hydrochloride (HCl), administered around the palmar nerves at the level of the base of the proximal sesamoid bones, can improve naturally occurring lameness that can be improved or abolished with a basilar sesamoid nerve block performed using lidocaine HCl and to compare the change in gait produced using lidocaine to the change in gait produced using ketamine by using objective lameness assessment. Experimental trial using research horses with naturally occurring lameness. Seven horses, chronically lame on a thoracic limb, were chosen for the study. A wireless, inertial, sensor-based, motion analysis system was used to evaluate lameness before and after administration of 2% lidocaine and later, before and after administration of 3% ketamine over the palmar digital nerves at the base of the proximal sesamoid bones (a basilar sesamoid nerve block) at 5 min intervals for 30 min. Lameness scores obtained before and after administration of lidocaine and ketamine HCl were compared using repeated measures analysis. Gait significantly improved after basilar sesamoid nerve blocks using 2% lidocaine, but gait did not significantly improve after performing the same nerve block using 3% ketamine HCl. Ketamine (3%) administered perineurally for regional anaesthesia of the digit does not desensitise the digit to the same extent as does lidocaine and thus 3% ketamine appears to have no value as a local anaesthetic agent for diagnostic regional anaesthesia. © 2013 EVJ Ltd.

Synthesis and Characterization of Polyol-Assisted Nano Cu0.2Ni0.2Sn0.2Ba0.4 Fe2O4 by a Wet Hydroxyl Route

Science.gov (United States)

Pavithradevi, S.; Suriyanarayanan, N.; Boobalan, T.; Velumani, S.; Chandramohan, M.; Manivel Raja, M.

2017-08-01

Nanocrystalline spinel ferrite of composition Cu0.2Ni0.2Sn0.2Ba0.4 Fe2O4 has been synthesized by a wet hydroxyl chemical route in ethylene glycol as chelating agent and sodium hydroxide as precipitator at pH 8. Ethylene glycol has been used as the medium which serves as the solvent as well as a complexing agent. The synthesized particles are annealed at temperatures of 350°C, 700°C, and 1050°C. Thermogravimetric (TG) analysis confirms that at 240°C, ethylene glycol has evaporated completely, and a stable phase is formed above 670°C. Fourier transform infrared (FT-IR) spectroscopy of mixed Cu0.2Ni0.2Sn0.2Ba0.4 ferrite nanoparticles like as synthesized and annealed at 1050°C are recorded between 400 cm-1 and 4000 cm-1. FT-IR appraises the structural formation of Cu0.2Ni0.2Sn0.2Ba0.4 Fe2O4 between the as-synthesized sample and the sample annealed at 1050°C. Structural characterizations of all the samples are carried out by x-ray diffraction (XRD) technique. XRD reveals that the particle size increases with the increase in annealing temperatures. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) confirms that the particles are flaky and spherical with the crystallite size in the range of 11-27 nm. The decrement of dielectric properties, like dielectric constant and dielectric loss, with the increment of frequency as seen in all the samples is an usual dielectric behavior of spinel ferrites. The lack of net magnetization is noticed immediately when the applied magnetic field is removed which prompts superparamagnetic behavior, as seen in all the samples.

Transport properties of S0.8Se16M0.2 (M = Al, Ag or Cu) system

International Nuclear Information System (INIS)

Wahab, L.A.

2003-01-01

The results are presented of a study of the electrical and optical properties of vacuum evaporated amorphous thin films in the S 0.8 Se 16 M 0.2 (M=Al, Ag or Cu) system. The activation energy and the pre-exponential factor which appear in the dc conductivity are found to be higher in case of Cu than in case of Ag and Al. The reflectance and transmission are used to measure the optical gap. The glass S 0.8 Se 16 Cu 0.2 behaves as a quasi intrinsic semiconductor (the electrical activation energy is about half of the optical gap). The electrical activation energy is about one-third of the optical gap for the chalcogenide glasses S 0.8 Se 16 Al 0.2 and S 0.8 Se 16 Ag 0.2 . The variation in the refractive index and the imaginary part of the dielectric constant with photon energy have also been reported. The influence of composition on the investigated parameters is reported

Even 'safe' medications need to be administered with care.

Science.gov (United States)

Lutwak, Nancy; Howland, Mary Ann; Gambetta, Rosemarie; Dill, Curt

2013-01-02

A 60-year-old man with a history of hepatic cirrhosis and cardiomyopathy underwent transoesophageal echocardiogram. He received mild sedation and topical lidocaine. During the recovery period the patient developed ataxia and diplopia for about 30 mins, a result of lidocaine toxicity. The patient was administered a commonly used local anaesthetic, a combination of 2% viscous lidocaine, 4% lidocaine gargle and 5% lidocaine ointment topically to the oropharnyx. The total dose was at least 280 mg. Oral lidocaine undergoes extensive first pass metabolism and its clearance is quite dependent on rates of liver blood flow as well as other factors. The patient's central nervous system symptoms were mild and transient but remind us that to avoid adverse side effects, orally administered drugs with fairly high hepatic extraction ratio given to patients with chronic liver disease need to be given in reduced dosages. Even 'Safe' medications need to be carefully administered.

A randomized trial comparing surgeon-administered intraoperative transversus abdominis plane block with anesthesiologist-administered transcutaneous block.

Science.gov (United States)

Narasimhulu, D M; Scharfman, L; Minkoff, H; George, B; Homel, P; Tyagaraj, K

2018-04-27

Injection of local anesthetic into the transversus abdominis plane (TAP block) decreases systemic morphine requirements after abdominal surgery. We compared intraoperative surgeon-administered TAP block (surgical TAP) to anesthesiologist-administered transcutaneous ultrasound-guided TAP block (conventional TAP) for post-cesarean analgesia. We hypothesized that surgical TAP blocks would take less time to perform than conventional TAP blocks. We performed a randomized trial, recruiting 41 women undergoing cesarean delivery under neuraxial anesthesia, assigning them to either surgical TAP block (n=20) or conventional TAP block (n=21). Time taken to perform the block was the primary outcome, while postoperative pain scores and 24-hour opioid requirements were secondary outcomes. Student's t-test was used to compare block time and Kruskal-Wallis test opioid consumption and pain-scores. Time taken to perform the block (2.4 vs 12.1 min, P consumption (P=0.17) and postoperative pain scores at 4, 8, 24 and 48 h were not significantly different between the groups. Surgical TAP blocks are feasible and less time consuming than conventional TAP blocks, while providing comparable analgesia after cesarean delivery. Copyright © 2018 Elsevier Ltd. All rights reserved.

MECHANISMS IN ENDOCRINOLOGY: Exogenous insulin does not increase muscle protein synthesis rate when administered systemically: a systematic review.

Science.gov (United States)

Trommelen, Jorn; Groen, Bart B L; Hamer, Henrike M; de Groot, Lisette C P G M; van Loon, Luc J C

2015-07-01

Though it is well appreciated that insulin plays an important role in the regulation of muscle protein metabolism, there is much discrepancy in the literature on the capacity of exogenous insulin administration to increase muscle protein synthesis rates in vivo in humans. To assess whether exogenous insulin administration increases muscle protein synthesis rates in young and older adults. A systematic review of clinical trials was performed and the presence or absence of an increase in muscle protein synthesis rate was reported for each individual study arm. In a stepwise manner, multiple models were constructed that excluded study arms based on the following conditions: model 1, concurrent hyperaminoacidemia; model 2, insulin-induced hypoaminoacidemia; model 3, supraphysiological insulin concentrations; and model 4, older, more insulin resistant, subjects. From the presented data in the current systematic review, we conclude that: i) exogenous insulin and amino acid administration effectively increase muscle protein synthesis, but this effect is attributed to the hyperaminoacidemia; ii) exogenous insulin administered systemically induces hypoaminoacidemia which obviates any insulin-stimulatory effect on muscle protein synthesis; iii) exogenous insulin resulting in supraphysiological insulin levels exceeding 50, 000  pmol/l may effectively augment muscle protein synthesis; iv) exogenous insulin may have a diminished effect on muscle protein synthesis in older adults due to age-related anabolic resistance; and v) exogenous insulin administered systemically does not increase muscle protein synthesis in healthy, young adults. © 2015 European Society of Endocrinology.

Systemic and Mucosal Antibody Responses to Soluble and Nanoparticle-Conjugated Antigens Administered Intranasally

Directory of Open Access Journals (Sweden)

Savannah E. Howe

2016-10-01

Full Text Available Nanoparticles (NPs are increasingly being used for drug delivery, as well as antigen carriers and immunostimulants for the purpose of developing vaccines. In this work, we examined how intranasal (i.n. priming followed by i.n. or subcutaneous (s.c. boosting immunization affects the humoral immune response to chicken ovalbumin (Ova and Ova conjugated to 20 nm NPs (NP-Ova. We show that i.n. priming with 20 mg of soluble Ova, a dose known to trigger oral tolerance when administered via gastric gavage, induced substantial systemic IgG1 and IgG2c, as well as mucosal antibodies. These responses were further boosted following a s.c. immunization with Ova and complete Freund’s adjuvant (Ova+CFA. In contrast, 100 µg of Ova delivered via NPs induced an IgG1-dominated systemic response, and primed the intestinal mucosa for secretion of IgA. Following a secondary s.c. or i.n. immunization with Ova+CFA or NP-Ova, systemic IgG1 titers significantly increased, and serum IgG2c and intestinal antibodies were induced in mice primed nasally with NP-Ova. Only Ova- and NP-Ova-primed mice that were s.c.-boosted exhibited substantial systemic and mucosal titers for up to 6 months after priming, whereas the antibodies of i.n.-boosted mice declined over time. Our results indicate that although the amount of Ova delivered by NPs was 1000-fold less than Ova delivered in soluble form, the antigen-specific antibody responses, both systemic and mucosal, are essentially identical by 6 months following the initial priming immunization. Additionally, both i.n.- and s.c.-boosting strategies for NP-Ova-primed mice were capable of inducing a polarized Th1/Th2 immune response, as well as intestinal antibodies; however, it is only by using a heterogeneous prime-boost strategy that long-lasting antibody responses were initiated. These results provide valuable insight for future mucosal vaccine development, as well as furthering our understanding of mucosal antibody responses.

Evaluation of the SLAP lesion using a low-field (0.2T) magnetic resonance system

International Nuclear Information System (INIS)

Cho, Yong Soo; Back, Chang Hee; Lee, Kyung Rae; Shin, Yun Hack

2007-01-01

To evaluate the diagnostic capabilities of the low-field (0.2T) magnetic resonance (MR) system in the detection of the superior labrum anterior to posterior (SLAP) lesion. One hundred fifty patients underwent magnetic resonance imaging of the shoulder over a 7-month period. Forty-six patients underwent arthroscopic surgery, and the surgical results were correlated with the findings of the MR imaging. Arthroscopic procedures were performed within a mean of 8 days after MR imaging. MR imaging of the shoulder was conducted as follows: shoulder coil; T1-weighted spin echo, coronal-oblique images; T2-weighted gradient echo, coronal-oblique and axial images; and T2-weighted spin echo, coronal oblique and sagittal-oblique images. Prospectively, one radiologist interpreted the MR images. The results of surgery were as follow: SLAP II in 26 shoulders, SLAP III in 1 shoulder, SLAP IV in 1 shoulder, normal labrum in 6 shoulder. For SLAP lesions with a higher grade than type 2, the sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of the low-field MRI were 85.7%, 55.5%. 75%, 71%, and 74%, respectively. There was relatively good agreement for the comparison of the MR results obtained using a low-field MR system with the surgical findings for identifying SLAP lesions

Even ‘safe’ medications need to be administered with care

Science.gov (United States)

Lutwak, Nancy; Howland, Mary Ann; Gambetta, Rosemarie; Dill, Curt

2013-01-01

A 60-year-old man with a history of hepatic cirrhosis and cardiomyopathy underwent transoesophageal echocardiogram. He received mild sedation and topical lidocaine. During the recovery period the patient developed ataxia and diplopia for about 30 mins, a result of lidocaine toxicity. The patient was administered a commonly used local anaesthetic, a combination of 2% viscous lidocaine, 4% lidocaine gargle and 5% lidocaine ointment topically to the oropharnyx. The total dose was at least 280 mg. Oral lidocaine undergoes extensive first pass metabolism and its clearance is quite dependent on rates of liver blood flow as well as other factors. The patient's central nervous system symptoms were mild and transient but remind us that to avoid adverse side effects, orally administered drugs with fairly high hepatic extraction ratio given to patients with chronic liver disease need to be given in reduced dosages. Even ‘Safe’ medications need to be carefully administered. PMID:23283606

Administer and collect medical questionnaires with Google documents: a simple, safe, and free system.

Science.gov (United States)

Rayhan, Rakib U; Zheng, Yin; Uddin, Ebsan; Timbol, Christian; Adewuyi, Oluwatoyin; Baraniuk, James N

2013-01-01

Questionnaires are an invaluable resource for clinical trials. They serve to estimate disease burden and clinical parameters associated with a particular study. However, current researchers are tackling budget constraints, loss of funding opportunities, and rise of research associated fees. We aimed at exploring alternative avenues taking advantage of the free Google docs software for questionnaire administration. This presents an opportunity to reduce costs while simultaneously increasing efficiency and data fidelity. Google documents were used as a platform to create online questionnaires that were automatically hosted via a unique URL. Password protected access to the URL link and a unique study ID gave patients around the clock access from anywhere in the world. Unique study ID ensured confidentially of all self-reported data. Patient responses were secured using a "Cloud" database where the data was automatically sorted, scaled and scored by custom Excel formulas. Researchers downloaded real-time questionnaire responses in multiple formats (e.g. excel) which was then analyzed with a statistical software of choice. This simple workflow provided instant questionnaire scores that eliminated the use for paper-based responses and subsequent manual entry of data. Ease of access to online questionnaires provided convenience to patients leading to better response rates and increase in data fidelity. The system also allowed for real time monitoring of patient's progress on completing questionnaires. Online questionnaires had 100% completion rate compared to paper-based questionnaires. Google docs can serve as an efficient and free platform to administer questionnaires to a clinical population without sacrificing quality, security, and fidelity of data.

Bioavailability of detomidine administered sublingually to horses as an oromucosal gel.

Science.gov (United States)

Kaukinen, H; Aspegrén, J; Hyyppä, S; Tamm, L; Salonen, J S

2011-02-01

The objective of the study was to determine the absorption, bioavailability and sedative effect of detomidine administered to horses as an oromucosal gel compared to intravenous and intramuscular administration of detomidine injectable solution. The study was open and randomized, with three sequences crossover design. Nine healthy horses were given 40 μg/kg detomidine intravenously, intramuscularly or administered under the tongue with a 7-day wash-out period between treatments. Blood samples were collected before and after drug administration for the measurement of detomidine concentrations in serum. The effects of the route of administration on heart rate and rhythm were evaluated and the depth of sedation assessed. Mean (±SD) bioavailability of detomidine was 22% (±5.3%) after sublingual administration and 38.2% (±7.9%) after intramuscular administration. The sedative effects correlated with detomidine concentrations regardless of the route of administration. We conclude that less detomidine is absorbed when given sublingually than when given intramuscularly, because part of it does not reach the circulation. Sublingual administration of detomidine oromucosal gel at 40 μg/kg produces safe sedation in horses. Slow absorption leads to fewer and less pronounced adverse effects than the more rapid absorption after intramuscular injection. © 2010 Blackwell Publishing Ltd.

HLA-A*31:01 and HLA-B*15:02 as genetic markers for carbamazepine hypersensitivity in children

Science.gov (United States)

Amstutz, Ursula; Ross, Colin J.D.; Castro-Pastrana, Lucila I.; Rieder, Michael J.; Shear, Neil H.; Hayden, Michael R.; Carleton, Bruce C.

2013-01-01

The occurrence of hypersensitivity reactions including rare but life-threatening Stevens-Johnson syndrome (SJS) and drug-induced hypersensitivity syndrome (HSS) limits the use of the anticonvulsant carbamazepine (CBZ). HLA-B*15:02 and HLA-A*31:01 have been identified as predictive genetic markers for CBZ hypersensitivity in Asian and European patients. To replicate these genetic associations in pediatric patients from North America with a diverse ethnic background, we investigated HLA-A*31:01 and HLA-B*15:02 in 42 children with CBZ hypersensitivity, and 91 CBZ-tolerant children from across Canada. HLA-A*31:01 was significantly associated with CBZ-HSS (odds ratio (OR): 26.4, p=0.0025) and maculopapular exanthems (OR: 8.6, p=0.0037), but not with CBZ-SJS. Conversely, HLA-B*15:02 was associated with CBZ-SJS (OR: 38.6, p=0.002), but not HSS and maculopapular exanthems. This study is the first to demonstrate the association of HLA-A*31:01 with CBZ hypersensitivity in children, providing important replication of this association and highlighting the importance of HLA-A*31:01 as a predictive biomarker across various ancestries. PMID:23588310

Minocycline hepatotoxicity: Clinical characterization and identification of HLA-B∗35:02 as a risk factor.

Science.gov (United States)

Urban, Thomas Jacob; Nicoletti, Paola; Chalasani, Naga; Serrano, José; Stolz, Andrew; Daly, Ann K; Aithal, Guruprasad P; Dillon, John; Navarro, Victor; Odin, Joseph; Barnhart, Huiman; Ostrov, David; Long, Nanye; Cirulli, Elizabeth Trilby; Watkins, Paul Brent; Fontana, Robert John

2017-07-01

Minocycline hepatotoxicity can present with prominent autoimmune features in previously healthy individuals. The aim of this study was to identify genetic determinants of minocycline drug-induced liver injury (DILI) in a well-phenotyped cohort of patients. Caucasian patients with minocycline DILI underwent genome-wide genotyping and were compared to unexposed population controls. Human leukocyte antigen (HLA) binding of minocycline was assessed using AutoDock Vina. Among the 25 cases, 80% were female, median age was 19years and median latency from drug start to DILI onset was 318days. At presentation, 76% had acute hepatocellular liver injury, median ALT 1,077U/L (range: 63 to 2,333), median bilirubin 4.5mg/dl (range: 0.2 to 16.7), and 90% had a +ANA. During follow-up, 50% were treated with corticosteroids and no participants died or required a liver transplant. A significant association was noted between HLA-B∗35:02 and risk for minocycline DILI; a 16% carrier frequency in DILI cases compared to 0.6% in population controls (odds ratio: 29.6, 95% CI: 7.8-89.8, p=2.5×10 -8 ). Verification of HLA-B∗35:02 imputation was confirmed by sequence-based HLA typing. HLA-B∗35:02 carriers had similar presenting features and outcomes compared to non-carriers. In silico modeling studies support the hypothesis that direct binding of minocycline to this novel HLA risk allele might be an important initiating event in minocycline DILI. HLA-B∗35:02 is a rare HLA allele that was more frequently identified in the 25 minocycline DILI cases compared to population controls. If confirmed in other cohorts, this HLA allele may prove to be a useful diagnostic marker of minocycline DILI. Development of liver injury following prolonged use of minocycline for acne is a rare but potentially severe form of drug-induced liver injury. Our study demonstrates that individuals who are HLA-B∗35:02 carriers are at increased risk of developing minocycline related liver injury. These results may

Construction and qualification of the Power Supply system of the AMS-02 Tracker detector

International Nuclear Information System (INIS)

Menichelli, M.; Accardo, L.; Ambrosi, G.; Battiston, R.; Bizzarri, M.; Blasko, S.; Cosson, D.; Fiori, E.M.; Maris, O.; Papi, A.; Scolieri, G.

2007-01-01

The AMS-02 Tracker power supply system, described in this paper, has been designed optimizing noise performances, modularity and efficiency. The power is distributed starting from a 28V line coming from the power distribution system is converted into the needed voltages by means of DC-DC converters, and for bias supply and front-end voltages is post-regulated by means of linear regulators. Components Off The Shelf (COTS) have been extensively used in the construction of this power supply, however various radiation test campaigns have been performed in order to verify the reliability of these components. The power supply architecture developed for the tracker detector has been used as a guideline for the development of the power supplies for the other detectors in the experiment

Administer and collect medical questionnaires with Google documents: a simple, safe, and free system

Directory of Open Access Journals (Sweden)

Rakib Uddin RAYHAN

2013-09-01

Full Text Available Aim: Questionnaires are an invaluable resource for clinical trials. They serve to estimate disease burden and clinical parameters associated with a particular study. However, current researchers are tackling budget constraints, loss of funding opportunities, and rise of research associated fees. We aimed at exploring alternative avenues taking advantage of the free Google docs software for questionnaire administration. This presents an opportunity to reduce costs while simultaneously increasing efficiency and data fidelity. Material and Methods: Google documents were used as a platform to create online questionnaires that were automatically hosted via a unique URL. Password protected access to the URL link and a unique study ID gave patients around the clock access from anywhere in the world. Unique study ID ensured confidentially of all self-reported data. Patient responses were secured using a “Cloud” database where the data was automatically sorted, scaled and scored by custom Excel formulas. Researchers downloaded real-time questionnaire responses in multiple formats (e.g. excel which was then analyzed with a statistical software of choice. Results: This simple workflow provided instant questionnaire scores that eliminated the use for paper-based responses and subsequent manual entry of data. Ease of access to online questionnaires provided convenience to patients leading to better response rates and increase in data fidelity. The system also allowed for real time monitoring of patient’s progress on completing questionnaires. Online questionnaires had 100% completion rate compared to paper-based questionnaires. Conclusions: Google docs can serve as an efficient and free platform to administer questionnaires to a clinical population without sacrificing quality, security, and fidelity of data.

2018-02-26T02:07:12Z https://www.ajol.info/index.php/all/oai oai:ojs ...

African Journals Online (AJOL)

article/100034 2018-02-26T02:07:12Z pamj:ART Assessment of laboratory logistics management information system practice for HIV/AIDS and tuberculosis laboratory commodities in selected public health facilities in Addis Ababa, Ethiopia ...

Pair housing differentially affects motivation to self-administer cocaine in male and female rats.

Science.gov (United States)

Westenbroek, Christel; Perry, Adam N; Becker, Jill B

2013-09-01

Female rats exhibit greater intake and motivation to self-administer cocaine. In females but not males, isolation by itself is a stressor, which could lead to increased drug intake. Therefore, we hypothesized that social housing would buffer against stress and reduce the motivation to self-administer cocaine primarily in females. Male and female Sprague-Dawley rats were housed individually or in same-sex pairs. The individually housed rats and one of each pair were allowed to self-administer (SA) a low dose of cocaine (0.2 mg/kg/inf) on a fixed ratio (FR1) schedule for one week. Motivation for cocaine SA was measured for an additional 2 weeks on a progressive ratio schedule. Isolated females had greater cocaine-intake on the FR1 schedule and greater motivation to take cocaine than males. Pair-housing in females, but not males, attenuated the motivation to take cocaine. Isolated females, but not males, showed escalation of their motivation to take cocaine, which was attenuated by pair housing of females. Concluding, the motivation to take cocaine escalates in females but not males, and pair-housing of females attenuates this escalation. Copyright © 2013 Elsevier B.V. All rights reserved.

The Effect of a Combination of Diclofenac and Methadone Applied as Gel in a Human Experimental Pain Model- A Randomized, Placebo-Controlled Trial

DEFF Research Database (Denmark)

Larsen, Isabelle M; Drewes, Asbjørn M; Olesen, Anne E

2018-01-01

should be low. We hypothesized that anti-allodynic and anti-hyperalgesic effects of Diclometh could be demonstrated in a human experimental pain model, and that Diclometh would be safe to administer. Thus, the aims were: 1) To compare two doses of Diclometh versus placebo; 2) To assess the safety profile...... of Diclometh. The study was a cross-over, randomized, double-blind, placebo-controlled comparison of two doses of Diclometh gel (0.1% and 0.2%) administered topically in healthy participants. Nerve growth factor (NGF) and capsaicin intradermal injections were used as human pain models. Pressure stimulation...... of anti-allodynic effect of Diclometh 0.2% was found. Additionally, it was demonstrated that Diclometh was safe to use. This article is protected by copyright. All rights reserved....

Evaluation of SIPIC01 and SIPIC02 on Motor Speed Control

Directory of Open Access Journals (Sweden)

Wong Kah Kit

2018-01-01

Full Text Available Due to its simplicity, Proportional-Integral (PI controller still remains as the widely used controller for motor speed control system. However, PI controller exhibits windup phenomenon when the motor operates in a saturated state, which may cause degradation to the control system. In order to overcome the windup phenomenon, many researches have introduced various types of anti-windup methods such as the Conditioning Technique (CI, Tracking Back Calculation (TBC, Integral State Prediction (ISP, Steady-state Integral Proportional Integral Controller-01 (SIPIC01 and Steady-state Integral Proportional Integral Controller-02 (SIPIC02. These are anti-windup techniques with integral control switching mechanism, coupling of proportional gain, kp, and integral gain, ki. Due to the coupled kp and ki, tuning motor performance is a difficult task with short settling time without experiencing overshoot. SIPIC01 and SIPIC02 are robust anti-windup methods without a switching mechanism and exhibit decoupling feature. SIPIC01 and SIPIC02 have shown better dynamic performance compared to CI, TBC and ISP. However, SIPIC01 has not been compared to SIPIC02 in terms of their decoupling effect flexibility and dynamic performance. The decoupling effect was verified using MATLAB simulation, while the performance analysis was verified through hardware simulation and testing by using Scilab. The results obtained from the simulation showed that both SIPIC01 and SIPIC02 consist of decoupling features that allow a performance with coexistence of zero or minimum overshoot with short settling time. However, SIPIC02 consists of longer rise and settling time as compared to SIPIC01. Therefore, it can be concluded that SIPIC01 is better than SIPIC02 in term of dynamic performance.

Acute Chloroform Ingestion Successfully Treated with Intravenously Administered N-acetylcysteine

OpenAIRE

Dell’Aglio, Damon M.; Sutter, Mark E.; Schwartz, Michael D.; Koch, David D.; Algren, D. A.; Morgan, Brent W.

2010-01-01

Chloroform, a halogenated hydrocarbon, causes central nervous system depression, cardiac arrhythmias, and hepatotoxicity. We describe a case of chloroform ingestion with a confirmatory serum level and resultant hepatotoxicity successfully treated with intravenously administered N-acetylcysteine (NAC). A 19-year-old man attempting suicide ingested approximately 75 mL of chloroform. He was unresponsive and intubated upon arrival. Intravenously administered NAC was started after initial stabiliz...

Single-crystal LiNi{sub 0.6}Co{sub 0.2}Mn{sub 0.2}O{sub 2} as high performance cathode materials for Li-ion batteries

Energy Technology Data Exchange (ETDEWEB)

Wang, Lei [School of Materials Science and Engineering, Beijing Institute of Technology, Beijing Key Laboratory of Environment Science and Engineering, Beijing 100081 (China); Wu, Borong, E-mail: wubr@bit.edu.cn [School of Materials Science and Engineering, Beijing Institute of Technology, Beijing Key Laboratory of Environment Science and Engineering, Beijing 100081 (China); Beijing Higher Institution Engineering Research Center of Power Battery and Chemical Energy Materials, Beijing 100081 (China); Collaborative Innovation Center of Electric Vehicles in Beijing, Beijing 100081 (China); Mu, Daobin, E-mail: mudb@bit.edu.cn [School of Materials Science and Engineering, Beijing Institute of Technology, Beijing Key Laboratory of Environment Science and Engineering, Beijing 100081 (China); Beijing Higher Institution Engineering Research Center of Power Battery and Chemical Energy Materials, Beijing 100081 (China); Liu, Xiaojiang [Institute of Electric Engineering, China Academy of Engineering Physics, Mianyang 621900 (China); Peng, Yiyuan [Key Laboratory of Small Fuctional Organic Molecule, Ministry of Education, Jiangxi Normal University, Nanchang 330022 (China); Xu, Hongliang; Liu, Qi; Gai, Liang [School of Materials Science and Engineering, Beijing Institute of Technology, Beijing Key Laboratory of Environment Science and Engineering, Beijing 100081 (China); Wu, Feng [School of Materials Science and Engineering, Beijing Institute of Technology, Beijing Key Laboratory of Environment Science and Engineering, Beijing 100081 (China); Beijing Higher Institution Engineering Research Center of Power Battery and Chemical Energy Materials, Beijing 100081 (China); Collaborative Innovation Center of Electric Vehicles in Beijing, Beijing 100081 (China)

2016-07-25

Single-crystal nickel-high materials (ST-LNCMO) LiNi{sub 0.6}Co{sub 0.2}Mn{sub 0.2}O{sub 2} have been synthesized using a versatile hydrothermal method. The as-prepared samples are characterized by X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscope (TEM), and selected area electron diffraction (SAED). The results show that the sample annealed at an optimized temperature of 850 °C reveals uniform fine well-crystallized single-particles with diameters of ~800 nm. Electrochemical data demonstrate that the cell using this nickel-high material as the cathode exhibits excellent performance. The sample displays a high capacity of 183.7 mA h·g{sup −1} at 36 mA·g{sup −1} (0.2 C) and excellent cycling stability at different rates. It yields an initial discharge capacity of 153.6 mA h·g{sup −1} at a rate of 10C-rate and a voltage of 2.8 V – 4.3 V. The sample also has an outstanding rate capacity at a high cut-off voltage (4.6 V). This superior performance is attributed to the merits of the single-crystal structure, which may be beneficial to the transportation of the Li{sup +} ion along the grain. - Highlights: • A single-crystal LiNi{sub 0.6}Co{sub 0.2}Mn{sub 0.2}O{sub 2} is prepared by a hydrothermal method. • A high discharge capacity of 183.7 mA h·g{sup −1} at 0.2 C and good cycling stability. • It yields an initial discharge capacity of 153.6 mA h·g{sup −1} at 10 C-rate under 2.8 V–4.3 V. • Superior electrochemical performance may be obtained attributed to the single-crystal structure.

Bioavailability of everolimus administered as a single 5 mg tablet versus five 1 mg tablets: a randomized, open-label, two-way crossover study of healthy volunteers.

Science.gov (United States)

Thudium, Karen; Gallo, Jorge; Bouillaud, Emmanuel; Sachs, Carolin; Eddy, Simantini; Cheung, Wing

2015-01-01

The mammalian target of rapamycin (mTOR) inhibitor everolimus has a well-established pharmacokinetics profile. We conducted a randomized, single-center, open-label, two-sequence, two-period crossover study of healthy volunteers to assess the relative bioavailability of everolimus administered as one 5 mg tablet or five 1 mg tablets. Subjects were randomized 1:1 to receive everolimus dosed as one 5 mg tablet or as five 1 mg tablets on day 1, followed by a washout period on days 8-14 and then the opposite formulation on day 15. Blood sampling for pharmacokinetic evaluation was performed at prespecified time points, with 17 samples taken for each treatment period. Primary variables for evaluation of relative bioavailability were area under the concentration-time curve from time zero to infinity (AUCinf) and maximum blood concentration (Cmax). Safety was assessed by reporting the incidence of adverse events (AEs). Twenty-two participants received everolimus as one 5 mg tablet followed by five 1 mg tablets (n=11) or the opposite sequence (n=11). The Cmax of five 1 mg tablets was 48% higher than that of one 5 mg tablet (geometric mean ratio, 1.48; 90% confidence interval [CI], 1.35-1.62). AUCinf was similar (geometric mean ratio, 1.08; 90% CI, 1.02-1.16), as were the extent of absorption and the distribution and elimination kinetics. AEs, all grade 1 or 2, were observed in 54.5% of subjects. Although the extent of absorption was similar, the Cmax of five 1 mg tablets was higher than that of one 5 mg tablet, suggesting these formulations lead to different peak blood concentrations and are not interchangeable at the dose tested.

The LiyNi0.2Mn0.2Co0.6O2 electrode materials: A structural and magnetic study

International Nuclear Information System (INIS)

Labrini, Mohamed; Saadoune, Ismael; Almaggoussi, Abdelmajid; Elhaskouri, Jamal; Amoros, Pedro

2012-01-01

Graphical abstract: EPR signal of the Li 0.6 Co 0.6 Ni 0.2 Mn 0.2 O 2 composition showing that Mn 4+ ions are the solely paramagnetic ions in the structure. Highlights: ► LiCo 0.6 Ni 0.2 Mn 0.2 O 2 was prepared by the combustion method with sucrose as a fuel. ► Chemical delithiaition was performed by using NO 2 BF 4 oxidizing agent. ► The rhombohedral symmetry was preserved upon lithium removal. ► Lithium extraction leads to Ni 2+ oxidation to Ni 4+ followed by Co 3+ oxidation. ► The EPR narrow signal of Li 0.6 Co 0.6 Ni 0.2 Mn 0.2 O 2 is due to the only active Mn 4+ ions. -- Abstract: Layered LiNi 0.2 Mn 0.2 Co 0.6 O 2 phase, belonging to a solid solution between LiNi 1/2 Mn 1/2 O 2 and LiCoO 2 most commercialized cathodes, was prepared via the combustion method at 900 °C for a short time (1 h). Structural and magnetic properties of this material during chemical extraction were investigated. The powders adopted the α-NaFeO 2 structure with almost none of the well-known Li/Ni cation disorder. The analysis of the magnetic properties in the paramagnetic domain agrees with the combination of Ni 2+ (S = 1), Co 3+ (S = 0) and Mn 4+ (S = 3/2) spin-only values. X-ray analysis of the chemically delithiated Li y Ni 0.2 Mn 0.2 Co 0.6 O 2 reveals no structural transition. The process of lithium extraction from and insertion into LiNi 0.2 Mn 0.2 Co 0.6 O 2 was discussed on the basis of ex situ EPR experiments and magnetic susceptibility. Oxidation of Ni 2+ (S = 1) to Ni 3+ (S = 1/2) and to Ni 4+ (S = 0) was observed upon lithium removal.

India National Gas Hydrate Program Expedition 02 Technical Contributions

Science.gov (United States)

Collett, T. S.; Kumar, P.; Shukla, K. M.; Nagalingam, J.; Lall, M. V.; Yamada, Y.; Schultheiss, P. J.; Holland, M.; Waite, W. F.

2017-12-01

The National Gas Hydrate Program Expedition 02 (NGHP-02) was conducted from 3-March-2015 to 28-July-2015 off the eastern coast of India. The primary objective of this expedition was the exploration and discovery of highly saturated gas hydrate occurrences in sand reservoirs that would be targets of future production testing. The first 2 months of the expedition were dedicated to logging while drilling (LWD) operations with a total of 25 holes being drilled and logged. The next 3 months were dedicated to coring operations at 10 of the most promising sites. NGHP-02 downhole logging, coring and formation pressure testing have confirmed the presence of large, highly saturated, gas hydrate accumulations in coarse-grained sand-rich depositional systems throughout the Krishna-Godavari Basin within the regions defined during NGHP-02 as Area-B, Area-C, and Area-E. The nature of the discovered gas hydrate occurrences closely matched pre-drill predictions, confirming the project developed depositional models for the sand-rich depositional facies in the Krishna-Godavari and Mahanadi Basins. The existence of a fully developed gas hydrate petroleum system was established in Area-C of the Krishna-Godavari Basin with the discovery of a large slope-basin interconnected depositional system, including a sand-rich, gas-hydrate-bearing channel-levee prospect at Sites NGHP-02-08 and -09. The acquisition of closely spaced LWD and core holes in the Area-B L1 Block gas hydrate accumulation have provided one of the most complete three-dimensional petrophysical-based views of any known gas hydrate reservoir system in the world. It was concluded that Area-B and Area-C in the area of the greater Krishna-Godavari Basin contain important world-class gas hydrate accumulations and represent ideal sites for consideration of future gas hydrate production testing.

Modification of heating system on HeaTiNG-02 test section of beta test loop

International Nuclear Information System (INIS)

Sagino; Dedy Haryanto; Riswan Djambiar; Edy Sumarno

2013-01-01

Modifications have been carried out on the heating test section heating-02 on the integration strand Beta Test (UUB). The activities carried out to overcome the obstacles that arise in the test section when used. Constraint that often arises is the fall of the heating source super chantal when it reaches a certain temperature. To mitigate the super chantal is initially converted into a horizontal vertical position. Change from vertical to horizontal position on super chantal aims to stabilize the position of super chantal, so it needs to be modified in the heating system. Modification activities include manufacturing, installation and testing of super chantal and refractory stone as super chantal support. Manufacturing refractory stone formation and assembly into the heater in accordance with design modifications that have been done in electromechanical workshop obtained using some machine tools. Testing results of fabrication has been done by providing voltage 110 volts until it reaches operating temperature 400°C. Test results obtained super chantal stable position when it reaches operating temperature, and heater of heating-02 test section feasible to be used for experiments. (author)

Labview applications based on field programmable gate array (FPGA) on temperature measurement system of heating-02

International Nuclear Information System (INIS)

Kussigit Santosa

2013-01-01

Temperature measurements system has been created at the heating-02 test using LabVIEW 2011 software. Making this measurement systems on FPGA is the development of previous a measurement system using the measurement with cDAQ9188. The advantage of this system is the independence of the system means that the execution time can run itself without a computer. The scope of the current study was limited on the development, programming and testing of data acquisition focused on programming of the FPGA modules that have been embedded on the cRIO 9074. In the making of temperature measurement systems is required the data acquisition system by National Texas Instruments cRIO 9074 module, power supply, Ni 9023 module, 7011 HIOKI current source, the software Labview 2011 and the computer. The using method is stringing the temperature measurement system, programming of data acquisition the FPGA as well as the acquisition system interface that is easy to do observations. From the experimental results, it can be concluded that the temperature measurement system can run well. So that the measurement system is expected to be used for the actual measurement. (author)

Randomized controlled trial of RTS,S/AS02D and RTS,S/AS01E malaria candidate vaccines given according to different schedules in Ghanaian children.

Directory of Open Access Journals (Sweden)

Seth Owusu-Agyei

2009-10-01

Full Text Available The target delivery channel of RTS,S candidate malaria vaccines in malaria-endemic countries in Africa is the World Health Organisation Expanded Program on Immunization. As an Adjuvant System, age de-escalation and schedule selection step, this study assessed 3 schedules of RTS,S/AS01(E and RTS,S/AS02(D in infants and young children 5-17 months of age in Ghana.A Phase II, partially-blind randomized controlled study (blind to vaccine, not to schedule, of 19 months duration was conducted in two (2 centres in Ghana between August 2006 and May 2008. Subjects were allocated randomly (1:1:1:1:1:1 to one of six study groups at each study site, each defining which vaccine should be given and by which schedule (0,1-, 0,1,2- or 0,1,7-months. For the 0,1,2-month schedule participants received RTS,S/AS01(E or rabies vaccine at one center and RTS,S/AS01(E or RTS,S/AS02(D at the other. For the other schedules at both study sites, they received RTS,S/AS01(E or RTS,S/AS02(D. The primary outcome measure was the occurrence of serious adverse events until 10 months post dose 1.The number of serious adverse events reported across groups was balanced. One child had a simple febrile convulsion, which evolved favourably without sequelae, considered to be related to RTS,S/AS01(E vaccination. Low grade reactions occurred slightly more frequently in recipients of RTS,S/AS than rabies vaccines; grade 3 reactions were infrequent. Less local reactogenicity occurred with RTS,S/AS01(E than RTS,S/AS02(D. Both candidate vaccines were highly immunogenic for anti-circumsporozoite and anti-Hepatitis B Virus surface antigen antibodies. Recipients of RTS,S/AS01(E compared to RTS,S/AS02(D had higher peak anti-circumsporozoite antibody responses for all 3 schedules. Three dose schedules were more immunogenic than 2 dose schedules. Area under the curve analyses for anti-circumsporozoite antibodies were comparable between the 0,1,2- and 0,1,7-month RTS,S/AS01(E schedules.Both candidate

Physico-chemical stability of eribulin mesylate containing concentrate and ready-to-administer solutions.

Science.gov (United States)

Spindeldreier, Kirsten; Thiesen, Judith; Lipp, Hans-Peter; Krämer, Irene

2014-06-01

The aim of this study was to determine the stability of commercially available eribulin mesylate containing injection solution as well as diluted ready-to-administer solutions stored under refrigeration or at room temperature. Stability was studied by a novel developed stability-indicating reversed-phase high-performance liquid chromatography (RP-HPLC) assay with ultraviolet detection (detection wavelength 200 nm). Triplicate test solutions of eribulin mesylate containing injection concentrate (0.5 mg/mL) and with 0.9% sodium chloride solution diluted ready-to-administer preparations (0.205 mg/mL eribulin mesylate in polypropylene (PP) syringes, 0.020 mg/mL eribulin mesylate in polypropylene/polyethylene (PE) bags) were stored protected from light either at room temperature (25) or under refrigeration (2-8). Samples were withdrawn on day 0 (initial), 1, 3, 5, 7, 14, 21 and 28 of storage and assayed. Physical stability was determined by measuring the pH value once a week and checking for visible precipitations or colour changes. The stability tests revealed that concentrations of eribulin mesylate remained unchanged over a period of 28 days irrespective of concentration, container material or storage temperature. Neither colour changes nor visible particles have been observed. The pH value varied slightly over time but remained in the stability favourable range of 5-9. Eribulin mesylate injection (0.5 mg/mL) is physico-chemically stable over a period of 28 days after first puncture of the vial. After dilution with 0.9% NaCl vehicle solution, ready-to-administer eribulin mesylate injection solutions (0.205 mg/mL in PP syringe) and infusion solutions (0.02 mg/mL in prefilled PP/PE bags) are physico-chemically stable for a period of at least four weeks either refrigerated or stored at room temperature. For microbiological reasons storage under refrigeration is recommended.

Determination of travel time capsules hydraulic rabbit system channel 2 (JBB 02) at the G.A. Siwabessy reactor

International Nuclear Information System (INIS)

Sutrisno; Sunarko; Elisabeth Ratnawati

2014-01-01

Rabbit System is an irradiation facilities used for research on neutron activation. There are two types of Rabbit Systems including 4 pieces Rabbit Hydraulic Systems (JBB01 - JBB04) and Rabbit Pneumatic Systems (JBB05). Irradiation facility of hydraulic rabbit system is irradiation facility with media delivery in the form of capsules. Travel time delivery and the return capsule in hydraulic rabbit system facility depends on the magnitude of the observed flow rate on flow measurement instruments for water circulation. To determine the travel time should be observed flow rates varied by opening the valve (JBB02 AA007), so the delivery time and the return capsule in the rabbit facility hydraulic system can be known. Observations made from the results obtained travel time capsule delivery poly ethylene (PE) of the isotope cell to irradiation position appropriate to the graph Y=57,67 e -0,139.x , for capsules Aluminum (Al) appropriate graph Y= 68,178 e -0,189.x , while the travel time of the return capsule poly ethylene (PE) from the irradiation position to the isotope cell appropriate graph Y=56,459 e -13.x , for capsules Al appropriate graph Y= 65,51 e -183.x this result can be used as a reference for determining the travel time desired by the operator. (author)

Investigations on highly stable thermal characteristics of a dilute In0.2Ga0.8AsSb/GaAs doped-channel field-effect transistor

International Nuclear Information System (INIS)

Su, Ke-Hua; Hsu, Wei-Chou; Hu, Po-Jung; Lee, Ching-Sung; Wu, Yue-Han; Chang, Li; Hsiao, Ru-Shang; Chen, Jenn-Fang; Chi, Tung-Wei

2008-01-01

This work reports for the first time a novel In 0.2 Ga 0.8 AsSb/GaAs heterostructure doped-channel field-effect transistor (DCFET) grown by the molecular beam epitaxy system. The interfacial quality within the InGaAsSb/GaAs quantum well of the DCFET device has been effectively improved by introducing surfactant-like Sb atoms during the growth of the Si-doped InGaAs channel layer. The improved device characteristics include the peak extrinsic transconductance (g m,max ) of 161.5 mS mm −1 , the peak drain–source saturation current density (I DSS,max ) of 230 mA mm −1 , the gate–voltage swing (GVS) of 1.65 V, the cutoff frequency (f T ) of 12.5 GHz and the maximum oscillation frequency (f max ) of 25 GHz at 300 K with the gate dimensions of 1.2 × 200 µm 2 . The proposed design has also shown a stable thermal threshold coefficient (∂V th /∂T) of −0.7 mV K −1

Experiment data report for semiscale Mod-1, test S-02-7. Blowndown heat transfer test

International Nuclear Information System (INIS)

Crapo, H.S.; Jensen, M.F.; Sackett, K.E.

1975-11-01

Recorded test data are presented for Test S-02-7 of the Semiscale Mod-1 blowdown heat transfer test series conducted to investigate the thermal and hydraulic phenomena accompanying an hypothesized loss-of-coolant accident (LOCA) in a water-cooled nuclear reactor system and to provide data for the assessment of the Loss-of-Fluid Test (LOFT) design basis. Test S-02-7 was conducted from an initial cold leg fluid temperature of 543 0 F and an initial pressure of 2,263 psia. A simulated double-ended offset shear cold leg break was used to investigate the system response to a depressurization transient with full design core power (1.6 MW). An electrically heated core was used in the pressure vessel to simulate the effects of a nuclear core with power set to provide a flat radial power profile. System flow was set to achieve the full design core temperature differential of 66 0 F. Blowdown to the pressure suppression system was accomplished without simulated emergency core cooling injection or pressure suppression system coolant spray. The uninterpreted data from Test S-02-7 are presented for future data analysis and test results reporting activities. The data, presented in the form of graphs in engineering units, have been analyzed only to the extent necessary to assure that they are reasonable and consistent. Also included as an appendix are selected data from a test identified as Test S-02-7C. This test was an initial attempt at Test S-02-7 in which an inadvertent power trip occurred at 2.3 seconds after rupture. Selected data comparisons of the results from Test S-02-7 and S-02-7C are presented to indicate the repeatability of system behavior

The administered activity of radionuclides in nuclear medicine

International Nuclear Information System (INIS)

Nakamura, Mototoshi; Koga, Sukehiko; Kondo, Takeshi

1993-01-01

A survey of 104 hospitals was conducted to determine the administered activity of radionuclides. Eighty-five hospitals responded, and reported a total of 119,614 examinations in one year. The examinations included: bone scintigraphy, 26.4%; thallium-201 ( 201 Tl) myocardial scintigraphy, 15.5%; gallium-67 ( 67 Ga) scintigraphy, 13.3%; N-isopropyl-p-[ 123 I] iodoamphetamine (IMP) brain perfusion scintigraphy, 7.0%. The administered activity was corrected by body weight only for children at more than 80% of the responding hospitals. The number of hospitals that reported over-administration of radionuclide varied according to the type of scintigraphy performed: bone, 76%; inflammatory ( 67 Ga), 93%; myocardial ( 201 Tl), 89.2%; brain (IMP), 8.5%. The administered activity of IMP was closer to the upper limits specified in the Recommendations on Standardization of Radionuclide Imaging by the Japan Radioisotope Association (1987), because IMP is very expensive and is supplied as single vials. The highest average effective dose was for myocardial scintigraphy, the second-highest for inflammatory scintigraphy, and the third-highest for bone scintigraphy. In 201 Tl and 67 Ga scintigraphy, the entire contents of the vial may be administered two days before the expiration date, because the ratio of (true patient administered activity) to (declared patient administered activity) is similar to the ratio of (radioactivity on the day of supply) to (radioactivity on the day of expiration). The factors that influence administered activity are through put, price of the radionuclide, and whether the radionuclide is sold as a single vial. In order to decrease the effective dose, it is necessary to establish a close cooperation between medical personnel, the makers of radiopharmaceuticals, and manufactures of gamma cameras. (author)

Is Tamsulosin 0.2 mg Effective and Safe as a First-Line Treatment Compared with Other Alpha Blockers?: A Meta-Analysis and a Moderator Focused Study.

Science.gov (United States)

Shim, Sung Ryul; Kim, Jae Heon; Chang, In Ho; Shin, In Soo; Hwang, Sung Dong; Kim, Khae Hwan; Yoon, Sang Jin; Song, Yun Seob

2016-03-01

Tamsulosin 0.2 mg is used widely in Asian people, but the low dose has been studied less than tamsulosin 0.4 mg or other alpha blockers of standard dose. This study investigated the efficacy and safety of tamsulosin 0.2 mg by a meta-analysis and meta-regression. We conducted a meta-analysis of efficacy of tamsulosin 0.2 mg using International Prostate Symptom Score (IPSS), maximal urinary flow rate (Qmax), post-voided residual volume (PVR), and quality of life (QoL). Safety was analyzed using adverse events. Relevant studies were searched using MEDLINE, EMBASE, and Cochrane library from January 1980 to June 2013. Ten studies were included with a total sample size of 1418 subjects [722 tamsulosin 0.2 mg group and 696 other alpha-blockers (terazosin, doxazosin, naftopidil, silodosin) group]. Study duration ranged from 4 to 24 weeks. The pooled overall standardized mean differences (SMD) in the mean change of IPSS from baseline for the tamsulosin group versus the control group was 0.02 [95% confidence interval (CI); -0.20, 0.25]. The pooled overall SMD in the mean change of QoL from baseline for the tamsulosin group versus the control group was 0.16 (95% CI; -0.16, 0.48). The regression analysis with the continuous variables (number of patients, study duration) revealed no significance in all outcomes as IPSS, QoL, and Qmax. This study clarifies that tamsulosin 0.2 mg has similar efficacy and fewer adverse events compared with other alpha-blockers as an initial treatment strategy for men with lower urinary tract symptoms.

Interviewer versus self-administered health-related quality of life questionnaires - Does it matter?

Directory of Open Access Journals (Sweden)

Ackatz Lori E

2011-05-01

Full Text Available Abstract Background Patient-reported outcomes are measured in many epidemiologic studies using self- or interviewer-administered questionnaires. While in some studies differences between these administration formats were observed, other studies did not show statistically significant differences important to patients. Since the evidence about the effect of administration format is inconsistent and mainly available from cross-sectional studies our aim was to assess the effects of different administration formats on repeated measurements of patient-reported outcomes in participants with AIDS enrolled in the Longitudinal Study of Ocular Complications of AIDS. Methods We included participants enrolled in the Longitudinal Study of Ocular Complications in AIDS (LSOCA who completed the Medical Outcome Study [MOS] -HIV questionnaire, the EuroQol, the Feeling Thermometer and the Visual Function Questionnaire (VFQ 25 every six months thereafter using self- or interviewer-administration. A large print questionnaire was available for participants with visual impairment. Considering all measurements over time and adjusting for patient and study site characteristics we used linear models to compare HRQL scores (all scores from 0-100 between administration formats. We defined adjusted differences of ≥0.2 standard deviations [SD] to be quantitatively meaningful. Results We included 2,261 participants (80.6% males with a median of 43.1 years of age at enrolment who provided data on 23,420 study visits. The self-administered MOS-HIV, Feeling Thermometer and EuroQol were used in 70% of all visits and the VFQ-25 in 80%. For eight domains of the MOS-HIV differences between the interviewer- and self- administered format were Conclusions Our large study provides evidence that administration formats do not have a meaningful effect on repeated measurements of patient-reported outcomes. As a consequence, longitudinal studies may not need to consider the effect of

Acute chloroform ingestion successfully treated with intravenously administered N-acetylcysteine.

Science.gov (United States)

Dell'Aglio, Damon M; Sutter, Mark E; Schwartz, Michael D; Koch, David D; Algren, D A; Morgan, Brent W

2010-06-01

Chloroform, a halogenated hydrocarbon, causes central nervous system depression, cardiac arrhythmias, and hepatotoxicity. We describe a case of chloroform ingestion with a confirmatory serum level and resultant hepatotoxicity successfully treated with intravenously administered N-acetylcysteine (NAC). A 19-year-old man attempting suicide ingested approximately 75 mL of chloroform. He was unresponsive and intubated upon arrival. Intravenously administered NAC was started after initial stabilization was complete. His vital signs were normal. Admission laboratory values revealed normal serum electrolytes, AST, ALT, PT, BUN, creatinine, and bilirubin. Serum ethanol level was 15 mg/dL, and aspirin and acetaminophen were undetectable. The patient was extubated but developed liver function abnormalities with a peak AST of 224 IU/L, ALT of 583 IU/L, and bilirubin level reaching 16.3 mg/dL. NAC was continued through hospital day 6. Serum chloroform level obtained on admission was 91 μg/mL. The patient was discharged to psychiatry without known sequelae and normal liver function tests. The average serum chloroform level in fatal cases of inhalational chloroform poisoning was 64 μg/mL, significantly lower than our patient. The toxicity is believed to be similar in both inhalation and ingestion routes of exposure, with mortality predominantly resulting from anoxia secondary to central nervous system depression. Hepatocellular toxicity is thought to result from free radical-induced oxidative damage. Previous reports describe survival after treatment with orally administered NAC, we report the first use of intravenously administered NAC for chloroform ingestion. Acute oral ingestion of chloroform is extremely rare. Our case illustrates that with appropriate supportive care, patients can recover from chloroform ingestion, and intravenously administered NAC may be of benefit in such cases.

Reassessment of the RERF dosimetry system - overview of the new dosimetry system DS02

International Nuclear Information System (INIS)

Young, R.W.

2003-01-01

This paper describes a major reassessment of the system used at the Radiation Effects Research Foundation (RERF) to determine radiation doses for atomic-bomb survivors. This effort has resolved the neutron discrepancy in RERF dosimetry, and has defined the parameters for a replacement system for survivor dose calculation. A Joint US-Japan Working Group undertook a comprehensive evaluation of the calculations that comprise the RERF dosimetry system and the measurements used to verify those calculations. During the course of this reassessment, the working groups, with members from American, German and Japanese universities and national laboratories, have recomputed all of the Hiroshima and Nagasaki radiation calculations, made fast-neutron and low-background thermal-neutron measurements, upgraded the calculation of the radiation shielding provided by terrain and large buildings, and conducted a comprehensive reassessment of all radiation measurements. The new calculations produced during this reassessment agree with both gamma and neutron measurements out to distances from the detonations at which in-situ measurements become indistinguishable from background, effectively resolving the long-standing neutron dose discrepancy. The calculations that produce this agreement are the basis for the new DS02 dosimetry system. New calculations and measurements confirmed the yield and epicenter for the Nagasaki detonation while refining both these values for Hiroshima. Current measurements and calculations confirm a 21-kiloton-yield for the Nagasaki bomb and a burst point to within two meters of previous assessments. In Hiroshima, the estimated yield has been increased from 15 kt to 16 kt and the epicenter has been repositioned 20 meters higher and 15 meters to the west. While these refined parameters make the dosimetry system more accurate and users of the system more confident in the results, the calculated dose to survivors will change only about ten percent

A systematic review and meta-analysis of written self-administered psychosocial interventions among adults with a physical illness.

Science.gov (United States)

Lambert, Sylvie D; Beatty, Lisa; McElduff, Patrick; Levesque, Janelle V; Lawsin, Catalina; Jacobsen, Paul; Turner, Jane; Girgis, Afaf

2017-12-01

The cost of implementing professionally-led psychosocial interventions has limited their integration into routine care. To enhance the translation of effective psychosocial interventions in routine care, a self-administered format is sometimes used. The meta-analysis examined the efficacy of written self-administered, psychosocial interventions to improve outcomes among individuals with a physical illness. Studies comparing a written self-administered intervention to a control group were identified through electronic databases searching. Pooled effect sizes were calculated across follow-up time points using random-effects models. Studies were also categorised according to three levels of guidance (self-administered, minimal contact, or guided) to examine the effect of this variable on outcomes. Forty manuscripts were retained for the descriptive review and 28 for the meta-analysis. Findings were significant for anxiety, depression, distress, and self-efficacy. Results were not significant for quality of life and related domains as well as coping. Purely self-administered interventions were efficacious for depression, distress, and self-efficacy; only guided interventions had an impact on anxiety. Findings showed that written self-administered interventions show promise across a number of outcomes. Self-administered interventions are a potentially efficacious and cost-effective approach to address some of the most common needs of patients with a physical illness. Copyright © 2017 Elsevier B.V. All rights reserved.

Experimental Conditions: SE3_S02_M02_D03 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M02_D03 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M02 6.7 mg [MassBase ID] MDLC1_25530 SE3_MS1 LC-FT-ICR-M

Experimental Conditions: SE3_S02_M02_D01 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M02_D01 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M02 6.7 mg [MassBase ID] MDLC1_25530 SE3_MS1 LC-FT-ICR-M

EXAFS and EPR study of La0.6Sr0.2Ca0.2MnO3 and La0.6Sr0.2Ba0.2MnO3

International Nuclear Information System (INIS)

Yang, D.-K.Dong-Seok; Ulyanov, A.N.; Phan, Manh-Huong; Kim, Ikgyun; Ahn, Byong-Keun; Rhee, Jang Roh; Kim, Jung Sun; Nguyen, Chau; Yu, Seong-Cho

2003-01-01

Extended X-ray absorption fine structure (EXAFS) analysis and electron-paramagnetic resonance (EPR) have been used to examine the local structure and the internal dynamics of La 0.6 Sr 0.2 Ca 0.2 MnO 3 and La 0.6 Sr 0.2 Ba 0.2 MnO 3 lanthanum manganites. The Mn-O bond distance (∼1.94 Angst for both samples) and the Debye-Waller factors (0.36x10 -2 and 0.41x10 -2 Angst 2 for La 0.6 Sr 0.2 Ca 0.2 MnO 3 and for La 0.6 Sr 0.2 Ba 0.2 MnO 3 , respectively) were obtained from the EXAFS analysis. The dependence of the EPR line width on dopant kind (Ca or Ba) showed a decrease of the spin-lattice interaction with an increase of the Curie temperature. For both compositions, the EPR line intensity followed the exponential law I(T)=I 0 exp(E a /k B T), deduced on the basis of the adiabatic polaron hopping model

Preclinical safety evaluation of intravenously administered mixed micelles.

Science.gov (United States)

Teelmann, K; Schläppi, B; Schüpbach, M; Kistler, A

1984-01-01

Mixed micelles, with their main constituents lecithin and glycocholic acid, form a new principle for the parenteral administration of compounds which are poorly water-soluble. Their composition of mainly physiological substances as well as their comparatively good stability substantiate their attractivity in comparison to existing solvents. A decomposition due to physical influences such as heat or storage for several years will almost exclusively affect the lecithin component in the form of hydrolysis into free fatty acids and lysolecithin. Their toxicity was examined experimentally in various studies using both undecomposed and artificially decomposed mixed micelles. In these studies the mixed micelles were locally and systemically well tolerated and proved to be neither embryotoxic, teratogenic nor mutagenic. Only when comparatively high doses of the undecomposed mixed micelles were administered, corresponding to approximately 30 to 50 times the anticipated clinical injection volume (of e.g. diazepam mixed micelles), did some vomitus (dogs), slight liver enzyme elevation (rats and dogs), and slightly increased liver weights (dogs) occur. After repeated injections of the artificially decomposed formulation (approximately 25% of lecithin hydrolyzed to free fatty acids and lysolecithin) effects such as intravascular haemolysis, liver enzyme elevations and intrahepatic cholestasis (dogs only) were observed but only when doses exceeding a threshold of approximately 40 to 60 mg lysolecithin/kg body weight were administered. All alterations were reversible after cessation of treatment.

Effectiveness of ophthalmic solution preservatives: a comparison of latanoprost with 0.02% benzalkonium chloride and travoprost with the sofZia preservative system

Directory of Open Access Journals (Sweden)

Lovelace Cherie

2011-04-01

% BAK exhibited more effective microbial protection than travoprost with sofZia using rates of microbial reduction, time to no recovery for all challenges and evaluation against EP-A criteria as measures. The rapid and complete reduction of all microbial challenges demonstrates that antimicrobial activity of latanoprost with 0.02% BAK exceeds that of travoprost with sofZia preservative system in these products and provides a more protective environment in the event of contamination and subsequent exposure to microorganisms during use.

Effectiveness of ophthalmic solution preservatives: a comparison of latanoprost with 0.02% benzalkonium chloride and travoprost with the sofZia preservative system.

Science.gov (United States)

Ryan, Gerard; Fain, Joel M; Lovelace, Cherie; Gelotte, Karl M

2011-04-21

travoprost with sofZia using rates of microbial reduction, time to no recovery for all challenges and evaluation against EP-A criteria as measures. The rapid and complete reduction of all microbial challenges demonstrates that antimicrobial activity of latanoprost with 0.02% BAK exceeds that of travoprost with sofZia preservative system in these products and provides a more protective environment in the event of contamination and subsequent exposure to microorganisms during use.

22 CFR 196.4 - Administering office.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Administering office. 196.4 Section 196.4... AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.4 Administering office. The Department of State's Bureau of Human Resources, Office of Recruitment is responsible for administering the Thomas R...

40 CFR 131.8 - Requirements for Indian Tribes to administer a water quality standards program.

Science.gov (United States)

2010-07-01

... administer a water quality standards program. 131.8 Section 131.8 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS WATER QUALITY STANDARDS General Provisions § 131.8 Requirements for Indian Tribes to administer a water quality standards program. (a) The Regional Administrator, as...

Crystal structure and optical property of complex perovskite oxynitrides ALi0.2Nb0.8O2.8N0.2, ANa0.2Nb0.8O2.8N0.2, and AMg0.2Nb0.8O2.6N0.4 (A = Sr, Ba)

Science.gov (United States)

Moon, Keon Ho; Avdeev, Maxim; Kim, Young-Il

2017-10-01

Oxynitride type complex perovskites AM0.2Nb0.8O3-xNx (A = Sr, Ba; M = Li, Na, Mg) were newly synthesized by the solid state diffusion of Li+, Na+, or Mg2+ into the layered oxide, A5Nb4O15, with concurrent O/N substitution. Neutron and synchrotron X-ray Rietveld refinement showed that SrLi0.2Nb0.8O2.8N0.2, SrNa0.2Nb0.8O2.8N0.2, and SrMg0.2Nb0.8O2.6N0.4 had body-centered tetragonal symmetry (I4/mcm), while those with A = Ba had simple cubic symmetry (Pm 3 ̅ m). In the tetragonal Sr-compounds, the nitrogen atoms were localized on the c-axial 4a site. However, the octahedral cations, M/Nb (M = Li, Na, Mg) were distributed randomly in all six compounds. The lattice volume of AM0.2Nb0.8O3-xNx was dependent on various factors including the type of A and the electronegativity of M. Compared to the simple perovskites, ANbO2N (A = Sr, Ba), AM0.2Nb0.8O3-xNx had wider band gaps (1.76-2.15 eV for A = Sr and 1.65-2.10 eV for A = Ba), but significantly lower sub-gap absorption.

Supraspinally-administered agmatine attenuates the development of oral fentanyl self-administration

Science.gov (United States)

Wade, Carrie L.; Schuster, Daniel J.; Domingo, Kristine M.; Kitto, Kelley F.; Fairbanks, Carolyn A.

2009-01-01

The decarboxylation product of arginine, agmatine, has effectively reduced or prevented opioid-induced tolerance and dependence when given either systemically (intraperitoneally or subcutaneously) or centrally (intrathecally or intracerebroventricularly). Systemically administered agmatine also reduces the escalation phase of intravenous fentanyl self-administration in rats. The present study assessed whether centrally (intracerebroventricular, i.c.v.) delivered agmatine could prevent the development of fentanyl self-administration in mice. Mice were trained to respond under a fixed-ratio 1 (FR1) schedule for either fentanyl (0.7 μg/70 μl, p.o.) or food reinforcement. Agmatine (10 nmol/5 μl), injected i.c.v. 12-14h before the first session and every other evening (12-14h before session) for 2 weeks, completely attenuated oral fentanyl self-administration (but not food-maintained responding) compared to saline-injected controls. When agmatine was administered after fentanyl self-administration had been established (day 8) it had no attenuating effects on bar pressing. This dose of agmatine does not decrease locomotor activity as assessed by rotarod. The present findings significantly extend the previous observation that agmatine prevents opioid-maintained behavior to a chronic model of oral fentanyl self-administration as well as identifying a supraspinal site of action for agmatine inhibition of drug addiction. PMID:18495108

40 CFR 282.50 - Alabama State-Administered Program.

Science.gov (United States)

2010-07-01

... financial responsibility for hazardous substance underground storage tank systems. (2) Statement of legal... administered by the Alabama Department of Environmental Management, was approved by EPA pursuant to 42 U.S.C... obtained from the Ground Water Branch, Alabama Department of Environmental Management, 1751 W.L. Dickinson...

The AMS-02 transition radiation detector

CERN Document Server

Kirn, Th

2004-01-01

The Alpha Magnetic Spectrometer AMS02 will be equipped with a large transition radiation detector (TRD) to achieve a proton background suppression necessary for dark matter searches. The AMS02 TRD consists of 20 layers of fleece radiator each with Xe/CO//2 proportional wire straw tubes read out by a dedicated low-power data- acquisition system. A space-qualified TRD design will be presented. The performance of a 20-layer prototype was tested at CERN with electron, myon and pion beams up to l00 GeV and with protons up to 250 GeV. The beam-test results will be compared to Geant3 MC predictions. The detector is under construction at RWTH Aachen; the gas system will be built at MIT, slow-control at MIT and INFN Rome and DAQ at TH Karlsruhe. This project is funded by the German Space Agency DLR, the US Department of Energy DOE and NASA.

Experimental Conditions: SE3_S02_M01_D02 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M01_D02 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M01 6.7mg [MassBase ID] MDLC1_25529 SE3_MS1 LC-FT-ICR-MS

Experimental Conditions: SE3_S02_M03_D02 [Metabolonote[Archive

Lifescience Database Archive (English)

Full Text Available SE3_S02_M03_D02 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M03 6.7 mg [MassBase ID] MDLC1_25531 SE3_MS1 LC-FT-ICR-M

A Controlled Study to Assess the Clinical Efficacy of Totally Self-Administered Systematic Desensitization

Science.gov (United States)

Rosen, Gerald M.; And Others

1976-01-01

Highly anxious self-referred snake phobics received either (a) therapist-administered desensitization, (b) self-administered desensitization with weekly therapist phone calls, (c) totally self-administered desensitization, (d) self-administered double-blind placebo control, or (e) no treatment. Pretreatment to posttreatment measures revealed…

The making of pressure measurement device on heating-02 based realtime

International Nuclear Information System (INIS)

Giarno; Kussigit Santosa; Agus Nur Rachman; G B Heru K

2013-01-01

In order to modify the installation strand BETA Test Section Test integrated with heating-02 into a closed loop, it would require an additional system that can measure pressure changes in the closed-loop system. By making the measurement device to test the system pressure at the heating-expected 02 researchers can monitor the pressure changes that occur in the system. The pressure gauge device fabrication using manufacturing simulation methodology, the preparation of the hardware and software and test functions. Manufacturing simulation using measuring devices HIOKI DC current source Signal Source, preparation of pressure measurement devices require hardware such as pressure transducers, NI cRIO-9074, NI 9203 analog module, Computer and software LabVIEW 2011 as programming. In the test process function method is used to provide flow simulation module that is connected to the 9203 NI NI cRIO-9074. Current provision tailored to the specifics pressure transducer is 4 mA s/d 20 mA. Based on the test results obtained function value of the lowest current is 4.00 mA = 0.001 bar, and the highest current value of 20.00 mA = 4995 bar. From the results of calculations using the linear equations obtained correlation coefficient (R 2 ) of 0.999, so it is evident that the pressure changes in LabVIEW is affected by changes in flow. The results obtained from this activity is a device that can measure the pressure in the heating-02 test. (author)

Statistical analysis of Japanese Thorotrast-administered autopsy cases--1980

Energy Technology Data Exchange (ETDEWEB)

Mori, T. (National Inst. of Radiological Sciences, Anagawa, Japan); Kato, Y.; Aoki, N.; Hatakeyama, S.

1983-01-01

In 193 cases autopsied between 1945 and 1980, all persons who had been intravascularly injected with Thorotrast in life, the authors found 131 malignant hepatic tumors, 20 liver cirrhoses, 6 myeloid leukemias, 4 erythroleukemias, 5 aplastic anemias, 4 lung cancers, 1 mesothelioma and 1 osteosarcoma. The causes of death in the Thorotrast-administered autopsy group (193 cases) were compared with those of a non-Thorotrast-administered autopsy group (95,000 cases) of the same sex and age at death as recorded in the Annals of Japanese Pathological Autopsy cases from 1958 to 1978. This comparison revealed that the frequencies of malignant hepatic tumors, liver cirrhosis, erythroleukemia, and aplastic anemia were significantly higher in the Thorotrast-administered group than in the non-Thorotrast-administered group.

Tritium ( 3 H) Retention In Mice: Administered As HTO, DTO or as 3 H-Labeled Amino-Acids.

Science.gov (United States)

Priest, Nicholas D; Blimkie, Melinda S J; Wyatt, Heather; Bugden, Michelle; Bannister, Laura A; Gueguen, Yann; Jourdain, Jean-Rene; Klokov, Dmitry

2017-05-01

The objective of this study was to compare the biokinetics of injected H-labeled light (HTO) and heavy (DTO) water in CBA/CaJ mice and to compare the organ distribution and/or body content of H administered by chronic ingestion for 1 mo to C57Bl/6J mice, as either H-labeled water or H-labeled amino acids (glycine, alanine and proline). HTO and DTO were administered to CBA/CaJ mice by single intraperitoneal injection and body retention was determined for up to 384 h post-injection. Tritium-labeled water or H-labeled amino acids were given to C57Bl/6J mice ad libitum for 30 d in drinking water. Body content and organ distribution of H during the period of administration and subsequent to administration was determined by liquid scintillation counting. No differences were found between the biokinetics of HTO and DTO, indicating that data generated using HTO can be used to help assess the consequences of H releases from heavy water reactors. The results for H-water showed that the concentration of radionuclide in the mice reached a peak after about 10 d and dropped rapidly after the cessation of H administration. The maximum concentration reached was only 50% of that in the water consumed, indicating that mice receive a significant fraction of their water from respiration. Contrary to the findings of others, the pattern of H retention following the administration of a cocktail of the labeled amino acids was very little different from that found for the water. This is consistent with the suggestion that most of the ingested amino acids were rapidly metabolized, releasing water and carbon dioxide.

Activities of radiopharmaceuticals administered for diagnostic and therapeutic procedures in nuclear medicine in Argentina: results of a national survey

International Nuclear Information System (INIS)

Bomben, Ana M.; Chiliutti, Claudia A.

2004-01-01

Nuclear medicine in Argentine is carried out at 292 centres, distributed all over the country, mainly concentrated in the capital cities of the provinces. With the purpose of knowing the activity levels of radiopharmaceuticals that were administered to patients for diagnostic and therapeutic procedures in nuclear medicine, a national survey was conducted, during 2001 and 2002. This survey was answered voluntarily by 107 centres. Sixty-four percent of the participants centres are equipped with SPECT system while the other centres have a gamma camera or scintiscanner. There were 37 nuclear medicine procedures, chosen among those most frequently performed, were included in the survey. In those diagnostic procedures were included tests for: bone, brain, thyroid, kidney, liver, lung and cardiovascular system; and also activities administered for some therapeutic procedures. The nuclear medicine physicians reported the different radiopharmaceutical activities administered to typical adult patients. In this paper are presented the average radiopharmaceutical activity administered for each of the diagnostic and therapeutic procedures included in the survey and the range and distribution of values. In order to place these data in a frame of reference, these average values were compared to the guidance levels for diagnostic procedures in nuclear medicine mentioned at the Safety Series no. 115. From this comparison it was noticed that the activities administered in the 40% of the diagnostic procedures included in the survey were between ±30% of the reference values. For those nuclear medicine procedures that could not be compared with the above mentioned guidance levels, the comparison was made with values published by UNSCEAR or standards recommended by international bodies. As a result of this study, it is important to point out the need to continue the gathering of data in a wider scale survey to increase the knowledge about national trends. It is also essential to widely

The AMS-02 experiment status

International Nuclear Information System (INIS)

Oliva, A.

2011-01-01

The Alpha Magnetic Spectrometer (AMS) is a high-energy physics experiment built to operate in space. The prototype of the AMS detector was AMS-01, fown in1998 on-board of the space shuttle Discovery (missionSTS-91). Starting from the experience acquired in the high successful AMS-01 mission the detector AMS-02 has been designed improving the AMS-01 energetic range, geometric acceptance and particle identifcation capabilities. In 2010 the AMS-02 detector has been validated for the space/scientifc operations by means of a wide test campaign(including beam tests, TVT test and EMI test). A major change in the design of AMS-02 has been decided after the thermo-vacuum test to extend as much aspossible the endurance of the experiment, profiting also of the extended endurance of the International Space Station (ISS) program toward 2020. The final AMS-02 configuration has been integrated during summer 2010, then tested on the H8 beam-line at CERN, and finally delivered to the launch site (Kennedy Space Center, Florida) at the end of August. AMS-02 is planned to be installed on the International Space Station in 2011 by the space shuttle Endeavour (mission STS-134).

Calorimetric investigation into interaction in Zr0.8Ti0.2CrFe-H2 system

International Nuclear Information System (INIS)

Sirotina, R.A.; Verbetskij, V.N.

1993-01-01

For studying Zr 0.8 Ti 0.2 CrFe-H 2 system is applied the calorimetric method with usage of the Tian-Calve type calorimeter. It is shown that up to 488 K in the system there are three characteristic regions: α (hydrogen solution in an intermetallic compounds (IMC)), β (hydrogen solution in a hydride) and α + β (region of coexistence of two phases). Temperature 448 K is near to critical one, when exceeding of which exists only hydrogen solution in a metal matrix. Pressure dependence of hydrogen content in IMC is described satisfactorily by a linear equation

Comparison of the PTSD Checklist (PCL) Administered via a Mobile Device Relative to a Paper Form.

Science.gov (United States)

Price, Matthew; Kuhn, Eric; Hoffman, Julia E; Ruzek, Josef; Acierno, Ron

2015-10-01

Mobile devices are increasingly used to administer self-report measures of mental health symptoms. There are significant differences, however, in the way that information is presented on mobile devices compared to the traditional paper forms that were used to administer such measures. Such differences may systematically alter responses. The present study evaluated if and how responses differed for a self-report measure, the PTSD Checklist (PCL), administered via mobile device relative to paper and pencil. Participants were 153 trauma-exposed individuals who completed counterbalanced administrations of the PCL on a mobile device and on paper. PCL total scores (d = 0.07) and item responses did not meaningfully or significantly differ across administrations. Power was sufficient to detect a difference in total score between administrations determined by prior work of 3.46 with a d = 0.23. The magnitude of differences between administration formats was unrelated to prior use of mobile devices or participant age. These findings suggest that responses to self-report measures administered via mobile device are equivalent to those obtained via paper and they can be used with experienced as well as naïve users of mobile devices. Copyright © 2015 Wiley Periodicals, Inc., A Wiley Company.

Training pharmacy technicians to administer immunizations.

Science.gov (United States)

McKeirnan, Kimberly C; Frazier, Kyle R; Nguyen, Maryann; MacLean, Linda Garrelts

To evaluate the effectiveness of an immunization training program for pharmacy technicians on technicians' self-reported confidence, knowledge, and number of vaccines administered. A one-group pre- and posttest study was conducted with certified pharmacy technicians from Albertsons and Safeway community pharmacies in Idaho. Thirty pharmacy technicians were recruited to participate in an immunization administration training program comprising a 2-hour home study and a 2-hour live training. Pharmacy technician scores on a 10-question knowledge assessment, responses on a pre- and posttraining survey, and number of immunizations administered in the 6-month period following the training were collected. Twenty-five pharmacy technicians completed the home study and live portions of the immunization training program. All 29 pharmacy technicians who took the home study assessment passed with greater than 70% competency on the first attempt. Technicians self-reported increased confidence with immunization skills between the pretraining survey and the posttraining survey. From December 2016 to May 2017, the technicians administered 953 immunizations with 0 adverse events reported. For the first time, pharmacy technicians have legally administered immunizations in the United States. Trained pharmacy technicians demonstrated knowledge of vaccination procedures and self-reported improved confidence in immunization skills and administered immunizations after participating in a 4-hour training program. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Computer-Administered Interviews and Rating Scales

Science.gov (United States)

Garb, Howard N.

2007-01-01

To evaluate the value of computer-administered interviews and rating scales, the following topics are reviewed in the present article: (a) strengths and weaknesses of structured and unstructured assessment instruments, (b) advantages and disadvantages of computer administration, and (c) the validity and utility of computer-administered interviews…

Development of a self-administered questionnaire to screen patients for cervical myelopathy

Directory of Open Access Journals (Sweden)

Sekiguchi Yasufumi

2010-11-01

Full Text Available Abstract Background In primary care, it is often difficult to diagnose cervical myelopathy. However, a delay in treatment could cause irreversible aftereffects. With a brief and effective self-administered questionnaire for cervical myelopathy, cervical myelopathy may be screened more easily and oversight may be avoided. As there is presently no screening tool for cervical myelopathy, the aim of this study was to develop a self-administered questionnaire for the screening of cervical myelopathy. Methods A case-control study was performed with the following two groups at our university hospital from February 2006 to September 2008. Sixty-two patients (48 men, 14 women with cervical myelopathy who underwent operative treatment were included in the myelopathy group. In the control group, 49 patients (20 men, 29 women with symptoms that could be distinguished from those of cervical myelopathy, such as numbness, pain in the upper extremities, and manual clumsiness, were included. The underlying conditions were diagnosed as carpal tunnel syndrome, cubital tunnel syndrome, thoracic outlet syndrome, tarsal tunnel syndrome, diabetes mellitus neuropathy, cervical radiculopathy, and neuralgic amyotrophy. Twenty items for a questionnaire in this study were chosen from the Japanese Orthopaedic Association Cervical Myelopathy Evaluation Questionnaire, which is a new self-administered questionnaire, as an outcome measure for patients with cervical myelopathy. Data were analyzed by univariate analysis using the chi-square test and by multiple logistic regression analysis. According to the resulting odds ratio, β-coefficients, and p value, items were chosen and assigned a score. Results Eight items were chosen by univariate and multiple logistic regression analyses and assigned a score. The Hosmer-Lemeshow statistic showed p = 0.805. The area under the receiver operation characteristic curve was 0.86. The developed questionnaire had a sensitivity of 93.5% and a

Analysis of standard problem six (Semiscale test S-02-6) data

International Nuclear Information System (INIS)

Cartmill, C.E.

1977-08-01

Test S-02-6 of the Semiscale Mod-1 blowdown heat transfer test series was conducted to supply data for the U.S. Nuclear Regulatory Commission Standard Problem Six. To determine the credibility of the data and thus establish the validity of Standard Problem Six, an analysis of the results of Test S-02-6 was performed and is presented. This analysis consisted of investigations of system hydraulic and core thermal data. The credibility of the system hydraulic data was investigated through comparisons of the data with data and calculations from related sources (Test S-02-4) and, when necessary, through assessment of physical events. The credibility of the core thermal data was based on a thorough analysis of physical events. The results of these investigations substantiate the validity of Test S-02-6 data

Township Administered Roads

Data.gov (United States)

Minnesota Department of Natural Resources — This data set contains roadway centerlines for township administered roads found on the USGS 1:24,000 mapping series. In some areas, these roadways are current...

The custodian administered research extract server: "improving the pipeline" in linked data delivery systems.

Science.gov (United States)

Eitelhuber, Tom; Davis, Geoff

2014-01-01

At Western Australia's Data Linkage Branch (DLB) the extraction of linked data has become increasingly complex over the past decade and classical methods of data delivery are unsuited to the larger extractions which have become the norm. The Custodian Administered Research Extract Server (CARES) is a fast, accurate and predictable approach to linked data extraction. The Data Linkage Branch (DLB) creates linkage keys within and between datasets. To comply with the separation principal, these keys are sent to applicable data collection agencies for extraction. Routing requests through multiple channels is inefficient and makes it hard to monitor work and predict delivery times. CARES was developed to address these shortcomings and involved ongoing consultation with the Custodians and staff of collections, plus challenges of hardware, programming, governance and security. The introduction of CARES has reduced the workload burden of linked data extractions, while improving the efficiency, stability and predictability of turnaround times. As the scope of a linkage system broadens, challenges in data delivery are inevitable. CARES overcomes multiple obstacles with no sacrifice to the integrity, confidentiality or security of data. CARES is a valuable component of linkage infrastructure that is operable at any scale and adaptable to many data environments.

Detrimental Effects of a Self-reward Contracting Program on Subjects' Involvement in Self-administered Desensitization

Science.gov (United States)

Barrera, Manuel Jr.; Rosen, Gerald M.

1977-01-01

Assesses a self-reward contracting procedure intended to facilitate completion of self-administered desensitization. Self-referred snake phobics received either (a) self-administered desensitization; (b) self-administered desensitization with self-reward contracting; or (c) a self-administered placebo with self-reward contracting. Results show the…

Nurse-administered propofol sedation for endoscopy

DEFF Research Database (Denmark)

Jensen, J T; Vilmann, P; Horsted, T

2011-01-01

The aim of the present study was to perform a risk analysis during the implementation phase of nurse-administered propofol sedation (NAPS) and to validate our structured training program.......The aim of the present study was to perform a risk analysis during the implementation phase of nurse-administered propofol sedation (NAPS) and to validate our structured training program....

Deep levels in as-grown and Si-implanted In(0.2)Ga(0.8)As-GaAs strained-layer superlattice optical guiding structures

Science.gov (United States)

Dhar, S.; Das, U.; Bhattacharya, P. K.

1986-01-01

Trap levels in about 2-micron In(0.2)Ga(0.8)As(94 A)/GaAs(25 A) strained-layer superlattices, suitable for optical waveguides, have been identified and characterized by deep-level transient spectroscopy and optical deep-level transient spectroscopy measurements. Several dominant electron and hole traps with concentrations of approximately 10 to the 14th/cu cm, and thermal ionization energies Delta-E(T) varying from 0.20 to 0.75 eV have been detected. Except for a 0.20-eV electron trap, which might be present in the In(0.2)Ga(0.8)As well regions, all the other traps have characteristics similar to those identified in molecular-beam epitaxial GaAs. Of these, a 0.42-eV hole trap is believed to originate from Cu impurities, and the others are probably related to native defects. Upon Si implantation and halogen lamp annealing, new deep centers are created. These are electron traps with Delta-E(T) = 0.81 eV and hole traps with Delta-E(T) = 0.46 eV. Traps occurring at room temperature may present limitations for optical devices.

Comparison of morphine and carprofen administered alone or in combination for analgesia in dogs undergoing ovariohysterectomy.

Science.gov (United States)

Dzikiti, T B; Joubert, K E; Venter, L J; Dzikiti, L N

2006-09-01

In this study the analgesic efficacy of the pure agonistic opioid morphine and the cyclo-oxygenase type-2-selective carprofen were compared since there is no previous specific comparative study for these two common analgesics. Forty-five bitches undergoing elective ovariohysterectomy were randomly assigned to one of three groups; receiving morphine 0.4 mg/kg bodyweight pre-operatively and 0.2 mg/kg every 4-6 hours thereafter (Morphine group), receiving a once-off carprofen 4 mg/kg injection (Carprofen group) or receiving both morphine and carprofen (MorphCarp group). The dogs were premedicated with acepromazine 0.01 mg/kg and induced with either thiopentone 5-10 mg/kg or propofol 4-6 mg/kg. General anaesthesia was maintained with halothane in oxygen. The degree of pain was assessed over a 24-hour period under blinded conditions using a pain scale modified from the University of Melbourne pain scale and the Glasgow composite pain tool. Physiological parameters such as respiratory rate, pulse rate and body temperature were also assessed over the same time period. There was no significant difference in pain-scores and thus analgesia offered by the three analgesia protocols at any assessment point across the three groups, but there were differences within groups across time points. Baseline total pain-scores were lower than scores at all post-operative points within all three groups. Both morphine and carprofen provided good analgesia without any obvious adverse effects. This study indicates that at the dosages indicated above, carprofen administered on its own produces analgesia equal to that produced by morphine and that the two drugs administered together do not produce better analgesia than either drug administered on its own.

Effect of packing on changes in erythrocyte osmotic fragility and malondialdehyde concentration in donkeys administered with ascorbic acid

OpenAIRE

Folashade Olaifa; Joseph O. Ayo; Suleiman F. Ambali; Peter I. Rekwot

2012-01-01

Experiments were performed with the aim of investigating the effect of packing on erythrocyte osmotic fragility (EOF) and malondialdehyde (MDA) concentration in donkeys, and the effect of ascorbic acid (AA). Twelve apparently healthy donkeys raised under the traditional extensive system served as experimental subjects. Six donkeys administered orally with AA (200 mg/kg) and subjected to packing were used as experimental animals, whilst six others not administered with AA served as contro...

LPSF/GQ-02 inhibits the development of hepatic steatosis and inflammation in a mouse model of non-alcoholic fatty liver disease (NAFLD).

Science.gov (United States)

Soares e Silva, Amanda Karolina; de Oliveira Cipriano Torres, Dilênia; dos Santos Gomes, Fabiana Oliveira; dos Santos Silva, Bruna; Lima Ribeiro, Edlene; Costa Oliveira, Amanda; dos Santos, Laise Aline Martins; de Lima, Maria do Carmo Alves; Pitta, Ivan da Rocha; Peixoto, Christina Alves

2015-01-01

Non-alcoholic fatty liver disease (NAFLD) defines a wide spectrum of liver diseases that extends from simple steatosis to non-alcoholic steatohepatitis. Although the pathogenesis of NAFLD remains undefined, it is recognized that insulin resistance is present in almost all patients who develop this disease. Thiazolidinediones (TZDs) act as an insulin sensitizer and have been used in the treatment of patients with type 2 diabetes and other insulin-resistant conditions, including NAFLD. Hence, therapy of NAFLD with insulin-sensitizing drugs should ideally improve the key hepatic histological changes, while also reducing cardiometabolic and cancer risks. Controversially, TZDs are associated with the development of cardiovascular events and liver problems. Therefore, there is a need for the development of new therapeutic strategies to improve liver function in patients with chronic liver diseases. The aim of the present study was to assess the therapeutic effects of LPSF/GQ-02 on the liver of LDLR-/- mice after a high-fat diet. Eighty male mice were divided into 4 groups and two different experiments: 1-received a standard diet; 2-fed with a high-fat diet (HFD); 3-HFD+pioglitazone; 4-HFD+LPSF/GQ-02. The experiments were conducted for 10 or 12 weeks and in the last two or four weeks respectively, the drugs were administered daily by gavage. The results obtained with an NAFLD murine model indicated that LPSF/GQ-02 was effective in improving the hepatic architecture, decreasing fat accumulation, reducing the amount of collagen, decreasing inflammation by reducing IL-6, iNOS, COX-2 and F4 / 80, and increasing the protein expression of IκBα, cytoplasmic NFκB-65, eNOS and IRS-1 in mice LDLR -/-. These results suggest a direct action by LPSF/GQ-02 on the factors that affect inflammation, insulin resistance and fat accumulation in the liver of these animals. Further studies are being conducted in our laboratory to investigate the possible mechanism of action of LPSF/GQ-02 on

Lay health worker experiences administering a multi-level combination intervention to improve PMTCT retention.

Science.gov (United States)

DiCarlo, Abby; Fayorsey, Ruby; Syengo, Masila; Chege, Duncan; Sirengo, Martin; Reidy, William; Otieno, Juliana; Omoto, Jackton; Hawken, Mark P; Abrams, Elaine J

2018-01-10

The recent scale-up of prevention of mother-to-child transmission of HIV (PMTCT) services has rapidly accelerated antiretroviral therapy (ART) uptake among pregnant and postpartum women in sub-Saharan Africa. The Mother and Infant Retention for Health (MIR4Health) study evaluates the impact of a combination intervention administered by trained lay health workers to decrease attrition among HIV-positive women initiating PMTCT services and their infants through 6 months postpartum. This was a qualitative study nested within the MIR4Health trial. MIR4Health was conducted at 10 health facilities in Nyanza, Kenya from September 2013 to September 2015. The trial intervention addressed behavioral, social, and structural barriers to PMTCT retention and included: appointment reminders via text and phone calls, follow-up and tracking for missed clinic visits, PMTCT health education at home visits and during clinic visits, and retention and adherence support and counseling. All interventions were administered by lay health workers. We describe results of a nested small qualitative inquiry which conducted two focus groups to assess the experiences and perceptions of lay health workers administering the interventions. Discussions were recorded and simultaneously transcribed and translated into English. Data were analyzed using framework analysis approach. Study findings show lay health workers played a critical role supporting mothers in PMTCT services across a range of behavioral, social, and structural domains, including improved communication and contact, health education, peer support, and patient advocacy and assistance. Findings also identified barriers to the uptake and implementation of the interventions, such as concerns about privacy and stigma, and the limitations of the healthcare system including healthcare worker attitudes. Overall, study findings indicate that lay health workers found the interventions to be feasible, acceptable, and well received by clients. Lay

45 CFR 400.66 - Eligibility and payment levels in a publicly-administered RCA program.

Science.gov (United States)

2010-10-01

... 45 Public Welfare 2 2010-10-01 2010-10-01 false Eligibility and payment levels in a publicly... REFUGEE RESETTLEMENT PROGRAM Refugee Cash Assistance § 400.66 Eligibility and payment levels in a publicly-administered RCA program. (a) In administering a publicly-administered refugee cash assistance program, the...

Ebola Vaccination Using a DNA Vaccine Coated on PLGA-PLL/γPGA Nanoparticles Administered Using a Microneedle Patch.

Science.gov (United States)

Yang, Hung-Wei; Ye, Ling; Guo, Xin Dong; Yang, Chinglai; Compans, Richard W; Prausnitz, Mark R

2017-01-01

Ebola DNA vaccine is incorporated into PLGA-PLL/γPGA nanoparticles and administered to skin using a microneedle (MN) patch. The nanoparticle delivery system increases vaccine thermostability and immunogenicity compared to free vaccine. Vaccination by MN patch produces stronger immune responses than intramuscular administration. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fast Dissemination of New HIV-1 CRF02/A1 Recombinants in Pakistan.

Directory of Open Access Journals (Sweden)

Yue Chen

Full Text Available A number of HIV-1 subtypes are identified in Pakistan by characterization of partial viral gene sequences. Little is known whether new recombinants are generated and how they disseminate since whole genome sequences for these viruses have not been characterized. Near full-length genome (NFLG sequences were obtained by amplifying two overlapping half genomes or next generation sequencing from 34 HIV-1-infected individuals in Pakistan. Phylogenetic tree analysis showed that the newly characterized sequences were 16 subtype As, one subtype C, and 17 A/G recombinants. Further analysis showed that all 16 subtype A1 sequences (47%, together with the vast majority of sequences from Pakistan from other studies, formed a tight subcluster (A1a within the subtype A1 clade, suggesting that they were derived from a single introduction. More in-depth analysis of 17 A/G NFLG sequences showed that five shared similar recombination breakpoints as in CRF02 (15% but were phylogenetically distinct from the prototype CRF02 by forming a tight subcluster (CRF02a while 12 (38% were new recombinants between CRF02a and A1a or a divergent A1b viruses. Unique recombination patterns among the majority of the newly characterized recombinants indicated ongoing recombination. Interestingly, recombination breakpoints in these CRF02/A1 recombinants were similar to those in prototype CRF02 viruses, indicating that recombination at these sites more likely generate variable recombinant viruses. The dominance and fast dissemination of new CRF02a/A1 recombinants over prototype CRF02 suggest that these recombinant have more adapted and may become major epidemic strains in Pakistan.

Fast Dissemination of New HIV-1 CRF02/A1 Recombinants in Pakistan

Science.gov (United States)

Chen, Yue; Hora, Bhavna; DeMarco, Todd; Shah, Sharaf Ali; Ahmed, Manzoor; Sanchez, Ana M.; Su, Chang; Carter, Meredith; Stone, Mars; Hasan, Rumina; Hasan, Zahra; Busch, Michael P.; Denny, Thomas N.; Gao, Feng

2016-01-01

A number of HIV-1 subtypes are identified in Pakistan by characterization of partial viral gene sequences. Little is known whether new recombinants are generated and how they disseminate since whole genome sequences for these viruses have not been characterized. Near full-length genome (NFLG) sequences were obtained by amplifying two overlapping half genomes or next generation sequencing from 34 HIV-1-infected individuals in Pakistan. Phylogenetic tree analysis showed that the newly characterized sequences were 16 subtype As, one subtype C, and 17 A/G recombinants. Further analysis showed that all 16 subtype A1 sequences (47%), together with the vast majority of sequences from Pakistan from other studies, formed a tight subcluster (A1a) within the subtype A1 clade, suggesting that they were derived from a single introduction. More in-depth analysis of 17 A/G NFLG sequences showed that five shared similar recombination breakpoints as in CRF02 (15%) but were phylogenetically distinct from the prototype CRF02 by forming a tight subcluster (CRF02a) while 12 (38%) were new recombinants between CRF02a and A1a or a divergent A1b viruses. Unique recombination patterns among the majority of the newly characterized recombinants indicated ongoing recombination. Interestingly, recombination breakpoints in these CRF02/A1 recombinants were similar to those in prototype CRF02 viruses, indicating that recombination at these sites more likely generate variable recombinant viruses. The dominance and fast dissemination of new CRF02a/A1 recombinants over prototype CRF02 suggest that these recombinant have more adapted and may become major epidemic strains in Pakistan. PMID:27973597

A 0.2 V Micro-Electromechanical Switch Enabled by a Phase Transition.

Science.gov (United States)

Dong, Kaichen; Choe, Hwan Sung; Wang, Xi; Liu, Huili; Saha, Bivas; Ko, Changhyun; Deng, Yang; Tom, Kyle B; Lou, Shuai; Wang, Letian; Grigoropoulos, Costas P; You, Zheng; Yao, Jie; Wu, Junqiao

2018-04-01

Micro-electromechanical (MEM) switches, with advantages such as quasi-zero leakage current, emerge as attractive candidates for overcoming the physical limits of complementary metal-oxide semiconductor (CMOS) devices. To practically integrate MEM switches into CMOS circuits, two major challenges must be addressed: sub 1 V operating voltage to match the voltage levels in current circuit systems and being able to deliver at least millions of operating cycles. However, existing sub 1 V mechanical switches are mostly subject to significant body bias and/or limited lifetimes, thus failing to meet both limitations simultaneously. Here 0.2 V MEM switching devices with ≳10 6 safe operating cycles in ambient air are reported, which achieve the lowest operating voltage in mechanical switches without body bias reported to date. The ultralow operating voltage is mainly enabled by the abrupt phase transition of nanolayered vanadium dioxide (VO 2 ) slightly above room temperature. The phase-transition MEM switches open possibilities for sub 1 V hybrid integrated devices/circuits/systems, as well as ultralow power consumption sensors for Internet of Things applications. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Two S-wave gap symmetry for single crystals of the superconductor BaFe1.8Co0.2As2

International Nuclear Information System (INIS)

Choi, Ki-Young; Kim, Soo Hyun; Choi, Changho; Jung, Myung-Hwa; Wang, X.F.; Chen, X.H.; Noh, Jae Dong; Lee, Sung-IK

2010-01-01

To clarify the gap structure of the iron-pnictide superconductors, we synthesized optimally doped single crystals of BaFe 1.8 Co 0.2 As 2 , which had a critical temperature, T c , of 23.6 K. The initial M-H curve was used to find the lower critical field, H c1 . The full range of the temperature dependence of H c1 was explained by using a two S-wave gap symmetry. We estimate the two gap as Δ 1 (0) = 1.64 ± 0.2 meV for the small gap and Δ 2 (0) = 6.20 ± 0.2 meV for the large gap.

Development of a separate tank with an electrolysis-dependent bacteria controlling system for the long term storage of potable water.

Science.gov (United States)

Ishizuka, Akinori; Tanji, Masataka; Hayashi, Nobuatsu; Wakabayashi, Akihiro; Tatsumoto, Hideki; Hotta, Kunimoto

2006-12-01

For the long term storage of tap water, we developed a separate type of tank (5 m3) equipped with an electrolysis system to control bacterial growth. The electrolysis conditions using 20A direct current and a water flow rate of 10 L/min were capable of producing available chlorine (AC) at the rate of 5-8mg/min and raising the AC level of the stored tap water by about 0.2 mg/kg within 20-30 min The electrolyzed tap water with 0.2 mg/kg AC showed a capability per ml of killing 10(5)-10(6) cfu of bacteria such as Escherichia coli and Pseudomonas aeruginosa within 15 sec. A 6-month trial operation of the storage system with an automatic electrolysis control to keep AC level ranging 0.2-0.4 mg/kg demonstrated that the system worked well for the stored tap water in suppressing bacterial growth as well as in keeping good potable quality with reference to the 46 parameters specified for Japanese tap water. Actually, the electrolysis treatment was administered intermittently with an interval of about two weeks. Thus we believe the developed system has good potential to secure a potable water supply not only in the occasion of emergencies but also in countries having problems in the supply of safe drinking water.

Al{sub 0.2}Ga{sub 0.8}As X-ray photodiodes for X-ray spectroscopy

Energy Technology Data Exchange (ETDEWEB)

Whitaker, M.D.C., E-mail: M.Whitaker@sussex.ac.uk; Lioliou, G.; Butera, S.; Barnett, A.M.

2016-12-21

Three custom-made Al{sub 0.2}Ga{sub 0.8}As p-i-n mesa X-ray photodiodes (200 µm diameter, 3 µm i layer) were electrically characterised and investigated for their response to illumination with soft X-rays from an {sup 55}Fe radioisotope X-ray source (Mn Kα = 5.9 keV; Mn Kβ = 6.49 keV). The AlGaAs photodiodes were shown to be suitable for photon counting X-ray spectroscopy at room temperature. When coupled to a custom-made low-noise charge-sensitive preamplifier, a mean energy resolution (as quantified by the full width at half maximum of the 5.9 keV photopeak) of 1.24 keV was measured at room temperature. Parameters such as the depletion width (1.92 µm at 10 V), charge trapping noise (61.7 e{sup −} rms ENC at 5 V, negligible at 10 V) and the electronic noise components (known dielectric noise (63.4 e{sup −} rms), series white noise (27.7 e{sup −} rms), parallel white noise (9.5 e{sup −} rms) and 1/f series noise (2.2 e{sup −} rms) at 10 V reverse bias) affecting the achieved energy resolution were computed. The estimated charge trapping noise and mean energy resolution were compared to similar materials (e.g. Al{sub 0.8}Ga{sub 0.2}As) previously reported, and discussed. These results are the first demonstration of photon counting X-ray spectroscopy with Al{sub 0.2}Ga{sub 0.8}As reported to date.

Effect of buffer thickness on properties of In0.8Ga0.2As/InP with two-step growth technique

International Nuclear Information System (INIS)

Zhang Tiemin; Miao Guoqing; Jin Yixin; Yu Shuzhen; Jiang Hong; Li Zhiming; Song Hang

2009-01-01

In 0.8 Ga 0.2 As was grown by low-pressure metalorganic chemical vapor deposition (LP-MOCVD) on InP(1 0 0) substrate with two-step growth technique. Effect of buffer thickness on crystalline quality, surface morphology, electrical property and stress of In 0.8 Ga 0.2 As epilayer was analyzed, and properties of the In 0.8 Ga 0.2 As epilayer were characterized by X-ray diffraction, scanning electron microscopy, Hall measurements and Raman scattering. The experiments showed that the properties of the In 0.8 Ga 0.2 As epilayer had close relation to the buffer thickness and the optimum buffer thickness was about 100 nm

Nurse-Administered, Gut-Directed Hypnotherapy in IBS: Efficacy and Factors Predicting a Positive Response.

Science.gov (United States)

Lövdahl, Jenny; Ringström, Gisela; Agerforz, Pia; Törnblom, Hans; Simrén, Magnus

2015-07-01

Hypnotherapy is an effective treatment in irritable bowel syndrome (IBS). It is often delivered by a psychotherapist and is costly and time consuming. Nurse-administered hypnotherapy could increase availability and reduce costs. In this study the authors evaluate the effectiveness of nurse-administered, gut-directed hypnotherapy and identify factors predicting treatment outcome. Eighty-five patients were included in the study. Participants received hypnotherapy by a nurse once/week for 12 weeks. Patients reported marked improvement in gastrointestinal (GI) and extra-colonic symptoms after treatment, as well as a reduction in GI-specific anxiety, general anxiety, and depression. Fifty-eight percent were responders after the 12 weeks treatment period, and of these 82% had a favorable clinical response already at week 6. Women were more likely than men to respond favorably to the treatment. Nurse-administered hypnotherapy is an effective treatment for IBS. Being female and reporting a favorable response to treatment by week 6 predicted a positive treatment response at the end of the 12 weeks treatment period.

Evaluation of candidate magnetohydrodynamic materials for the U-02 Phase III test

International Nuclear Information System (INIS)

Marchant, D.D.; Bates, J.L.

1978-06-01

As part of a cooperative U.S.--U.S.S.R. program, electrode and insulator materials tested at the Westinghouse Electrode Systems Test Facility in Pittsburgh, Pennsylvania, were evaluated. From this evaluation materials will be selected for use in the third phase of tests being conducted in the U-02 magnetohydrodynamics test facility in the Soviet Union. Electrode and insulator materials were examined with both an optical microscope and a scanning electron microscope. The cathodes were found to behave differently from the anodes; most notably, the cathodes showed greater potassium interaction. The lanthanum chromite-based electrodes (excluding those fabricated by plasma-spraying) are recommended for testing in the U-02 Phase III test. Hotpressed, fused-grained MgO and sintered MgAl 2 O 4 are recommended as insulator materials. The electrode attachment techniques used in the Westinghouse Tests were inadequate and need to be modified for the U-02 test

IBA levels and substrates in the rooting of UENF/CALIMAN 02 hybrid papaya minicuttings in a semi-hydroponic system

Directory of Open Access Journals (Sweden)

Márcio José Vieira de Oliveira

2018-02-01

Full Text Available Abstract Mini-cutting is a technique with large applications in various crops, mainly due to the increase in the percentage and quality of adventitious roots, reducing time for the formation of clonal seedlings. The aim of this study was to evaluate IBA levels and substrates on the rooting of UENF/CALIMAN 02 hybrid papaya mini-cuttings. To perform the experiment, papaya mini-cuttings were taken from mother plants grown in pots in greenhouse, induced to produce shoots through pruning and growth regulator applications. Mini-cuttings were fixed in vermiculite or coconut fiver substrates placed in alveolate trays with 4.5x4.5x5.0 cm cells, and styrofoam trays were placed in plastic trays where different IBA levels were added in a modified Hoagland solution. After 45 days, rooted buds were transplanted to plastic pots of 600 mL of volume with soil, sand, well-cured bovine fertilizer, in the proportion of 3:1:1, remaining for 45 days. When they were taken from pots, roots were carefully washed, and the length of shoots, length of the largest root, dried mass of shoots and radicular system and root percentage were measured. The experiment was set up in a randomized complete block 5 x 2 factorial design, with 5 IBA levels: 0; 2.5; 5.0; 7.5 and 10 mg L-1, two substrates: vermiculite and coconut fiber, three replicates, with six plants per replicate. IBA levels of 5.0 mg L-1 and substrate vermiculite are the most adequate for the rooting of ‘UENF/CALIMAN 02’ papaya mini-cuttings in semi-hydroponic system in alveolate styrofoam trays with 4.5x4.5x5.0 cm cells.

Dose reader CD-02

International Nuclear Information System (INIS)

Jakowiuk, A.; Kaluska, I.; Machaj, B.

2005-01-01

Dose Reader CD-02 is designed for measurement of dose from a long narrow band of dosimetric foil used for check up and control of electron beam dose during sterilization of materials and products on conveyor belt. Irradiated foil after processing (heating) is inserted into foil driving (moving) system and when the foil is moved across focused light beam the absorbed dose is measured and displayed at the same time at computer monitor (in form of a diagram). The absorbed dose is measured on the principle of light attenuation at selected light wavelength (foil absorbance is measured). (author)

Comparison of morphine and carprofen administered alone or in combination for analgesia in dogs undergoing ovariohysterectomy

Directory of Open Access Journals (Sweden)

T.B. Dzikiti

2006-06-01

Full Text Available In this study the analgesic efficacy of the pure agonistic opioid morphine and the cyclo-oxygenase type-2-selective carprofen were compared since there is no previous specific comparative study for these two common analgesics. Forty-five bitches undergoing elective ovariohysterectomy were randomly assigned to one of three groups; receiving morphine 0.4 mg/kg bodyweight pre-operatively and 0.2 mg/kg every 4-6 hours thereafter (Morphine group, receiving a once-off carprofen 4 mg/kg injection (Carprofen group or receiving both morphine and carprofen (MorphCarp group. The dogs were premedicated with acepromazine 0.01 mg/kg and induced with either thiopentone 5-10 mg/kg or propofol 4-6 mg/kg. General anaesthesia was maintained with halothane in oxygen. The degree of pain was assessed over a 24-hour period under blinded conditions using a pain scale modified from the University of Melbourne pain scale and the Glasgow composite pain tool. Physiological parameters such as respiratory rate, pulse rate and body temperature were also assessed over the same time period. There was no significant difference in pain-scores and thus analgesia offered by the three analgesia protocols at any assessment point across the three groups, but there were differences within groups across time points. Baseline total pain-scores were lower than scores at all post-operative points within all three groups. Both morphine and carprofen provided good analgesia without any obvious adverse effects. This study indicates that at the dosages indicated above, carprofen administered on its own produces analgesia equal to that produced by morphine and that the two drugs administered together do not produce better analgesia than either drug administered on its own.

40 CFR 52.02 - Introduction.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Introduction. 52.02 Section 52.02 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS General Provisions § 52.02 Introduction. (a) This part sets forth the...

Nurse administered propofol sedation for pulmonary endoscopies requires a specific protocol

DEFF Research Database (Denmark)

Jensen, Jeppe Thue; Banning, Anne-Marie; Clementsen, Paul

2012-01-01

This study provides an evaluation and risk analysis of propofol sedation for endoscopic pulmonary procedures according to our unit's "gastroenterologic nurse-administered propofol sedation (NAPS) guideline".......This study provides an evaluation and risk analysis of propofol sedation for endoscopic pulmonary procedures according to our unit's "gastroenterologic nurse-administered propofol sedation (NAPS) guideline"....

The effect of systemic antibiotics administered during the active phase of non-surgical periodontal therapy or after the healing phase: a systematic review.

Science.gov (United States)

Fritoli, Aretuza; Gonçalves, Cristiane; Faveri, Marcelo; Figueiredo, Luciene Cristina; Pérez-Chaparro, Paula Juliana; Fermiano, Daiane; Feres, Magda

2015-01-01

The aim of this systematic review was to compare the clinical effectiveness of systemic antibiotics administered in the active stage of periodontal treatment or after the healing phase. An electronic search was performed in the databases EMBASE, MEDLINE and Cochrane Central Register of Controlled Trials (CENTRAL), in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analysis (PRISMA) statement. A manual search of the reference list of selected studies and of review articles was also performed up to November 2013. Randomized Clinical Trials (RCT) that evaluated the systemic administration of antibiotics as adjuvants to scaling and root planning (SRP) at different phases of periodontal treatment were included. Systematic reviews and studies that evaluated subjects with systemic diseases and those that used subantimicrobial doses of antibiotics were excluded. The initial search identified 1,039 articles, of which seven were selected, and only one met the inclusion criteria. This study showed that subjects taking metronidazole and amoxicillin at the initial phase of treatment exhibited statistically significantly greater reduction in pocket depth and gain in clinical attachment level in initially deep sites (PD≥7 mm) than subjects taking antibiotics after healing (pantibiotic intake, at the healing phase. To date, only one short-term RCT has directly compared different moments of systemic antibiotics administration, as adjuncts to SRP, in the treatment of periodontitis. Although the results of this study suggested some benefits for antibiotics intake during the active phase of therapy, these findings need to be confirmed by larger placebo-controlled randomized clinical trials with longer follow-up periods.

Structural phase transition and multiferroic properties of Bi0.8A0.2Fe0.8Mn0.2O3 (A = Ca, Sr)

Science.gov (United States)

Rout, Jyoshna; Choudhary, R. N. P.

2018-05-01

The multiferroic BiFeO3 and Bi0.8A0.2Fe0.8Mn0.2O3 (A = Ca, Sr) have been synthesized using direct mechanosynthesis. Detailed investigations were made on the influence of Ca-Mn and Sr-Mn co-substitutions on the structure change, electric and magnetic properties of the BFO. Rietveld refinement on the XRD pattern of the modified samples clarifies the structural transition from R3c:H (parent BiFeO3) to the biphasic structure (R3c: H + Pnma). Scanning electron micrographs confirmed the polycrystalline nature of the materials and each of the microstructure comprised of uniformly distributed grains with less porosity. The dielectric measurements reveal that enhancement in dielectric properties due to the reduction of oxygen vacancies by substitutional ions. Studies of frequency-dependence of impedance and related parameters exhibit that the electrical properties of the materials are strongly dependent on temperature, and bear a good correlation with its microstructure. The bulk resistance (evaluated from impedance studies) is found to decrease with increasing temperature for all the samples. The alternating current (ac) conductivity spectra show a typical signature of an ionic conducting system, and are found to obey Jonscher's universal power law. Preliminary studies of magnetic characteristics of the samples reveal enhanced magnetization for Ca-Mn co-substituted sample. The magnetoelectric coefficient as the function of applied dc magnetizing field under fixed ac magnetic field 15.368 Oe is measured and this ME coefficient αME corresponds to induction of polarization by a magnetic field.

CAT - A Disk Cataloging System for the CP/M Operating System.

Science.gov (United States)

1980-08-04

MAC KM80 C02 sCQcwr *MAC MACROSO XC02 SCIN *MAC MACROSO XC02 SCIO, MAC M9CRO80 *C02 scLOIJT .*? AC M9LCRO80 XC02 44 CAT Interrupted 44 Chipter 5 -Page 6...7 A A088 167 ARMY SATELLITE COMMUNICATIONS AGENCY FORT MONMOUTH N.J F/S 9/2 CAT - A DISK CATALOGING SYSTEM FOR THE CP/ OPERATING SYSTEM.(U) UG 80...RECIPIENT’S CATALOG NUMBER 4. TITLE (and Subtitle) 5. TYPE OF REPORT & PERIOD COVERED S atsk Cat oging System for theP/M Final ..a.St. 6. PERFORMING ORG

Pharmacokinetics of the injectable formulation of methadone hydrochloride administered orally in horses.

Science.gov (United States)

Linardi, R L; Stokes, A M; Barker, S A; Short, C; Hosgood, G; Natalini, C C

2009-10-01

Methadone hydrochloride is a synthetic mu-opioid receptor agonist with potent analgesic properties. Oral methadone has been successfully used in human medicine and may overcome some limitations of other analgesics in equine species for producing analgesia with minimal adverse effects. However, there are no studies describing the pharmacokinetics (PK) of oral opioids in horses. The aim of this study was to describe the PK of orally administered methadone (0.1, 0.2 and 0.4 mg/kg) and physical effects in 12 healthy adult horses. Serum methadone concentrations were measured by gas chromatography/mass spectrometry at predetermined time points for 24 h, and PK parameters were estimated using a noncompartmental model. Physical effects were observed and recorded by experienced clinicians. No drug toxicity, behavioural or adverse effects were observed in the horses. The disposition of methadone followed first order elimination and a biphasic serum profile with rapid absorption and elimination phases. The PK profile of methadone was characterized by high clearance (Cl/F), small volume of distribution (V(d)/F) and short elimination half-life (t(1/2)). The mean of the estimated t(1/2) (SD) for each dose (0.1, 0.2 and 0.4 mg/kg) was 2.2 (35.6), 1.3 (46.1) and 1.5 (40.8), and the mean for the estimated C(max) (SD) was 33.9 (6.7), 127.9 (36.0) and 193.5 (65.8) respectively.

Insights into long-lasting protection induced by RTS,S/AS02A malaria vaccine: further results from a phase IIb trial in Mozambican children.

Directory of Open Access Journals (Sweden)

Caterina Guinovart

Full Text Available The pre-erythrocytic malaria vaccine RTS,S/AS02A has shown to confer protection against clinical malaria for at least 21 months in a trial in Mozambican children. Efficacy varied between different endpoints, such as parasitaemia or clinical malaria; however the underlying mechanisms that determine efficacy and its duration remain unknown. We performed a new, exploratory analysis to explore differences in the duration of protection among participants to better understand the protection afforded by RTS,S.The study was a Phase IIb double-blind, randomized controlled trial in 2022 children aged 1 to 4 years. The trial was designed with two cohorts to estimate vaccine efficacy against two different endpoints: clinical malaria (cohort 1 and infection (cohort 2. Participants were randomly allocated to receive three doses of RTS,S/AS02A or control vaccines. We did a retrospective, unplanned sub-analysis of cohort 2 data using information collected for safety through the health facility-based passive case detection system. Vaccine efficacy against clinical malaria was estimated over the first six-month surveillance period (double-blind phase and over the following 12 months (single-blind phase, and analysis was per-protocol. Adjusted vaccine efficacy against first clinical malaria episodes in cohort 2 was of 35.4% (95% CI 4.5-56.3; p = 0.029 over the double-blind phase and of 9.0% (-30.6-36.6; p = 0.609 during the single-blind phase.Contrary to observations in cohort 1, where efficacy against clinical malaria did not wane over time, in cohort 2 the efficacy decreases with time. We hypothesize that this reduced duration of protection is a result of the early diagnosis and treatment of infections in cohort 2 participants, preventing sufficient exposure to asexual-stage antigens. On the other hand, the long-term protection against clinical disease observed in cohort 1 may be a consequence of a prolonged exposure to low-dose blood-stage asexual parasitaemia

NCBI nr-aa BLAST: CBRC-DMEL-02-0080 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-DMEL-02-0080 ref|NP_622419.1| Ribose/xylose/arabinose/galactoside ABC-type transport systems...inose/galactoside ABC-type transport systems, permease components [Thermoanaerobacter tengcongensis MB4] NP_622419.1 0.92 33% ...

The construction and space qualification of the control electronics for the tracker detector cooling system of the AMS-02 experiment

International Nuclear Information System (INIS)

Menichelli, M.; Accardo, L.; Alberti, G.; Bardet, M.; Battiston, R.; Blasko, S.; He, Z.; Koutsenko, V.; Lebedev, A.; Ni, J.; Papi, A.; Pauw, A.; Van Ess, J.; Wang, Z.; Zhang, D.; Zwartbol, T.

2010-01-01

This article describes the control electronics for the silicon tracker cooling system in the AMS-02 apparatus. It also contains a brief description of the cooling system itself necessary for the description of the electronics. The tracker cooling system includes a set of various sensors and actuators which are necessary for bringing the tracker detector to a uniform temperature at which it can operate correctly. In order to test the system performing the various qualification activities we have built also an Electronic Ground support equipment (EGSE). The EGSE should simulate the behaviour of all sensors and actuators previously mentioned.

Selection of a radon level corresponding to 0.02 WL

International Nuclear Information System (INIS)

Haywood, L.R.

1980-01-01

The Atomic Energy Control Board requires that the concentration of radon daughters in occupied structures in communities associated with nuclear facilities be less than 0.02 working level. The AECB has been interested in using measurements of radon concentration rather than of working level for compliance at 0.02 WL. It has been found, however, that there is no radon concentration which corresponds to 0.02 WL over a typical range of field conditions. This is principally due to the range of physical characteristics of structures, heating methods, living habits and of outdoor temperatures that may be encountered. A radon level of 2.4 pCi/l would indicate 95 percent of the instances at the three towns studied when working level exceeded 0.02

Evaluation of web-based, self-administered, graphical food frequency questionnaire.

Science.gov (United States)

Kristal, Alan R; Kolar, Ann S; Fisher, James L; Plascak, Jesse J; Stumbo, Phyllis J; Weiss, Rick; Paskett, Electra D

2014-04-01

Computer-administered food frequency questionnaires (FFQs) can address limitations inherent in paper questionnaires by allowing very complex skip patterns, portion size estimation based on food pictures, and real-time error checking. We evaluated a web-based FFQ, the Graphical Food Frequency System (GraFFS). Participants completed the GraFFS, six telephone-administered 24-hour dietary recalls over the next 12 weeks, followed by a second GraFFS. Participants were 40 men and 34 women, aged 18 to 69 years, living in the Columbus, OH, area. Intakes of energy, macronutrients, and 17 micronutrients/food components were estimated from the GraFFS and the mean of all recalls. Bias (second GraFFS minus recalls) was -9%, -5%, +4%, and -4% for energy and percentages of energy from fat, carbohydrate, and protein, respectively. De-attenuated, energy-adjusted correlations (intermethod reliability) between the recalls and the second GraFFS for fat, carbohydrate, protein, and alcohol were 0.82, 0.79, 0.67, and 0.90, respectively; for micronutrients/food components the median was 0.61 and ranged from 0.40 for zinc to 0.92 for beta carotene. The correlations between the two administrations of the GraFFS (test-retest reliability) for fat, carbohydrate, protein, and alcohol were 0.60, 0.63, 0.73, and 0.87, respectively; among micronutrients/food components the median was 0.67 and ranged from 0.49 for vitamin B-12 to 0.82 for fiber. The measurement characteristics of the GraFFS were at least as good as those reported for most paper FFQs, and its high intermethod reliability suggests that further development of computer-administered FFQs is warranted. Copyright © 2014 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

Route and Type of Formulation Administered Influences the Absorption and Disposition of Vitamin B12 Levels in Serum

Directory of Open Access Journals (Sweden)

Luis Vitetta

2018-01-01

Full Text Available The administration of biological compounds that optimize health benefits is an ever-evolving therapeutic goal. Pharmaceutical and other adjunctive biological compounds have been administered via many different routes in order to produce a systemic pharmacological effect. The article summarizes the findings from an Australian comparative study in adults administered vitamin B12 through different oral delivery platforms. A total of 16 subjects (9 males, 7 females voluntarily partook in a comparative clinical study of five different vitamin B12 formulations across a six-month period, completing 474 person-hours of cumulative contribution, that was equivalent to an n = 60 participation. A nanoparticle delivered vitamin B12 through a NanoCelle platform was observed to be significantly (p < 0.05 better absorbed than all other dose equivalent platforms (i.e., tablets, emulsions, or liposomes from baseline to 1, 3, and 6 h of the study period. The nanoparticle platform delivered vitamin B12 demonstrated an enhanced and significant absorption profile as exemplified by rapid systemic detection (i.e., 1 h from baseline when administered to the oro-buccal mucosa with no reports of any adverse events of toxicity. The nanoparticle formulation of methylcobalamin (1000 µg/dose in 0.3 mL volume showed bioequivalence only with a chewable-dissolvable tablet that administered a five times higher dose of methylcobalamin (5000 µg per tablet. This study has demonstrated that an active metabolite embedded in a functional biomaterial (NanoCelle may constitute a drug delivery method that can better access the circulatory system.

Composite Fe - BaCe0.2Zr0.6Y0.2O2.9 Anodes for Proton Conductor Fuel Cells

DEFF Research Database (Denmark)

Lapina, Alberto; Chatzichristodoulou, Christodoulos; Holtappels, Peter

2014-01-01

Symmetrical cells with Fe - BaCe0.2Zr0.6Y0.2O2.9 composite electrodes are produced by screen printing and infiltration, using BaCe0.2Zr0.6Y0.2O2.9 as electrolyte. The electrochemical performance of the composite electrode is studied by impedance spectroscopy at 250–500◦C in dry and wet hydrogen/n...

The effect of systemic antibiotics administered during the active phase of non-surgical periodontal therapy or after the healing phase: a systematic review

Directory of Open Access Journals (Sweden)

Aretuza FRITOLI

2015-06-01

Full Text Available Objective The aim of this systematic review was to compare the clinical effectiveness of systemic antibiotics administered in the active stage of periodontal treatment or after the healing phase. Material and Methods An electronic search was performed in the databases EMBASE, MEDLINE and Cochrane Central Register of Controlled Trials (CENTRAL, in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analysis (PRISMA statement. A manual search of the reference list of selected studies and of review articles was also performed up to November 2013. Randomized Clinical Trials (RCT that evaluated the systemic administration of antibiotics as adjuvants to scaling and root planning (SRP at different phases of periodontal treatment were included. Systematic reviews and studies that evaluated subjects with systemic diseases and those that used subantimicrobial doses of antibiotics were excluded. Results The initial search identified 1,039 articles, of which seven were selected, and only one met the inclusion criteria. This study showed that subjects taking metronidazole and amoxicillin at the initial phase of treatment exhibited statistically significantly greater reduction in pocket depth and gain in clinical attachment level in initially deep sites (PD≥7 mm than subjects taking antibiotics after healing (p<0.05. This comparison was conducted 2 months after antibiotic intake, at the healing phase. Conclusion To date, only one short-term RCT has directly compared different moments of systemic antibiotics administration, as adjuncts to SRP, in the treatment of periodontitis. Although the results of this study suggested some benefits for antibiotics intake during the active phase of therapy, these findings need to be confirmed by larger placebo-controlled randomized clinical trials with longer follow-up periods.

The effect of systemic antibiotics administered during the active phase of non-surgical periodontal therapy or after the healing phase: a systematic review

Science.gov (United States)

FRITOLI, Aretuza; GONÇALVES, Cristiane; FAVERI, Marcelo; FIGUEIREDO, Luciene Cristina; PÉREZ-CHAPARRO, Paula Juliana; FERMIANO, Daiane; FERES, Magda

2015-01-01

Objective The aim of this systematic review was to compare the clinical effectiveness of systemic antibiotics administered in the active stage of periodontal treatment or after the healing phase. Material and Methods An electronic search was performed in the databases EMBASE, MEDLINE and Cochrane Central Register of Controlled Trials (CENTRAL), in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analysis (PRISMA) statement. A manual search of the reference list of selected studies and of review articles was also performed up to November 2013. Randomized Clinical Trials (RCT) that evaluated the systemic administration of antibiotics as adjuvants to scaling and root planning (SRP) at different phases of periodontal treatment were included. Systematic reviews and studies that evaluated subjects with systemic diseases and those that used subantimicrobial doses of antibiotics were excluded. Results The initial search identified 1,039 articles, of which seven were selected, and only one met the inclusion criteria. This study showed that subjects taking metronidazole and amoxicillin at the initial phase of treatment exhibited statistically significantly greater reduction in pocket depth and gain in clinical attachment level in initially deep sites (PD≥7 mm) than subjects taking antibiotics after healing (pantibiotic intake, at the healing phase. Conclusion To date, only one short-term RCT has directly compared different moments of systemic antibiotics administration, as adjuncts to SRP, in the treatment of periodontitis. Although the results of this study suggested some benefits for antibiotics intake during the active phase of therapy, these findings need to be confirmed by larger placebo-controlled randomized clinical trials with longer follow-up periods. PMID:26221918

The SNL100-02 blade :

Energy Technology Data Exchange (ETDEWEB)

Griffith, Daniel

2013-11-01

A series of design studies are performed to investigate the effects of advanced core materials and a new core material strategy on blade weight and performance for large blades using the Sandia 100-meter blade designs as a starting point. The initial core material design studies were based on the SNL100-01 100- meter carbon spar design. Advanced core material with improved performance to weight was investigated with the goal to reduce core material content in the design and reduce blade weight. A secondary element of the core study was to evaluate the suitability of core materials from natural, regrowable sources such as balsa and recyclable foam materials. The new core strategy for the SNL100-02 design resulted in a design mass of 59 tons, which is a 20% reduction from the most recent SNL100-01 carbon spar design and over 48% reduction from the initial SNL100-00 all-glass baseline blade. This document provides a description of the final SNL100-02 design, includes a description of the major design modifications, and summarizes the pertinent blade design information. This document is also intended to be a companion document to the distribution of the NuMAD blade model files for SNL100-02 that are made publicly available.

Lipid profile and atherogenic predictor indices of albino rabbits administered coconut water as antidote to paracetamol overdose

Directory of Open Access Journals (Sweden)

Chidi Uzoma Igwe

2016-11-01

Full Text Available Objective: To investigate the effects of coconut water intake on lipid profile and atherogenic predictor indices of albino rabbits overdosed with paracetamol using standard methods. Methods: Thirty-five albino rabbits weighing between 800–1200 g and aged between 2 and 3 months, were divided into 7 groups (I–VII of 5 animals each. Groups I, II and III were orally administered distilled water (20 mL/kg body weight, coconut water (20 mL/kg body weight and paracetamol (1000 mg/kg body weight respectively, for 7 days. Groups IV and V were administered coconut water (20 mL/kg body weight and silymarin (35 mg/kg body weight, respectively, for 6 days, then paracetamol (1000 mg/kg body weight on the 7th day. Groups VI and VII were administered distilled water for 6 days, paracetamol on the 7th day, then coconut water and silymarin, respectively, after 3 h. Results: The results showed that paracetamol overdose significantly reduced (P < 0.05 the mean body weight of the animals, increased the concentrations of serum total cholesterol, triacylglycerol, very low density lipoprotein cholesterol, low density lipoprotein cholesterol and the atherogenic predictor indices but reduced the serum high density lipoprotein cholesterol concentration of the animals relative to the control. The observed changes in the lipid profile and atherogenic predictor indices were countered more by post- than pre-treatment with coconut water and silymarin. Conclusions: The results indicated that coconut water acted as an effective antidote to paracetamol overdose-induced lipid abnormality in animals.

Portable upper extremity robotics is as efficacious as upper extremity rehabilitative therapy: a randomized controlled pilot trial.

Science.gov (United States)

Page, Stephen J; Hill, Valerie; White, Susan

2013-06-01

To compare the efficacy of a repetitive task-specific practice regimen integrating a portable, electromyography-controlled brace called the 'Myomo' versus usual care repetitive task-specific practice in subjects with chronic, moderate upper extremity impairment. Sixteen subjects (7 males; mean age 57.0 ± 11.02 years; mean time post stroke 75.0 ± 87.63 months; 5 left-sided strokes) exhibiting chronic, stable, moderate upper extremity impairment. Subjects were administered repetitive task-specific practice in which they participated in valued, functional tasks using their paretic upper extremities. Both groups were supervised by a therapist and were administered therapy targeting their paretic upper extremities that was 30 minutes in duration, occurring 3 days/week for eight weeks. One group participated in repetitive task-specific practice entirely while wearing the portable robotic, while the other performed the same activity regimen manually. The upper extremity Fugl-Meyer, Canadian Occupational Performance Measure and Stroke Impact Scale were administered on two occasions before intervention and once after intervention. After intervention, groups exhibited nearly identical Fugl-Meyer score increases of ≈2.1 points; the group using robotics exhibited larger score changes on all but one of the Canadian Occupational Performance Measure and Stroke Impact Scale subscales, including a 12.5-point increase on the Stroke Impact Scale recovery subscale. Findings suggest that therapist-supervised repetitive task-specific practice integrating robotics is as efficacious as manual practice in subjects with moderate upper extremity impairment.

Nurse-administered propofol sedation for endoscopy

DEFF Research Database (Denmark)

Jensen, J T; Vilmann, P; Horsted, T

2011-01-01

BACKGROUND AND STUDY AIMS: The aim of the present study was to perform a risk analysis during the implementation phase of nurse-administered propofol sedation (NAPS) and to validate our structured training program. PATIENTS AND METHODS: A structured training program was developed both for endosco......BACKGROUND AND STUDY AIMS: The aim of the present study was to perform a risk analysis during the implementation phase of nurse-administered propofol sedation (NAPS) and to validate our structured training program. PATIENTS AND METHODS: A structured training program was developed both...... pressure was recorded in 451 patients (26%). Independent risk factors were type of intervention and level of experience of the staff performing the sedation. CONCLUSION: These results were obtained after development of a structured training program both for endoscopists and nurses using propofol...... for sedation, and can be used as basis for further comparison. NAPS for endoscopic procedures is safe when performed by personnel properly trained in airway handling and sedation with propofol, and has considerable advantages compared with conventional sedation for endoscopy....

Fossil-Fuel C02 Emissions Database and Exploration System

Science.gov (United States)

Krassovski, M.; Boden, T.

2012-04-01

Fossil-Fuel C02 Emissions Database and Exploration System Misha Krassovski and Tom Boden Carbon Dioxide Information Analysis Center Oak Ridge National Laboratory The Carbon Dioxide Information Analysis Center (CDIAC) at Oak Ridge National Laboratory (ORNL) quantifies the release of carbon from fossil-fuel use and cement production each year at global, regional, and national spatial scales. These estimates are vital to climate change research given the strong evidence suggesting fossil-fuel emissions are responsible for unprecedented levels of carbon dioxide (CO2) in the atmosphere. The CDIAC fossil-fuel emissions time series are based largely on annual energy statistics published for all nations by the United Nations (UN). Publications containing historical energy statistics make it possible to estimate fossil-fuel CO2 emissions back to 1751 before the Industrial Revolution. From these core fossil-fuel CO2 emission time series, CDIAC has developed a number of additional data products to satisfy modeling needs and to address other questions aimed at improving our understanding of the global carbon cycle budget. For example, CDIAC also produces a time series of gridded fossil-fuel CO2 emission estimates and isotopic (e.g., C13) emissions estimates. The gridded data are generated using the methodology described in Andres et al. (2011) and provide monthly and annual estimates for 1751-2008 at 1° latitude by 1° longitude resolution. These gridded emission estimates are being used in the latest IPCC Scientific Assessment (AR4). Isotopic estimates are possible thanks to detailed information for individual nations regarding the carbon content of select fuels (e.g., the carbon signature of natural gas from Russia). CDIAC has recently developed a relational database to house these baseline emissions estimates and associated derived products and a web-based interface to help users worldwide query these data holdings. Users can identify, explore and download desired CDIAC

40 CFR 62.02 - Introduction.

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Introduction. 62.02 Section 62.02 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPROVAL AND PROMULGATION OF STATE PLANS FOR DESIGNATED FACILITIES AND POLLUTANTS General Provisions § 62.02 Introduction...

Magnetic resonance imaging of lateral epicondylitis of the elbow with a 0.2-T dedicated system

Energy Technology Data Exchange (ETDEWEB)

Steinborn, M.; Heuck, A.; Bonel, H.; Reiser, M. [Department of Radiology, Ludwig Maximilians Univ., Muenchen (Germany); Jessel, C. [Department of Orthopedics, Ludwig Maximilians Univ., Muenchen (Germany)

1999-09-01

The purpose of this study was to evaluate MR imaging findings of the common extensor tendon in patients with lateral epicondylitis and asymptomatic volunteers studied on a 0.2-T dedicated system. In 23 patients (age range 29-58 years, mean age 47 years) with clinical symptoms of lateral epicondylitis MR imaging was performed using T1-, T2- and contrast-enhanced T1-weighted spin-echo sequences. In addition, the elbows of seven healthy volunteers (age range 22-29 years, mean age 25 years) and the symptom-free contralateral elbow of 11 of the 23 patients (age range 29-58 years, mean age 47 years) were studied as controls. Five patients were surgically treated after the MR examination and the results of histopathology were correlated with MR findings. Of the patients, 95.6 % showed intratendinous signal intensity changes on T1-weighted images on the symptomatic side. In 69.6 % signal alterations were observed on T2-weighted sequences and in 56.5 % an intratendinous contrast enhancement was present. Histopathology showed fibrovascular proliferation and fatty degeneration in patients with distinct signal intensity changes and contrast enhancement. Patients with only minor signal intensity changes on T1- and T2-weighted sequences and no contrast enhancement demonstrated fibrosclerotic degeneration and intratendinous cartilage formation in histopathology. The contralateral elbow showed signal intensity changes in 6 of 11 (54.5 %) cases on T1-weighted images and in 3 of 11 (27.3 %) on T2-weighted images. In the group of healthy volunteers minor signal intensity changes of the common extensor tendon could be seen in only 1 case. In patients with lateral epicondylitis of the elbow the type and extent of pathologic changes within the common extensor tendon can be evaluated using a dedicated low-field MR system. On the basis of MR imaging findings a more specified therapy planning among the variety of treatment modalities can be achieved. (orig.) With 3 figs., 5 tabs., 15 refs.

Magnetic resonance imaging of lateral epicondylitis of the elbow with a 0.2-T dedicated system

International Nuclear Information System (INIS)

Steinborn, M.; Heuck, A.; Bonel, H.; Reiser, M.; Jessel, C.

1999-01-01

The purpose of this study was to evaluate MR imaging findings of the common extensor tendon in patients with lateral epicondylitis and asymptomatic volunteers studied on a 0.2-T dedicated system. In 23 patients (age range 29-58 years, mean age 47 years) with clinical symptoms of lateral epicondylitis MR imaging was performed using T1-, T2- and contrast-enhanced T1-weighted spin-echo sequences. In addition, the elbows of seven healthy volunteers (age range 22-29 years, mean age 25 years) and the symptom-free contralateral elbow of 11 of the 23 patients (age range 29-58 years, mean age 47 years) were studied as controls. Five patients were surgically treated after the MR examination and the results of histopathology were correlated with MR findings. Of the patients, 95.6 % showed intratendinous signal intensity changes on T1-weighted images on the symptomatic side. In 69.6 % signal alterations were observed on T2-weighted sequences and in 56.5 % an intratendinous contrast enhancement was present. Histopathology showed fibrovascular proliferation and fatty degeneration in patients with distinct signal intensity changes and contrast enhancement. Patients with only minor signal intensity changes on T1- and T2-weighted sequences and no contrast enhancement demonstrated fibrosclerotic degeneration and intratendinous cartilage formation in histopathology. The contralateral elbow showed signal intensity changes in 6 of 11 (54.5 %) cases on T1-weighted images and in 3 of 11 (27.3 %) on T2-weighted images. In the group of healthy volunteers minor signal intensity changes of the common extensor tendon could be seen in only 1 case. In patients with lateral epicondylitis of the elbow the type and extent of pathologic changes within the common extensor tendon can be evaluated using a dedicated low-field MR system. On the basis of MR imaging findings a more specified therapy planning among the variety of treatment modalities can be achieved. (orig.)

Informationally administered reward enhances intrinsic motivation in schizophrenia.

Science.gov (United States)

Lee, Hyeon-Seung; Jang, Seon-Kyeong; Lee, Ga-Young; Park, Seon-Cheol; Medalia, Alice; Choi, Kee-Hong

2017-10-01

Even when individuals with schizophrenia have an intact ability to enjoy rewarding moments, the means to assist them to translate rewarding experiences into goal-directed behaviors is unclear. The present study sought to determine whether informationally administered rewards enhance intrinsic motivation to foster goal-directed behaviors in individuals with schizophrenia (SZ) and healthy controls (HCs). Eighty-four participants (SZ=43, HCs=41) were randomly assigned to conditions involving either a performance-contingent reward with an informationally administered reward or a task-contingent reward with no feedback. Participants were asked to play two cognitive games of equalized difficulty. Accuracy, self-reported intrinsic motivation, free-choice intrinsic motivation (i.e., game play during a free-choice observation period), and perceived competency were measured. Intrinsic motivation and perceived competency in the cognitive games were similar between the two participant groups. The informationally administered reward significantly enhanced self-reported intrinsic motivation and perceived competency in both the groups. The likelihood that individuals with schizophrenia would play the game during the free-choice observation period was four times greater in the informationally administered reward condition than that in the no-feedback condition. Our findings suggest that, in the context of cognitive remediation, individuals with schizophrenia would benefit from informationally administered rewards. Copyright © 2017 Elsevier B.V. All rights reserved.

40 CFR 191.02 - Definitions.

Science.gov (United States)

2010-07-01

... TRANSURANIC RADIOACTIVE WASTES Environmental Standards for Management and Storage § 191.02 Definitions. Unless... process associated with the management and storage of spent nuclear fuel or radioactive waste is conducted... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Definitions. 191.02 Section 191.02...

78 FR 69516 - DeltaPoint Capital IV, L.P.; License No. 02/02-0662; Notice Seeking Exemption Under the Small...

Science.gov (United States)

2013-11-19

... Business Investment Act of 1958, as amended (``the Act''), in connection with the financing of a small... SMALL BUSINESS ADMINISTRATION DeltaPoint Capital IV, L.P.; License No. 02/02-0662; Notice Seeking Exemption Under the Small Business Investment Act, Conflicts of Interest Notice is hereby given that Delta...

NCBI nr-aa BLAST: CBRC-MDOM-02-0387 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-MDOM-02-0387 ref|YP_002730825.1| oligopeptide transport system permease protein AppB [Persephone...lla marina EX-H1] gb|ACO04361.1| oligopeptide transport system permease protein AppB [Persephonella marina EX-H1] YP_002730825.1 0.47 27% ...

Disposal of wastes from radiopharmaceuticals administered in human body in hospital

International Nuclear Information System (INIS)

Kaneko, Masao

1976-01-01

Radiopharmaceuticals used in hospitals have remarkably increased in amount. Among radioactive matters discharged from pharmaceuticals administered into human bodies, a small amount of radio-pharmaceuticals remained in disporsable containers and syringes, excreta from patients administered such drugs and their washing, may cause the problems, radioisotopes with short half-life such as sup(99m)Tc tend to be administered increasingly while radioisotopes with long life have been decreasing. Long life radioactive wastes and short life wastes have to be strictly separated. And then long life radioisotopes wastes have to be condensed and stored, less than a tenth of the maximum allowable density after decay to discharge. Radioactive gas as 133 Xe should be diffused by ventilation. This is the time to make the numerical guide concerning the problem. (Kobatake, H.)

Standardization of D2 lymphadenectomy and surgical quality control (KLASS-02-QC): a prospective, observational, multicenter study [NCT01283893

International Nuclear Information System (INIS)

Kim, Hyoung-Il; Hur, Hoon; Kim, Youn Nam; Lee, Hyuk-Joon; Kim, Min-Chan; Han, Sang-Uk; Hyung, Woo Jin

2014-01-01

Extended systemic lymphadenectomy (D2) is standard procedure for surgical treatment of advanced gastric cancer (AGC) although less extensive lymphadenectomy (D1) can be applied to early gastric cancer. Complete D2 lymphadenectomy is the mandatory procedure for studies that evaluate surgical treatment results of AGC. However, the actual extent of D2 lymphadenectomy varies among surgeons because of a lacking consensus on the anatomical definition of each lymph node station. This study is aimed to develop a consensus for D2 lymphadenectomy and also to qualify surgeons that can perform both laparoscopic and open D2 gastrectomy. This (KLASS-02-QC) is a prospective, observational, multicenter study to qualify the surgeons that will participate in the KLASS-02-RCT, which is a prospective, randomized, clinical trial comparing laparoscopic and open gastrectomy for AGC. Surgeons and reviewers participating in the study will be required to complete a questionnaire detailing their professional experience and specific gastrectomy surgical background/training, and the gastrectomy metrics of their primary hospitals. All surgeons must submit three laparoscopic and three open D2 gastrectomy videos, respectively. Each video will be allocated to five peer reviewers; thus each surgeon’s operations will be assessed by a total of 30 reviews. Based on blinded assessment of unedited videos by experts’ review, a separate review evaluation committee will decide whether or not the evaluated surgeon will participate in the KLASS-02-RCT. The primary outcome measure is each surgeon’s proficiency, as assessed by the reviewers based on evaluation criteria for completeness of D2 lymphadenectomy. We believe that our study for standardization of D2 lymphadenectomy and surgical quality control (KLASS-02-QC) will guarantee successful implementation of the subsequent KLASS-02-RCT study. After making consensus on D2 lymphadenectomy, we developed evaluation criteria for completeness of D2

Administering an epoch initiated for remote memory access

Science.gov (United States)

Blocksome, Michael A; Miller, Douglas R

2012-10-23

Methods, systems, and products are disclosed for administering an epoch initiated for remote memory access that include: initiating, by an origin application messaging module on an origin compute node, one or more data transfers to a target compute node for the epoch; initiating, by the origin application messaging module after initiating the data transfers, a closing stage for the epoch, including rejecting any new data transfers after initiating the closing stage for the epoch; determining, by the origin application messaging module, whether the data transfers have completed; and closing, by the origin application messaging module, the epoch if the data transfers have completed.

Experiment data report for Semiscale Mod-1 test S-02-5 (blowdown heat transfer test)

International Nuclear Information System (INIS)

1975-12-01

Recorded test data are presented for Test S-02-5 of the Semiscale Mod-1 blowdown heat transfer test series. Test S-02-5 is one of several Semiscale Mod-1 experiments conducted to investigate the thermal and hydraulic phenomena accompanying a hypothesized loss-of-coolant accident in a water-cooled nuclear reactor system and to provide data for the assessment of the Loss-of-Fluid Test (LOFT) design basis. Test S-02-5 was conducted from an initial cold leg fluid temperature of 544 0 F and an initial pressure of 2,253 psia. A simulated double-ended offset shear cold leg break was used to investigate the system response to a depressurization transient with full core power (1.6 MW). An electrically heated core was used in the pressure vessel to simulate the effects of a nuclear core. System flow was set to achieve the full design core temperature differential of 66 0 F. The flow resistance of the intact loop was based on core area scaling. During system depressurization, core power was reduced from the initial level of 1.6 MW in such a manner as to simulate the surface heat flux response of the LOFT nuclear fuel rods until such time that departure from nucleate boiling occurs

Effect of HMB and 2-Ox administered during pregnancy on bone properties in primiparous and multiparous minks (Neivison vison

Directory of Open Access Journals (Sweden)

Tomaszewska Ewa

2015-12-01

Full Text Available The aim of the study was to determine the mechanical and geometric properties as well as bone tissue density of long bones in primiparous and multiparous dams of minks supplemented with β-hydroxy β-methylbutyrate (HMB and/or 2-oxoketoglutarate (2-Ox during gestation. Powdered 2-Ox was given at the daily dosage of 0.4 g/kg b.w. separately or simultaneously with HMB, which was administered at the daily dosage of 0.02 g/kg b.w. The study demonstrates for the first time that administration of 2-Ox and/or HMB to dams markedly influences bone tissue density and the mechanical and geometrical properties of mother`s bones in minks. Moreover, it was demonstrated that the supplementation was more effective in the thoracic limb, which was comprehensively used in contrast to the pelvic limb. The mechanical parameters and bone tissue density significantly increased in the humerus in multiparous minks. Only such diet may provide satisfactory production results in the animals. Nutritional deficiencies occurring during pregnancies may trigger body`s own reserves to cover the bone mass increase in developing foetuses and support milk production. This can prevent regeneration of dams’ organisms, which negatively affects their reproductive performance. 2-Ox or HMB may be regarded as a protective metabolite when administered orally to minks, counteracting the negative influences of pregnancy and lactation periods on bones condition. Both simultaneous treatment with 2-Ox and HMB and their separate administration were equally effective.

Effects of caffeic and chlorogenic acids on the rat skeletal system.

Science.gov (United States)

Folwarczna, J; Pytlik, M; Zych, M; Cegieła, U; Nowinska, B; Kaczmarczyk-Sedlak, I; Sliwinski, L; Trzeciak, H; Trzeciak, H I

2015-02-01

Caffeic acid, predominantly as esters linked to quinic acid (chlorogenic acids), is a phenolic acid present at high levels in coffee. The aim of the study was to investigate effects of caffeic and chlorogenic acids on the skeletal system of female rats with normal estrogen levels and estrogen-deficient. Caffeic acid (5 and 50 mg/kg p.o. daily) and chlorogenic acid (100 mg/kg p.o. daily) were administered for 4 weeks to non-ovariectomized and bilaterally ovariectomized mature Wistar rats, and their effects were compared with appropriate controls. Moreover, estradiol (0.2 mg/kg p.o. daily) was administered to ovariectomized rats. Bone turnover markers, mass, mineralization and mechanical properties were examined. Although caffeic acid at a low dose exerted some unfavorable effects on the skeletal system, at high doses, caffeic and chlorogenic acids slightly increased mineralization in the tibia and improved mechanical properties of the femoral diaphysis (compact bone). Unlike estradiol, they did not counteract the worsening of the tibial metaphysis bone strength (cancellous bone) and increases in osteocalcin concentration induced by estrogen deficiency. High doses of the phenolic acids slightly favorably affected the rat skeletal system independently of the estrogen status.

Project W-314 specific test and evaluation plan for 241-AY-02A pump pit upgrade

International Nuclear Information System (INIS)

Hays, W.H.

1998-01-01

This Specific Test and Evaluation Plan (STEP) defines the test and evaluation activities encompassing the upgrade of the 241-AY-02A Pump Pit for the W-314 Project. The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made to the 241-AY-02A Pump Pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)

Towards direction dependent fluxes with AMS-02

Energy Technology Data Exchange (ETDEWEB)

Zeissler, Stefan; Andeen, Karen; Boer, Wim de; Gebauer, Iris; Merx, Carmen; Nikonov, Nikolay; Vagelli, Valerio [Karlsruher Institut fuer Technologie KIT (Germany)

2015-07-01

The Alpha Magnetic Spectrometer (AMS-02) is a state-of-the-art particle physics detector designed to operate as an external module on the International Space Station (ISS). In the unique space environment cosmic particles can be measured with high precision over an energy range from GeV up to TeV. In 2014 electron and positron flux measurements where published which indicate an additional source of positrons among the various cosmic particles. The arrival directions of energetic positrons and electrons convey fundamental information on their origin. We evaluate the AMS-02 detector acceptance for each incoming particle direction and show preliminary results of a direction dependent measurement of the AMS-02 lepton flux.

AMS-02 in space: physics results, overview, and challenges

Science.gov (United States)

Tomassetti, Nicola; AMS Collaboration

2015-08-01

The Alpha Magnetic Spectrometer (AMS-02) is a state of the art particle detector measuring cosmic rays (CRs) on the International Space Station (ISS) since May 19th 2011. AMS-02 identifies CR leptons and nuclei in the energy range from hundreds MeV to few TeV per nucleon. Several sub-detector systems allow for redundant particle identification with unprecedented precision, a powerful lepton-hadron separation, and a high purity of the antimatter signal. The new AMS-02 leptonic data from 1 to 500 GeV are presented and discussed. These new data indicate that new sources of CR leptons need to be included to describe the observed spectra at high energies. Explanations of this anomaly may be found either in dark-matter particles annihilation or in the existence of nearby astrophysical sources of e±. Future data at higher energies and forthcoming measurements on the antiproton spectrum and the boron-to-carbon ratio will be crucial in providing the discrimination among the different scenario.

The role of intraperitoneally administered vitamin C during ...

African Journals Online (AJOL)

The effects of daily intraperitoneally administered doses of 100 mg/kg bd. wt. vitamin C on levels of some endogenous antioxidants as well as hepatic and renal function were investigated in a group of rabbits infected with a strain of Trypanosoma congolense (strain number: BS2/TC /SP28/P4). Values of parameters ...

MR imaging of the breast. Localization of focal breast lesions with the magnetom open at 0.2 T

International Nuclear Information System (INIS)

Sittek, H.; Perlet, C.; Herrmann, K.; Linsmeier, E.; Kessler, M.; Reiser, M.; Kolem, H.; Untch, M.

1997-01-01

Purpose: To answer the following questions: Whether reliable detection of lesions is possible in low-field-MRI-system (Magnetom Open 0.2 T) equipped with currently available hard- and software components in comparison to high field system (Magnetom Impact 1.0 T). Furthermore, whether localization of lesions suspect in MR-mammography can be realized in MR system of low field (Magnetom Open 0.2 T). Patients and Methods: In 11 patients, suspect lesions were diagnosed in diagnostic MR-mammography acquired with high field system (Magnetom Impact 1.0 T) and were compared to low field MR-mammographies of 0.2 T (Magnetom Open 0.2 T). In six of the 11 patients a suspect lesion was localized using wire marking. Results: All lesions considered suspect in diagnostic MR-mammography (Magnetom Impact 1.0 T) were also clearly identified in the 0.2 T system (Magnetom Open). In six cases wire marking was performed without any complications and with an accuracy of≤0.5 cm distance to the lesion. Conclusion: Although studies in the 0.2 T system clearly showed inferior SNR (34.6 vs. 83.1) and CNR (14.6 vs. 43.5) compared to studies with the high field system, all lesions considered suspect in diagnostic MR-mammography were reliably identified also in 0.2 T studies. Due to its open construction permitting permanent access to the breast and due to sufficient image quality, the Magnetom Open is suitable for interventions on the breast. (orig.) [de

32 CFR 637.11 - Authority to administer oaths.

Science.gov (United States)

2010-07-01

... ENFORCEMENT AND CRIMINAL INVESTIGATIONS MILITARY POLICE INVESTIGATION Investigations § 637.11 Authority to... administer oaths to military personnel who are subject to the UCMJ. The authority to administer oaths to...

Effect of pressure on photo-induced expansion of As0.2Se0.8 layer

International Nuclear Information System (INIS)

Charnovych, S.; Kokenyesi, S.; Erdelyi, G.; Csik, A.

2011-01-01

Complete text of publication follows. Amorphous chalcogenide glasses are well known as materials where different kinds of structure-related transformations, like amorphysation-crystallization, volume and chemical stability changes take place under certain external influences (heat-, light-, and electric field). In spite of a rather long history of investigations and even some important applications in memory devices the mechanism of these effects is not completely clear, since besides the necessary condition of light interaction with glass and charge generation of the mass transport, shift or diffusion of atoms must occur. Unfortunately, we have only very little information about the light induced atomic transport processes in amorphous chalcogenides. Recent investigations on light-induced expansion, and holographic recording in chalcogenide glasses show that As 0.2 Se 0.8 composition reveals giant photo-expansion and photoplasticity effects. We selected this material for more detailed investigations of the direct relief formation process. In this work we investigate the influence of hydrostatic pressure on photo-stimulated surface relief formation in As 0.2 Se 0.8 thin films. 1 μm tick layers were evaporated from bulk glassy materials. Silica glass plates were used as substrate for films. The thickness of the layers were measured with profilometer type Ambios XP-I. The samples were illuminated with red laser beam (633 nm, output power P=7.5mW) through a copper grid, which resulted to an imprint picture on the surface of the film with interference fringes at the edges. In this way surface relief with different heights were formed after the given exposure according to the distribution of light intensity. The measurements were carried out at room temperature in a large-volume (1 cm 3 ) optical cell having sapphire windows. The hydrostatic pressure was generated by means of a 3-stage gas compressor. We used profilometer as well as scanning electron- and atomic force

Macroscopic and microscopic biodistribution of intravenously administered iron oxide nanoparticles

Science.gov (United States)

Misra, Adwiteeya; Petryk, Alicia A.; Strawbridge, Rendall R.; Hoopes, P. Jack

2015-03-01

Iron oxide nanoparticles (IONP) are being developed for use as a cancer treatment. They have demonstrated efficacy when used either as a monotherapy or in conjunction with conventional chemotherapy and radiation. The success of IONP as a therapeutic tool depends on the delivery of a safe and controlled cytotoxic thermal dose to tumor tissue following activation with an alternating magnetic field (AMF). Prior to clinical approval, knowledge of IONP toxicity, biodistribution and physiological clearance is essential. This preliminary time-course study determines the acute toxicity and biodistribution of 110 nm dextran-coated IONP (iron) in mice, 7 days post systemic, at doses of 0.4, 0.6, and 1.0 mg Fe/ g mouse bodyweight. Acute toxicity, manifested as changes in the behavior of mice, was only observed temporarily at 1.0 mg Fe/ g mouse bodyweight, the highest dose administered. Regardless of dose, mass spectrometry and histological analysis demonstrated over 3 mg Fe/g tissue in organs within the reticuloendotheilial system (i.e. liver, spleen, and lymph nodes). Other organs (brain, heart, lungs, and kidney) had less than 0.5 mg Fe/g tissue with iron predominantly confined to the organ vasculature.

NDA BATCH 2002-02

Energy Technology Data Exchange (ETDEWEB)

Lawrence Livermore National Laboratory

2009-12-09

QC sample results (daily background checks, 20-gram and 100-gram SGS drum checks) were within acceptable criteria established by WIPP's Quality Assurance Objectives for TRU Waste Characterization. Replicate runs were performed on 5 drums with IDs LL85101099TRU, LL85801147TRU, LL85801109TRU, LL85300999TRU and LL85500979TRU. All replicate measurement results are identical at the 95% confidence level as established by WIPP criteria. Note that the batch covered 5 weeks of SGS measurements from 23-Jan-2002 through 22-Feb-2002. Data packet for SGS Batch 2002-02 generated using gamma spectroscopy with the Pu Facility SGS unit is technically reasonable. All QC samples are in compliance with established control limits. The batch data packet has been reviewed for correctness, completeness, consistency and compliance with WIPP's Quality Assurance Objectives and determined to be acceptable. An Expert Review was performed on the data packet between 28-Feb-02 and 09-Jul-02 to check for potential U-235, Np-237 and Am-241 interferences and address drum cases where specific scan segments showed Se gamma ray transmissions for the 136-keV gamma to be below 0.1 %. Two drums in the batch showed Pu-238 at a relative mass ratio more than 2% of all the Pu isotopes.

Disclosure of sensitive behaviors across self-administered survey modes: a meta-analysis.

Science.gov (United States)

Gnambs, Timo; Kaspar, Kai

2015-12-01

In surveys, individuals tend to misreport behaviors that are in contrast to prevalent social norms or regulations. Several design features of the survey procedure have been suggested to counteract this problem; particularly, computerized surveys are supposed to elicit more truthful responding. This assumption was tested in a meta-analysis of survey experiments reporting 460 effect sizes (total N =125,672). Self-reported prevalence rates of several sensitive behaviors for which motivated misreporting has been frequently observed were compared across self-administered paper-and-pencil versus computerized surveys. The results revealed that computerized surveys led to significantly more reporting of socially undesirable behaviors than comparable surveys administered on paper. This effect was strongest for highly sensitive behaviors and surveys administered individually to respondents. Moderator analyses did not identify interviewer effects or benefits of audio-enhanced computer surveys. The meta-analysis highlighted the advantages of computerized survey modes for the assessment of sensitive topics.

Production and characterization of rhamnolipids produced by Serratia rubidaea SNAU02 under solid-state fermentation and its application as biocontrol agent.

Science.gov (United States)

Nalini, S; Parthasarathi, R

2014-12-01

The present study aimed at exploring mahua (Madhuca indica) oil cake as a novel substrate for the production of biosurfactant by Serratia rubidaea SNAU02 under solid-state fermentation (SSF). Response surface methodology showed followings as the optimal conditions for the production of biosurfactant: mahua oil cake 7.48 g, 2.5 ml inoculum size (1×10(8) cells/ml), and pH 7.22 and 31 °C temperature. The characterization of the biosurfactant by TLC, FT-IR and GC-MS revealed the presence of rhamnolipid. The presence of rhamnosyl transferase gene responsible for biosynthesis of rhamnolipid was identified. The strain SNAU02 exhibited antifungal activity and demonstrated no toxicity against the seeds of Brassica oleracea and Artemia salina employed as a bio-indicator. The present findings indicated the potential of mahua oil cake as suitable substrate for the production of rhamnolipids in SSF by S. rubidaea SNAU02 and application potential of the biosurfactant produced as biocontrol agent against plant pathogens. Copyright © 2014 Elsevier Ltd. All rights reserved.

Alteration of intestinal microbiota in mice orally administered with salmon cartilage proteoglycan, a prophylactic agent.

Directory of Open Access Journals (Sweden)

Krisana Asano

Full Text Available Proteoglycan (PG extracted from salmon nasal cartilage has potential to be a prophylactic agent. Daily oral administration of the PG attenuates systemic inflammatory response in the experimental mouse models. In this study, we applied the culture-independent approach to investigate an alteration of intestinal microbiota composition in PG-administered mice. The results indicated that the population level of bacilli increased in the small and large intestine upon PG administration. On the other hand, the population level of clostridia decreased in the large intestine. The proportion of bacteria that are able to ferment saccharides and produce short-chain fatty acids increased in the small intestine and decreased in the large intestine. Importantly, population level of probiotic lactobacilli and bacteria exhibiting the immunomodulatory effect increased in the PG-administered mice. In addition, several disease-associated bacteria decreased upon PG administration. These results provided an understanding of the specific role of PG involved in host immune modulation and supported our hypothesis that daily oral administration of PG improves the overall balance in composition of the intestinal microbial community.

A thermodynamic model of the Hg(0.8)Cd(0.2)Te-iodine transport system. I - Te-saturated source material. II - Source material composition within the homogeneity range

Science.gov (United States)

Chandra, D.; Wiedemeier, H.

1987-01-01

A thermochemical analysis of the Hg(0.8)Cd(0.2)Te-iodine vapor transport system is presented, and theoretical calculations of diffusion-controlled mass transport rates are made. The predicted mass fluxes are compared with experimental data obtained from transport experiments under vertical, stabilizing conditions reported earlier and with results of additional transport experiments conducted during the present study. Experimental mass transport rate studies of the transport system for fixed amount of excess Hg as a function of transport agent pressure are presented. The mass fluxes are determined for the vertical, stabilizing orientation of the density gradient relative to the gravitational vector. In order to compare experimental mass transport rates with computed values, the thermochemical analysis is extended to take the formation of Hg vacancies in the above compound into account along with their effect on the partial pressure of the system.

Self-Administered Domiciliary tDCS Treatment for Tinnitus: A Double-Blind Sham-Controlled Study.

Directory of Open Access Journals (Sweden)

Petteri Hyvärinen

Full Text Available Transcranial direct current stimulation (tDCS has shown potential for providing tinnitus relief, although positive effects have usually been observed only during a short time period after treatment. In recent studies the focus has turned from one-session experiments towards multi-session treatment studies investigating long-term outcomes with double-blinded and sham-controlled study designs. Traditionally, tDCS has been administered in a clinical setting by a healthcare professional but in studies involving multiple treatment sessions, often a trade-off has to be made between sample size and the amount of labor needed to run the trial. Also, as the number of required visits to the clinic increases, the dropout rate is likely to rise proportionally.The aim of the current study was to find out if tDCS treatment for tinnitus could be patient-administered in a domiciliary setting and whether the results would be comparable to those from in-hospital treatment studies. Forty-three patients with chronic (> 6 months tinnitus were involved in the study, and data on 35 out of these patients were included in final analysis. Patients received 20 minutes of left temporal area anodal (LTA or bifrontal tDCS stimulation (2 mA or sham stimulation (0.3 mA for ten consecutive days. An overall reduction in the main outcome measure, Tinnitus Handicap Inventory (THI, was found (mean change -5.0 points, p < 0.05, but there was no significant difference between active and sham treatment outcomes. Patients found the tDCS treatment easy to administer and they all tolerated it well. In conclusion, self-administered domiciliary tDCS treatment for tinnitus was found safe and feasible and gave outcome results similar to recent randomized controlled long-term treatment trials. The results suggest better overall treatment response-as measured by THI-with domiciliary treatment than with in-hospital treatment, but this advantage is not related to the tDCS variant. The study

Silent hepatic lesions detected with computed tomography in aplastic anemia patients administered androgens for a long period

International Nuclear Information System (INIS)

Yamagishi, Morihisa; Hiraoka, Atsunobu; Uchino, Haruto.

1982-01-01

Macroscopic liver lesions were investigated with the use of computed tomography (CT) and radionuclide imaging (RN) in 15 aplastic anemia patients who were administered anabolic steroids for over one year and who showed no apparent physical and biochemical sign of liver tumor. In 3 patients, CT scans showed radiolucent areas in the liver. Contrast enhancements revealed these lesions to be well vascularized, suggesting they were not cysts but probably tumors. RN imaging could not demonstrate any definite space occupying lesions. Total dose of AS administered to each of the three patients exceeded 30,000 mg. It was felt that attention should be paid to the possible development of hepatic tumor when the dose of AS administered exceeds 30,000 mg. (author)

Silent hepatic lesions detected with computed tomography in aplastic anemia patients administered androgens for a long period

Energy Technology Data Exchange (ETDEWEB)

Yamagishi, Morihisa (Shiga Univ., Otsu (Japan)); Hiraoka, Atsumobu; Uchino, Haruto

1982-07-01

Macroscopic liver lesions were investigated with the use of computed tomography (CT) and radionuclide imaging (RN) in 15 aplastic anemia patients who were administered anabolic steroids for over one year and who showed no apparent physical and biochemical sign of liver tumor. In 3 patients, CT scans showed radiolucent areas in the liver. Contrast enhancements revealed these lesions to be well vascularized, suggesting they were not cysts but probably tumors. RN imaging could not demonstrate any definite space occupying lesions. Total dose of AS administered to each of the three patients exceeded 30,000 mg. It was felt that attention should be paid to the possible development of hepatic tumor when the dose of AS administered exceeds 30,000 mg.

40 CFR 190.02 - Definitions.

Science.gov (United States)

2010-07-01

... materials from -the cycle. (c) General environment means the total terrestrial, atmospheric and aquatic... of the public means any individual that can receive a radiation dose in the general environment... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Definitions. 190.02 Section 190.02...

Current role of non-anesthesiologist administered propofol sedation in advanced interventional endoscopy

DEFF Research Database (Denmark)

Burtea, Daniela Elena; Dimitriu, Anca; Maloş, Anca Elena

2015-01-01

the patients and medical personnel. Current guidelines support the use of propofol sedation, which has the same rate of adverse effects as traditional sedation with benzodiazepines and/or opioids, but decreases the procedural and recovery time. Non-anesthesiologist administered propofol sedation has become......, improved satisfaction for patients and doctors, as well as decreased recovery and discharge time. Despite the advantages of non-anesthesiologist administered propofol, there is still a continuous debate related to the successful generalization of the procedures....

50 CFR 402.02 - Definitions.

Science.gov (United States)

2010-10-01

... OF COMMERCE); ENDANGERED SPECIES COMMITTEE REGULATIONS SUBCHAPTER A INTERAGENCY COOPERATION-ENDANGERED SPECIES ACT OF 1973, AS AMENDED General § 402.02 Definitions. Act means the Endangered Species Act... species. Listed species means any species of fish, wildlife, or plant which has been determined to be...

Validation of a self-administered questionnaire for assessing occupational and environmental exposures of pregnant women

International Nuclear Information System (INIS)

Eskenazi, B.; Pearson, K.

1988-01-01

The present investigation sought to determine whether a self-administered questionnaire could be used to obtain occupational information from pregnant women attending the obstetrical clinics at the University of California, San Francisco from July to November 1986. The authors compared the accuracy of responses of 57 women on the self-administered questionnaire with those obtained on a detailed clinical interview by an occupational health professional. The self-administered questionnaire and the clinical interview included information on the woman's job title, the type of company she worked for, the level of physical activity, her exposures on the job and at home, and her partner's occupation. The authors also examined whether the validity of the self-administered questionnaire could be improved on review by an industrial hygienist. The questionnaire took less than 20 minutes to complete, with over 90% of the women answering three-quarters of it. It was substantially accurate in obtaining information on number of hours worked during pregnancy, type of shift worked, and stress level in the workplace; exposure to radiation, video display terminals, fumes, gases, and cigarette smoke in the workplace; and exposure to pesticides, paint, and cigarette smoke at home. On those variables for which the responses on the self-administered questionnaire were less accurate, review by the industrial hygienist improved the level of accuracy considerably. These findings suggest that a self-administered questionnaire can be used to obtain valid information from pregnant women attending a prenatal clinic

[COOP/WONCA: Reliability and validity of the test administered by telephone].

Science.gov (United States)

Pedrero-Pérez, Eduardo J; Díaz-Olalla, José Manuel

2016-01-01

The COOP/WONCA test was initially proposed as a self-report in which the answers were supported by drawings illustrating the state investigated. Subsequent studies have confirmed its usefulness as a mere verbal self-report face-to-face administered. No data have been found about its useful when administered by telephone interview. The aim of this study was to determine the psychometric properties of the COOP / WONCA test to measure Related Quality of Life (HRQoL) administered by telephone and compare them with those obtained in other forms of prior administration. Cross-sectional study on a random. City of Madrid. Random sample of 802 adult subjects, representative of the adult population in Madrid, obtained by stratification from the population census. Questionnaire COOP/WONCA with 9 ítems included in a broader battery, administered by telephone interview. The unrestricted factor analysis points to the unifactoriality of the scale, which measures a single latent construct (HRQOL), showing high internal consistency, not significantly different from those found by face-to-face administration, ruling out the existence of biases in the phone modality. The COOP/WONCA test appears as a reliable and valid measure of HRQOL and telephonic administration allows to assume no changes in the results, which can reduce costs in population studies, increasing efficiency without loss of quality in the information collected. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

Efficacy of ivermectin as an anthelmintic in leopard frogs.

Science.gov (United States)

Letcher, J; Glade, M

1992-02-15

Ivermectin administered cutaneously at dosages of 2 mg/kg of body weight eliminated nematode infections in leopard frogs. Three clinical trials were conducted. In the first trial, 5 groups of 11 frogs were given ivermectin IM at dosages of 0, 0.2, 0.4, 2, or 20 mg/kg. All frogs given ivermectin IM at dosages of 2.0 mg/kg or greater died. In trial 2, 44 frogs, allotted to 5 groups, were given ivermectin cutaneously at 0, 0.2, 2, or 20 mg/kg. Cutaneously administered ivermectin was not toxic at dosages up to 20 mg/kg. In trial 3, nematode infections were eliminated in all 10 frogs treated cutaneously with ivermectin at 2.0 mg/kg.

Increasing efficacy and reducing systemic absorption of brimonidine tartrate ophthalmic gels in rabbits.

Science.gov (United States)

Pang, Xiaochen; Li, Jiawei; Pi, Jiaxin; Qi, Dongli; Guo, Pan; Li, Nan; Wu, Yumei; Liu, Zhidong

2018-03-01

Systemic absorption of ocularly administered Brimonidine Tartrate has been reported to give rise to several side-effects. Hence, it has become crucial to develop a delivery system that could increase efficacy and reduce systemic absorption. Therefore, the present work aims to develop Brimonidine Tartrate gels with different concentrations (0.05%, 0.1%, and 0.2% w/v, respectively) using Carbopol 974 P and HPMC E4M, and compare the therapeutic efficacy and systemic absorption with that of eye drop (0.2%, w/v) by UPLC-MS/MS. The result of histological analysis did not show any morphological or structural changes after the administration of formulations. In vitro residence time studies demonstrated that the gels exhibited a better precorneal residence time as compared with the eye drop. The gels with lower concentrations of the drug (0.05% and 0.1%, w/v) could significantly decrease intraocular pressure (IOP) in both normal and water-loaded rabbits as compared to the eye drop. Finally, the values of the ratio of AUC (0→∞) in comparison to eye drop showed the gels with lower concentrations of Brimonidine Tartrate could decrease the systemic absorption. From the result, it can be concluded the 0.1% ophthalmic gel has a potential to improve therapeutic efficacy and reduce the potential toxicity caused by systemic absorption.

Glabridin and glycyrrhizic acid show no beneficial effect on the chemical composition and mechanical properties of bones in ovariectomized rats, when administered in moderate dose.

Science.gov (United States)

Kaczmarczyk-Sedlak, Ilona; Klasik-Ciszewska, Sylwia; Wojnar, Weronika

2016-10-01

One of the major causes of osteoporosis and bone fracture in postmenopausal women is estrogen deficiency. To prevent the fractures, and avoid the side effects of hormone replacement therapy, phytoestrogens including the isoflavonoids are used. In the presented study two constituents occurring in the licorice root-the isoflavane glabridin and triterpenoid saponin glycyrrhizic acid were examined on the skeletal system of ovariectomized rats. The female Wistar rats were divided into five groups: control group, ovariectomized group as well as three ovariectomized groups treated with estradiol (0.2mg/kg), glabridin (5mg/kg) or glycyrrhizic acid (15mg/kg). All substances were administered orally for 4 weeks. The estradiol served as a positive control. The mechanical properties of femoral diaphysis, tibial metaphysis and femoral neck were assessed using bending and compression tests. Moreover the chemical composition of the femur, tibia and L-4 vertebra - content of water, organic substances and minerals - was determined. Ovariectomy induced unfavorable changes in the skeletal system of the rats. Administration of glabridin and glycyrrhizic acid to the ovariectomized rats did not improve analyzed parameters of the bones. Obtained results indicate, that the tested substances revealed no beneficial effect on the mechanical properties and chemical composition of the tested bones, thus they cannot be used as the osteoporosis protective agents. Copyright © 2016 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Synthesize and electrochemical characterization of Mg-doped Li-rich layered Li[Li0.2Ni0.2Mn0.6]O2 cathode material

International Nuclear Information System (INIS)

Wang, Dan; Huang, Yan; Huo, Zhenqing; Chen, Li

2013-01-01

Highlights: • Layered Li[Li 0.2 Ni 0.2−x Mn 0.6−x Mg 2x ]O 2 (2x = 0, 0.01, 0.02, 0.05) were synthetized. • Li[Li 0.2 Ni 0.2−x Mn 0.6−x Mg 2x ]O 2 exhibit enhanced electrochemical properties. • The improved performance is attributed to enhanced structure stability. -- Abstract: Mg-doped Li[Li 0.2 Ni 0.2 Mn 0.6 ]O 2 as a Li-rich cathode material of lithium-ion batteries were prepared by co-precipitation method and ball-milling treatment using Mg(OH) 2 as a dopant. Scanning electron microscopy (SEM), ex situ X-ray powder diffraction (XRD), cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and galvantatic charge/discharge were used to investigate the effect of Mg doping on structure and electrochemical performance. Compared with the bare material, Mg-doped materials exhibit better cycle stabilities and superior rate capabilities. Li[Li 0.2 Ni 0.195 Mn 0.595 Mg 0.01 ]O 2 displays a high reversible capacity of 226.5 mAh g −1 after 60 cycles at 0.1 C. The excellent cycle performance can be attributed to the improvement in structure stability, which is verified by XRD tests before and after 60 cycles. EIS results show that Mg doping decreases the charge-transfer resistance and enhances the reaction kinetics, which is considered to be the major factor for higher rate performance

A phase I clinical study to evaluate safety of orally administered, genetically engineered Salmonella enterica serovar Typhimurium for canine osteosarcoma

OpenAIRE

Fritz, Sara; Henson, Michael; Greengard, Emily; Winter, Amber; Stuebner, Kathleen; Yoon, Una; Wilk, Vicki; Borgatti, Antonella; Augustin, Lance; Modiano, Jaime; Saltzman, Daniel

2017-01-01

Abstract We conducted a prospective phase I study to evaluate safety of an orally administered Salmonella encoding IL‐2 (SalpIL2) in combination with amputation and adjuvant doxorubicin for canine appendicular osteosarcoma. Efficacy was assessed as a secondary measure. The first dose of SalpIL2 was administered to 19 dogs on Day 0; amputation was done after 10 days with chemotherapy following 2 weeks later. SalpIL2 was administered concurrent with chemotherapy, for a total of five doses of do...

Statistical analysis of Japanese Thorotrast-administered autopsy cases

International Nuclear Information System (INIS)

Mori, T.; Kato, Y.; Shimamine, T.; Watanabe, S.

1979-01-01

The causes of death of 144 Japanese autopsy cases during 1945-1975, who had been intravascularly injected with Thorotrast in life, were compared with those of non-Thorotrast-administered autopsy cases in the same age bracket, recorded in the Annals of Japanese Pathological Autopsy Cases during 1958-1973. This comparison revealed that the incidence of malignant hepatic tumors was more than 10 times higher in the Thorotrast-administered cases. The increase was attributable to an increased incidence of hemangioendothelioma and cholangiocarcinoma of the liver. The only significant increase of liver cirrhosis found to exist in the Thorotrast group occurred in the female cases. Some of the Thorotrast-administered cases were found to have developed myeloid leukemia and erythroleukemia. There was also a significant increase in the number of cases of aplastic anemia in the Thorotrast group, but clinically and pathologically these were atypical. Lymphatic leukemia was not observed. No significant difference was found in the incidence of either malignant lymphomas or osteosarcomas in the Thorotrast group and the controls. Lung cancer, on the other hand, showed a significantly higher incidence among the controls than among the Thorotrast-administered cases

Engineered Barrier System performance requirements systems study report. Revision 02

International Nuclear Information System (INIS)

Balady, M.A.

1997-01-01

This study evaluates the current design concept for the Engineered Barrier System (EBS), in concert with the current understanding of the geologic setting to assess whether enhancements to the required performance of the EBS are necessary. The performance assessment calculations are performed by coupling the EBS with the geologic setting based on the models (some of which were updated for this study) and assumptions used for the 1995 Total System Performance Assessment (TSPA). The need for enhancements is determined by comparing the performance assessment results against the EBS related performance requirements. Subsystem quantitative performance requirements related to the EBS include the requirement to allow no more than 1% of the waste packages (WPs) to fail before 1,000 years after permanent closure of the repository, as well as a requirement to control the release rate of radionuclides from the EBS. The EBS performance enhancements considered included additional engineered components as well as evaluating additional performance available from existing design features but for which no performance credit is currently being taken

Engineered Barrier System performance requirements systems study report. Revision 02

Energy Technology Data Exchange (ETDEWEB)

Balady, M.A.

1997-01-14

This study evaluates the current design concept for the Engineered Barrier System (EBS), in concert with the current understanding of the geologic setting to assess whether enhancements to the required performance of the EBS are necessary. The performance assessment calculations are performed by coupling the EBS with the geologic setting based on the models (some of which were updated for this study) and assumptions used for the 1995 Total System Performance Assessment (TSPA). The need for enhancements is determined by comparing the performance assessment results against the EBS related performance requirements. Subsystem quantitative performance requirements related to the EBS include the requirement to allow no more than 1% of the waste packages (WPs) to fail before 1,000 years after permanent closure of the repository, as well as a requirement to control the release rate of radionuclides from the EBS. The EBS performance enhancements considered included additional engineered components as well as evaluating additional performance available from existing design features but for which no performance credit is currently being taken.

AMS-02 fits dark matter

Science.gov (United States)

Balázs, Csaba; Li, Tong

2016-05-01

In this work we perform a comprehensive statistical analysis of the AMS-02 electron, positron fluxes and the antiproton-to-proton ratio in the context of a simplified dark matter model. We include known, standard astrophysical sources and a dark matter component in the cosmic ray injection spectra. To predict the AMS-02 observables we use propagation parameters extracted from observed fluxes of heavier nuclei and the low energy part of the AMS-02 data. We assume that the dark matter particle is a Majorana fermion coupling to third generation fermions via a spin-0 mediator, and annihilating to multiple channels at once. The simultaneous presence of various annihilation channels provides the dark matter model with additional flexibility, and this enables us to simultaneously fit all cosmic ray spectra using a simple particle physics model and coherent astrophysical assumptions. Our results indicate that AMS-02 observations are not only consistent with the dark matter hypothesis within the uncertainties, but adding a dark matter contribution improves the fit to the data. Assuming, however, that dark matter is solely responsible for this improvement of the fit, it is difficult to evade the latest CMB limits in this model.

AMS-02 fits dark matter

Energy Technology Data Exchange (ETDEWEB)

Balázs, Csaba; Li, Tong [ARC Centre of Excellence for Particle Physics at the Tera-scale,School of Physics and Astronomy, Monash University, Melbourne, Victoria 3800 (Australia)

2016-05-05

In this work we perform a comprehensive statistical analysis of the AMS-02 electron, positron fluxes and the antiproton-to-proton ratio in the context of a simplified dark matter model. We include known, standard astrophysical sources and a dark matter component in the cosmic ray injection spectra. To predict the AMS-02 observables we use propagation parameters extracted from observed fluxes of heavier nuclei and the low energy part of the AMS-02 data. We assume that the dark matter particle is a Majorana fermion coupling to third generation fermions via a spin-0 mediator, and annihilating to multiple channels at once. The simultaneous presence of various annihilation channels provides the dark matter model with additional flexibility, and this enables us to simultaneously fit all cosmic ray spectra using a simple particle physics model and coherent astrophysical assumptions. Our results indicate that AMS-02 observations are not only consistent with the dark matter hypothesis within the uncertainties, but adding a dark matter contribution improves the fit to the data. Assuming, however, that dark matter is solely responsible for this improvement of the fit, it is difficult to evade the latest CMB limits in this model.

Synthesis and characterization of modified starch/polybutadiene as novel transdermal drug delivery system.

Science.gov (United States)

Saboktakin, Mohammad Reza; Akhyari, Shahab; Nasirov, Fizuli A

2014-08-01

Transdermal drug delivery systems are topically administered medicaments in the form of patches that deliver drugs for systemic effects at a predetermined and controlled rate. It works very simply in which drug is applied inside the patch and it is worn on skin for long period of time. Polymer matrix, drug, permeation enhancers are the main components of transdermal drug delivery systems. The objective of the present study was to develop the modified starch and 1,4-cis polybutadiene nanoparticles as novel polymer matrix system. We have been studied the properties of a novel transdermal drug delivery system with clonidine as drug model. Copyright © 2014 Elsevier B.V. All rights reserved.

76 FR 9963 - Airworthiness Directives; Thielert Aircraft Engines GmbH Models TAE 125-02-99 and TAE 125-02-114...

Science.gov (United States)

2011-02-23

... Airworthiness Directives; Thielert Aircraft Engines GmbH Models TAE 125-02-99 and TAE 125-02-114 Reciprocating... TAE 125-02-99 and TAE 125-02-114 reciprocating engines installed in, but not limited to, Cessna 172... occurs later. Repetitive Replacements of Timing Chains for All TAE 125-02-99 and TAE 125-02-114 Engines...

[Efficiency of brimonidine 0.2% and dorzolamide 2% as adjunctive therapy to beta-blockers].

Science.gov (United States)

Carrasco Font, C; Arias Puente, A; García Sáenz, M C; Villarejo Díaz-Maroto, I

2004-04-01

To evaluate the clinical efficiency and tolerability of brimonidine and dorzolamide twice daily as an adjunctive therapy for glaucoma patients with an inadequate response to beta-blockers therapy. This multicenter prospective analysis included 92 patients (180 eyes) with primary open-angle glaucoma or ocular hypertension on therapy beta-blockers and with intraocular pressure (IOP) greater than or equal to 18mmHg. The patients were randomly treated either with brimonidine 0.2% or dorzolamide 2% added for three months. Efficiency was determined by the reduction in 15% IOP from baseline at the first and the third month. Mean pre-treatment IOP was 22.37 DE 2.8 mmHg in the brimonidine group and 22.38 DE 2.6 mmHg in the dorzolamide group; mean post-treatment IOP decrease was 4.39 mmHg in the brimonidine group and 3.29 mmHg in the dorzolamide group. Clinical control at the first month was achieved in 78.3% and 71% of cases respectively (p=0.05). No statistical differences existed between groups for systemic adverse events. Four patients on brimonidine discontinued treatment due to local side effects. In the dorzolamide group, two patients left the treatment referring itching and three others left due to ocular allergy. This study found similar efficiency and safety when treating with brimonidine or dorzolamide as an adjunctive therapy for patients with hypertension or primary open-angle glaucoma.

[Preoperatively administered flomoxef sodium concentration in aqueous humor].

Science.gov (United States)

Miyamoto, Mariko; Watanabe, Yoichiro; Mizuki, Nobuhisa

2007-04-01

We intravenously administered flomoxef sodium (FMOX) 0.5-3.5 hours before cataract surgery and measured the concentration of the agent in the aqueous humor to investigate its penetration into the aqueous humor and its efficacy in the prevention of postoperative endophthalmitis. 56 patients who underwent cataract surgery were enrolled in this study. They received 1 g FMOX via a 20-minute intravenous drip beginning 0.5-3.5 hours before the operation. Aqueous humor was aspirated from the anterior chamber and assayed for FMOX concentration using high-performance liquid chromatography. The mean intraoperative FMOX concentrations in the patients' aqueous humor were 0.79 +/- 0.24 microg/ml (administered 3.5 hours before surgery)--1.47 0.79 microg/ml (administered 1.5 hours before surgery). These concentrations administered 0.5-3.0 hours before surgery sufficiently exceeded the minimum inhibitory concentration (MIC) 90 values against Staphylococcus epidermidis, Staphylococcus aureus and Propionibacterium acnes, but did not achieve the MIC90 values against Enterococcus faecalis and Pseudomonas aeruginosa. The FMOX concentrations in the aqueous humor sampling were adequate to kill bacteria in vitro. This drug may be efficacious in the prevention of postoperative endophthalmitis in patients undergoing cataract surgery.

46 CFR 148.02-1 - Shipping papers.

Science.gov (United States)

2010-10-01

... 46 Shipping 5 2010-10-01 2010-10-01 false Shipping papers. 148.02-1 Section 148.02-1 Shipping... MATERIALS IN BULK Vessel Requirements § 148.02-1 Shipping papers. (a) Carriers may not accept for..., unless the hazardous materials offered for such shipment is accompanied by a shipping paper on which the...

The COX-2 inhibitor meloxicam prevents pregnancy when administered as an emergency contraceptive to nonhuman primates.

Science.gov (United States)

McCann, Nicole C; Lynch, Terrie J; Kim, Soon Ok; Duffy, Diane M

2013-12-01

Cyclooxygenase-2 (COX-2) inhibitors reduce prostaglandin synthesis and disrupt essential reproductive processes. Ultrasound studies in women demonstrated that oral COX-2 inhibitors can delay or prevent follicle collapse associated with ovulation. The goal of this study was to determine if oral administration of a COX-2 inhibitor can inhibit reproductive function with sufficient efficacy to prevent pregnancy in primates. The COX-2 inhibitor meloxicam (or vehicle) was administered orally to proven fertile female cynomolgus macaques using one emergency contraceptive model and three monthly contraceptive models. In the emergency contraceptive model, females were bred with a proven fertile male once 2±1 days before ovulation, returned to the females' home cage, and then received 5 days of meloxicam treatment. In the monthly contraceptive models, females were co-caged for breeding with a proven fertile male for a total of 5 days beginning 2±1 days before ovulation. Animals received meloxicam treatment (1) cycle days 5-22, or (2) every day, or (3) each day of the 5-day breeding period. Female were then assessed for pregnancy. The pregnancy rate with meloxicam administration using the emergency contraception model was 6.5%, significantly lower than the pregnancy rate of 33.3% when vehicle without meloxicam was administered. Pregnancy rates with the three monthly contraceptive models (75%-100%) were not consistent with preventing pregnancy. Oral COX-2 inhibitor administration can prevent pregnancy after a single instance of breeding in primates. While meloxicam may be ineffective for regular contraception, pharmacological inhibition of COX-2 may be an effective method of emergency contraception for women. COX-2 inhibitors can interfere with ovulation, but the contraceptive efficacy of drugs of this class has not been directly tested. This study, conducted in nonhuman primates, is the first to suggest that a COX-2 inhibitor may be effective as an emergency contraceptive. �

Late decaying 2-component dark matter scenario as an explanation of the AMS-02 positron excess

Energy Technology Data Exchange (ETDEWEB)

Buch, Jatan; Ralegankar, Pranjal; Rentala, Vikram, E-mail: jatan_buch@brown.edu, E-mail: pranjal6@illinois.edu, E-mail: rentala@phy.iitb.ac.in [Department of Physics, Indian Institute of Technology - Bombay, Powai, Mumbai 400076 (India)

2017-10-01

The long standing anomaly in the positron flux as measured by the PAMELA and AMS-02 experiments could potentially be explained by dark matter (DM) annihilations. This scenario typically requires a large 'boost factor' to be consistent with a thermal relic dark matter candidate produced via freeze-out. However, such an explanation is disfavored by constraints from CMB observations on energy deposition during the epoch of recombination. We discuss a scenario called late-decaying two-component dark matter (LD2DM), where the entire DM consists of two semi-degenerate species. Within this framework, the heavier species is produced as a thermal relic in the early universe and decays to the lighter species over cosmological timescales. Consequently, the lighter species becomes the DM which populates the universe today. We show that annihilation of the lighter DM species with an enhanced cross-section, produced via such a non-thermal mechanism, can explain the observed AMS-02 positron flux while avoiding CMB constraints. The observed DM relic density can be correctly reproduced as well with simple s -wave annihilation cross-sections. We demonstrate that the scenario is safe from CMB constraints on late-time energy depositions during the cosmic 'dark ages'. Interestingly, structure formation constraints force us to consider small mass splittings between the two dark matter species. We explore possible cosmological and particle physics signatures in a toy model that realizes this scenario.

Late decaying 2-component dark matter scenario as an explanation of the AMS-02 positron excess

International Nuclear Information System (INIS)

Buch, Jatan; Ralegankar, Pranjal; Rentala, Vikram

2017-01-01

The long standing anomaly in the positron flux as measured by the PAMELA and AMS-02 experiments could potentially be explained by dark matter (DM) annihilations. This scenario typically requires a large 'boost factor' to be consistent with a thermal relic dark matter candidate produced via freeze-out. However, such an explanation is disfavored by constraints from CMB observations on energy deposition during the epoch of recombination. We discuss a scenario called late-decaying two-component dark matter (LD2DM), where the entire DM consists of two semi-degenerate species. Within this framework, the heavier species is produced as a thermal relic in the early universe and decays to the lighter species over cosmological timescales. Consequently, the lighter species becomes the DM which populates the universe today. We show that annihilation of the lighter DM species with an enhanced cross-section, produced via such a non-thermal mechanism, can explain the observed AMS-02 positron flux while avoiding CMB constraints. The observed DM relic density can be correctly reproduced as well with simple s -wave annihilation cross-sections. We demonstrate that the scenario is safe from CMB constraints on late-time energy depositions during the cosmic 'dark ages'. Interestingly, structure formation constraints force us to consider small mass splittings between the two dark matter species. We explore possible cosmological and particle physics signatures in a toy model that realizes this scenario.

34 CFR 692.30 - How does a State administer its community service-learning job program?

Science.gov (United States)

2010-07-01

...-learning job program? 692.30 Section 692.30 Education Regulations of the Offices of the Department of... Administer Its Community Service-Learning Job Program? § 692.30 How does a State administer its community service-learning job program? (a)(1) Each year, a State may use up to 20 percent of its allotment for a...

Characterization of CoPK02, a Ca2+/calmodulin-dependent protein kinase in mushroom Coprinopsis cinerea.

Science.gov (United States)

Yamashita, Masashi; Sueyoshi, Noriyuki; Yamada, Hiroki; Katayama, Syouichi; Senga, Yukako; Takenaka, Yasuhiro; Ishida, Atsuhiko; Kameshita, Isamu; Shigeri, Yasushi

2018-04-20

We surveyed genome sequences from the basidiomycetous mushroom Coprinopsis cinerea and isolated a cDNA homologous to CMKA, a calmodulin-dependent protein kinase (CaMK) in Aspergillus nidulans. We designated this sequence, encoding 580 amino acids with a molecular weight of 63,987, as CoPK02. CoPK02 possessed twelve subdomains specific to protein kinases and exhibited 43, 35, 40% identity with rat CaMKI, CaMKII, CaMKIV, respectively, and 40% identity with CoPK12, one of the CaMK orthologs in C. cinerea. CoPK02 showed significant autophosphorylation activity and phosphorylated exogenous proteins in the presence of Ca 2+ /CaM. By the CaM-overlay assay we confirmed that the C-terminal sequence (Trp346-Arg358) was the calmodulin-binding site, and that the binding of Ca 2+ /CaM to CoPK02 was reduced by the autophosphorylation of CoPK02. Since CoPK02 evolved in a different clade from CoPK12, and showed different gene expression compared to that of CoPK32, which is homologous to mitogen-activated protein kinase-activated protein kinase, CoPK02 and CoPK12 might cooperatively regulate Ca 2+ -signaling in C. cinerea.

A cross-cultural validation of the Clinician Administered PTSD Scale for Children and Adolescents in a Dutch population

NARCIS (Netherlands)

Diehle, Julia; de Roos, Carlijn; Boer, Frits; Lindauer, Ramón J. L.

2013-01-01

Background: Trauma-focused interventions for children could be administered more efficiently and effectively if posttraumatic stress disorder (PTSD) and related symptoms were first investigated by a reliable and valid instrument. The Clinician Administered PTSD Scale for Children and Adolescents

8 CFR 337.8 - Oath administered by the courts.

Science.gov (United States)

2010-01-01

... Form N-646, that the applicant has been determined by the Attorney General to be eligible for admission... ALLEGIANCE § 337.8 Oath administered by the courts. (a) Notification of election. An applicant for... election to have the oath of allegiance administered in an appropriate court having jurisdiction over the...

Feasibility of online self-administered cognitive training in moderate-severe brain injury.

Science.gov (United States)

Sharma, Bhanu; Tomaszczyk, Jennifer C; Dawson, Deirdre; Turner, Gary R; Colella, Brenda; Green, Robin E A

2017-07-01

Cognitive environmental enrichment (C-EE) offers promise for offsetting neural decline that is observed in chronic moderate-severe traumatic brain injury (TBI). Brain games are a delivery modality for C-EE that can be self-administered over the Internet without therapist oversight. To date, only one study has examined the feasibility of self-administered brain games in TBI, and the study focused predominantly on mild TBI. Therefore, the primary purpose of the current study was to examine the feasibility of self-administered brain games in moderate-severe TBI. A secondary and related purpose was to examine the feasibility of remote monitoring of any C-EE-induced adverse symptoms with a self-administered evaluation tool. Ten patients with moderate-severe TBI were asked to complete 12 weeks (60 min/day, five days/week) of online brain games with bi-weekly self-evaluation, intended to measure any adverse consequences of cognitive training (e.g., fatigue, eye strain). There was modest weekly adherence (42.6% ± 4.4%, averaged across patients and weeks) and 70% patient retention; of the seven retained patients, six completed the self-evaluation questionnaire at least once/week for each week of the study. Even patients with moderate-severe TBI can complete a demanding, online C-EE intervention and a self-administered symptom evaluation tool with limited therapist oversight, though at daily rate closer to 30 than 60 min per day. Further self-administered C-EE research is underway in our lab, with more extensive environmental support. Implications for Rehabilitation Online brain games (which may serve as a rehabilitation paradigm that can help offset the neurodegeneration observed in chronic TBI) can be feasibly self-administered by moderate-to-severe TBI patients. Brain games are a promising therapy modality, as they can be accessed by all moderate-to-severe TBI patients irrespective of geographic location, clinic and/or therapist availability, or impairments that

Regadenoson pharmacologic stress for myocardial perfusion imaging: a three-way comparison between regadenoson administered at peak exercise, during walk recovery, or no-exercise.

Science.gov (United States)

Thompson, Randall C; Patil, Harshal; Thompson, Elaine C; Thomas, Gregory S; Al-Amoodi, Mohammed; Kennedy, Kevin F; Bybee, Kevin A; Iain McGhie, A; O'Keefe, James H; Oakes, Lisa; Bateman, Timothy M

2013-04-01

Regadenoson (Reg) is being administered with increasing frequency either at peak exercise (ExPeak-Reg) or during a slow-down/walking recovery state (ExRec-Reg) rather than at rest (Rest-Reg). The aim of this study was to compare the clinical response of ExPeak-Reg, ExRec-Reg, and Rest-Reg. We compared 531 patients divided equally between Rest-Reg, ExPeak-Reg, and ExRec-Reg matched for age, sex, and BMI. The average systolic blood pressure (SBP) rise following Reg was modest, but there was considerable heterogeneity and the ExPeak-Reg group had a higher percentage of patients who had a SBP rise of 40 mm Hg or a fall of 20 mm Hg than either the ExRec-Reg or the Rest-Reg groups (≥40 mm Hg rise 6.8%, 1.7%, and 1.7%, respectively) (P < .02) (≥20 mm Hg fall 15.8%, 13.0%, and 7.3%, respectively) (P < .05). Chest discomfort, nausea, dizziness, and interfering abdominal radiotracer activity were less common in both exercise Reg groups compared to Rest-Reg (P < .05). Regadenoson injected at peak of symptom-limited exercise was generally well tolerated, but some patients had a significant rise or drop in SBP. There is no apparent advantage of administering regadenoson at peak exercise rather than during walk recovery, and the latter approach may have a greater safety margin.

[The estimation of systemic chemotherapy treatment administered in breast cancer on lysozyme activity in tears--preliminary report].

Science.gov (United States)

Wojciechowska, Katarzyna; Jurowski, Piotr; Wieckowska-Szakiel, Marzena; Rózalska, Barbara

2012-01-01

Estimation of cytostatics influence used in breast cancer treatment on lysozyme activity in human tears depend on time of treatment. 8 women were treated at the base of chemotherapy schema: docetaxel with doxorubicin and 4 women treated with schema CMF: cyclophosphamide, methotrexate, 5-fluorouracil. Lysozyme activity in tears was assessed by measurement of diameter zone of Micrococcus lysodeicticus growth inhibition. It was revealed that both chemotherapy schema caused statistically significant reduction of diameter zone of M. lysodeicticus growth inhibition, after first and second course of chemotherapy treatment. After second chemotherapy course CMF schema induced loss of lysozyme activity in patient's tears (zero mm of M. lysodeicticus diameter zone growth inhibition). Systemic chemotherapy administered in breast cancer induce reduction of lysozyme activity in tears, that may cause higher morbidity of ocular surface infections caused by Gram-positive bacteria.

Effect of self-administered foot reflexology for symptom management in healthy persons: a systematic review and meta-analysis.

Science.gov (United States)

Song, Hyun Jin; Son, Heejeong; Seo, Hyun-Ju; Lee, Heeyoung; Choi, Sun Mi; Lee, Sanghun

2015-02-01

Self-administered foot reflexology is unrestricted by time and space, economical, and practical because it is easy to learn and apply. This study estimated the effectiveness of self-foot reflexology for symptom management in healthy persons through a systematic review and meta-analysis. The participants were healthy persons not diagnosed with a specific disease. The intervention was foot reflexology administered by participants, not by practitioners or healthcare providers. The comparative studies either between groups or within group comparison were included. Our search utilized core databases (MEDLINE, EMBASE, Cochrane, and CINAHL). We also searched Chinese (CNKI), Japanese (J-STAGE), and Korean databases (KoreaMed, KMbase, KISS, NDSL, KISTI, and OASIS). The search was used MeSH terminology and key words (foot reflexology, foot massage, and self). Analysis of three non-randomized trials and three before-and-after studies showed that self-administered foot reflexology resulted in significant improvement in subjective outcomes such as perceived stress, fatigue, and depression. However, there was no significant improvement in objective outcomes such as cortisol levels, blood pressure, and pulse rate. We did not find any randomized controlled trial. This study presents the effectiveness of self-administered foot reflexology for healthy persons' psychological and physiological symptoms. While objective outcomes showed limited results, significant improvements were found in subjective outcomes. However, owing to the small number of studies and methodological flaws, there was insufficient evidence supporting the use of self-performed foot reflexology. Well-designed randomized controlled trials are needed to assess the effect of self-administered foot reflexology in healthy people. Copyright © 2014 Elsevier Ltd. All rights reserved.

Self-administered physical activity questionnaires for the elderly: a systematic review of measurement properties.

Science.gov (United States)

Forsén, Lisa; Loland, Nina Waaler; Vuillemin, Anne; Chinapaw, Mai J M; van Poppel, Mireille N M; Mokkink, Lidwine B; van Mechelen, Willem; Terwee, Caroline B

2010-07-01

To systematically review and appraise studies examining self-administered physical activity questionnaires (PAQ) for the elderly. This article is one of a group of four articles in Sports Medicine on the content and measurement properties of PAQs. LITERATURE SEARCH METHODOLOGY: Searches in PubMed, EMBASE and SportDiscu (until May 2009) on self-administered PAQ. Inclusion criteria were as follows: (i) the study examined (at least one of) the measurement properties of a self-administered PAQ; (ii) the questionnaire aimed to measure physical activity (PA) in older people; (iii) the average age of the study population was >55 years; (iv) the article was written in English. We excluded PA interviews, diaries and studies that evaluated the measurement properties of a self-administered PAQ in a specific population, such as patients. We used a standard checklist (qualitative attributes and measurement properties of PA questionnaires [QAPAQ]) for appraising the measurement properties of PAQs. Eighteen articles on 13 PAQs were reviewed, including 16 reliability analyses and 25 validity analyses (of which 15 were on construct validity, seven on health/functioning associations, two on known-groups validity and one on responsiveness). Many studies suffered from methodological flaws, e.g. too small sample size or inadequate time interval between test and retest. Three PAQs received a positive rating on reliability: IPAQ-C (International Physical Activity Questionnaire-Chinese), intraclass correlation coefficient (ICC) > or = 0.81; WHI-PAQ (Women's Health Initiative-PAQ), ICC = 0.76; and PASE (Physical Activity Scale for the Elderly), Pearson correlation coefficient (r) = 0.84. However, PASE was negatively rated on reliability in another study (ICC = 0.65). One PAQ received a positive rating on construct validity: PASE against Mini-Logger (r > 0.52), but PASE was negatively rated in another study against accelerometer and another PAQ, Spearman correlation coefficient = 0.17 and 0

J/ψ production as a function of charged-particle pseudorapidity density in p–Pb collisions at √sNN = 5.02 TeV

NARCIS (Netherlands)

Adamová, D.; Aggarwal, M. M.; Aglieri Rinella, G.; Agnello, M.; Agrawal, N.; Ahammed, Z.; Ahmad, N.; Ahn, S. U.; Aiola, S.; Akindinov, A.; Alam, S. N.; Albuquerque, D. S. D.; Aleksandrov, D.; Alessandro, B.; Alexandre, D.; Alfaro Molina, R.; Alici, A.; Alkin, A.; Alme, J.; Alt, T.; Altsybeev, I.; Alves Garcia Prado, C.; Janssen, M M; Andrei, C.; Andrews, H. A.; Andronic, A.; Anguelov, V.; Anson, C. D.; Antičić, T.; Antinori, F.; Antonioli, P.; Anwar, R.; Aphecetche, L.; Appelshäuser, H.; Arcelli, S.; Arnaldi, R.; Arnold, O. W.; Arsene, I. C.; Arslandok, M.; Audurier, B.; Augustinus, A.; Averbeck, R.; Azmi, M. D.; Badalà, A.; Baek, Y. W.; Bagnasco, S.; Bailhache, R.; Bala, R.; Baldisseri, A.; Ball, M.C.; Baral, R. C.; Barbano, A. M.; Barbera, R.; Barile, F.; Barioglio, L.; Barnaföldi, G. G.; Barnby, L. S.; Barret, V.; Bartalini, P.; Barth, K.; Bartke, J.; Bartsch, E.; Basile, M.; Bastid, N.; Basu, S.; Bathen, B.; Batigne, G.; Batista Camejo, A.; Batyunya, B.; Batzing, P. C.; Bearden, I. G.; Beck, H.; Bedda, C.|info:eu-repo/dai/nl/411263188; Behera, N. K.; Belikov, I.; Bellini, F.; Bello Martinez, H.; Bellwied, R.; Beltran, L. G. E.; Belyaev, V.; Bencedi, G.; Beole, S.; Bercuci, A.; Berdnikov, Y.; Berenyi, D.; Bertens, R. A.|info:eu-repo/dai/nl/371577810; Berzano, D.; Betev, L.; Bhasin, A.; Bhat, I. R.; Bhati, A. K.; Bhattacharjee, B.; Bhom, J.; Bianchi, L.; Bianchi, N.; Bianchin, C.|info:eu-repo/dai/nl/371578248; Bielčík, J.; Bielčíková, J.; Bilandzic, A.; Biro, G.; Biswas, R.; Biswas, S.; Blair, J. T.; Blau, D.; Blume, C.; Boca, G.; Bock, F.; Bogdanov, A.; Boldizsár, L.; Bombara, M.; Bonomi, G.; Bonora, M.; Book, J.; Borel, H.; Borissov, A.; Borri, M.; Botta, E.; Bourjau, C.; Braun-Munzinger, P.; Bregant, M.; Broker, T. A.; Browning, T. A.; Broz, M.; Brucken, E. J.; Bruna, E.; Bruno, G. E.; Budnikov, D.; Buesching, H.; Bufalino, S.; Buhler, P.; Iga Buitron, S. A.; Buncic, P.; Busch, O.; Buthelezi, Z.; Butt, J. B.; Buxton, J. T.; Cabala, J.; Caffarri, D.; Caines, H.; Caliva, A.|info:eu-repo/dai/nl/411885812; Calvo Villar, E.; Camerini, P.; Capon, A. A.; Carena, F.; Carena, W.; Carnesecchi, F.; Castillo Castellanos, J.; Castro, A. J.; Casula, E. A R; Ceballos Sanchez, C.; Cerello, P.; Chang, B.; Chapeland, S.; Chartier, M.; Charvet, J. L.; Chattopadhyay, S.; Chattopadhyay, S.; Chauvin, A.; Cherney, M.; Cheshkov, C.; Cheynis, B.; Chibante Barroso, V.; Chinellato, D. D.; Cho, Sukhee; Chochula, P.; Choi, K.; Chojnacki, M.|info:eu-repo/dai/nl/411888056; Choudhury, S.; Christakoglou, P.; Christensen, C. H.; Christiansen, P.; Chujo, T.; Chung, S. U.; Cicalo, C.; Cifarelli, L.; Cindolo, F.; Cleymans, J.; Colamaria, F.; Colella, D.; Collu, A.; Colocci, M.; Conesa Balbastre, G.; Conesa del Valle, Z.; Connors, M. E.; Contreras, J. G.; Cormier, T. M.; Corrales Morales, Y.; Cortés Maldonado, I.; Cortese, P.; Cosentino, M. R.; Costa, F.; Costanza, S.; Crkovská, J.; Crochet, P.; Cuautle, E.; Cunqueiro, L.; Dahms, T.; Dainese, A.; Danisch, M. C.; Danu, A.; Das, D.; Das, I.; Das, S.; Dash, A.; Dash, S.; Dasgupta, S. S.; De Caro, A.; De Cataldo, G.; De Conti, C.; De Cuveland, J.; De Falco, A.; De Gruttola, D.; De Marco, N.; De Pasquale, S.; De Souza, R. Derradi; Degenhardt, H. F.; Deisting, A.; Deloff, A.; Deplano, C.; Dhankher, P.; Di Bari, D.; Di Mauro, A.; Di Nezza, P.; Di Ruzza, B.; Diaz Corchero, M. A.; Dietel, T.; Dillenseger, P.; Divià, R.; Djuvsland, O.; Dobrin, A.|info:eu-repo/dai/nl/372618715; Domenicis Gimenez, D.; Dönigus, B.; Dordic, O.; Drozhzhova, T.; Dubey, A. K.; Dubla, A.|info:eu-repo/dai/nl/355502488; Ducroux, L.; Duggal, A. K.; Dupieux, P.; Ehlers, R. J.; Elia, D.; Endress, E.; Engel, H.; Epple, E.; Erazmus, B.; Erhardt, F.; Espagnon, B.; Esumi, S.; Eulisse, G.; Eum, J.; Evans, D.; Evdokimov, S.; Fabbietti, L.; Faivre, J.; Fantoni, A.; Fasel, M.; Feldkamp, L.; Feliciello, A.; Feofilov, G.; Ferencei, J.; Fernández Téllez, A.; Ferreiro, E. G.; Ferretti, A.; Festanti, A.; Feuillard, V. J. G.; Figiel, J.; Figueredo, M. A S; Filchagin, S.; Finogeev, D.; Fionda, F. M.; Fiore, E. M.; Floris, M.; Foertsch, S.; Foka, P.; Fokin, S.; Fragiacomo, E.; Francescon, A.; De Francisco, A.; Frankenfeld, U.; Fronze, G. G.; Fuchs, U.; Furget, C.; Furs, A.; Fusco Girard, M.; Gaardhøje, J. J.; Gagliardi, M.; Gago, A. M.; Gajdosova, K.; Gallio, M.; Galvan, C. D.; Ganoti, P.; Gao, C.; Garabatos, C.; Garcia-Solis, E.; Garg, K.; Garg, P.; Gargiulo, C.; Gasik, P.; Gauger, E. F.; Gay Ducati, M. B.; Germain, M.; Ghosh, P.; Ghosh, S. K.; Gianotti, P.; Giubellino, P.; Giubilato, P.; Gladysz-Dziadus, E.; Glässel, P.; Goméz Coral, D. M.; Gomez Ramirez, A.; Gonzalez, A. S.; Gonzalez, V; González-Zamora, P.; Gorbunov, S.; Görlich, L.; Gotovac, S.; Grabski, V.; Graczykowski, L. K.; Graham, K. L.; Greiner, L. C.; Grelli, A.|info:eu-repo/dai/nl/326052577; Grigoras, C.; Grigoriev, V.; Grigoryan, A.; Grigoryan, S.; Grion, N.; Gronefeld, J. M.; Grosa, F.; Grosse-Oetringhaus, J. F.; Grosso, R.; Gruber, L.; Grull, F. R.; Guber, F.; Guernane, R.; Guerzoni, B.; Gulbrandsen, K.; Gunji, T.; Gupta, A.; Gupta, R.; Guzman, I. B.; Haake, R.; Hadjidakis, C.; Hamagaki, H.; Hamar, G.; Hamon, J. C.; Harris, J. W.; Harton, A.; Hatzifotiadou, D.; Hayashi, S.; Heckel, S. T.; Hellbär, E.; Helstrup, H.; Herghelegiu, A.; Herrera Corral, G.; Herrmann, F.; Hess, B. A.; Hetland, K. F.; Hillemanns, H.; Hippolyte, B.; Hladky, J.; Hohlweger, B.; Horak, D.; Hosokawa, R.; Hristov, P.; Hughes, C.W.; Humanic, T. J.; Hussain, N.; Hussain, T.; Hutter, D.; Hwang, D. S.; Ilkaev, R.; Inaba, M.; Ippolitov, M.; Irfan, M.; Isakov, V.; Islam, M. S.; Ivanov, M.; Ivanov, V.; Izucheev, V.; Jacak, B.; Jacazio, N.; Jacobs, P. M.; Jadhav, M. B.; Jadlovska, S.; Jadlovsky, J.; Jaelani, S.; Jahnke, C.; Jakubowska, M. J.; Janik, M. A.; Jayarathna, P. H S Y; Jena, C.; Jena, S.; Jercic, M.; Jimenez Bustamante, R. T.; Jones, P. G.; Jusko, A.; Kalinak, P.; Kalweit, A.; Kang, J. H.; Kaplin, V.; Kar, S.; Karasu Uysal, A.; Karavichev, O.; Karavicheva, T.; Karayan, L.; Karpechev, E.; Kebschull, U.; Keidel, R.; Keijdener, D. L.D.|info:eu-repo/dai/nl/370530780; Keil, M.; Ketzer, B.; Mohisin Khan, M.; Khan, P.M.; Khan, Shfaqat A.; Khanzadeev, A.; Kharlov, Y.; Khatun, A.; Khuntia, A.; Kielbowicz, M. M.; Kileng, B.; Kim, D. W.; Kim, D. J.; Kim, D.-S.; Kim, H.; Kim, J. S.; Kim, J.; Kim, M.; Kim, M.; Kim, S.; Kim, T.; Kirsch, S.; Kisel, I.; Kiselev, S.; Kisiel, A.; Kiss, G.; Klay, J. L.; Klein, C; Klein, J.; Klein-Bösing, C.; Klewin, S.; Kluge, A.; Knichel, M. L.; Knospe, A. G.; Kobdaj, C.; Kofarago, M.|info:eu-repo/dai/nl/371571227; Kollegger, T.; Kolojvari, A.; Kondratiev, V.; Kondratyeva, N.; Kondratyuk, E.; Konevskikh, A.; Kopcik, M.; Kour, M.; Kouzinopoulos, C.; Kovalenko, O.; Kovalenko, V.; Kowalski, M.L.; Koyithatta Meethaleveedu, G.; Králik, I.; Kravčáková, A.; Krivda, M.; Krizek, F.; Kryshen, E.; Krzewicki, M.|info:eu-repo/dai/nl/362845670; Kubera, A. M.; Kučera, V.; Kuhn, C.; Kuijer, P. G.|info:eu-repo/dai/nl/074064975; Kumar, A.; Kumar, J.; Kumar, L.; Kumar, S.; Kundu, Seema; Kurashvili, P.; Kurepin, A.; Kurepin, A. B.; Kuryakin, A.; Kushpil, S.; Kweon, M. J.; Kwon, Y.; La Pointe, S. L.|info:eu-repo/dai/nl/355080192; La Rocca, P.; Lagana Fernandes, C.; Lakomov, I.; Langoy, R.; Lapidus, K.; Lara, C.; Lardeux, A.; Lattuca, A.; Laudi, E.; Lavicka, R.; Lazaridis, L.; Lea, R.; Leardini, L.; Lee, S.; Lehas, F.|info:eu-repo/dai/nl/411295721; Strunz-Lehner, Christine; Lehrbach, J.; Lemmon, R. C.; Lenti, V.; Leogrande, E.; León Monzón, I.; Lévai, P.; Li, S.; Li, X.; Lien, J.; Lietava, R.; Lindal, S.; Lindenstruth, V.; Lippmann, C.; Lisa, M. A.; Litichevskyi, V.; Ljunggren, H. M.; Llope, W. J.; Lodato, D. F.; Loenne, P. I.; Loginov, V.; Loizides, C.; Loncar, P.; Lopez, X.; López Torres, E.; Lowe, A.; Luettig, P.; Lunardon, M.; Luparello, G.|info:eu-repo/dai/nl/355080400; Lupi, M.; Lutz, T. H.; Maevskaya, A.; Mager, M.; Mahajan, S.; Mahmood, S. M.; Maire, A.; Majka, R. D.; Malaev, M.; Maldonado Cervantes, I.; Malinina, L.; Mal'kevich, D.; Malzacher, P.; Mamonov, A.; Manko, V.; Manso, F.; Manzari, V.; Mao, Y.; Marchisone, M.; Mareš, J.; Margagliotti, G. V.; Margotti, A.; Margutti, J.|info:eu-repo/dai/nl/412461684; Marín, Alicia; Markert, C.; Marquard, M.; Martin, N. A.; Martin Blanco, J.; Martinengo, P.; Martinez, J. A. L.; Martínez, Isabel M.; Martínez García, G.; Martinez Pedreira, M.; Mas, A.; Masciocchi, S.; Masera, M.; Masoni, A.; Mastroserio, A.; Mathis, A. M.; Matyja, A.; mayer, C.; Mazer, J.; Mazzilli, M.; Mazzoni, M. A.; Meddi, F.; Melikyan, Y.; Menchaca-Rocha, A.; Meninno, E.; Mercado Pérez, J.; Meres, M.; Mhlanga, S.; Miake, Y.; Mieskolainen, M. M.; Mihaylov, D. L.; Mikhaylov, K.; Milano, L.; Milosevic, J.; Mischke, A.|info:eu-repo/dai/nl/325781435; Mishra, A. N.; Miśkowiec, D.; Mitra, J.; Mitu, C. M.; Mohammadi, N.|info:eu-repo/dai/nl/369405870; Mohanty, B.; Montes, E.; Moreira De Godoy, D. A.; Moreno, L. A. P.; Moretto, S.; Morreale, A.; Morsch, A.; Muccifora, V.; Mudnic, E.; Mühlheim, D.; Muhuri, S.; Mukherjee, M.; Mulligan, J. D.; Munhoz, M. G.; Münning, K.; Munzer, R. H.; Murakami, H.; Murray, S.; Musa, L.; Musinsky, J.; Myers, C. J.; Naik, B.; Nair, Rajiv; Nandi, B. K.; Nania, R.; Nappi, E.; Naru, M. U.; Natal Da Luz, H.; Nattrass, C.; Navarro, S. R.; Nayak, K.; Nayak, R.; Nayak, T. K.; Nazarenko, S.; Nedosekin, A.; Negrao De Oliveira, R. A.; Nellen, L.; Nesbo, S. V.; Ng, F.; Nicassio, M.; Niculescu, M.; Niedziela, J.; Nielsen, B. S.; Nikolaev, S.; Nikulin, S.; Nikulin, V.; Noferini, F.; Nomokonov, P.; Nooren, G.|info:eu-repo/dai/nl/07051349X; Noris, J. C. C.; Norman, J.; Nyanin, A.; Nystrand, J.; Oeschler, H.; Oh, S.; Ohlson, A.; Okubo, T.; Olah, L.; Oleniacz, J.; Oliveira Da Silva, A. C.|info:eu-repo/dai/nl/323375618; Oliver, M. H.; Onderwaater, J.; Oppedisano, C.; Orava, R.; Oravec, M.; Ortiz Velasquez, A.; Oskarsson, A.; Otwinowski, J.; Oyama, K.; Pachmayer, Y.; Pacik, V.; Pagano, D.; Pagano, P.; Paić, G.; Palni, P.; Pan, J.; Pandey, A. K.; Panebianco, S.; Papikyan, V.; Pappalardo, G. S.; Pareek, P.; Park, J.; Park, J.-W.; Parmar, S.; Passfeld, A.; Pathak, S. P.; Paticchio, V.; Patra, R. N.; Paul, B.; Pei, H.; Peitzmann, T.|info:eu-repo/dai/nl/304833959; Peng, X.; Pereira, L. G.; Pereira Da Costa, H.; Peresunko, D.; Perez Lezama, E.; Peskov, V.; Pestov, Y.; Petráček, V.; Petrov, V.; Petrovici, M.; Petta, C.; Pezzi, R. P.; Piano, S.; Pikna, M.; Pillot, P.; Pimentel, L. O. D. L.; Pinazza, O.; Pinsky, L.; Piyarathna, D. B.; Płoskoń, M.; Planinic, M.; Pluta, J.; Pochybova, S.; Podesta-Lerma, P. L M; Poghosyan, M. G.; Polichtchouk, B.; Poljak, N.; Poonsawat, W.; Pop, A.; Poppenborg, H.; Porteboeuf-Houssais, S.; Porter, J.; Pospisil, J.; Pozdniakov, V.; Prasad, S. K.; Preghenella, R.; Prino, F.; Pruneau, C. A.; Pshenichnov, I.; Puccio, M.; Puddu, G.; Pujahari, P.; Punin, V.; Putschke, J.; Qvigstad, H.; Rachevski, A.; Raha, S.; Rajput, S.; Rak, J.; Rakotozafindrabe, A.; Ramello, L.; Rami, F.; Rana, D. B.; Raniwala, R.; Raniwala, S.; Räsänen, S.; Rascanu, B. T.; Rathee, D.; Ratza, V.; Ravasenga, I.; Read, K. F.; Redlich, K.; Rehman, A.; Reichelt, P.; Reidt, F.; Ren, X.; Renfordt, R.; Reolon, A. R.; Reshetin, A.; Reygers, K.; Riabov, V.; Ricci, R. A.; Richert, T.|info:eu-repo/dai/nl/413319628; Richter, M.; Riedler, P.; Riegler, W.; Riggi, F.; Ristea, C.; Rodríguez Cahuantzi, M.; Røed, K.; Rogochaya, E.; Rohr, D.; Röhrich, D.; Rokita, P. S.; Ronchetti, F.; Ronflette, L.; Rosnet, P.; Rossi, A.; Rotondi, A.; Roukoutakis, F.; Roy, A.; Roy, C.; Roy, P.; Rubio Montero, A. J.; Rui, R.; Russo, R.; Rustamov, A.; Ryabinkin, E.; Ryabov, Y.; Rybicki, A.; Saarinen, S.; Sadhu, S.; Sadovsky, S.; Šafařík, K.; Saha, S. K.; Sahlmuller, B.; Sahoo, B.; Sahoo, P.; Sahoo, R.; Sahoo, S.; Sahu, P. K.; Saini, J.; Sakai, S.; Saleh, M. A.; Salzwedel, J.; Sambyal, S.; Samsonov, V.; Sandoval, A.; Sarkar, D.; Sarkar, N.; Sarma, P.; Sas, M. H.P.|info:eu-repo/dai/nl/413332993; Scapparone, E.; Scarlassara, F.; Scharenberg, R. P.; Scheid, H. S.; Schiaua, C.; Schicker, R.; Schmidt, C.; Schmidt, H. R.; Schmidt, M. O.; Schmidt, M.; Schuchmann, S.; Schukraft, J.; Schutz, Y.; Schwarz, K.; Schweda, K.; Scioli, G.; Scomparin, E.; Scott, R.; Šefčík, M.; Seger, J. E.; Sekiguchi, Y.; Sekihata, D.; Selyuzhenkov, I.; Senosi, K.; Senyukov, S.; Serradilla, E.; Sett, P.; Sevcenco, A.; Shabanov, A.; Shabetai, A.; Shadura, O.; Shahoyan, R.; Shangaraev, A.; Sharma, A.; Sharma, A.; Sharma, M.; Sharma, M.; Sharma, N.; Sheikh, A. I.; Shigaki, K.; Shou, Q. Y.; Shtejer, K.; Sibiriak, Y.; Siddhanta, S.; Sielewicz, K. M.; Siemiarczuk, T.; Silvermyr, D.; Silvestre, C.; Simatovic, G.; Simonetti, G.; Singaraju, R.; Singh, R; Singhal, V.; Sinha, T.; Sitar, B.; Sitta, M.; Skaali, T. B.; Slupecki, M.; Smirnov, N.; Snellings, R. J.M.|info:eu-repo/dai/nl/165585781; Snellman, T. W.; Song, J.; Song, M.; Soramel, F.; Sorensen, S.; Sozzi, F.; Spiriti, E.; Sputowska, I.; Srivastava, B. K.; Stachel, J.; Stan, I.; Stankus, P.; Stenlund, E.; Stiller, J. H.; Stocco, D.; Strmen, P.; Suaide, A. A P; Sugitate, T.; Suire, C.; Suleymanov, M.; Suljic, M.; Sultanov, R.; Šumbera, M.; Sumowidagdo, S.; Suzuki, K.; Swain, S.; Szabo, A.; Szarka, I.; Szczepankiewicz, A.; Szymanski, M.; Tabassam, U.; Takahashi, J.; Tambave, G. J.; Tanaka, N.; Tarhini, M.; Tariq, M.; Tarzila, M. G.; Tauro, A.; Tejeda Muñoz, G.; Telesca, A.; Terasaki, K.; Terrevoli, C.; Teyssier, B.; Thakur, D.; Thakur, J. S.; Thomas, D.; Tieulent, R.; Tikhonov, A.; Timmins, A. R.; Toia, A.; tripathy, S.; Trogolo, S.; Trombetta, G.; Trubnikov, V.; Trzaska, W. H.; Trzeciak, B. A.; Tsuji, T.; Tumkin, A.; Turrisi, R.; Tveter, T. S.; Ullaland, K.; Umaka, E. N.; Uras, A.; Usai, G. L.; Utrobicic, A.; Vala, M.; Van Der Maarel, J.|info:eu-repo/dai/nl/412860996; Van Hoorne, J. W.; van Leeuwen, M.|info:eu-repo/dai/nl/250599171; Vanat, T.; Vande Vyvre, P.; Varga, D.; Vargas, A.; Vargyas, M.; Varma, R.; Vasileiou, M.; Vasiliev, A.; Vauthier, A.; Vázquez Doce, O.; Vechernin, V.; Veen, A. M.|info:eu-repo/dai/nl/413533751; Velure, A.; Vercellin, E.; Vergara Limón, S.; Vernet, R.; Vértesi, R.; Vickovic, L.; Vigolo, S.; Viinikainen, J.; Vilakazi, Z.; Villalobos Baillie, O.; Villatoro Tello, A.; Vinogradov, A.; Vinogradov, L.; Virgili, T.; Vislavicius, V.; Vodopyanov, A.; Völkl, M. A.; Voloshin, K.; Voloshin, S. A.; Volpe, G.; Haller, B.; Vorobyev, I.; Voscek, D.; Vranic, D.; Vrláková, J.; Wagner, B.; Wagner, J.; Wang, H.|info:eu-repo/dai/nl/369509307; Wang, M.; Watanabe, D.; Watanabe, Y.; Weber, M.; Weber, S. G.; Weiser, D. F.; Wessels, J. P.; Westerhoff, U.; Whitehead, A. M.; Wiechula, J.; Wikne, J.; Wilk, G.; Wilkinson, J.; Willems, G. A.; Williams, M. C S; Windelband, B.; Winn, M.; Witt, W. E.; Yalcin, S.; Yang, P.; Yano, S.; Yin, Z.; Yokoyama, H.; Yoo, I. K.; Yoon, J. H.; Yurchenko, V.; Zaccolo, V.; Zaman, A.; Zampolli, C.; Zanoli, H. J. C.; Zardoshti, N.; Zarochentsev, A.; Závada, P.; Zaviyalov, N.; Zbroszczyk, H.; Zhalov, M.; Zhang, H.; Zhang, X.; Zhang, Y.; Zhang, C.; Zhang, Z.; Zhao, C.; Zhigareva, N.; Zhou, D.; Zhou, Y.; Zhou, Z.; Zhu, H.; Zhu, J.; Zhu, X.; Zichichi, A.; Zimmermann, A.; Zimmermann, M. B.; Zimmermann, S.; Zinovjev, G.; Zmeskal, J.

2018-01-01

We report measurements of the inclusive J/ψ yield and average transverse momentum as a function of charged-particle pseudorapidity density dNch/dη in p–Pb collisions at √sNN = 5.02 TeV with ALICE at the LHC. The observables are normalised to their corresponding averages in non-single diffractive

Thermal expansion of CeCu5.8Ag0.2

International Nuclear Information System (INIS)

Kuechler, R.; Gegenwart, P.; Heuser, K.; Scheidt, E.-W.; Stewart, G.R.; Steglich, F.

2005-01-01

We present low-temperature thermal expansion measurements on the heavy fermion system CeCu 5.8 Ag 0.2 , which is located at an antiferromagnetic (AF) quantum critical point (QCP). At zero magnetic field, the volume expansion coefficient divided by temperature shows a logarithmic divergence upon cooling below 1K. This temperature dependence is incompatible with the predictions of the itinerant spin-density wave theory for an AF QCP. The application of magnetic fields leads to a cross-over to Landau Fermi liquid behavior as expected for a zero-field QCP

40 CFR 147.1703 - EPA-administered program-Indian lands.

Science.gov (United States)

2010-07-01

... Carolina § 147.1703 EPA-administered program—Indian lands. (a) Contents. The UIC program for all classes of wells on Indian lands in the State of North Carolina is administered by EPA. This program consists of... these requirements. (b) Effective date. The effective date of the UIC program for Indian lands in North...

DS02 uncertainty analysis

International Nuclear Information System (INIS)

Kaul, Dean C.; Egbert, Stephen D.; Woolson, William A.

2005-01-01

In order to avoid the pitfalls that so discredited DS86 and its uncertainty estimates, and to provide DS02 uncertainties that are both defensible and credible, this report not only presents the ensemble uncertainties assembled from uncertainties in individual computational elements and radiation dose components but also describes how these relate to comparisons between observed and computed quantities at critical intervals in the computational process. These comparisons include those between observed and calculated radiation free-field components, where observations include thermal- and fast-neutron activation and gamma-ray thermoluminescence, which are relevant to the estimated systematic uncertainty for DS02. The comparisons also include those between calculated and observed survivor shielding, where the observations consist of biodosimetric measurements for individual survivors, which are relevant to the estimated random uncertainty for DS02. (J.P.N.)

Collective flow in 2.76 and 5.02 A TeV Pb + Pb collisions

Energy Technology Data Exchange (ETDEWEB)

Zhao, Wenbin; Xu, Hao-jie [Peking University, Department of Physics and State Key Laboratory of Nuclear Physics and Technology, Beijing (China); Song, Huichao [Peking University, Department of Physics and State Key Laboratory of Nuclear Physics and Technology, Beijing (China); Collaborative Innovation Center of Quantum Matter, Beijing (China); Peking University, Center for High Energy Physics, Beijing (China)

2017-09-15

In this paper, we study and predict flow observables in 2.76 and 5.02 A TeV Pb + Pb collisions, using the iEBE-VISHNU hybrid model with TRENTo and AMPT initial conditions and with different forms of the QGP transport coefficients. With properly chosen and tuned parameter sets, our model calculations can nicely describe various flow observables in 2.76 A TeV Pb + Pb collisions, as well as the measured flow harmonics of all charged hadrons in 5.02 A TeV Pb + Pb collisions. We also predict other flow observables, including v{sub n}(p{sub T}) of identified particles, event-by-event v{sub n} distributions, event-plane correlations, (normalized) symmetric cumulants, non-linear response coefficients and p{sub T}-dependent factorization ratios, in 5.02 A TeV Pb + Pb collisions. We find many of these observables to remain approximately the same values as the ones in 2.76 A TeV Pb + Pb collisions. Our theoretical studies and predictions could shed light to the experimental investigations in the near future. (orig.)

A self-administered method of acute pressure block of sciatic nerves for short-term relief of dental pain: a randomized study.

Science.gov (United States)

Wang, Xiaolin; Zhao, Wanghong; Wang, Ye; Hu, Jiao; Chen, Qiu; Yu, Juncai; Wu, Bin; Huang, Rong; Gao, Jie; He, Jiman

2014-08-01

While stimulation of the peripheral nerves increases the pain threshold, chronic pressure stimulation of the sciatic nerve is associated with sciatica. We recently found that acute pressure block of the sciatic nerve inhibits pain. Therefore, we propose that, the pain pathology-causing pressure is chronic, not acute. Here, we report a novel self-administered method: acute pressure block of the sciatic nerves is applied by the patients themselves for short-term relief of pain from dental diseases. This was a randomized, single-blind study. Hospital patients. Patients aged 16-60 years with acute pulpitis, acute apical periodontitis, or pericoronitis of the third molar of the mandible experiencing pain ≥3 on the 11-point numerical pain rating scale. Three-minute pressure to sciatic nerves was applied by using the hands (hand pressure method) or by having the patients squat to force the thigh and shin as tightly as possible on the sandwiched sciatic nerve bundles (self-administered method). The primary efficacy variable was the mean difference in pain scores from the baseline. One hundred seventy-two dental patients were randomized. The self-administered method produced significant relief from pain associated with dental diseases (P ≤ 0.001). The analgesic effect of the self-administered method was similar to that of the hand pressure method. The self-administered method is easy to learn and can be applied at any time for pain relief. We believe that patients will benefit from this method. © 2014 The Authors. Pain Medicine published by Wiley Periodicals, Inc. on behalf of American Academy of Pain Medicine.

Transverse stress induced LP 02-LP 21 modal interference of stimulated Raman scattered light in a few-mode optical fiber

Science.gov (United States)

Sharma, A.; Posey, R.

1996-02-01

Four-photon mixing followed by stimulated Raman scattering is observed in LP 02 mode in a 7.9 μm core diameter optical fiber. A localized transverse stress efficiency couples LP 02 to the LP 21 mode with a macroscopic beat length of 1.8 mm. LP 02-LP 21 modal interference is investigated by detecting the 550-590 nm SRS through a pinhole in the far field exit plane. Quantitative explanation of wavelength dependent intensity modulation results in a precise experimental determination of {∂[β 02(λ) - β 21(λ)] }/{∂λ}, for mode-propagation constants β02( λ) and β21( λ) of LP 02 and LP 21 modes respectively, as well as Δ, the relative core-cladding refractive index difference. The LP 02-LP 21 modal interference is used for sensing of temperature between 50-300°C.

Walk a Mile in My Shoes: Stakeholder Accounts of Testing Experience with a Computer-Administered Test

Science.gov (United States)

Fox, Janna; Cheng, Liying

2015-01-01

In keeping with the trend to elicit multiple stakeholder responses to operational tests as part of test validation, this exploratory mixed methods study examines test-taker accounts of an Internet-based (i.e., computer-administered) test in the high-stakes context of proficiency testing for university admission. In 2013, as language testing…

Experiment data report for semiscale Mod-1 test S-02-3 (blowdown heat transfer test)

International Nuclear Information System (INIS)

Crapo, H.S.; Jensen, M.F.; Sackett, K.E.

1975-09-01

Recorded test data are presented for Test S-02-3 of the Semiscale Mod-1 blowdown heat transfer test series. Test S-02-3 was conducted from an initial cold leg fluid temperature of 544 0 F and an initial pressure of 2,263 psig. A simulated double-ended offset shear cold leg break was used to investigate the system response to a depressurization transient with a moderately heated core (75 percent design power level). An electrically heated core was used in the pressure vessel to simulate the effects of a nuclear core. System flow was also set at the 75 percent design level to achieve full core temperature differential. The flow resistance of the intact loop was based on core area scaling. During system depressurization, core power was reduced from the initial level of 1.2 MW in such a manner as to simulate the surface heat flux response of the LOFT nuclear fuel rods until such time that departure from nucleate boiling (DNB) occurs. Blowdown to the pressure suppression system was accomplished without simulated emergency core coolant injection or pressure suppression system coolant spray

22 CFR 231.02 - Definitions.

Science.gov (United States)

2010-04-01

... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Definitions. 231.02 Section 231.02 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT ARAB REPUBLIC OF EGYPT LOAN GUARANTEES ISSUED UNDER THE EMERGENCY WARTIME SUPPLEMENTAL APPROPRIATIONS ACT OF 2003, PUBLIC LAW 108-11-STANDARD TERMS AND CONDITIONS...

Differences in lercanidipine systemic exposure when administered according to labelling: in fasting state and 15 minutes before food intake.

Science.gov (United States)

Álvarez, Covadonga; Gómez, Estrella; Simón, Marta; Govantes, Carlos; Guerra, Pedro; Frías, Jesús; García-Arieta, Alfredo

2012-07-01

The aim of this study was to compare the systemic exposure of lercanidipine (Zanidip) after oral administration in the fasted state and 15 min before food intake (meals) to investigate if the recommendations in the Summary of Product Characteristics (SPC) with respect to the intake of meals are adequate. The results of three pilot bioequivalence studies performed to develop a lercanidipine generic product, where Zanidip was administered consistently as reference product in the fasted state or 15 min before a standard breakfast, were compared to estimate the drug–food interaction and the similarity of the methods of administration defined in the SPC. The ingestion of a standard (non-high-fat, non-high-calorie) meal 15 min after drug intake increased the area under the concentration–time curve (AUC(0-t)) of S-lercanidipine by 1.78-fold [90% confidence interval (CI) 1.48–2.15, Pfood intake does not seem to be consistent with this recommendation. The Marketing Authorisation Holder should clarify the dosing instructions in relation to meals and identify a sufficient time-lapse to ensure an exposure similar to that obtained in phase III clinical efficacy studies.

New Fabrication Method of Three-Electrode System on Cylindrical Capillary Surface as a Flexible Implantable Microneedle

Science.gov (United States)

Yang, Zhuoqing; Zhang, Yi; Itoh, Toshihiro; Maeda, Ryutaro

2013-04-01

In this present paper, a three-electrode system has been fabricated and integrated on the cylindrical polymer capillary surface by micromachining technology, which could be used as a flexible and implantable microneedle for glucose sensor application in future. A UV lithography system is successfully developed for high resolution alignment on cylindrical substrates. The multilayer alignment exposure for cylindrical polymer capillary substrate is for the first time realized utilizing the lithography system. The ±1 μm alignment precision has been realized on the 330 μm-outer diameter polymer capillary surface, on which the three-electrode structure consisting of two platinum electrodes and one Ag/AgCl reference electrode has been fabricated. The fabricated whole device as microneedle for glucose sensor application has been also characterized in 1 mol/L KCl and 0.02 mol/L K3Fe(CN)6 mix solution. The measured cyclic voltammetry curve shows that the prepared three-electrode system has a good redox property.

F-theory and 2d (0,2) theories

Energy Technology Data Exchange (ETDEWEB)

Schäfer-Nameki, Sakura [Department of Mathematics, King’s College London, The Strand, London WC2R 2LS (United Kingdom); Weigand, Timo [Institut für Theoretische Physik, Ruprecht-Karls-Universität,Philosophenweg 19, 69120 Heidelberg (Germany)

2016-05-11

F-theory compactified on singular, elliptically fibered Calabi-Yau five-folds gives rise to two-dimensional gauge theories preserving N=(0,2) supersymmetry. In this paper we initiate the study of such compactifications and determine the dictionary between the geometric data of the elliptic fibration and the 2d gauge theory such as the matter content in terms of (0,2) superfields and their supersymmetric couplings. We study this setup both from a gauge-theoretic point of view, in terms of the partially twisted 7-brane theory, and provide a global geometric description based on the structure of the elliptic fibration and its singularities. Global consistency conditions are determined and checked against the dual M-theory compactification to one dimension. This includes a discussion of gauge anomalies, the structure of the Green-Schwarz terms and the Chern-Simons couplings in the dual M-theory supersymmetric quantum mechanics. Furthermore, by interpreting the resulting 2d (0,2) theories as heterotic worldsheet theories, we propose a correspondence between the geometric data of elliptically fibered Calabi-Yau five-folds and the target space of a heterotic gauged linear sigma-model (GLSM). In particular the correspondence between the Landau-Ginsburg and sigma-model phase of a 2d (0,2) GLSM is realized via different T-branes or gluing data in F-theory.

Study of the potentiometric properties of spinel-type manganese oxide doped with gallium and anions Ga0.02Mn1.98O3.98X0.02 (X = S2− and F−) as selective sensor for lithium ion

International Nuclear Information System (INIS)

David-Parra, Diego N.; Bocchi, Nerilso; Teixeira, Marcos F.S.

2015-01-01

Highlights: • Investigated the influence of doping agents on the potentiometric response • Reduction of the unit cell size affected directly in the potentiometric performance of the electrode • Sensor performance increased in the order: Ga 0.02 Mn 1.98 O 4 > Ga 0.02 Mn 1.98 O 3.98 S 0.02 > Ga 0.02 Mn 1.98 O 3.98 F 0.02 . - Abstract: This paper describes the development of a selective lithium ion sensor based on spinel-type manganese oxide doped with gallium and anions (Ga 0.02 Mn 1.98 O 3.98 X 0.02 , where X = S 2− and F − ). Investigation was made of the influence of cationic and/or anionic doping agents on the potentiometric response of the sensor. Experimental parameters evaluated included the effect of the lithium concentration on activation of the sensor by cyclic voltammetry, the pH of the electrolyte solution, and the selectivity towards Li + compared to other alkali and alkaline-earth metal ions. There was an important influence of the unit cell size of the material on the linear range, detection limit, and selectivity of the sensor. Reduction in the size of the tunnel for insertion of the lithium in the porous structure of the oxide directly affected the potentiometric performance of the electrode. Sensor performance increased in the order: Ga 0.02 Mn 1.98 O 4 > Ga 0.02 Mn 1.98 O 3.98 S 0.02 > Ga 0.02 Mn 1.98 O 3.98 F 0.02 . The observed super-Nernstian response could be explained by a mixed potential arising from two equilibria (redox and ion exchange) in the spinel-type manganese oxide. Sensitivity and the influence of pH on the electrode response were directly related to the doping agents present in the oxide structure

Development of a Grid-Independent Geos-Chem Chemical Transport Model (v9-02) as an Atmospheric Chemistry Module for Earth System Models

Science.gov (United States)

Long, M. S.; Yantosca, R.; Nielsen, J. E; Keller, C. A.; Da Silva, A.; Sulprizio, M. P.; Pawson, S.; Jacob, D. J.

2015-01-01

The GEOS-Chem global chemical transport model (CTM), used by a large atmospheric chemistry research community, has been re-engineered to also serve as an atmospheric chemistry module for Earth system models (ESMs). This was done using an Earth System Modeling Framework (ESMF) interface that operates independently of the GEOSChem scientific code, permitting the exact same GEOSChem code to be used as an ESM module or as a standalone CTM. In this manner, the continual stream of updates contributed by the CTM user community is automatically passed on to the ESM module, which remains state of science and referenced to the latest version of the standard GEOS-Chem CTM. A major step in this re-engineering was to make GEOS-Chem grid independent, i.e., capable of using any geophysical grid specified at run time. GEOS-Chem data sockets were also created for communication between modules and with external ESM code. The grid-independent, ESMF-compatible GEOS-Chem is now the standard version of the GEOS-Chem CTM. It has been implemented as an atmospheric chemistry module into the NASA GEOS- 5 ESM. The coupled GEOS-5-GEOS-Chem system was tested for scalability and performance with a tropospheric oxidant-aerosol simulation (120 coupled species, 66 transported tracers) using 48-240 cores and message-passing interface (MPI) distributed-memory parallelization. Numerical experiments demonstrate that the GEOS-Chem chemistry module scales efficiently for the number of cores tested, with no degradation as the number of cores increases. Although inclusion of atmospheric chemistry in ESMs is computationally expensive, the excellent scalability of the chemistry module means that the relative cost goes down with increasing number of cores in a massively parallel environment.

Argon laser peripheral iridoplasty versus systemic intraocular pressure-lowering medications as immediate management for acute phacomorphic angle closure

Directory of Open Access Journals (Sweden)

Lee JW

2013-01-01

Full Text Available Jacky WY Lee,1 Jimmy SM Lai,1 Doris WF Yick,2 Can YF Yuen21Department of Ophthalmology, University of Hong Kong, 2Department of Ophthalmology, The Caritas Medical Centre, Kowloon West Cluster, Hong Kong, People’s Republic of ChinaBackground: The purpose of this study was to compare the efficacy and safety of argon laser peripheral iridoplasty (ALPI and systemic intraocular pressure (IOP-lowering medications in the immediate management of acute phacomorphic angle closure.Methods: Consecutive cases of acute phacomorphic angle closure were randomized to receive ALPI and an intravenous or oral carbonic anhydrase inhibitor as initial treatment. Intravenous mannitol was administered for presenting IOP > 60 mmHg or IOP > 40 mmHg 2 hours posttreatment in both arms.Results: Of 10 consecutive cases, six received medical therapy and four received ALPI. Fifty percent in the medical group and none in the ALPI group required intravenous mannitol. The ALPI group took less time to achieve IOP < 25 mmHg (18.8 ± 7.5 minutes versus 115.0 ± 97.0 minutes, P = 0.001, F test; had a greater IOP reduction within 30 minutes (69.8% ± 7.7% versus 40.9 ± 23.9%, P = 0.03, t-test; and had a consistently smaller post-attack cup to disc ratio (0.50 ± 0.02 versus 0.60 ± 0.20, P = 0.002, F test.Conclusion: ALPI offers greater safety, consistency, and efficacy than systemic IOP-lowering medications as initial treatment for phacomorphic angle closure.Keywords: phacomorphic, glaucoma, argon laser peripheral iridoplasty, medical, intraocular pressure

Intravenously administered lidocaine in therapeutic doses increases the intraspinal release of acetylcholine in rats

DEFF Research Database (Denmark)

Abelson, Klas S P; Höglund, A Urban

2002-01-01

The local anesthetic lidocaine suppresses different pain conditions when administered systemically. Part of the antinociceptive effect appears to be mediated via receptor mechanisms. We have previously shown that muscarinic and nicotinic agonists that produce antinociception increase the intraspi...

Two-week course of preoperative chemoradiotherapy followed by delayed surgery for rectal cancer: A phase II multi-institutional clinical trial (KROG 11-02)

International Nuclear Information System (INIS)

Lee, Jong Hoon; Kim, Jun-Gi; Oh, Seong Taek; Lee, Myung Ah; Chun, Hoo Geun; Kim, Dae Yong; Kim, Tae Hyun; Kim, Sun Young; Baek, Ji Yeon; Park, Ji Won; Oh, Jae Hwan; Park, Hee Chul; Choi, Doo Ho; Park, Young Suk; Kim, Hee Cheol; Chie, Eui Kyu; Jang, Hong Seok

2014-01-01

Purpose: The aim of this study was to evaluate the efficacy and safety of a two-week schedule of radiotherapy with oral capecitabine in locally advanced rectal cancer. Methods and materials: Eighty patients with rectal cancer located in the mid to low rectum, staged cT3-4N0-2M0, were prospectively enrolled. They underwent preoperative chemoradiotherapy and delayed surgery 6–8 weeks after the completion of radiation therapy. A radiation dose of 33 Gy in 10 fractions was delivered to the pelvis for 2 weeks. One cycle of oral capecitabine was administered at a dose of 1650 mg/m 2 /day during radiotherapy. Tumor response and toxicity were the study endpoints. This study was registered at ClinicalTrials.gov (number, (NCT01431599)). Results: All included patients underwent total mesorectal excisions including 12 cases of robot assisted surgery and 50 cases of laparoscopic surgery. Of the 80 patients, 27 (33.8%) achieved downstaging (ypT0-2N0) of a rectal tumor and 11 (13.8%) had a pathologically complete response (ypCR). Downstaging rates were 45% for T classification and 65% for N classification. Sphincter saving was achieved in 73 (91.3%) of the 80 patients. Of the 80 patients, 3 (3.8%) experienced grade 3 hematologic toxicity, and 2 (2.5%) had grade 3 postoperative complications such as ileus and wound dehiscence. There was no grade 4 toxicity. Conclusion: A two-week schedule of radiotherapy with oral capecitabine in locally advanced rectal cancer patients showed low toxicity profiles and promising results in terms of tumor response

On the coexistence of copper-molybdenum bronzes: CuxMoO3 (0.2 yMoO3-z (0.1 2-O quasi-ternary system

International Nuclear Information System (INIS)

Warner, T.E.; Skou, E.M.

2010-01-01

Two copper-molybdenum bronzes: Cu y MoO 3-z (0.1 x MoO 3 (0.2 3 at 600 o C under argon in Pt crucibles. Powder XRD showed that the material with global composition '0.1Cu.MoO 3 ' comprises ∼Cu 0.15 MoO 3 and MoO 3 ; whilst '0.2Cu.MoO 3 ' comprises ∼Cu 0.15 MoO 3 and ∼Cu 0.23 MoO 3 . DTA performed on '0.2Cu.MoO 3 ' reveals a reversible solid state phase transition ∼520 o C under argon. Reacting equimolar amounts of Cu 2 O and MoO 2 at 600 o C in a Cu crucible under argon yields: Cu 6 Mo 5 O 18 , Cu and MoO 2 . A tentative subsolidus Cu-MoO 2 -O isothermal (∼25 o C) phase diagram under argon is drawn from these data. Oxidation states of Cu and Mo within this system are discussed.

42 CFR 2a.5 - Contents of application; research projects in which drugs will be administered.

Science.gov (United States)

2010-10-01

... application; research projects in which drugs will be administered. (a) In addition to the information... drug shall contain: (1) Identification of the drugs to be administered in the research project and a... project will be conducted. (b) An application for an authorization of confidentiality with respect to a...

Repetitive immunization enhances the susceptibility of mice to peripherally administered prions.

Directory of Open Access Journals (Sweden)

Juliane Bremer

Full Text Available The susceptibility of humans and animals to prion infections is determined by the virulence of the infectious agent, by genetic modifiers, and by hitherto unknown host and environmental risk factors. While little is known about the latter two, the activation state of the immune system was surmised to influence prion susceptibility. Here we administered prions to mice that were repeatedly immunized by two initial injections of CpG oligodeoxynucleotides followed by repeated injections of bovine serum albumin/alum. Immunization greatly reduced the required dosage of peripherally administered prion inoculum necessary to induce scrapie in 50% of mice. No difference in susceptibility was observed following intracerebral prion challenge. Due to its profound impact onto scrapie susceptibility, the host immune status may determine disease penetrance after low-dose prion exposure, including those that may give rise to iatrogenic and variant Creutzfeldt-Jakob disease.

Electrochemical Properties of the LiNi0.6Co0.2Mn0.2O2 Cathode Material Modified by Lithium Tungstate under High Voltage.

Science.gov (United States)

Fu, Jiale; Mu, Daobin; Wu, Borong; Bi, Jiaying; Cui, Hui; Yang, Hao; Wu, Hanfeng; Wu, Feng

2018-05-31

An amount (5 wt %) of lithium tungstate (Li 2 WO 4 ) as an additive significantly improves the cycle and rate performances of the LiNi 0.6 Co 0.2 Mn 0.2 O 2 electrode at the cutoff voltage of 4.6 V. The 5 wt % Li 2 WO 4 -mixed LiNi 0.6 Co 0.2 Mn 0.2 O 2 electrode delivers a reversible capacity of 199.2 mA h g -1 and keeps 73.1% capacity for 200 cycles at 1 C. It retains 67.4% capacity after 200 cycles at 2 C and delivers a discharge capacity of 167.3 mA h g -1 at 10 C, while those of the pristine electrode are only 44.7% and 87.5 mA h g -1 , respectively. It is shown that the structure of the LiNi 0.6 Co 0.2 Mn 0.2 O 2 cathode material is not affected by mixing Li 2 WO 4 . The introduced Li 2 WO 4 effectively restrains the LiPF 6 and carbonate solvent decomposition by consuming PF 5 at high cutoff voltage, forming a stable cathode/electrolyte interface film with low resistance.

77 FR 20871 - Praesidian Capital Opportunity Fund III, LP; License No. 02/02-0647; Notice Seeking Exemption...

Science.gov (United States)

2012-04-06

... contemplated to fund working capital and capital expenditures. The financing is brought within the purview of... SMALL BUSINESS ADMINISTRATION Praesidian Capital Opportunity Fund III, LP; License No. 02/02- 0647... given that Praesidian Capital Opportunity Fund III, LP, 419 Park Avenue South, New York, NY 10016, a...

Design heating test section HeaTiNG-02

International Nuclear Information System (INIS)

Riswan Djambiar; Sagino; Dedy Haryanto; Joko Prasetio Witoko

2013-01-01

HeaTiNG-02 is a component test loop BETA which serves as a heater in conducting experimental heat transfer processes in two-phase flow in narrow slit-shaped plate, considering this phenomenon is one of the conditions postulated accident scenarios a NPP type PWR. To produce heat for the heating component takes the AC power the source voltage can be set from 0 Volts to 220 Volts with no more than a maximum power of 25 KVA. To obtain the thermal conditions on HeaTiNG-02 heating wire dimensions need to be determined and the corresponding voltage so that it will an expected power. Determination of the dimensions of the heater wire through calculations using electricity formulations. Retrieved draft heater test BETA (UUB) HeaTiNG-02 use material super kanthal (FeCuAl) in diameter (Ø) = 2 mm and wire length 3770 mm. Voltage regulators with a maximum power of 25 kVA with a minimum voltage of 0 volts and a maximum of 220 volts. Heater is used as the base to form refractory stone trench. (author)

A review of toxic epidermal necrolysis management in Japan

Directory of Open Access Journals (Sweden)

Yuri Kinoshita

2017-01-01

Full Text Available Toxic epidermal necrolysis (TEN is a severe adverse drug reaction characterized by necrosis of the epidermis. Its incidence is approximately 1 per million a year and average mortality rate is high at 25–50%. TEN has a flu-like prodrome, followed by atypical, targetoid erythematous or purpuric macules on the skin. These macules coalesce to form flaccid blisters that slough off as areas of epidermal necrosis. Drugs such as allopurinol, sulfonamides, and carbamazepine are the most common causes. The human leukocyte antigen (HLA-B*15:02 in Asians being administered carbamazepine and the HLA-B*58:01 antigen in patients of all ethnicities being administered allopurinol are known to be high-risk factors. Rapid diagnosis, discontinuation of the causative drug, and supportive treatment are essential for better prognosis and improvement of sequelae. Till now, systemic corticosteroids and intravenous immunoglobulins have been used as the most common active interventions; however, no gold standard has been established. In Japan, physicians follow a unique diagnostic criteria and treatment guideline to improve the diagnosis rate and streamline treatments. This may be a contributing factor for the lower mortality rate (14.3%. The efficacy of systemic corticosteroids, immunoglobulins, and plasmapheresis may have been beneficial as well. In Japan, TEN is defined as an epidermal detachment of over 10% of the body surface area (BSA, while the globally accepted definition established by Bastuji-Garin describes it as an epidermal detachment of over 30% of the BSA. In Japanese individuals, HLA-A*02:06, HLA-A*02:07, HLA-A*31:01 and HLA-B*51:01 may be linked to higher risks of TEN.

Knee Injury and Osteoarthritis Outcome Score (KOOS)--development of a self-administered outcome measure

DEFF Research Database (Denmark)

Roos, Ewa M.; Roos, H P; Lohmander, L S

1998-01-01

There is broad consensus that good outcome measures are needed to distinguish interventions that are effective from those that are not. This task requires standardized, patient-centered measures that can be administered at a low cost. We developed a questionnaire to assess short- and long......-term patient-relevant outcomes following knee injury, based on the WOMAC Osteoarthritis Index, a literature review, an expert panel, and a pilot study. The Knee injury and Osteoarthritis Outcome Score (KOOS) is self-administered and assesses five outcomes: pain, symptoms, activities of daily living, sport...

A multicenter evaluation of the efficacy and duration of action of alcaftadine 0.25% and olopatadine 0.2% in the conjunctival allergen challenge model

Directory of Open Access Journals (Sweden)

Ackerman S

2013-04-01

Full Text Available Stacey Ackerman,1 Francis D’Ambrosio Jr,2 Jack V Greiner,3 Linda Villanueva,4 Joseph B Ciolino,5 David A Hollander41Philadelphia Eye Associates, Philadelphia, PA, 2D’Ambrosio Eye Care, Lancaster, MA, 3Schepens Eye Research Institute, Massachusetts Eye and Ear Infirmary, Harvard Medical School, Boston, MA, 4Allergan, Inc, Irvine, CA, 5Massachusetts Eye and Ear Infirmary, Boston, MA, USABackground: The purpose of this study was to evaluate the efficacy and duration of action of once-daily dosing with alcaftadine 0.25% ophthalmic solution and olopatadine 0.2% ophthalmic solution as compared with placebo in the prevention of ocular itching, and to directly compare the efficacy of alcaftadine 0.25% with olopatadine 0.2% in the prevention of ocular itching associated with allergic conjunctivitis using the conjunctival allergen challenge model.Methods: Subjects with allergic conjunctivitis (n = 127 were enrolled in a multicenter, double-masked, randomized, active-controlled and placebo-controlled clinical trial. Using the conjunctival allergen challenge model, this study was conducted over the course of approximately 5 weeks. Subjects were randomized into one of three treatment arms: alcaftadine 0.25% ophthalmic solution, olopatadine 0.2% ophthalmic solution, or placebo. Study medications were administered twice over the course of the trial. The primary efficacy measure for the study was ocular itching evaluated by the subject at 3, 5, and 7 minutes post challenge. Secondary endpoints, measured at 7, 15, and 20 minutes post challenge, included conjunctival, ciliary, and episcleral redness, lid swelling, chemosis, and tearing. Duration of action was measured at 16 and 24 hours post-instillation of the study medication at visits 3 and 4, respectively.Results: For the primary measure of ocular itching, both actives, alcaftadine 0.25% and olopatadine 0.2%, were statistically superior to placebo at all three measured time points for both the 16-hour and

Challenges in converting an interviewer-administered food probe database to self-administration in the National Cancer Institute Automated Self-administered 24-Hour Recall (ASA24).

Science.gov (United States)

Zimmerman, Thea Palmer; Hull, Stephen G; McNutt, Suzanne; Mittl, Beth; Islam, Noemi; Guenther, Patricia M; Thompson, Frances E; Potischman, Nancy A; Subar, Amy F

2009-12-01

The National Cancer Institute (NCI) is developing an automated, self-administered 24-hour dietary recall (ASA24) application to collect and code dietary intake data. The goal of the ASA24 development is to create a web-based dietary interview based on the US Department of Agriculture (USDA) Automated Multiple Pass Method (AMPM) instrument currently used in the National Health and Nutrition Examination Survey (NHANES). The ASA24 food list, detail probes, and portion probes were drawn from the AMPM instrument; portion-size pictures from Baylor College of Medicine's Food Intake Recording Software System (FIRSSt) were added; and the food code/portion code assignments were linked to the USDA Food and Nutrient Database for Dietary Studies (FNDDS). The requirements that the interview be self-administered and fully auto-coded presented several challenges as the AMPM probes and responses were linked with the FNDDS food codes and portion pictures. This linking was accomplished through a "food pathway," or the sequence of steps that leads from a respondent's initial food selection, through the AMPM probes and portion pictures, to the point at which a food code and gram weight portion size are assigned. The ASA24 interview database that accomplishes this contains more than 1,100 food probes and more than 2 million food pathways and will include about 10,000 pictures of individual foods depicting up to 8 portion sizes per food. The ASA24 will make the administration of multiple days of recalls in large-scale studies economical and feasible.

A Unique Sample of Extreme-BCG Clusters at 0.2 < z < 0.5

Science.gov (United States)

Garmire, Gordon

2017-09-01

The recently-discovered Phoenix cluster harbors the most extreme BCG in the known universe. Despite the cluster's high mass and X-ray luminosity, it was consistently identified by surveys as an isolated AGN, due to the bright central point source and the compact cool core. Armed with hindsight, we have undertaken an all-sky survey based on archival X-ray, OIR, and radio data to identify other similarly-extreme systems that were likewise missed. A pilot study demonstrated that this strategy works, leading to the discovery of a new, massive cluster at z 0.2 which was missed by previous X-ray surveys due to the presence of a bright central QSO. We propose here to observe 6 new clusters from our complete northern-sky survey, which harbor some of the most extreme central galaxies known.

Oxygen and minority carrier lifetimes in N-and P-type AL0.2GA0.8AS grown by metal organics vapor phase epitaxy

International Nuclear Information System (INIS)

Zahraman, Khaled; Leroux, M.; Gibart, P.; Zaidi, M.A.; Bremond, G.; Guillot, G.

2000-01-01

author.The minority carrier lifetimes in Al x Ga 1-x As grown by Metal-Organics Vapor Phase Epitaxy (MOVPE) is generally lower than in GaAs. This is believed to be due to oxygen incorporation in the layers. We describe a study of radiative and non radiative minority carriers lifetimes in n-and p-type Al 0.2 Ga 0.8 As as a function of growth parameters, in correlation with oxygen concentration measurements and deep level transient spectroscopy (DLTS) studies. Long non radiative lifetimes and low oxygen contents are achieved using temperature growth. A main minority hole lifetime killer appears to be 0.4 eV deep O related electron trap detected by DLTS at concentrations three orders of magnitude lower than the atomic oxygen one. Record lifetimes in MOVPE grown n-and p-type Al 0.2 Ga 0.8 As are obtained. An Al 0.85 Ga 0.15 As/Al 0.2 Ga 0.8 As surface recombination velocity lower than 4.5x10 3 cm.s -1 is measured

40 CFR 467.02 - General definitions.

Science.gov (United States)

2010-07-01

... coating and anodizing when performed as an integral part of the aluminum forming operations are considered... STANDARDS ALUMINUM FORMING POINT SOURCE CATEGORY General Provisions § 467.02 General definitions. In...) Aluminum forming is a set of manufacturing operations in which aluminum and aluminum alloys are made into...

Internet-versus group-administered cognitive behaviour therapy for panic disorder in a psychiatric setting: a randomised trial

OpenAIRE

Bergstrom, Jan; Andersson, Gerhard; Ljotsson, Brjann; Ruck, Christian; Andreewitch, Sergej; Karlsson, Andreas; Carlbring, Per; Andersson, Erik; Lindefors, Nils

2010-01-01

Background: Internet administered cognitive behaviour therapy (CBT) is a promising new way to deliver psychological treatment, but its effectiveness in regular care settings and in relation to more traditional CBT group treatment has not yet been determined. The primary aim of this study was to compare the effectiveness of Internet- and group administered CBT for panic disorder (with or without agoraphobia) in a randomised trial within a regular psychiatric care setting. The second aim of the...

Test Operations Procedure (TOP) 02-2-603A Vehicle Fuel Consumption

Science.gov (United States)

2012-05-10

API) Hydrometer . The API Hydrometer is used for accurate determination of the density, relative density (specific gravity), or API gravity of... Hydrometer Method. 5. TOP 02-2-505, Inspection and Preliminary Operation of Vehicles, 4 February 1987. 6. TOP 02-1-003, Hybrid Electric

Radiographs and low field MRI (0.2T) as predictors of efficacy in a weight loss trial in obese women with knee osteoarthritis

DEFF Research Database (Denmark)

Gudbergsen, Henrik; Boesen, Mikael; Christensen, Robin

2011-01-01

To study the predictive value of baseline radiographs and low-field (0.2T) MRI scans for the symptomatic outcome of clinically significant weight loss in obese patients with knee osteoarthritis.......To study the predictive value of baseline radiographs and low-field (0.2T) MRI scans for the symptomatic outcome of clinically significant weight loss in obese patients with knee osteoarthritis....

Ultrathin ZnO interfacial passivation layer for atomic layer deposited ZrO2 dielectric on the p-In0.2Ga0.8As substrate

Science.gov (United States)

Liu, Chen; Lü, Hongliang; Yang, Tong; Zhang, Yuming; Zhang, Yimen; Liu, Dong; Ma, Zhenqiang; Yu, Weijian; Guo, Lixin

2018-06-01

Interfacial and electrical properties were investigated on metal-oxidesemiconductor capacitors (MOSCAPs) fabricated with bilayer ZnO/ZrO2 films by atomic layer deposition (ALD) on p-In0.2Ga0.8As substrates. The ZnO passivated In0.2Ga0.8As MOSCAPs have exhibited significantly improved capacitance-voltage (C-V) characteristics with the suppressed "stretched out" effect, increased accumulation capacitance and reduced accumulation frequency dispersion as well as the lower gate leakage current. In addition, the interface trap density (Dit) estimated by the Terman method was decreased dramatically for ZnO passivated p-In0.2Ga0.8As. The inherent mechanism is attributed to the fact that an ultrathin ZnO IPL employed by ALD prior to ZrO2 dielectric deposition can effectively suppress the formation of defect-related low-k oxides and As-As dimers at the interface, thus effectively improving the interface quality by largely removing the border traps aligned near the valence band edge of the p-In0.2Ga0.8As substrate.

25 CFR 26.4 - Who administers the Job Placement and Training Program?

Science.gov (United States)

2010-04-01

... 25 Indians 1 2010-04-01 2010-04-01 false Who administers the Job Placement and Training Program... PLACEMENT AND TRAINING PROGRAM General Applicability § 26.4 Who administers the Job Placement and Training Program? The Job Placement and Training Program is administered by the Bureau of Indian Affairs or a...

Psychology of computer use: IX. A menu of self-administered microcomputer-based neurotoxicology tests

Science.gov (United States)

Kennedy, R. S.; Baltzley, D. R.; Wilkes, R. L.; Kuntz, L. A.

1989-01-01

This study examined the feasibility of repeated self-administration of a newly developed battery of mental acuity tests which may have application in screening for fitness-for-duty or for persons who may be exposed to environmental stress, toxic agents, or disease. 16 subjects self-administered 18 microcomputer-based tests (13 new, 5 "core"), without proctors, over 10 sessions. The hardware performed well throughout the study and the tests appeared to be easily self-administered. Stabilities and reliabilities of the tests from the "core" battery were comparable to those obtained previously under more controlled experimental conditions. Eight of the new tests exceeded minimum criteria for metric and practical requirements and can be recommended as additions to the menu. Although the average retest reliability was high, cross-correlations between tests were low, implying factorial diversity. The menu can be used to form batteries with flexible total testing time which are likely to tap different mental processes and functions.

32 CFR 644.396 - Assignment of personnel to administer.

Science.gov (United States)

2010-07-01

... 32 National Defense 4 2010-07-01 2010-07-01 true Assignment of personnel to administer. 644.396... PROPERTY REAL ESTATE HANDBOOK Disposal Predisposal Action § 644.396 Assignment of personnel to administer... responsible representative to each installation, or group of installations, to act under his staff supervision...

47 CFR 97.509 - Administering VE requirements.

Science.gov (United States)

2010-10-01

..., grandchildren, stepchildren, parents, grandparents, stepparents, brothers, sisters, stepbrothers, stepsisters... accommodate an examinee whose physical disabilities require a special examination procedure. The administering VEs may require a physician's certification indicating the nature of the disability before determining...

40 CFR 147.50 - State-administered program-Class II wells.

Science.gov (United States)

2010-07-01

... Carry Out Underground Injection Control Program Relating to Class II Wells as Described in Federal Safe... PROGRAMS (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Alabama... application: (a) Incorporation by reference. The requirements set forth in the State statutes and regulations...

Indirect and inclusive search for dark matter with AMS02 space spectrometer; Recherche indirecte et inclusive de matiere noire avec le spectrometre spatial AMS02

Energy Technology Data Exchange (ETDEWEB)

Brun, P

2007-06-15

AMS02 is a particle physics detector designed for 3 years of data collecting aboard the International Space Station. Equipped with a superconducting magnet, it will allow to measure gamma and cosmic ray fluxes in the GeV to TeV region with high particle identification capabilities. Its performance is based on the redundancy of measurements in specific sub-detectors: a Time-Of-Flight counter, a Transition Radiation Detector, a Silicon Tracker, a Ring Imaging Cherenkov counter and an Electromagnetic calorimeter (Ecal). The Ecal is studied in details, in particular with the qualification of a stand-alone trigger devoted to gamma ray astronomy. This system allows the increase of the AMS02 sensitivity to photons, and the improvement of the reconstruction of electromagnetic events. The analog part of the trigger system has been tested with test benches and with a beam at CERN. The in-orbit calibration of the Ecal is studied, it may proceed in two steps. First, the Ecal cells responses have to be equalized with minimum ionizing particles data. Then an absolute calibration can be performed with cosmic electrons. For both the relative and the absolute calibration, possible procedures are defined and realistic calibration times are estimated. The second part deals with the indirect searches for dark matter and the study of the AMS02 sensitivity. Dark matter stands for 84% of the Universe mass and could consist in new particles. Dark matter particles are expected to surround our Galaxy and annihilate in high density regions. These annihilations could become observable exotic primary cosmic ray sources. Searches for anomalous excesses in (p-bar, e{sup +}, D-bar) and {gamma} ray fluxes will be performed by AMS02. A numerical tool allowing us to perform predictions for these exotic fluxes within supersymmetry or extra-dimension is developed and is presented in details. Phenomenological studies regarding possible enhancements of these signals by over-dense regions of the halo

40 CFR 147.2051 - EPA-administered program-Indian lands.

Science.gov (United States)

2010-07-01

... Carolina § 147.2051 EPA-administered program—Indian lands. (a) Contents. The UIC program for all classes of... these requirements. (b) Effective date. The effective date of the UIC program for Indian lands in South Carolina is November 25, 1988. [53 FR 43090, Oct. 25, 1988, as amended at 56 FR 9419, Mar. 6, 1991] ...

(La, Pr)0.8Sr0.2FeO3-δ-Sm 0.2Ce0.8O2-δ composite cathode for proton-conducting solid oxide fuel cells

KAUST Repository

Chen, Yonghong

2014-08-01

Mixed rare-earth (La, Pr)0.8Sr0.2FeO 3-δ-Sm0.2Ce0.8O2-δ (LPSF-SDC) composite cathode was investigated for proton-conducting solid oxide fuel cells based on protonic BaZr0.1Ce0.7Y 0.2O3-δ (BZCY) electrolyte. The powders of La 0.8-xPrxSr0.2FeO3-δ (x = 0, 0.2, 0.4, 0.6), Sm0.2Ce0.8O2-δ (SDC) and BaZr0.1Ce0.7Y0.2O3-δ (BZCY) were synthesized by a citric acid-nitrates self-propagating combustion method. The XRD results indicate that La0.8-xPrxSr 0.2FeO3-δ samples calcined at 950 °C exhibit perovskite structure and there are no interactions between LPSF0.2 and SDC at 1100 °C. The average thermal expansion coefficient (TEC) of LPSF0.2-SDC, BZCY and NiO-BZCY is 12.50 × 10-6 K-1, 13.51 × 10-6 K-1 and 13.47 × 10-6 K -1, respectively, which can provide good thermal compatibility between electrodes and electrolyte. An anode-supported single cell of NiO-BZCY|BZCY|LPSF0.2-SDC was successfully fabricated and operated from 700 °C to 550 °C with humidified hydrogen (∼3% H2O) as fuel and the static air as oxidant. A high maximum power density of 488 mW cm -2, an open-circuit potential of 0.95 V, and a low electrode polarization resistance of 0.071 Ω cm2 were achieved at 700 °C. Preliminary results demonstrate that LPSF0.2-SDC composite is a promising cathode material for proton-conducting solid oxide fuel cells. © 2014, Hydrogen Energy Publications, LLC. Published by Elsevier Ltd. All rights reserved.

2018-02-21T03:02:06Z https://www.ajol.info/index.php/all/oai oai:ojs ...

African Journals Online (AJOL)

article/40158 2018-02-21T03:02:06Z jonamp:ART Mathematical model for bird flu disease transmission Yusuf, T T Okosun, KO Bird flu (Avian influenza) is a contagious disease of animals caused by viruses that normally infect only birds and, less ...

The effects of intra-cerebroventricular administered rocuronium on the central nervous system of rats and determination of its epileptic seizure-inducing dose.

Science.gov (United States)

Baykal, Mehmet; Gökmen, Necati; Doğan, Alper; Erbayraktar, Serhat; Yılmaz, Osman; Ocmen, Elvan; Erdost, Hale Aksu; Arkan, Atalay

The aim of this study was to investigate the effects of intracerebroventricularly administered rocuronium bromide on the central nervous system, determine the seizure threshold dose of rocuronium bromide in rats, and investigate the effects of rocuronium on the central nervous system at 1/5, 1/10, and 1/100 dilutions of the determined seizure threshold dose. A permanent cannula was placed in the lateral cerebral ventricle of the animals. The study was designed in two phases. In the first phase, the seizure threshold dose of rocuronium bromide was determined. In the second phase, Group R 1/5 (n=6), Group 1/10 (n=6), and Group 1/100 (n=6) were formed using doses of 1/5, 1/10, and 1/100, respectively, of the obtained rocuronium bromide seizure threshold dose. The rocuronium bromide seizure threshold value was found to be 0.056±0.009μmoL. The seizure threshold, as a function of the body weight of rats, was calculated as 0.286μmoL/kg -1 . A dose of 1/5 of the seizure threshold dose primarily caused splayed limbs, posturing, and tremors of the entire body, whereas the dose of 1/10 of the seizure threshold dose caused agitation and shivering. A dose of 1/100 of the seizure threshold dose was associated with decreased locomotor activity. This study showed that rocuronium bromide has dose-related deleterious effects on the central nervous system and can produce dose-dependent excitatory effects and seizures. Published by Elsevier Editora Ltda.

[The effects of intra-cerebroventricular administered rocuronium on the central nervous system of rats and determination of its epileptic seizure-inducing dose].

Science.gov (United States)

Baykal, Mehmet; Gökmen, Necati; Doğan, Alper; Erbayraktar, Serhat; Yılmaz, Osman; Ocmen, Elvan; Erdost, Hale Aksu; Arkan, Atalay

The aim of this study was to investigate the effects of intracerebroventricularly administered rocuronium bromide on the central nervous system, determine the seizure threshold dose of rocuronium bromide in rats, and investigate the effects of rocuronium on the central nervous system at 1/5, 1/10, and 1/100 dilutions of the determined seizure threshold dose. A permanent cannula was placed in the lateral cerebral ventricle of the animals. The study was designed in two phases. In the first phase, the seizure threshold dose of rocuronium bromide was determined. In the second phase, Group R 1/5 (n=6), Group 1/10 (n=6), and Group 1/100 (n=6) were formed using doses of 1/5, 1/10, and 1/100, respectively, of the obtained rocuronium bromide seizure threshold dose. The rocuronium bromide seizure threshold value was found to be 0.056±0.009μmoL. The seizure threshold, as a function of the body weight of rats, was calculated as 0.286μmoL/kg -1 . A dose of 1/5 of the seizure threshold dose primarily caused splayed limbs, posturing, and tremors of the entire body, whereas the dose of 1/10 of the seizure threshold dose caused agitation and shivering. A dose of 1/100 of the seizure threshold dose was associated with decreased locomotor activity. This study showed that rocuronium bromide has dose-related deleterious effects on the central nervous system and can produce dose-dependent excitatory effects and seizures. Publicado por Elsevier Editora Ltda.

Effect of tubing on loss of clonazepam administered by continuous subcutaneous infusion.

Science.gov (United States)

Schneider, Jennifer J; Good, Phillip; Ravenscroft, Peter J

2006-06-01

Previous studies have reported loss of clonazepam from solutions administered intravenously from plastic infusion bags and administration sets. In palliative care, clonazepam is sometimes administered through syringe drivers using polyvinyl chloride (PVC) infusion tubing. No data currently exist to show whether use of PVC tubing affects the amount of clonazepam actually received by the patient. This study compared the use of two different types of PVC tubing with a non-PVC tubing. Solutions containing clonazepam or clonazepam and morphine were prepared with either normal saline or water for injection as diluent. Concentrations of morphine and clonazepam were determined using high-performance liquid chromatography. Significant loss of clonazepam (up to 50%) was observed in all solutions infused through PVC tubing. Solutions infused through non-PVC tubing retained greater than 90% of the initial concentration of clonazepam. It is recommended that when administering clonazepam using a syringe driver, non-PVC tubing be used.

The impact of glucocorticosteroids administered for systemic diseases on the osseointegration and survival of dental implants placed without bone grafting-A retrospective study in 31 patients.

Science.gov (United States)

Petsinis, Vassilis; Kamperos, Georgios; Alexandridi, Foteini; Alexandridis, Konstantinos

2017-08-01

To evaluate the impact of glucocorticosteroids, administered for the treatment of systemic diseases, on the osseointegration and survival of dental implants placed without bone grafting. A retrospective study was conducted in search of patients treated with dental implants while receiving glucocorticosteroid therapy for various systemic diseases. In these cases, a conventional two-stage surgical protocol was used, without bone regeneration procedures. The osseointegration was clinically and radiographically tested at the uncovering of the implants. The follow-up after loading was set at a minimum of 3 years. A total of 31 patients were included in the study. Of the 105 dental implants placed, 104 were osseointegrated (99%). No bone absorption was radiographically noted at the uncovering of the osseointegrated implants. All of the osseointegrated implants were successfully loaded for the prosthetic restoration. The mean follow-up period after loading was 71 months, with an implant survival rate of 99%. Glucocorticosteroid intake for systemic diseases does not have a significant impact on the osseointegration and the 3-year survival of dental implants placed with a conventional two-stage surgical protocol and without bone grafting. Therefore, it should not be considered a contraindication for dental implant placement. Copyright © 2017 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

Indirect and inclusive search for dark matter with AMS02 space spectrometer; Recherche indirecte et inclusive de matiere noire avec le spectrometre spatial AMS02

Energy Technology Data Exchange (ETDEWEB)

Brun, Pierre [Laboratoire d' Annecy-le-vieux de Physique des Particules, Chemin de Bellevue, BP 110, 74941 Annecy-le-Vieux Cedex (France)

2007-07-01

AMS02 is a particle physics detector designed for 3 years of data taking aboard the International Space Station. Equipped with a superconducting magnet, it will allow to measure gamma and cosmic ray fluxes in the GeV to TeV region with high particle identification capabilities. Its performance is based on the redundancy of measurements in specific sub-detectors: a Time-Of-Flight counter, a Transition Radiation Detector, a Silicon Tracker, a Ring Imaging Cherenkov counter and an Electromagnetic calorimeter (Ecal). The Ecal is studied in details, in particular with the qualification of a stand-alone trigger devoted to gamma ray astronomy. This system allows to increase the AMS02 sensitivity to photons, and to improve the reconstruction of electromagnetic events. The analog part of the trigger system has been tested with test benches and in-beam at CERN. The in-orbit calibration of the Ecal is studied, it may proceed in two steps. First, the Ecal cells responses have to be equalized with minimum ionizing particles data. Then an absolute calibration can be performed with cosmic electrons. For both the relative and the absolute calibration, possible procedures are defined and realistic calibration times are estimated. The second part deals with the indirect searches for dark matter and the study of the AMS02 sensitivity. Dark matter stands for 84% of the Universe mass and could consist in new particles. Dark matter particles are expected to surround our Galaxy and annihilate in high density regions. These annihilations could become observable exotic primary cosmic ray sources. Searches for anomalous excesses in (p-bar, e{sup +}, D-bar) and {gamma} ray fluxes will be performed by AMS02. A numerical tool allowing to perform predictions for these exotic fluxes within supersymmetry or extra-dimension is developed and is presented in details. Phenomenological studies regarding possible enhancements of these signals by over-dense regions of the halo have also been performed

Cryogenic solid Schmidt camera as a base for future wide-field IR systems

Science.gov (United States)

Yudin, Alexey N.

2011-11-01

Work is focused on study of capability of solid Schmidt camera to serve as a wide-field infrared lens for aircraft system with whole sphere coverage, working in 8-14 um spectral range, coupled with spherical focal array of megapixel class. Designs of 16 mm f/0.2 lens with 60 and 90 degrees sensor diagonal are presented, their image quality is compared with conventional solid design. Achromatic design with significantly improved performance, containing enclosed soft correcting lens behind protective front lens is proposed. One of the main goals of the work is to estimate benefits from curved detector arrays in 8-14 um spectral range wide-field systems. Coupling of photodetector with solid Schmidt camera by means of frustrated total internal reflection is considered, with corresponding tolerance analysis. The whole lens, except front element, is considered to be cryogenic, with solid Schmidt unit to be flown by hydrogen for improvement of bulk transmission.

Low-loss optical waveguides made with molecular beam epitaxial In(0.012)Ga(0.988)As and In(0.2)Ga(0.8)As-GaAs superlattices

Science.gov (United States)

Das, U.; Bhattacharya, P. K.; Dhar, S.

1986-01-01

Low-loss optical guiding in In-doped GaAs is demonstrated for the first time. Ridge waveguides are made with single In(0.012)Ga(0.988)As ternary layers and In(0.2)Ga(0.8)As-GaAs superlattices. Attenuation constants of about 1.3 dB/cm are measured and the principal loss mechanism is identified to be scattering at the ridge walls. It is expected that improved fabrication techniques will lead to guides with attenuation less than or equal to 0.5 dB/cm.

Sequence and structural characterization of great salt lake bacteriophage CW02, a member of the T7-like supergroup.

Science.gov (United States)

Shen, Peter S; Domek, Matthew J; Sanz-García, Eduardo; Makaju, Aman; Taylor, Ryan M; Hoggan, Ryan; Culumber, Michele D; Oberg, Craig J; Breakwell, Donald P; Prince, John T; Belnap, David M

2012-08-01

Halophage CW02 infects a Salinivibrio costicola-like bacterium, SA50, isolated from the Great Salt Lake. Following isolation, cultivation, and purification, CW02 was characterized by DNA sequencing, mass spectrometry, and electron microscopy. A conserved module of structural genes places CW02 in the T7 supergroup, members of which are found in diverse aquatic environments, including marine and freshwater ecosystems. CW02 has morphological similarities to viruses of the Podoviridae family. The structure of CW02, solved by cryogenic electron microscopy and three-dimensional reconstruction, enabled the fitting of a portion of the bacteriophage HK97 capsid protein into CW02 capsid density, thereby providing additional evidence that capsid proteins of tailed double-stranded DNA phages have a conserved fold. The CW02 capsid consists of bacteriophage lambda gpD-like densities that likely contribute to particle stability. Turret-like densities were found on icosahedral vertices and may represent a unique adaptation similar to what has been seen in other extremophilic viruses that infect archaea, such as Sulfolobus turreted icosahedral virus and halophage SH1.

Two-week course of preoperative chemoradiotherapy followed by delayed surgery for rectal cancer: a phase II multi-institutional clinical trial (KROG 11-02).

Science.gov (United States)

Lee, Jong Hoon; Kim, Jun-Gi; Oh, Seong Taek; Lee, Myung Ah; Chun, Hoo Geun; Kim, Dae Yong; Kim, Tae Hyun; Kim, Sun Young; Baek, Ji Yeon; Park, Ji Won; Oh, Jae Hwan; Park, Hee Chul; Choi, Doo Ho; Park, Young Suk; Kim, Hee Cheol; Chie, Eui Kyu; Jang, Hong Seok

2014-01-01

The aim of this study was to evaluate the efficacy and safety of a two-week schedule of radiotherapy with oral capecitabine in locally advanced rectal cancer. Eighty patients with rectal cancer located in the mid to low rectum, staged cT3-4N0-2M0, were prospectively enrolled. They underwent preoperative chemoradiotherapy and delayed surgery 6-8 weeks after the completion of radiation therapy. A radiation dose of 33 Gy in 10 fractions was delivered to the pelvis for 2 weeks. One cycle of oral capecitabine was administered at a dose of 1650 mg/m(2)/day during radiotherapy. Tumor response and toxicity were the study endpoints. This study was registered at ClinicalTrials.gov (number, NCT01431599). All included patients underwent total mesorectal excisions including 12 cases of robot assisted surgery and 50 cases of laparoscopic surgery. Of the 80 patients, 27 (33.8%) achieved downstaging (ypT0-2N0) of a rectal tumor and 11 (13.8%) had a pathologically complete response (ypCR). Downstaging rates were 45% for T classification and 65% for N classification. Sphincter saving was achieved in 73 (91.3%) of the 80 patients. Of the 80 patients, 3 (3.8%) experienced grade 3 hematologic toxicity, and 2 (2.5%) had grade 3 postoperative complications such as ileus and wound dehiscence. There was no grade 4 toxicity. A two-week schedule of radiotherapy with oral capecitabine in locally advanced rectal cancer patients showed low toxicity profiles and promising results in terms of tumor response. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Effect of lead acetate administered orally at different dosage levels ...

African Journals Online (AJOL)

The project was conducted to evaluate the effect of lead administered as lead acetate at different dosage levels via drinking water in broiler chicks. Thirty-five healthy chicks were divided into seven groups (five chicks each) and one group was kept as un-medicated control. Groups A, B, C, D, E and F were medicated with ...

34 CFR 461.1 - What is the Adult Education State-administered Basic Grant Program?

Science.gov (United States)

2010-07-01

... 34 Education 3 2010-07-01 2010-07-01 false What is the Adult Education State-administered Basic...-ADMINISTERED BASIC GRANT PROGRAM General § 461.1 What is the Adult Education State-administered Basic Grant Program? The Adult Education State-administered basic Grant Program (the program) is a cooperative effort...

Electronic and ionic transport in Ce0.8PrxTb0.2-xO2-δ and evaluation of performance as oxygen permeation membranes

DEFF Research Database (Denmark)

Chatzichristodoulou, Christodoulos; Hendriksen, Peter Vang

2012-01-01

is significantly enhanced relative to that of a Ce0.9Gd0.1O1.95-δ membrane at high oxygen activities of the permeate gas (aO2 an > 10-15) due to the enhanced electronic conductivity of the Ce0.8PrxTb0.2-xO2-δ compounds. Interference between the ionic and electronic flows has a significant positive effect......The electronic conductivity of Ce0.8PrxTb0.2-xO2-δ (x = 0, 0.05, 0.10, 0.15, 0.20) was determined in the oxygen activity range aO2 ≈ 103 to aO2 ≈ 10-17 at 700- 900 °C by means of Hebb-Wagner polarisation. The electronic conductivity of all the Ce0.8PrxTb0.2-xO2-δ compositions was significantly...... enhanced as compared to that of Ce0.9Gd0.1O1.95-δ, and its value was found to increase with increasing Pr/Tb ratio. The ionic mobility of Ce0.8PrxTb0.2-xO2-δ is similar to that of Ce1- 2δGd2δO2-δ at the same oxygen vacancy concentration. The calculated oxygen flux of a Ce0.8PrxTb0.2-xO2-δ membrane...

A clinician-administered severity rating scale for illness anxiety: development, reliability, and validity of the H-YBOCS-M.

Science.gov (United States)

Skritskaya, Natalia A; Carson-Wong, Amanda R; Moeller, James R; Shen, Sa; Barsky, Arthur J; Fallon, Brian A

2012-07-01

Clinician-administered measures to assess severity of illness anxiety and response to treatment are few. The authors evaluated a modified version of the hypochondriasis-Y-BOCS (H-YBOCS-M), a 19-item, semistructured, clinician-administered instrument designed to rate severity of illness-related thoughts, behaviors, and avoidance. The scale was administered to 195 treatment-seeking adults with DSM-IV hypochondriasis. Test-retest reliability was assessed in a subsample of 20 patients. Interrater reliability was assessed by 27 interviews independently rated by four raters. Sensitivity to change was evaluated in a subsample of 149 patients. Convergent and discriminant validity was examined by comparing H-YBOCS-M scores to other measures administered. Item clustering was examined with confirmatory and exploratory factor analyses. The H-YBOCS-M demonstrated good internal consistency, interrater and test-retest reliability, and sensitivity to symptom change with treatment. Construct validity was supported by significant higher correlations with scores on other measures of hypochondriasis than with nonhypochondriacal measures. Improvement over time in response to treatment correlated with improvement both on measures of hypochondriasis and on measures of somatization, depression, anxiety, and functional status. Confirmatory factor analysis did not show adequate fit for a three-factor model. Exploratory factor analysis revealed a five-factor solution with the first two factors consistent with the separation of the H-YBOCS-M items into the subscales of illness-related avoidance and compulsions. H-YBOCS-M appears to be valid, reliable, and appropriate as an outcome measure for treatment studies of illness anxiety. Study results highlight "avoidance" as a key feature of illness anxiety-with potentially important nosologic and treatment implications. © 2012 Wiley Periodicals, Inc.

Geometry of (0,2) Landau-Ginzburg orbifolds

International Nuclear Information System (INIS)

Kawai, Toshiya; Mohri, Kenji

1994-01-01

Several aspects of (0,2) Landau-Ginzburg orbifolds are investigated. Especially the elliptic genera are computed in general and, for a class of models recently invented by Distler and Kachru, they are compared with the ones from (0,2) sigma models. Our formalism gives an easy way to calculate the generation numbers for lots of Distler-Kachru models even if they are based on singular Calabi-Yau spaces. We also make some general remarks on the Born-Oppenheimer calculation of the ground states elucidating its mathematical meaning in the untwisted sector. For Distler-Kachru models based on non-singular Calabi-Yau spaces we show that there exist ''residue'' type formulas of the elliptic genera as well. ((orig.))

Cost as a Military Requirement

Science.gov (United States)

2013-01-01

from http://www.forbes.com/sites/frederickallen/2011/08/02/there-are- three-kinds-of-innovation- dont -get-trapped-doing-the-wrong-one/ Arena, M...Consideration of the CONOPS as part of the system development tradespace. Poster presentation at the National Defense Industrial Association (NDIA

Validity and reliability of a self-administered foot evaluation questionnaire (SAFE-Q).

Science.gov (United States)

Niki, Hisateru; Tatsunami, Shinobu; Haraguchi, Naoki; Aoki, Takafumi; Okuda, Ryuzo; Suda, Yasunori; Takao, Masato; Tanaka, Yasuhito

2013-03-01

The Japanese Society for Surgery of the Foot (JSSF) is developing a QOL questionnaire instrument for use in pathological conditions related to the foot and ankle. The main body of the outcome instrument (the Self-Administered Foot Evaluation Questionnaire, SAFE-Q version 2) consists of 34 questionnaire items, which provide five subscale scores (1: Pain and Pain-Related; 2: Physical Functioning and Daily Living; 3: Social Functioning; 4: Shoe-Related; and 5: General Health and Well-Being). In addition, the instrument has nine optional questionnaire items that provide a Sports Activity subscale score. The purpose of this study was to evaluate the test-retest reliability of the SAFE-Q. Version 2 of the SAFE-Q was administered to 876 patients and 491 non-patients, and the test-retest reliability was evaluated for 131 patients. In addition, the SF-36 questionnaire and the JSSF Scale scoring form were administered to all of the participants. Subscale scores were scaled such that the final sum of scores ranged between zero (least healthy) to 100 (healthiest). The intraclass correlation coefficients were larger than 0.7 for all of the scores. The means of the five subscale scores were between 60 and 75. The five subscales easily separated patients from non-patients. The coefficients for the correlations of the subscale scores with the scores on the JSSF Scale and the SF-36 subscales were all highly statistically significantly greater than zero (p valid and reliable. In the future, it will be beneficial to test the responsiveness of the SAFE-Q.

Effect of orally administered sodium bicarbonate on caecal pH.

Science.gov (United States)

Taylor, E A; Beard, W L; Douthit, T; Pohlman, L

2014-03-01

Caecal acidosis is a central event in the metabolic cascade that occurs following grain overload. Buffering the caecal acidosis by enterally administered sodium bicarbonate (NaHCO3 ) may be beneficial to affected horses. To determine the effect and duration of enterally administered NaHCO3 on caecal pH in healthy horses. Experimental study using horses with caecal cannulas. Nine horses had been previously fitted with a caecal cannula. Six horses received 1.0 g/kg bwt NaHCO3 and 3 control horses were given 3 l of water via nasogastric tube. Clinical parameters, water consumption, venous blood gases, caecal pH, faecal pH and faecal water content were measured at 6 h intervals over a 36 h study period. Horses that received enterally administered NaHCO3 had significantly increased caecal pH that lasted the duration of the study. Treated horses increased their water intake, and developed metabolic alkalaemia, significantly increased plasma sodium concentrations and significantly decreased plasma potassium concentrations. Enterally administered NaHCO3 may be beneficial in buffering caecal acidosis. © 2013 EVJ Ltd.

Pathway and rate-limiting step of glyphosate degradation by Aspergillus oryzae A-F02.

Science.gov (United States)

Fu, Gui-Ming; Chen, Yan; Li, Ru-Yi; Yuan, Xiao-Qiang; Liu, Cheng-Mei; Li, Bin; Wan, Yin

2017-09-14

Aspergillus oryzae A-F02, a glyphosate-degrading fungus, was isolated from an aeration tank in a pesticide factory. The pathway and rate-limiting step of glyphosate (GP) degradation were investigated through metabolite analysis. GP, aminomethylphosphonic acid (AMPA), and methylamine were detected in the fermentation liquid of A. oryzae A-F02, whereas sarcosine and glycine were not. The pathway of GP degradation in A. oryzae A-F02 was revealed: GP was first degraded into AMPA, which was then degraded into methylamine. Finally, methylamine was further degraded into other products. Investigating the effects of the exogenous addition of substrates and metabolites showed that the degradation of GP to AMPA is the rate-limiting step of GP degradation by A. oryzae A-F02. In addition, the accumulation of AMPA and methylamine did not cause feedback inhibition in GP degradation. Results showed that degrading GP to AMPA was a crucial step in the degradation of GP, which determines the degradation rate of GP by A. oryzae A-F02.

Second ATLAS Domestic Standard Problem (DSP-02) For A Code Assessment

International Nuclear Information System (INIS)

Kim, Yeonsik; Choi, Kiyong; Cho, Seok; Park, Hyunsik; Kang, Kyungho; Song, Chulhwa; Baek, Wonpil

2013-01-01

KAERI (Korea Atomic Energy Research Institute) has been operating an integral effect test facility, the Advanced Thermal-Hydraulic Test Loop for Accident Simulation (ATLAS), for transient and accident simulations of advanced pressurized water reactors (PWRs). Using ATLAS, a high-quality integral effect test database has been established for major design basis accidents of the APR1400 plant. A Domestic Standard Problem (DSP) exercise using the ATLAS database was promoted to transfer the database to domestic nuclear industries and contribute to improving a safety analysis methodology for PWRs. This 2 nd ATLAS DSP (DSP-02) exercise aims at an effective utilization of an integral effect database obtained from ATLAS, the establishment of a cooperation framework among the domestic nuclear industry, a better understanding of the thermal hydraulic phenomena, and an investigation into the possible limitation of the existing best-estimate safety analysis codes. A small break loss of coolant accident with a 6-inch break at the cold leg was determined as a target scenario by considering its technical importance and by incorporating interests from participants. This DSP exercise was performed in an open calculation environment where the integral effect test data was open to participants prior to the code calculations. This paper includes major information of the DSP-02 exercise as well as comparison results between the calculations and the experimental data

SECOND ATLAS DOMESTIC STANDARD PROBLEM (DSP-02 FOR A CODE ASSESSMENT

Directory of Open Access Journals (Sweden)

YEON-SIK KIM

2013-12-01

Full Text Available KAERI (Korea Atomic Energy Research Institute has been operating an integral effect test facility, the Advanced Thermal-Hydraulic Test Loop for Accident Simulation (ATLAS, for transient and accident simulations of advanced pressurized water reactors (PWRs. Using ATLAS, a high-quality integral effect test database has been established for major design basis accidents of the APR1400 plant. A Domestic Standard Problem (DSP exercise using the ATLAS database was promoted to transfer the database to domestic nuclear industries and contribute to improving a safety analysis methodology for PWRs. This 2nd ATLAS DSP (DSP-02 exercise aims at an effective utilization of an integral effect database obtained from ATLAS, the establishment of a cooperation framework among the domestic nuclear industry, a better understanding of the thermal hydraulic phenomena, and an investigation into the possible limitation of the existing best-estimate safety analysis codes. A small break loss of coolant accident with a 6-inch break at the cold leg was determined as a target scenario by considering its technical importance and by incorporating interests from participants. This DSP exercise was performed in an open calculation environment where the integral effect test data was open to participants prior to the code calculations. This paper includes major information of the DSP-02 exercise as well as comparison results between the calculations and the experimental data.

Prenatally administered HMB modifies the enamel surface roughness in spiny mice offspring: An atomic force microscopy study.

Science.gov (United States)

Świetlicka, Izabela; Muszyński, Siemowit; Tomaszewska, Ewa; Dobrowolski, Piotr; Kwaśniewska, Anita; Świetlicki, Michał; Skic, Anna; Gołacki, Krzysztof

2016-10-01

The aim of this research was to check the effect of the prenatally administered β-hydroxy β-methylbutyrate (HMB) on the development of enamel surface of the spiny mice offspring. The spiny mice dams were randomly assigned into three groups: control group (not supplemented with HMB) and two experimental groups in which powdered HMB was given at the daily dosage of 0.2g/kg of body weight (group I) and 0.02g/kg of body weight (group II) during the last period of gestation. Newborn pups were euthanized by CO 2 inhalation. The morphology of incisor teeth was analysed using atomic force microscopy (AFM) in semi-contact mode in the height, magnitude and phase domains. Height images became a basis for determination of surface roughness parameters. Conducted study indicated that maternal HMB administration markedly influences enamel development. Enamel of offspring's teeth in both experimental groups was characterized by significantly smaller values of indices describing surface roughness and profile. HMB supplementation influenced the calculated parameters regardless of the diet type and offspring sex, however higher dose of HMB caused stronger changes in enamel surface's physical properties and could be observed in higher intensity in the male group. HMB administration caused reduction in the irregularities of enamel surface, thereby possibly reducing the probability of bacteria adhesion and caries development. These observations may serve to improve nutrition and supplementation of animals and could be a lead for further research. Copyright © 2016 Elsevier Ltd. All rights reserved.

Use of Systemic Rosmarinus Officinalis to Enhance the Survival of Random-Pattern Skin Flaps

Directory of Open Access Journals (Sweden)

Bilsev İnce

2016-12-01

Full Text Available Background: Skin flaps are commonly used in soft-tissue reconstruction; however, necrosis can be a frequent complication. Several systemic and local agents have been used in attempts to improve skin flap survival, but none that can prevent flap necrosis have been identified. Aims: This study aims to determine whether the use of systemic Rosmarinus officinalis (R. officinalis extract can prevent flap necrosis and improve skin flap recovery. Study Design: Animal experimentation. Methods: Thirty-five Wistar albino rats were divided in five groups. A rectangular random-pattern flaps measuring 8×2 cm was elevated from the back of each rat. Group I was the control group. In Group II, 0.2 ml of R. officinalis oil was given orally 2h before surgery. R. officinalis oil was then applied orally twice a day for a week. In Group III, R. officinalis oil was given orally twice a day for one week before surgery. At the end of the week, 0.2 mL of R. officinalis oil was given orally 2 h before surgery. In Group IV, 0.2 mL of R. officinalis oil was injected subcutaneously 2 h before surgery. After the surgery, 0.2 mL R. officinalis oil was injected subcutaneously twice a day for one week. In Group V, 0.2 mL R. officinalis oil was injected subcutaneously twice a day for one week prior to surgery. At the end of the week, one last 0.2 mL R. officinalis oil injection was administered subcutaneously 2 h before surgery. After the surgery, 0.2 mL R. officinalis oil was injected subcutaneously twice a day for one week. Results: The mean percentage of viable surface area was significantly greater (p<0.05 in Groups II, III, IV, and V as compared to Group I. Mean vessel diameter was significantly greater (p<0.05 in Groups II, III, IV, and V as compared to Group I. Conclusion: We have determined that, in addition to its anti-inflammatory and anti-oxidant effects, R. officinalis has vasodilatory effects that contribute to increased skin flap survival.

Irradiation data analysis and thermal analysis of the 02M-02K capsule for material irradiation test

International Nuclear Information System (INIS)

Choi, Myoung Hwan; Choo, K. N.; Kang, Y. H.; Kim, B. G.; Cho, M. S.; Sohn, J. M.; Shin, Y. T.; Park, S. J.; Kim, Y. J.

2004-11-01

In order to evaluate the fracture toughness of RPV materials, the material irradiation test using the instrumented capsule (02M-02K) were carried out in the HANARO in August 2003. Based on the user's requirements the thermal design analysis of the capsule 02M-02K was performed, and the specimens were suitably arranged in each step of the capsule main body. In this report, both the temperature data of specimens measured during irradiation test and the calculated data from the thermal analysis are compared and evaluated. Also, the temperature profile in each step with the HANARO reactor power and helium pressure is reviewed and evaluated. The effects of the gap size such as theoretically calculated from thermal expansion during irradiation test and measured one in the manufacturing of the capsule on the specimen temperature were reviewed. The thermal analysis was performed by using a Finite Element (FE) analysis program, ANSYS. Two-dimensional model for the 1/4 section of the capsule is generated, and the γ-heating rate of the materials used in the capsule at the control rod position of 430 mm is used as input data. The thermal analysis using a 3-dimensional model, which is quite similar to the actual shape of the capsule, is also conducted to obtain the temperature distribution in the axial direction. The analysis results show that the temperature difference between the top and bottom positions of a specimen is found to be smaller than 13.2 .deg. C. The maximum measured and calculated temperature in the step 3 of the capsule is 256 .deg. C and 264 .deg. C, respectively. The measured temperature data are obtained at the reactor power of 24 MW, the heater power of 0 W and the helium pressure of 760 torr. Generally, the temperature data obtained by the FE analysis are slightly lower than those of the measured except the step 1 of the capsule. However, the temperature difference between the measured and the calculated shows a good agreement within 9 percent. It is

Temperature, salinity and other measurements found in datasets XBT and CTD taken from the MIRAI (R/V; call sign JNSR; built 1972 as Mutsu; renamed on 02/02/1996) in the North Pacific, Coastal N Pacific and other locations in 1999 (NODC Accession 0000857)

Data.gov (United States)

National Oceanic and Atmospheric Administration, Department of Commerce — Temperature, salinity and other measurements found in datasets XBT and CTD taken from the MIRAI (R/V; call sign JNSR; built 1972 as Mutsu; renamed on 02/02/1996)in...

Relative bioavailability of single doses of prolonged-release tacrolimus administered as a suspension, orally or via a nasogastric tube, compared with intact capsules: a phase 1 study in healthy participants.

Science.gov (United States)

Undre, Nasrullah; Dickinson, James

2017-04-04

Tacrolimus, an immunosuppressant widely used in solid organ transplantation, is available as a prolonged-release capsule for once-daily oral administration. In the immediate postsurgical period, if patients cannot take intact capsules orally, tacrolimus therapy is often initiated as a suspension of the capsule contents, delivered orally or via a nasogastric tube. This study evaluated the relative bioavailability of prolonged-release tacrolimus suspension versus intact capsules in healthy participants. A phase 1, open-label, single-dose, cross-over study. A single clinical research unit. In total, 20 male participants, 18-55 years old, entered and completed the study. All participants received nasogastric administration of tacrolimus 10 mg suspension in treatment period 1, with randomisation to oral administration of suspension or intact capsules in periods 2 and 3. Blood concentration-time profile over 144 hours was used to estimate pharmacokinetic parameters. Primary end point: relative bioavailability of prolonged-release intact capsule versus oral or nasogastric administration of prolonged-release tacrolimus suspension (area under the concentration-time curve (AUC) from time 0 to infinity post-tacrolimus dose (AUC 0-∞ ); AUC measured until the last quantifiable concentration (AUC 0-tz ); maximum observed concentration (C max ); time to C max (T max )). Tolerability was assessed throughout the study. Relative bioavailability of prolonged-release tacrolimus suspension administered orally was similar to intact capsules, with a ratio of least-square means for AUC 0-tz and AUC 0-∞ of 1.05 (90% CI 0.96 to 1.14). Bioavailability was lower with suspension administered via a nasogastric tube versus intact capsules (17%; ratio 0.83; CI 0.76 to 0.92). C max was higher for oral and nasogastric suspension (30% and 28%, respectively), and median T max was shorter (difference 1.0 and 1.5 hours postdose, respectively) versus intact capsules (2.0 hours). Single 10�

A screen-printed Ce 0.8Sm 0.2O 1.9 film solid oxide fuel cell with a Ba 0.5Sr 0.5Co 0.8Fe 0.2O 3- δ cathode

Science.gov (United States)

Zhang, Yaohui; Huang, Xiqiang; Lu, Zhe; Liu, Zhiguo; Ge, Xiaodong; Xu, Jiahuan; Xin, Xianshuang; Sha, Xueqing; Su, Wenhui

Screen-printing technology was developed to fabricate Ce 0.8Sm 0.2O 1.9 (SDC) electrolyte films onto porous NiO-SDC green anode substrates. After sintering at 1400 °C for 4 h, a gas-tight SDC film with a thickness of 12 μm was obtained. A novel cathode material of Ba 0.5Sr 0.5Co 0.8Fe 0.2O 3- δ was subsequently applied onto the sintered SDC electrolyte film also by screen-printing and sintered at 970 °C for 3 h to get a single cell. A fuel cell of Ni-SDC/SDC (12 μm)/Ba 0.5Sr 0.5Co 0.8Fe 0.2O 3- δ provides the maximum power densities of 1280, 1080, 670, 370, 180 and 73 mW cm -2 at 650, 600, 555, 505, 455 and 405 °C, respectively, using hydrogen as fuel and stationary air as oxidant. When dry methane was used as fuel, the maximum power densities are 876, 568, 346 and 114 mW cm -2 at 650, 600, 555 and 505 °C, respectively. The present fuel cell shows excellent performance at lowered temperatures.

Accurate costs of blood transfusion: a microcosting of administering blood products in the United Kingdom National Health Service.

Science.gov (United States)

Stokes, Elizabeth A; Wordsworth, Sarah; Staves, Julie; Mundy, Nicola; Skelly, Jane; Radford, Kelly; Stanworth, Simon J

2018-04-01

In an environment of limited health care resources, it is crucial for health care systems which provide blood transfusion to have accurate and comprehensive information on the costs of transfusion, incorporating not only the costs of blood products, but also their administration. Unfortunately, in many countries accurate costs for administering blood are not available. Our study aimed to generate comprehensive estimates of the costs of administering transfusions for the UK National Health Service. A detailed microcosting study was used to cost two key inputs into transfusion: transfusion laboratory and nursing inputs. For each input, data collection forms were developed to capture staff time, equipment, and consumables associated with each step in the transfusion process. Costing results were combined with costs of blood product wastage to calculate the cost per unit transfused, separately for different blood products. Data were collected in 2014/15 British pounds and converted to US dollars. A total of 438 data collection forms were completed by 74 staff. The cost of administering blood was $71 (£49) per unit for red blood cells, $84 (£58) for platelets, $55 (£38) for fresh-frozen plasma, and $72 (£49) for cryoprecipitate. Blood administration costs add substantially to the costs of the blood products themselves. These are frequently incurred costs; applying estimates to the blood components supplied to UK hospitals in 2015, the annual cost of blood administration, excluding blood products, exceeds $175 (£120) million. These results provide more accurate estimates of the total costs of transfusion than those previously available. © 2018 AABB.

May 02, 2009

Indian Academy of Sciences (India)

2009-05-02 http://www.loksatta.com/daily/20090502/ch04.htm. #1. Leading International Marathi News Daily. Expressindia | The ndian Expres$ The Financial Express | City Newslines | Screen | Kashmir Live ||. Express Computer. | Network Mag az ine ndfa es usiness TravellerExpressP harma| Express Hospitality Express ...

Test-retest repeatability of child's respiratory symptoms and perceived indoor air quality - comparing self- and parent-administered questionnaires.

Science.gov (United States)

Lampi, Jussi; Ung-Lanki, Sari; Santalahti, Päivi; Pekkanen, Juha

2018-02-09

Questionnaires can be used to assess perceived indoor air quality and symptoms in schools. Questionnaires for primary school aged children have traditionally been parent-administered, but self-administered questionnaires would be easier to administer and may yield as good, if not better, information. Our aim was to compare the repeatability of self- and parent-administered indoor air questionnaires designed for primary school aged pupils. Indoor air questionnaire with questions on child's symptoms and perceived indoor air quality in schools was sent to parents of pupils aged 7-12 years in two schools and again after two weeks. Slightly modified version of the questionnaire was administered to pupils aged 9-12 years in another two schools and repeated after a week. 351 (52%) parents and 319 pupils (86%) answered both the first and the second questionnaire. Test-retest repeatability was assessed with intra-class correlation (ICC) and Cohen's kappa coefficients (k). Test-retest repeatability was generally between 0.4-0.7 (ICC; k) in both self- and parent-administered questionnaire. In majority of the questions on symptoms and perceived indoor air quality test-retest repeatability was at the same level or slightly better in self-administered compared to parent-administered questionnaire. Agreement of self- and parent administered questionnaires was generally indoor air quality. Children aged 9-12 years can give as, or even more, repeatable information about their respiratory symptoms and perceived indoor air quality than their parents. Therefore, it may be possible to use self-administered questionnaires in future studies also with children.

Efficacy and safety of intravenous fentanyl administered by ambulance personnel

DEFF Research Database (Denmark)

Friesgaard, Kristian Dahl; Nikolajsen, Lone; Giebner, Matthias

2016-01-01

BACKGROUND: Management of pain in the pre-hospital setting is often inadequate. In 2011, ambulance personnel were authorized to administer intravenous fentanyl in the Central Denmark Region. The aim of this study was to evaluate the efficacy and safety of intravenous fentanyl administered...... by ambulance personnel. METHODS: Pre-hospital medical charts from 2348 adults treated with intravenous fentanyl by ambulance personnel during a 6-month period were reviewed. The primary outcome was the change in pain intensity on a numeric rating scale (NRS) from before fentanyl treatment to hospital arrival...... patients (1.3%) and hypotension observed in 71 patients (3.0%). CONCLUSION: Intravenous fentanyl caused clinically meaningful pain reduction in most patients and was safe in the hands of ambulance personnel. Many patients had moderate to severe pain at hospital arrival. As the protocol allowed higher doses...

A Pilot Project Demonstrating that Combat Medics Can Safely Administer Parenteral Medications in the Emergency Department.

Science.gov (United States)

Schauer, Steven G; Cunningham, Cord W; Fisher, Andrew D; DeLorenzo, Robert A

2017-12-01

Introduction Select units in the military have improved combat medic training by integrating their functions into routine clinical care activities with measurable improvements in battlefield care. This level of integration is currently limited to special operations units. It is unknown if regular Army units and combat medics can emulate these successes. The goal of this project was to determine whether US Army combat medics can be integrated into routine emergency department (ED) clinical care, specifically medication administration. Project Design This was a quality assurance project that monitored training of combat medics to administer parenteral medications and to ensure patient safety. Combat medics were provided training that included direct supervision during medication administration. Once proficiency was demonstrated, combat medics would prepare the medications under direct supervision, followed by indirect supervision during administration. As part of the quality assurance and safety processes, combat medics were required to document all medication administrations, supervising provider, and unexpected adverse events. Additional quality assurance follow-up occurred via complete chart review by the project lead. Data During the project period, the combat medics administered the following medications: ketamine (n=13), morphine (n=8), ketorolac (n=7), fentanyl (n=5), ondansetron (n=4), and other (n=6). No adverse events or patient safety events were reported by the combat medics or discovered during the quality assurance process. In this limited case series, combat medics safely administered parenteral medications under indirect provider supervision. Future research is needed to further develop this training model for both the military and civilian setting. Schauer SG , Cunningham C W, Fisher AD , DeLorenzo RA . A pilot project demonstrating that combat medics can safely administer parenteral medications in the emergency department. Prehosp Disaster Med. 2017;32(6):679-681.

Can we safely administer the recommended dose of phenobarbital in very low birth weight infants?

Science.gov (United States)

Oztekin, Osman; Kalay, Salih; Tezel, Gonul; Akcakus, Mustafa; Oygur, Nihal

2013-08-01

We investigated whether the recommended phenobarbital loading dose of 15-20 mg/kg with maintenance of 3-4 mg/kg/day can safely be administered to very low birth weight preterm newborns with seizures. Twenty-four convulsive preterms of Phenobarbital was administered intravenously with a loading dose of 15 mg/kg in approximately 10-15 min. After 24 h, the maintenance dose of 3 mg/kg/day was administered as a single injection. Blood samples were obtained 2, 24, 48, 72, and 96 h after the phenobarbital loading dose was administered, immediately before the next phenobarbital dose was injected. None of the cases had plasma phenobarbital concentrations above the therapeutic upper limit of 40 μg/mL on the 2nd hour; one case (4.7%), on the 24th; 11 cases (45.8%), on the 48th; 15 cases (62.5%), on the 72nd; and 17 cases (70.8%), on the 96th hour. A negative correlation was detected between the serum concentrations of phenobarbital and gestational age on the 72th (p, 0.036; r, -0.608) and 96th hour (p, 0.043; r, -0.769). We suggest that particular attention should be done while administering phenobarbital in preterms, as blood levels of phenobarbital are higher than the reference ranges that those are often reached with the recommended doses in these groups of babies.

Reassessment of the atomic bomb radiation dosimetry for Hiroshima and Nagasaki. Dosimetry system 2002. DS02. Volume 1

International Nuclear Information System (INIS)

Young, Robert W.; Kerr, George D.

2005-01-01

The extensive efforts to review the dosimetry of the atomic-bomb survivors and formulate the new dosimetry system DS02 have been greatly welcomed by the Radiation Effects Research Foundation (RERF). This accomplishment is a fine tribute to the importance of the epidemiological studies being conducted at RERF. No other study is so informative of the effects of radiation on human health. The gracious participation in the RERF program by the atomic-bomb survivors allows us to contribute to the well being of these individuals, and the high quality of the data obtained allows the RERF results to feature so prominently in the formulation of international guidelines for radiation protection. Such a great effort to improve and substantiate the dosimetry would not otherwise have been justified. RERF greatly appreciates the independent work of the U.S. and Japanese Working Groups on the atomic-bomb dosimetry and the review by the Joint Senior Review Group of this overall effort. We are assured that unbiased development of the new dosimetry system will reflect well in its application in the RERF epidemiology study. The documentation included in this report will serve as reference for the many deliberations concluded. The title publications are divided into 2 volumes. This is the first volume. The 8 of the reports in each chapter are indexed individually. (J.P.N.)

Reassessment of the atomic bomb radiation dosimetry for Hiroshima and Nagasaki. Dosimetry system 2002. DS02. Volume 2

International Nuclear Information System (INIS)

Young, Robert W.; Kerr, George D.

2005-01-01

The extensive efforts to review the dosimetry of the atomic-bomb survivors and formulate the new dosimetry system DS02 have been greatly welcomed by the Radiation Effects Research Foundation (RERF). This accomplishment is a fine tribute to the importance of the epidemiological studies being conducted at RERF. No other study is so informative of the effects of radiation on human health. The gracious participation in the RERF program by the atomic-bomb survivors allows us to contribute to the well being of these individuals, and the high quality of the data obtained allows the RERF results to feature so prominently in the formulation of international guidelines for radiation protection. Such a great effort to improve and substantiate the dosimetry would not otherwise have been justified. RERF greatly appreciates the independent work of the U.S. and Japanese Working Groups on the atomic-bomb dosimetry and the review by the Joint Senior Review Group of this overall effort. We are assured that unbiased development of the new dosimetry system will reflect well in its application in the RERF epidemiology study. The documentation included in this report will serve as reference for the many deliberations concluded. The title publications are divided into 2 volumes. This is the second volume. The 29 of the reports in each chapter are indexed individually. (J.P.N.)

Structural, magnetic and magnetocaloric properties of La{sub 0.8}Ca{sub 0.2−x}Na{sub x}MnO{sub 3} manganites (0≤x≤0.2)

Energy Technology Data Exchange (ETDEWEB)

Choura Maatar, S. [Laboratoire de Physique des Matériaux, Faculté des Sciences de Sfax, Sfax University, B.P. 1171, 3000 Sfax (Tunisia); M’nassri, R. [Laboratoire de Physique des Matériaux, Faculté des Sciences de Sfax, Sfax University, B.P. 1171, 3000 Sfax (Tunisia); Institut NEEL, CNRS, B.P.166, 38042 Grenoble Cedex 9 (France); Cheikhrouhou Koubaa, W., E-mail: wissem.koubaa@yahoo.fr [Laboratoire de Physique des Matériaux, Faculté des Sciences de Sfax, Sfax University, B.P. 1171, 3000 Sfax (Tunisia); Koubaa, M. [Laboratoire de Physique des Matériaux, Faculté des Sciences de Sfax, Sfax University, B.P. 1171, 3000 Sfax (Tunisia); Cheikhrouhou, A. [Laboratoire de Physique des Matériaux, Faculté des Sciences de Sfax, Sfax University, B.P. 1171, 3000 Sfax (Tunisia); Centre de Recherche en Informatique, Multimédia et Traitement Numérique des Données, Technopole de Sfax, Cité El Ons, Route de Tunis, Km 9, Sfax. B.P. 275, Sakiet Ezzit, 3021 Sfax (Tunisia)

2015-05-15

In this work, we report the effect of Na doping on the structural, magnetic and magnetocaloric properties in La{sub 0.8}Ca{sub 0.2−x}Na{sub x}MnO{sub 3} powder samples. Our polycristalline samples have been synthesized using the solid-state reaction method at high temperatures. The parent compound La{sub 0.8}Ca{sub 0.2}MnO{sub 3} crystallizes in the orthorhombic system with Pbnm space group. Na doping induces a structural transition from orthorhombic (Pbnm space group) to rhombohedral (R-3C space group) symmetry. Magnetization measurements versus temperature in a magnetic applied field of 50 mT showed that all our investigated samples display a paramagnetic-ferromagnetic transition with decreasing temperature. The Curie temperature T{sub C} increases with Na content from 240 K for x=0 to 330 K for x=0.2. A large magnetocaloric effect has been observed in all samples, the maximum entropy change, |∆S{sub M}|{sub max}, shifts to smaller values with increasing Na content, from4.56 J/kg K (x=0.05) to 2.3 J/kg K (x=0.2) under a magnetic field change ∆µ{sub 0}H of 2 T. For the same applied magnetic field of 2 T, the Relative Cooling Power (RCP) values are found to be constant around 91 J/kg. - Graphical abstract: Sodium doping induces an increase of T{sub C} from 240 K for x=0 to 330 K for x=0.2. - Highlights: • La{sub 0.8}Ca{sub 0.2−x}Na{sub x}MnO{sub 3} are synthesized using the ceramic method at high temperatures. • Na doping induces a structural transition from Pbnm to R-3C space group. • T{sub C} increases with Na content from 240 K for x=0 to 330 K for x=0.2. • RCP is constant around 91 J/kg for all compounds under 2 T.

CGP lil-gp 2.1;1.02 User's Manual

Science.gov (United States)

Janikow, Cezary Z.; DeWeese, Scott W.

1997-01-01

This document describes extensions provided to lil-gp facilitating dealing with constraints. This document deals specifically with lil-gp 1.02, and the resulting extension is referred to as CGP lil-gp 2.1; 1.02 (the first version is for the extension, the second for the utilized lil-gp version). Unless explicitly needed to avoid confusion, version numbers are omitted.

Self-administered foot reflexology for the management of chronic health conditions: a systematic review.

Science.gov (United States)

Song, Hyun Jin; Choi, Sun Mi; Seo, Hyun-Ju; Lee, Heeyoung; Son, Heejeong; Lee, Sanghun

2015-02-01

To systematically review the effect of self-administered foot reflexology in patients with chronic health conditions. Electronic databases were searched for literature published from 1948 to January 2014. The databases included MEDLINE, EMBASE, the Cochrane Library, CINAHL, CNKI, J-STAGE, Koreamed, Kmbase, KISS, NDSL, KISTI, and OASIS. Key search terms were "exp/relaxation therapy," "foot," "reflexology," "zone therapy," and "self." All study designs were included. Two raters independently extracted data and assessed study quality by using the Cochrane risk of bias tool (for randomized controlled trials) and the risk of bias assessment tool for nonrandomized studies (for nonrandomized and before-and-after studies). A qualitative and descriptive analysis was performed because of the clinical diversity associated with chronic health conditions. Of the 224 records assessed, 4 trials met the inclusion criteria: 3 nonrandomized controlled trials and 1 before-and-after study without comparison. Self-administered foot reflexology might have a positive effect in type 2 diabetes, but the low quality of the included study and the lack of adequately reported clinical outcomes obscure the results. Two studies of hypertensive patients and 1 study of patients with urinary incontinence showed that self-performed foot reflexology may exert a beneficial effect on lowering blood pressure and urinary incontinence; however, given the small sample size and the lack of any description of medications and other cointerventions, there was insufficient evidence to conclusively determine whether foot reflexology had any effect. The included studies on self-administered foot reflexology in patients with type 2 diabetes, hypertension, or urinary incontinence provided insufficient evidence to determine a treatment effect. Therefore, a well-designed, large-scale, and randomized controlled trial is needed to confirm the effect of self-administered foot reflexology for chronic conditions.

Novel chloroacetamido compound CWR-J02 is an anti-inflammatory glutaredoxin-1 inhibitor.

Directory of Open Access Journals (Sweden)

Olga Gorelenkova Miller

Full Text Available Glutaredoxin (Grx1 is a ubiquitously expressed thiol-disulfide oxidoreductase that specifically catalyzes reduction of S-glutathionylated substrates. Grx1 is known to be a key regulator of pro-inflammatory signaling, and Grx1 silencing inhibits inflammation in inflammatory disease models. Therefore, we anticipate that inhibition of Grx1 could be an anti-inflammatory therapeutic strategy. We used a rapid screening approach to test 504 novel electrophilic compounds for inhibition of Grx1, which has a highly reactive active-site cysteine residue (pKa 3.5. From this chemical library a chloroacetamido compound, CWR-J02, was identified as a potential lead compound to be characterized. CWR-J02 inhibited isolated Grx1 with an IC50 value of 32 μM in the presence of 1 mM glutathione. Mass spectrometric analysis documented preferential adduction of CWR-J02 to the active site Cys-22 of Grx1, and molecular dynamics simulation identified a potential non-covalent binding site. Treatment of the BV2 microglial cell line with CWR-J02 led to inhibition of intracellular Grx1 activity with an IC50 value (37 μM. CWR-J02 treatment decreased lipopolysaccharide-induced inflammatory gene transcription in the microglial cells in a parallel concentration-dependent manner, documenting the anti-inflammatory potential of CWR-J02. Exploiting the alkyne moiety of CWR-J02, we used click chemistry to link biotin azide to CWR-J02-adducted proteins, isolating them with streptavidin beads. Tandem mass spectrometric analysis identified many CWR-J02-reactive proteins, including Grx1 and several mediators of inflammatory activation. Taken together, these data identify CWR-J02 as an intracellularly effective Grx1 inhibitor that may elicit its anti-inflammatory action in a synergistic manner by also disabling other pro-inflammatory mediators. The CWR-J02 molecule provides a starting point for developing more selective Grx1 inhibitors and anti-inflammatory agents for therapeutic

Vaginally administered PEGylated LIF antagonist blocked embryo implantation and eliminated non-target effects on bone in mice.

Directory of Open Access Journals (Sweden)

Ellen Menkhorst

Full Text Available Female-controlled contraception/HIV prevention is critical to address health issues associated with gender inequality. Therefore, a contraceptive which can be administered in tandem with a microbicide to inhibit sexually transmitted infections, is desirable. Uterine leukemia inhibitory factor (LIF is obligatory for blastocyst implantation in mice and associated with infertility in women. We aimed to determine whether a PEGylated LIF inhibitor (PEGLA was an effective contraceptive following vaginal delivery and to identify non-uterine targets of PEGLA in mice.Vaginally-applied (125I-PEGLA accumulated in blood more slowly (30 min vs 10 min and showed reduced tissue and blood retention (24 h vs 96 h compared to intraperitoneal injection in mice. Vaginally-applied PEGLA blocked implantation. PEGLA administered by intraperitoneal injection inhibited bone remodelling whereas vaginally-applied PEGLA had no effect on bone. Further, PEGLA had no effect in an animal model of multiple sclerosis, experimental auto-immune encephalomyelitis, suggesting PEGLA cannot target the central nervous system.Vaginally-administered PEGLA is a promising non-hormonal contraceptive, one which could be delivered alone, or in tandem with a microbicide. Vaginal application reduced the total dose of PEGLA required to block implantation and eliminated the systemic effect on bone, showing the vagina is a promising site of administration for larger drugs which target organs within the reproductive tract.

Self-administered outpatient parenteral antimicrobial therapy: a report of three years experience in the Irish healthcare setting.

LENUS (Irish Health Repository)

Kieran, J

2012-02-01

Outpatient parenteral antibiotic therapy (OPAT) was first reported in 1972. OPAT programmes are not well established in Ireland, with no reported outcomes in the literature. An OPAT programme was established at St. James Hospital in 2006. Demographics, diagnoses and outcomes of the first 60 courses are reported. A retrospective analysis of prospectively recorded data was performed on patients treated from March 2006 to February 2009. The data was analysed using SPSS v.17. Sixty OPAT courses were administered to 56 patients, 57 percent of which were male. The median age was 50 years, the median inpatient stay was 19 days, the median duration of OPAT was 16 days and 1,289 inpatient bed days were saved. The additional cost per day of OPAT was 167.60 euros. Vancomycin was the most prescribed antimicrobial, administered to 35%. Musculoskeletal infection was the indication for treatment in 50%. Confirmatory microbiological diagnosis was identified in 72%, most frequently due to Staphylococcus aureus (68%). Only minor adverse events were recorded. Clinical cure was achieved in 92.8%. A patient satisfaction survey showed high satisfaction. OPAT is a safe and effective way of providing parenteral antibiotic therapy in the Irish healthcare system. Better integration of funding and the appointment of Infectious Diseases specialists will facilitate its expansion.

Curcumin as a clinically-promising anti-cancer agent: pharmacokinetics and drug interactions.

Science.gov (United States)

Adiwidjaja, Jeffry; McLachlan, Andrew J; Boddy, Alan V

2017-09-01

Curcumin has been extensively studied for its anti-cancer properties. While a diverse array of in vitro and preclinical research support the prospect of curcumin use as an anti-cancer therapeutic, most human studies have failed to meet the intended clinical expectation. Poor systemic availability of orally-administered curcumin may account for this disparity. Areas covered: This descriptive review aims to concisely summarise available clinical studies investigating curcumin pharmacokinetics when administered in different formulations. A critical analysis of pharmacokinetic- and pharmacodynamic-based interactions of curcumin with concomitantly administered drugs is also provided. Expert opinion: The encouraging clinical results of curcumin administration are currently limited to people with colorectal cancer, given that sufficient curcumin concentrations persist in colonic mucosa. Higher parent curcumin systemic exposure, which can be achieved by several newer formulations, has important implications for optimal treatment of cancers other than those in gastrointestinal tract. Curcumin-drug pharmacokinetic interactions are also almost exclusively in the enterocytes, owing to extensive first pass metabolism and poor curcumin bioavailability. Greater scope of these interactions, i.e. modulation of the systemic elimination of co-administered drugs, may be expected from more-bioavailable curcumin formulations. Further studies are still warranted, especially with newer formulations to support the inclusion of curcumin in cancer therapy regimens.

Microwave dielectric properties of (Ca0.8Sr0.2)(SnxTi1−x)O3 ceramics

International Nuclear Information System (INIS)

Hsu, Cheng-Hsing; Chang, Chia-Hao

2013-01-01

Highlights: ► New microwave dielectric properties of (Ca 0.8 Sr 0.2 )(Sn x Ti 1−x )O 3 ceramics were investigated. ► A single-phase solid solution containing orthorhombic Pbnm with different Sn contents was formed. ► A significant improvement of Q × f value and τ f were achieved by (Ca 0.8 Sr 0.2 )(Sn x Ti 1−x )O 3 system. ► Second phases were formed and affected the dielectric properties of (Ca 0.8 Sr 0.2 )(Sn x Ti 1−x )O 3 system. ► Low cost and suitable τ f value of (Ca 0.8 Sr 0.2 )(Sn x Ti 1−x )O 3 demonstrate a good potential for use in microwave device. -- Abstract: In this paper, we study the behavior of the B-site behavior with the incorporation of Sn 4+ ion in (Ca 0.8 Sr 0.2 )TiO 3 ceramics. An excess of Sn 4+ resulted in the formation of a secondary phase of CaSnO 3 and SrSnO 3 affecting the microwave dielectric properties of the (Ca 0.8 Sr 0.2 )(Sn x Ti 1−x )O 3 ceramics. The dielectric properties of the (Ca 0.8 Sr 0.2 )(Sn x Ti 1−x )O 3 ceramics were improved because of the solid solution of Sn 4+ substitution in the B-site. The temperature coefficient of resonant frequency (τ f ) of the (Ca 0.8 Sr 0.2 )(Sn x Ti 1−x )O 3 ceramics also improved with increasing Sn content

The development of a self-administered dementia checklist: the examination of concurrent validity and discriminant validity.

Science.gov (United States)

Miyamae, Fumiko; Ura, Chiaki; Sakuma, Naoko; Niikawa, Hirotoshi; Inagaki, Hiroki; Ijuin, Mutsuo; Okamura, Tsuyoshi; Sugiyama, Mika; Awata, Shuichi

2016-01-01

The present study aims to develop a self-administered dementia checklist to enable community-residing older adults to realize their declining functions and start using necessary services. A previous study confirmed the factorial validity and internal reliability of the checklist. The present study examined its concurrent validity and discriminant validity. The authors conducted a 3-step study (a self-administered survey including the checklist, interviews by nurses, and interviews by doctors and psychologists) of 7,682 community-residing individuals who were over 65 years of age. The authors calculated Spearman's correlation coefficients between the scores of the checklist and the results of a psychological test to examine the concurrent validity. They also compared the average total scores of the checklist between groups with different Clinical Dementia Rating (CDR) scores to examine discriminant validity and conducted a receiver operating characteristic analysis to examine the discriminative power for dementia. The authors analyzed the data of 131 respondents who completed all 3 steps. The checklist scores were significantly correlated with the respondents' Mini-Mental State Examination and Frontal Assessment Battery scores. The checklist also significantly discriminated the patients with dementia (CDR = 1+) from those without dementia (CDR = 0 or 0.5). The optimal cut-off point for the two groups was 17/18 (sensitivity, 72.0%; specificity, 69.2%; positive predictive value, 69.2%; negative predictive value, 72.0%). This study confirmed the concurrent validity and discriminant validity of the self-administered dementia checklist. However, due to its insufficient discriminative power as a screening tool for older people with declining cognitive functions, the checklist is only recommended as an educational and public awareness tool.

Does directly administered antiretroviral therapy represent good value for money in sub-Saharan Africa? A cost-utility and value of information analysis.

Science.gov (United States)

Uthman, Rashidah T; Sutton, Andrew J; Jackson, Louise J; Uthman, Olalekan A

2018-01-01

Successful antiretroviral therapy (ART) relies on the optimal level of ART adherence to achieve reliable viral suppression, avert HIV drug resistance, and prevent avoidable deaths. It has been shown that there are various groups of people living with HIV at high-risk of non-adherence to ART in sub-Saharan Africa. The objective of this study was to examine the cost effectiveness and value-of-information of directly administered antiretroviral therapy (DAART) versus self-administered ART among people living with HIV, at high risk of non-adherence to ART in sub-Saharan Africa. A Markov model was developed that describes the transition between HIV stages based on the CD4 count, along with direct costs, quality of life and the mortality rate associated with DAART in comparison with self-administered ART. Data used in the model were derived from the published literature. A health system perspective was employed using a life-time time horizon. Probabilistic sensitivity analysis was performed to determine the impact of parameter uncertainty. Value of information analysis was also conducted. The expected cost of self-administered ART and DAART were $5,200 and $15,500 and the expected QALYs gained were 8.52 and 9.75 respectively, giving an incremental cost effectiveness ratio of $8,400 per QALY gained. The analysis demonstrated that the annual cost DAART needs to be priced below $200 per patient to be cost-effective. The probability that DAART was cost-effective was 1% for a willingness to pay threshold of $5,096 for sub-Saharan Africa. The value of information associated with the cost of DAART and its effectiveness was substantial. From the perspective of the health care payer in sub-Saharan Africa, DAART cannot be regarded as cost-effective based on current information. The value of information analysis showed that further research will be worthwhile and potentially cost-effective in resolving the uncertainty about whether or not to adopt DAART.

Does directly administered antiretroviral therapy represent good value for money in sub-Saharan Africa? A cost-utility and value of information analysis

Science.gov (United States)

Uthman, Rashidah T.; Sutton, Andrew J.; Jackson, Louise J.

2018-01-01

Background Successful antiretroviral therapy (ART) relies on the optimal level of ART adherence to achieve reliable viral suppression, avert HIV drug resistance, and prevent avoidable deaths. It has been shown that there are various groups of people living with HIV at high-risk of non-adherence to ART in sub-Saharan Africa. The objective of this study was to examine the cost effectiveness and value-of-information of directly administered antiretroviral therapy (DAART) versus self-administered ART among people living with HIV, at high risk of non-adherence to ART in sub-Saharan Africa. Methods and findings A Markov model was developed that describes the transition between HIV stages based on the CD4 count, along with direct costs, quality of life and the mortality rate associated with DAART in comparison with self-administered ART. Data used in the model were derived from the published literature. A health system perspective was employed using a life-time time horizon. Probabilistic sensitivity analysis was performed to determine the impact of parameter uncertainty. Value of information analysis was also conducted. The expected cost of self-administered ART and DAART were $5,200 and $15,500 and the expected QALYs gained were 8.52 and 9.75 respectively, giving an incremental cost effectiveness ratio of $8,400 per QALY gained. The analysis demonstrated that the annual cost DAART needs to be priced below $200 per patient to be cost-effective. The probability that DAART was cost-effective was 1% for a willingness to pay threshold of $5,096 for sub-Saharan Africa. The value of information associated with the cost of DAART and its effectiveness was substantial. Conclusions From the perspective of the health care payer in sub-Saharan Africa, DAART cannot be regarded as cost-effective based on current information. The value of information analysis showed that further research will be worthwhile and potentially cost-effective in resolving the uncertainty about whether or not

Does directly administered antiretroviral therapy represent good value for money in sub-Saharan Africa? A cost-utility and value of information analysis.

Directory of Open Access Journals (Sweden)

Rashidah T Uthman

Full Text Available Successful antiretroviral therapy (ART relies on the optimal level of ART adherence to achieve reliable viral suppression, avert HIV drug resistance, and prevent avoidable deaths. It has been shown that there are various groups of people living with HIV at high-risk of non-adherence to ART in sub-Saharan Africa. The objective of this study was to examine the cost effectiveness and value-of-information of directly administered antiretroviral therapy (DAART versus self-administered ART among people living with HIV, at high risk of non-adherence to ART in sub-Saharan Africa.A Markov model was developed that describes the transition between HIV stages based on the CD4 count, along with direct costs, quality of life and the mortality rate associated with DAART in comparison with self-administered ART. Data used in the model were derived from the published literature. A health system perspective was employed using a life-time time horizon. Probabilistic sensitivity analysis was performed to determine the impact of parameter uncertainty. Value of information analysis was also conducted. The expected cost of self-administered ART and DAART were $5,200 and $15,500 and the expected QALYs gained were 8.52 and 9.75 respectively, giving an incremental cost effectiveness ratio of $8,400 per QALY gained. The analysis demonstrated that the annual cost DAART needs to be priced below $200 per patient to be cost-effective. The probability that DAART was cost-effective was 1% for a willingness to pay threshold of $5,096 for sub-Saharan Africa. The value of information associated with the cost of DAART and its effectiveness was substantial.From the perspective of the health care payer in sub-Saharan Africa, DAART cannot be regarded as cost-effective based on current information. The value of information analysis showed that further research will be worthwhile and potentially cost-effective in resolving the uncertainty about whether or not to adopt DAART.

Long-term persistence of systemic and mucosal immune response to HPV-16/18 AS04-adjuvanted vaccine in preteen/adolescent girls and young women

DEFF Research Database (Denmark)

Petäjä, T; Pedersen, Court; Poder, A

2011-01-01

Vaccination against oncogenic human papillomavirus (HPV) types is one key intervention for cervical cancer prevention. This follow-up study assessed the persistence of the systemic and mucosal immune responses together with the safety profile of the HPV-16/18 AS04-adjuvanted vaccine administered...... of transudation or exudation of serum IgG antibodies through the cervical epithelium. The HPV-16/18 AS04-adjuvanted vaccine had a clinically acceptable safety profile. In conclusion, this follow-up study shows that the HPV-16/18 AS04-adjuvanted vaccine administered to preteen/adolescents girls and young women...... induces long-term systemic and mucosal immune response and has a clinically acceptable safety profile up to four years after the first vaccine dose....

Long-term persistence of systemic and mucosal immune response to HPV-16/18 AS04-adjuvanted vaccine in preteen/adolescent girls and young women

DEFF Research Database (Denmark)

Petäjä, T; Pedersen, C; Andersen, Anne Poder

2010-01-01

Vaccination against oncogenic human papillomavirus (HPV) types is one key intervention for cervical cancer prevention. This follow-up study assessed the persistence of the systemic and mucosal immune responses together with the safety profile of the HPV-16/18 AS04-adjuvanted vaccine administered...... of transudation or exudation of serum IgG antibodies through the cervical epithelium. The HPV-16/18 AS04-adjuvanted vaccine had a clinically acceptable safety profile. In conclusion, this follow-up study shows that the HPV-16/18 AS04-adjuvanted vaccine administered to preteen/adolescents girls and young women...... induces long-term systemic and mucosal immune response and has a clinically acceptable safety profile up to four years after the first vaccine dose....

Design of control system parameters of voltage, current and timer on x-ray device mobile type IX 7-02 using personal computer

International Nuclear Information System (INIS)

Sujatno; Tatah Nurbarkah; Toto Trikasjono; Nugroho

2013-01-01

The control system has made a parameter X-ray machine mobile IX 7-02 using personal computers. The X-Ray or Roentgen apparatus is an equipment used for medical diagnosis. Before the X-Ray apparatus is operated, its parameter to be set are high voltage (kV), tube current (mA) and exposure time (s). The control system in a conventional X-Ray apparatus still use analog system. On the X-Ray manual operations resulted the value of velocity data that are less accurate, therefore it needs to be carried out a control system modifying using micro controller AT89S51 and the parameter value was setting through personal computer. In the limited voltage regulation to the movement of the stepper motor that drives the chain dimer, the result of testing obtained the value of angle stepper motors with an estimated value of voltage 50 kV, 60 kV, 70 kV, 80 kV, 90 kV and 100 kV respectively 164°, 182°, 200°, 218°, 236° and 258°. Current selection by 4 choices such as 50 mA, 60 mA, 70 mA and 80 mA can successfully activate the relay. The timing of exposure in the range of 0.01 to 1 second which is set through the microcontroller program can be realized as well. The X-ray can be operated with these results. (author)

40 CFR 410.02 - Monitoring requirements. [Reserved

Science.gov (United States)

2010-07-01

... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Monitoring requirements. [Reserved] 410.02 Section 410.02 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT... requirements. [Reserved] ...

PRIMUS: Galaxy clustering as a function of luminosity and color at 0.2 < z < 1

Energy Technology Data Exchange (ETDEWEB)

Skibba, Ramin A.; Smith, M. Stephen M.; Coil, Alison L.; Mendez, Alexander J. [Department of Physics, Center for Astrophysics and Space Sciences, University of California, 9500 Gilman Drive, La Jolla, San Diego, CA 92093 (United States); Moustakas, John [Department of Physics and Astronomy, Siena College, 515 Loudon Road, Loudonville, NY 12211 (United States); Aird, James [Department of Physics, Durham University, Durham DH1 3LE (United Kingdom); Blanton, Michael R. [Center for Cosmology and Particle Physics, Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Bray, Aaron D.; Eisenstein, Daniel J. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Cool, Richard J. [MMT Observatory, 1540 E Second Street, University of Arizona, Tucson, AZ 85721 (United States); Wong, Kenneth C. [Steward Observatory, The University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721 (United States); Zhu, Guangtun, E-mail: rskibba@ucsd.edu [Department of Physics and Astronomy, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218 (United States)

2014-04-01

We present measurements of the luminosity and color-dependence of galaxy clustering at 0.2 < z < 1.0 in the Prism Multi-object Survey. We quantify the clustering with the redshift-space and projected two-point correlation functions, ξ(r{sub p} , π) and w{sub p} (r{sub p} ), using volume-limited samples constructed from a parent sample of over ∼130, 000 galaxies with robust redshifts in seven independent fields covering 9 deg{sup 2} of sky. We quantify how the scale-dependent clustering amplitude increases with increasing luminosity and redder color, with relatively small errors over large volumes. We find that red galaxies have stronger small-scale (0.1 Mpc h {sup –1} < r{sub p} < 1 Mpc h {sup –1}) clustering and steeper correlation functions compared to blue galaxies, as well as a strong color dependent clustering within the red sequence alone. We interpret our measured clustering trends in terms of galaxy bias and obtain values of b {sub gal} ≈ 0.9-2.5, quantifying how galaxies are biased tracers of dark matter depending on their luminosity and color. We also interpret the color dependence with mock catalogs, and find that the clustering of blue galaxies is nearly constant with color, while redder galaxies have stronger clustering in the one-halo term due to a higher satellite galaxy fraction. In addition, we measure the evolution of the clustering strength and bias, and we do not detect statistically significant departures from passive evolution. We argue that the luminosity- and color-environment (or halo mass) relations of galaxies have not significantly evolved since z ∼ 1. Finally, using jackknife subsampling methods, we find that sampling fluctuations are important and that the COSMOS field is generally an outlier, due to having more overdense structures than other fields; we find that 'cosmic variance' can be a significant source of uncertainty for high-redshift clustering measurements.

Sub-Circuit Selection and Replacement Algorithms Modeled as Term Rewriting Systems

Science.gov (United States)

2008-12-16

of Defense, or the United States Government . AFIT/GCO/ENG/09-02 Sub-circuit Selection and Replacement Algorithms Modeled as Term Rewriting Systems... unicorns and random programs”. Communications and Computer Networks, 24–30. 2005. 87 Vita Eric D. Simonaire graduated from Granite Baptist Church School in...Service to attend the Air Force Institute of Technol- ogy in 2007. Upon graduation, he will serve the federal government in an Information Assurance

40 CFR 147.550 - State-administered program.

Science.gov (United States)

2010-07-01

... (CONTINUED) STATE, TRIBAL, AND EPA-ADMINISTERED UNDERGROUND INJECTION CONTROL PROGRAMS Georgia § 147.550...'s program application: (a) Incorporation by reference. The requirements set forth in the State... Hazardous Waste Management Act, O.C.G.A. §§ 12-8-60 through 12-8-83 (1988); (7) Georgia Safe Drinking Water...

Preclinical advantages of intramuscularly administered peptide A3-APO over existing therapies in Acinetobacter baumannii wound infections.

Science.gov (United States)

Ostorhazi, Eszter; Rozgonyi, Ferenc; Sztodola, Andras; Harmos, Ferenc; Kovalszky, Ilona; Szabo, Dora; Knappe, Daniel; Hoffmann, Ralf; Cassone, Marco; Wade, John D; Bonomo, Robert A; Otvos, Laszlo

2010-11-01

The designer antibacterial peptide A3-APO is efficacious in mouse models of Escherichia coli and Acinetobacter baumannii systemic infections. Here we compare the efficacy of the peptide with that of imipenem and colistin in A. baumannii wound infections after burn injury. CD-1 mice were inflicted with burn wounds and different inocula of A. baumannii, isolated from an injured soldier, were placed into the wound sites. The antibiotics were given intramuscularly (im) one to five times. Available free peptide in the blood and the systemic toxicity of colistin and A3-APO were studied in healthy mice. While toxicity of colistin was observed at 25 mg/kg bolus drug administration, the lowest toxic dose of A3-APO was 75 mg/kg. In the A. baumannii blast injury models, 5 mg/kg A3-APO improved survival and reduced bacterial counts in the blood as well as in the wounds and improved wound appearance significantly better than any other antibiotic treatment. The free peptide concentration in the blood did not reach 1 µg/mL. Peptide A3-APO, with an intramuscular therapeutic index of 15, is more efficacious and less toxic than any existing burn injury infection therapy modality against multidrug-resistant Gram-negative pathogens. A3-APO administered by the im route probably binds to a biopolymer that promotes the peptide's biodistribution.

Indirect and inclusive search for dark matter with AMS02 space spectrometer

International Nuclear Information System (INIS)

Brun, Pierre

2007-01-01

AMS02 is a particle physics detector designed for 3 years of data taking aboard the International Space Station. Equipped with a superconducting magnet, it will allow to measure gamma and cosmic ray fluxes in the GeV to TeV region with high particle identification capabilities. Its performance is based on the redundancy of measurements in specific sub-detectors: a Time-Of-Flight counter, a Transition Radiation Detector, a Silicon Tracker, a Ring Imaging Cherenkov counter and an Electromagnetic calorimeter (Ecal). The Ecal is studied in details, in particular with the qualification of a stand-alone trigger devoted to gamma ray astronomy. This system allows to increase the AMS02 sensitivity to photons, and to improve the reconstruction of electromagnetic events. The analog part of the trigger system has been tested with test benches and in-beam at CERN. The in-orbit calibration of the Ecal is studied, it may proceed in two steps. First, the Ecal cells responses have to be equalized with minimum ionizing particles data. Then an absolute calibration can be performed with cosmic electrons. For both the relative and the absolute calibration, possible procedures are defined and realistic calibration times are estimated. The second part deals with the indirect searches for dark matter and the study of the AMS02 sensitivity. Dark matter stands for 84% of the Universe mass and could consist in new particles. Dark matter particles are expected to surround our Galaxy and annihilate in high density regions. These annihilations could become observable exotic primary cosmic ray sources. Searches for anomalous excesses in (p-bar, e + , D-bar) and γ ray fluxes will be performed by AMS02. A numerical tool allowing to perform predictions for these exotic fluxes within supersymmetry or extra-dimension is developed and is presented in details. Phenomenological studies regarding possible enhancements of these signals by over-dense regions of the halo have also been performed. The

21 CFR 1300.02 - Definitions relating to listed chemicals.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Definitions relating to listed chemicals. 1300.02 Section 1300.02 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE DEFINITIONS § 1300.02 Definitions relating to listed chemicals. (a) Any term not defined in this part shall have the...

Power Plant with C02 -Capture and Solar Energy Conversion in Microalgae Mass Culture

International Nuclear Information System (INIS)

Borodyanski, G.; Yantovski, E.; Levin, L.

1998-01-01

The purpose of the present study was to investigate a concept of a fuel reproduction after its burning and C02 trapping. This concept is considered with practical (technical) point of view. We focus our attention on the involving of biological system of fuel reproduction and C02 trapping in power plant for electricity production. The paper discusses the energy, biological, ecological and economical aspects of such power plant. This work is connected with potential development of zero-emission power and technological plant on the base of microalgae solar

Self-Administered, Home-Based SMART (Sensorimotor Active Rehabilitation Training) Arm Training: A Single-Case Report.

Science.gov (United States)

Hayward, Kathryn S; Neibling, Bridee A; Barker, Ruth N

2015-01-01

This single-case, mixed-method study explored the feasibility of self-administered, home-based SMART (sensorimotor active rehabilitation training) Arm training for a 57-yr-old man with severe upper-limb disability after a right frontoparietal hemorrhagic stroke 9 mo earlier. Over 4 wk of self-administered, home-based SMART Arm training, the participant completed 2,100 repetitions unassisted. His wife provided support for equipment set-up and training progressions. Clinically meaningful improvements in arm impairment (strength), activity (arm and hand tasks), and participation (use of arm in everyday tasks) occurred after training (at 4 wk) and at follow-up (at 16 wk). Areas for refinement of SMART Arm training derived from thematic analysis of the participant's and researchers' journals focused on enabling independence, ensuring home and user friendliness, maintaining the motivation to persevere, progressing toward everyday tasks, and integrating practice into daily routine. These findings suggest that further investigation of self-administered, home-based SMART Arm training is warranted for people with stroke who have severe upper-limb disability. Copyright © 2015 by the American Occupational Therapy Association, Inc.

19 CFR 212.02 - When the Act applies.

Science.gov (United States)

2010-04-01

... 19 Customs Duties 3 2010-04-01 2010-04-01 false When the Act applies. 212.02 Section 212.02 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT General Provisions § 212.02 When the Act applies...

Retinal protective effects of topically administered agmatine on ischemic ocular injury caused by transient occlusion of the ophthalmic artery

Science.gov (United States)

Hong, S.; Hara, H.; Shimazawa, M.; Hyakkoku, K.; Kim, C.Y.; Seong, G.J.

2012-01-01

Agmatine, an endogenous polyamine and putative neuromodulator, is known to have neuroprotective effects on various neurons in the central nervous system. We determined whether or not topically administered agmatine could reduce ischemic retinal injury. Transient ocular ischemia was achieved by intraluminal occlusion of the middle cerebral artery of ddY mice (30-35 g) for 2 h, which is known to also induce occlusion of the ophthalmic artery. In the agmatine group (N = 6), a 1.0 mM agmatine-containing ophthalmic solution was administered four times daily for 2 weeks before occlusion. In the control group (N = 6), a 0.1% hyaluronic acid ophthalmic solution was instilled at the same times. At 22 h after reperfusion, the eyeballs were enucleated and the retinal sections were stained by terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL). Transient ocular ischemia induced apoptosis of retinal cells in the entire retinal layer, and topically administered agmatine can significantly reduce this ischemic retinal injury. The proportion of apoptotic cells was definitely decreased (P agmatine application effectively decreases retinal damage in an in vivo ocular ischemic injury model. This implies that agmatine is a good candidate as a direct neuroprotective agent for eyes with ocular ischemic diseases. PMID:22331138

MAC-sparing effect of nitrous oxide in sevoflurane anesthetized sheep and its reversal with systemic atipamezole administration

Science.gov (United States)

Scanu, Antonio; Melosu, Valentino; Careddu, Giovanni Mario; Sotgiu, Giovanni

2018-01-01

Introduction Nitrous oxide (N2O) is an anesthetic gas with antinociceptive properties and reduces the minimum alveolar concentration (MAC) for volatile anesthetic agents, potentially through mechanisms involving central alpha2-adrenoceptors. We hypothesized that 70% N2O in the inspired gas will significantly reduce the MAC of sevoflurane (MACSEVO) in sheep, and that this effect can be reversed by systemic atipamezole. Materials and methods Animals were initially anesthetized with SEVO in oxygen (O2) and exposed to an electrical current as supramaximal noxious stimulus in order to determine MACSEVO (in duplicates). Thereafter, 70% N2O was added to the inspired gas and the MAC re-determined in the presence of N2O (MACSN). A subgroup of sheep were anesthetized a second time with SEVO/N2O for re-determination of MACSN, after which atipamezole (0.2 mg kg-1, IV) was administered for MACSNA determinations. Sheep were anesthetized a third time, initially with only SEVO/O2 to re-determine MACSEVO, after which atipamezole (0.2 mg kg-1, IV) was administered for determination of MACSA. Results MACSEVO was 2.7 (0.3)% [mean (standard deviation)]. Addition of N2O resulted in a 37% reduction of MACSEVO to MACSN of 1.7 (0.2)% (p <0.0001). Atipamezole reversed this effect, producing a MACSNA of 3.1 (0.7)%, which did not differ from MACSEVO (p = 0.12). MACSEVO did not differ from MACSA (p = 0.69). Cardiorespiratory variables were not different among experimental groups except a lower ETCO2 in animals exposed to SEVO/N2O. Conclusions N2O produces significant MACSEVO-reduction in sheep; this effect is completely reversed by IV atipamezole confirming the involvement of alpha2-adrenoreceptors in the MAC-sparing action of N2O. PMID:29315308

Pharmacokinetics of orally administered tramadol in domestic rabbits (Oryctolagus cuniculus).

Science.gov (United States)

Souza, Marcy J; Greenacre, Cheryl B; Cox, Sherry K

2008-08-01

To determine the pharmacokinetics of an orally administered dose of tramadol in domestic rabbits (Oryctolagus cuniculus). 6 healthy adult sexually intact female New Zealand White rabbits. Physical examinations and plasma biochemical analyses were performed to ensure rabbits were healthy prior to the experiment. Rabbits were anesthetized with isoflurane, and IV catheters were placed in a medial saphenous or jugular vein for collection of blood samples. One blood sample was collected before treatment with tramadol. Rabbits were allowed to recover from anesthesia a minimum of 1 hour before treatment. Then, tramadol (11 mg/kg, PO) was administered once, and blood samples were collected at various time points up to 360 minutes after administration. Blood samples were analyzed with high-performance liquid chromatography to determine plasma concentrations of tramadol and its major metabolite (O-desmethyltramadol). No adverse effects were detected after oral administration of tramadol to rabbits. Mean +/- SD half-life of tramadol after administration was 145.4 +/- 81.0 minutes; mean +/- SD maximum plasma concentration was 135.3 +/- 89.1 ng/mL. Although the dose of tramadol required to provide analgesia in rabbits is unknown, the dose administered in the study reported here did not reach a plasma concentration of tramadol or O-desmethyltramadol that would provide sufficient analgesia in humans for clinically acceptable periods. Many factors may influence absorption of orally administered tramadol in rabbits.

Subunit Rotavirus Vaccine Administered Parenterally to Rabbits Induces Active Protective Immunity

Science.gov (United States)

Ciarlet, Max; Crawford, Sue E.; Barone, Christopher; Bertolotti-Ciarlet, Andrea; Ramig, Robert F.; Estes, Mary K.; Conner, Margaret E.

1998-01-01

Virus-like particles (VLPs) are being evaluated as a candidate rotavirus vaccine. The immunogenicity and protective efficacy of different formulations of VLPs administered parenterally to rabbits were tested. Two doses of VLPs (2/6-, G3 2/6/7-, or P[2], G3 2/4/6/7-VLPs) or SA11 simian rotavirus in Freund’s adjuvants, QS-21 (saponin adjuvant), or aluminum phosphate (AlP) were administered. Serological and mucosal immune responses were evaluated in all vaccinated and control rabbits before and after oral challenge with 103 50% infective doses of live P[14], G3 ALA lapine rotavirus. All VLP- and SA11-vaccinated rabbits developed high levels of rotavirus-specific serum and intestinal immunoglobulin G (IgG) antibodies but not intestinal IgA antibodies. SA11 and 2/4/6/7-VLPs afforded similar but much higher mean levels of protection than 2/6/7- or 2/6-VLPs in QS-21. The presence of neutralizing antibodies to VP4 correlated (P < 0.001, r = 0.55; Pearson’s correlation coefficient) with enhanced protection rates, suggesting that these antibodies are important for protection. Although the inclusion of VP4 resulted in higher mean protection levels, high levels of protection (87 to 100%) from infection were observed in individual rabbits immunized with 2/6/7- or 2/6-VLPs in Freund’s adjuvants. Therefore, neither VP7 nor VP4 was absolutely required to achieve protection from infection in the rabbit model when Freund’s adjuvant was used. Our results show that VLPs are immunogenic when administered parenterally to rabbits and that Freund’s adjuvant is a better adjuvant than QS-21. The use of the rabbit model may help further our understanding of the critical rotavirus proteins needed to induce active protection. VLPs are a promising candidate for a parenterally administered subunit rotavirus vaccine. PMID:9765471

Electrical conductivity of cobalt doped La 0.8Sr 0.2Ga 0.8Mg 0.2O 3- δ

Science.gov (United States)

Wang, Shizhong; Wu, Lingli; Liang, Ying

La 0.8Sr 0.2Ga 0.8Mg 0.2O 3- δ (LSGM8282), La 0.8Sr 0.2Ga 0.8Mg 0.15Co 0.05O 3- δ (LSGMC5) and La 0.8Sr 0.2Ga 0.8Mg 0.115Co 0.085O 3- δ (LSGMC8.5) were prepared using a conventional solid-state reaction. Electrical conductivities and electronic conductivities of the samples were measured using four-probe impedance spectrometry, four-probe dc polarization and Hebb-Wagner polarization within the temperature range of 973-1173 K. The electrical conductivities in LSGMC5 and LSGMC8.5 increased with decreasing oxygen partial pressures especially in the high (>10 -5 atm) and low oxygen partial pressure regions (lanthanum gallate samples increased with increasing concentration of cobalt, suggesting that the concentration of cobalt should be optimized carefully to maintain a high electrical conductivity and close to 1 oxygen ion transference number.

Use of and confidence in administering outcome measures among clinical prosthetists: Results from a national survey and mixed-methods training program.

Science.gov (United States)

Gaunaurd, Ignacio; Spaulding, Susan E; Amtmann, Dagmar; Salem, Rana; Gailey, Robert; Morgan, Sara J; Hafner, Brian J

2015-08-01

Outcome measures can be used in prosthetic practices to evaluate interventions, inform decision making, monitor progress, document outcomes, and justify services. Strategies to enhance prosthetists' ability to use outcome measures are needed to facilitate their adoption in routine practice. To assess prosthetists' use of outcome measures and evaluate the effects of training on their confidence in administering performance-based measures. Cross-sectional and single-group pretest-posttest survey. Seventy-nine certified prosthetists (mean of 16.0 years of clinical experience) were surveyed about their experiences with 20 standardized outcome measures. Prosthetists were formally trained by the investigators to administer the Timed Up and Go and Amputee Mobility Predictor. Prosthetists' confidence in administering the Timed Up and Go and Amputee Mobility Predictor was measured before and after training. The majority of prosthetists (62%) were classified as non-routine outcome measure users. Confidence administering the Timed Up and Go and Amputee Mobility Predictor prior to training was low-to-moderate across the study sample. Training significantly (p measures. Interactive training resulted in a statistically significant increase of prosthetists' confidence in administering the Timed Up and Go and Amputee Mobility Predictor and may facilitate use of outcome measures in clinical practice. Frequency of outcome measure use in the care of persons with limb loss has not been studied. Study results suggest that prosthetists may not regularly use standardized outcome measures and report limited confidence in administering them. Training enhances confidence and may encourage use of outcome measures in clinical practice. © The International Society for Prosthetics and Orthotics 2014.

An internet-based self-administered intervention for promoting healthy habits and weight loss in hypertensive people who are overweight or obese: a randomized controlled trial.

Science.gov (United States)

Banos, Rosa M; Mensorio, Marinna S; Cebolla, Ausias; Rodilla, Enrique; Palomar, Gonzalo; Lisón, JuanFrancisco; Botella, Cristina

2015-08-04

The prevalence of overweight and obesity is on the rise worldwide with severe physical and psychosocial consequences. One of the most dangerous is hypertension. Lifestyle changes related to eating behaviour and physical activity are the critical components in the prevention and treatment of hypertension and obesity. Data indicates that the usual procedures to promote these healthy habits in health services are either insufficient or not efficient enough. Internet has been shown to be an effective tool for the implementation of lifestyle interventions based on this type of problem. This study aims to assess the efficacy of a totally self-administered online intervention programme versus the usual medical care for obese and overweight participants with hypertension (from the Spanish public health care system) to promote healthy lifestyles (eating behaviour and physical activity). A randomized controlled trial will be conducted with 100 patients recruited from the hypertension unit of a public hospital. Participants will be randomly assigned to one of two conditions: a) SII: a self-administered Internet-based intervention protocol; and b) MUC-medical usual care. The online intervention is an Internet-delivered, multimedia, interactive, self-administered programme, composed of nine modules designed to promote healthy eating habits and increase physical activity. The first five modules will be activated at a rate of one per week, and access for modules 5 to 9 will open every two weeks. Patients will be assessed at four points: before the intervention, after the intervention (3 months), and at 6 and 12 months (follow-up). The outcome variables will include blood pressure, and Body Mass Index, as primary outcome measures, and quality of life and other lifestyle and anthropometrical variables as secondary outcome measures. The literature highlights the need for more studies on the benefits of using the Internet to promote lifestyle interventions. This study aims to

Rectally administered indomethacin to prevent post-ESWL-pancreatitis (RIPEP): study protocol for a randomized controlled trial.

Science.gov (United States)

Qian, Yang-Yang; Chen, Hui; Tang, Xin-Ying; Jiang, Xi; Qian, Wei; Zou, Wen-Bin; Xin, Lei; Li, Bo; Qi, Yan-Fen; Hu, Liang-Hao; Zou, Duo-Wu; Jin, Zhen-Dong; Wang, Dong; Du, Yi-Qi; Wang, Luo-Wei; Liu, Feng; Li, Zhao-Shen; Liao, Zhuan

2017-11-02

Pancreatic extracorporeal shock wave lithotripsy (P-ESWL) is the first-line therapy for large pancreatic duct stones. Although it is a highly effective and safe procedure for the fragmentation of pancreatic stones, it is still not complication-free. Just like endoscopic retrograde cholangiopancreatography (ERCP), pancreatitis is the most common complication. To date, nonsteroidal anti-inflammatory drugs (NSAIDs) have proven to be the only effective prophylactic medication for post-ERCP pancreatitis and the European, American and Japanese Society for Gastrointestinal Endoscopy guidelines have recommended prophylactic rectally administered indomethacin for all patients undergoing ERCP. Given the little research about effective prevention for post P-ESWL pancreatitis, we aim to determine whether rectally administered indomethacin can reduce post-ESWL-pancreatitis. The RIPEP study is a prospective, randomized, double-blinded, placebo-controlled trial. One thousand three hundred and seventy patients with chronic pancreatitis and pancreatic stones (>5 mm in diameter) treated with P-ESWL at Changhai Hospital will be randomly allocated to rectally administered indomethacin or placebo therapy before the procedure. The primary endpoint is the incidence of post-ESWL pancreatitis. Secondary endpoints include the severity of pancreatitis, occurrence rate of asymptomatic hyperamylasemia and other complications. The RIPEP trial is designed to show that rectally administered indomethacin reduces the development and severity of post-ESWL pancreatitis and benefits patients treated with P-ESWL. ClinicalTrials.gov, ID: NCT02797067 . Registered on 17 November 2016.

Airborne Collision Avoidance System as a Cyber-Physical System

Directory of Open Access Journals (Sweden)

Andrei C. NAE

2015-12-01

Full Text Available In this paper the key concepts of ITS - Intelligent Transport Systems, CPS - Cyber-Physical Systems and SM - Smart Mobility are defined and correlated with the need for ACAS – Airborne Collision Avoidance System, as the last resort safety net and indispensable ingredient in civil aviation. Smart Mobility is addressed from a Cyber Physical-Systems perspective, detailing some of the elements that this entails. Here we consider the Air Transportations System of the future as a Cyber-Physical System and analyze the implications of doing so from different perspectives. The objective is to introduce a 4D collision avoidance shield technology which forms a last resort safety net technology for the next generation air transport (2050 and beyond. The new system will represent a step change over the performance of current technology. As conclusions, the benefits of implementing Transport Cyber-Physical Systems are discussed, as well as what this would require for future deployment.

Findings from Survey Administered to Weatherization Training Centers

Energy Technology Data Exchange (ETDEWEB)

Conlon, Brian [Univ. of Tennessee, Knoxville, TN (United States); Tonn, Bruce Edward [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

2015-03-01

This report summarizes results of a survey administered to directors of weatherization training centers that receive funding from the U.S. Department of Energy. The survey presents results related to questions on training offered and future plans.

Diminished metabolic responses to centrally-administered apelin-13 in diet-induced obese rats fed a high-fat diet.

Science.gov (United States)

Clarke, K J; Whitaker, K W; Reyes, T M

2009-02-01

The central administration of apelin, a recently identified adipokine, has been shown to affect food and water intake. The present study investigated whether body weight could affect an animal's response to apelin. The effects of centrally-administered apelin-13 on food and water intake, activity and metabolic rate were investigated in adult male diet-induced obese (DIO) rats fed either a high fat (32%) or control diet. Rats were administered i.c.v. apelin-13, 15-30 min prior to lights out, and food and water intake, activity and metabolic rate were assessed. Intracerebroventricular administration of apelin-13 decreased food and water intake and respiratory exchange ratio in DIO rats on the control diet, but had no effect in DIO rats on the high-fat diet. In an effort to identify potential central mechanisms explaining the observed physiological responses, the mRNA level of the apelin receptor, APJ, was examined in the hypothalamus. A high-fat diet induced an up-regulation of the expression of the receptor. Apelin induced a down-regulation of the receptor, but only in the DIO animals on the high-fat diet. In conclusion, we have demonstrated a diminished central nervous system response to apelin that is coincident with obesity.

Internet-versus group-administered cognitive behaviour therapy for panic disorder in a psychiatric setting: a randomised trial

Directory of Open Access Journals (Sweden)

Karlsson Andreas

2010-07-01

Full Text Available Abstract Background Internet administered cognitive behaviour therapy (CBT is a promising new way to deliver psychological treatment, but its effectiveness in regular care settings and in relation to more traditional CBT group treatment has not yet been determined. The primary aim of this study was to compare the effectiveness of Internet-and group administered CBT for panic disorder (with or without agoraphobia in a randomised trial within a regular psychiatric care setting. The second aim of the study was to establish the cost-effectiveness of these interventions. Methods Patients referred for treatment by their physician, or self-referred, were telephone-screened by a psychiatric nurse. Patients fulfilling screening criteria underwent an in-person structured clinical interview carried out by a psychiatrist. A total of 113 consecutive patients were then randomly assigned to 10 weeks of either guided Internet delivered CBT (n = 53 or group CBT (n = 60. After treatment, and at a 6-month follow-up, patients were again assessed by the psychiatrist, blind to treatment condition. Results Immediately after randomization 9 patients dropped out, leaving 104 patients who started treatment. Patients in both treatment conditions showed significant improvement on the main outcome measure, the Panic Disorder Severity Scale (PDSS after treatment. For the Internet treatment the within-group effect size (pre-post on the PDSS was Cohen's d = 1.73, and for the group treatment it was d = 1.63. Between group effect sizes were low and treatment effects were maintained at 6-months follow-up. We found no statistically significant differences between the two treatment conditions using a mixed models approach to account for missing data. Group CBT utilised considerably more therapist time than did Internet CBT. Defining effect as proportion of PDSS responders, the cost-effectiveness analysis concerning therapist time showed that Internet treatment had superior cost

Development of a sedation protocol using orally administered tiletamine-zolazepam-acepromazine in free-roaming dogs.

Science.gov (United States)

Huang, Hsiao-Chun; Huang, Shih-Wei; Yu, Kuan-Hua; Wang, Jiann-Hsiung; Wu, Jui-Te

2017-09-01

To investigate the sedative effects in dogs of tiletamine-zolazepam-acepromazine (TZA) or ketamine-flunitrazepam (KF) administered orally and to evaluate the effectiveness of encapsulated TZA for capturing free-roaming dogs. Experimental study followed by a field trial. Six research dogs and 27 free-roaming dogs. In a pilot study, six research dogs were administered liquid TZA (20 mg kg -1 tiletamine-zolazepam and 2 mg kg -1 acepromazine) or liquid KF (50 mg kg -1 ketamine and 2 mg kg -1 flunitrazepam) orally: treatment 1, forcefully squirting liquid medication into the mouth; treatment 2, encapsulating liquid medication for administration in canned food; treatment 3, administering liquid medication mixed with gravy. Sedation was scored. A follow-up field trial attempted capture of 27 free-roaming dogs. In the pilot study, the median time (range) to lateral recumbency (% dogs) after TZA administration was: treatment 1, 47.5 (35-80) minutes (67%); treatment 2, 30 (15-65) minutes (83%); and treatment 3, 75 (45-110) minutes (100%). No dogs in KF treatment 2 or 3 achieved lateral recumbency. Based on these results, 20 free-roaming dogs were offered encapsulated TZA in canned food: TZ (20 mg kg -1 ) and acepromazine (2 mg kg -1 ). Of these, no further drugs to four dogs (one dog captured), 10 dogs were administered a second dose within 30 minutes (five dogs captured) and six dogs were administered TZ (5 mg kg -1 ) and xylazine (1.1-2.2 mg kg -1 ) intramuscularly by blow dart (six dogs captured). Seven dogs were initially offered twice the TZA dose (five dogs captured). In total, 63% free-roaming dogs were captured after administration of encapsulated TZA in canned food. Oral administration of encapsulated TZA in canned dog food can aid in the capture of free-roaming dogs, but additional drugs may be required. The sedation onset time and medication palatability influenced the capture rate. Copyright © 2017 Association of Veterinary Anaesthetists and

Analgesic efficacy, adverse effects, and safety of oxycodone administered as continuous intravenous infusion in patients after total hip arthroplasty

Directory of Open Access Journals (Sweden)

Olczak B

2017-05-01

Full Text Available Bogumił Olczak,1 Grzegorz Kowalski,1,2 Wojciech Leppert,2 Iwona Zaporowska-Stachowiak,3 Katarzyna Wieczorowska-Tobis2 1Department of Anesthesiology, Józef Struś Multiprofile Municipal Hospital, 2Department of Palliative Medicine, Poznan University of Medical Sciences, 3Department of Pharmacology, Poznan University of Medical Sciences, Poland Background: Total hip arthroplasty (THA causes extensive tissue damage and severe pain. This study aimed to assess the analgesic efficacy, adverse effects (AEs, and safety of continuous intravenous (iv oxycodone infusion with ketoprofen (injected into the iv line in patients after THA, and to assay serum oxycodone levels.Patients and methods: Fourteen patients, aged 59‒82 years with American Society of Anesthesiologists (ASA classification I or III, underwent THA with intrathecal analgesia and sedation induced by iv propofol. After the surgery, oxycodone (continuous iv infusion at a dose of 1 mg/h (five patients or 2 mg/h (nine patients with 100 mg ketoprofen (injected into the iv line was administered to each patient every 12 h. Pain was assessed using a numerical rating scale (NRS: 0 – no pain, 10 – the most severe pain at rest and during movement. AEs, including hemodynamic unsteadiness, nausea, vomiting, pruritus, cognitive impairment, and respiratory depression, were registered during the first 24 h after surgery.Results: Oxycodone (continuous iv infusion at a dose of 2 mg/h with ketoprofen (100 mg administered every 12 h provided satisfactory analgesia in all nine patients without the need of rescue analgesics within the first 24 h after THA. In three out of five patients, oxycodone at 1 mg/h was effective. Oxycodone did not induce drowsiness, vomiting, pruritus, respiratory depression, or changes in blood pressure. Bradycardia appeared in two patients, and nausea was observed in one patient.Conclusion: Oxycodone infusion with ketoprofen administered by iv is effective in patients after THA

Gadolinium-DTPA (Magnevist) as a contrast medium for arterial DSA

International Nuclear Information System (INIS)

Schild, H.H.; Weber, W.; Boeck, E.; Mildenberger, P.; Strunk, H.; Dueber, C.; Grebe, P.; Schadmand-Fischer, S.; Thelen, M.

1994-01-01

16 DSA investigations using intra-arterial Gd-DTPA were performed on 12 patients. The contrast medium was administered either as a 0.5 molar gadolinium solution (commercially available) or diluted with distilled water to a 0.2 -0.4 molar gadolinium solution. The injection was made either by pressure injector or by hand. The aortic arch, abdominal aorta and pelvic and lower limb arteries were examined. 14 of the 16 procedures were diagnostically adequate, but compared with iodinated contrast materials, contrast was less marked. There were no cardiovascular, neurological or allergic side effects. Three patients suffered a feeling of heat and one patient had mild pain during the injection. Even large volumes rapidly injected (up to 20 ml/s of the commercially available solution) were well tolerated. DSA with intra-arterial Gd-DTPA seems to be a suitable alternative for vascular imaging if iodine-containing contrast materials are contraindicated. (orig.) [de

Screening for cognitive impairment in SLE using the Self-Administered Gerocognitive Exam.

Science.gov (United States)

Meara, A; Davidson, N; Steigelman, H; Zhao, S; Brock, G; Jarjour, W N; Rovin, B H; Madhoun, H; Parikh, S; Hebert, L; Ayoub, I; Ardoin, S P

2018-01-01

Objective Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease that can affect the central nervous system in multiple ways, including causing cognitive dysfunction. Cognitive dysfunction is a common complaint of SLE patients yet diagnosis is challenging, time consuming, and costly. This study evaluated the Self-Administered Gerocognitive Exam (SAGE) as a screening test for cognitive impairment in a cohort of SLE patients. Methods A total of 118 SLE patients completed the SAGE. Providers completed the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) and the Systemic Lupus International Collaborative Clinics Damage Index (SLICC-DI). SAGE scores were grouped into normal (>16) and abnormal (≤16) categories. Univariate and multivariate analyses were performed. Results Of the 118 participants, 21(18%) scored ≤16 on the SAGE instrument. In univariate analysis, race, ethnicity, household income, and SLICC-DI scores were associated with the SAGE ( p SAGE score was independently associated with higher SLICC-DI score (odds ratio (OR) = 1.44, 95% confidence intervals 1.04-1.99, p = 0.03)), Hispanic ethnicity (OR = 43.4, 95% CI 3.1-601, p = 0.005), and lower household income (OR = 11.9 for ≤$15,000 vs >$50,000, 95% CI 2.45-57, p = 0.002). Conclusions In SLE patients, this study demonstrates an independent relationship between neurocognitive impairment (as measured by the SAGE) and higher lupus-related damage, as measured by the SLICC-DI, and lower household income. Abnormal SAGE scores were also associated with Hispanic ethnicity. A language barrier could explain this because the SAGE instrument was conducted in English only. The SAGE was feasible to measure in the clinic setting.

A RETRAN-02 model of the Sizewell B PCSR design - the Winfrith one-loop model, version 3.0

International Nuclear Information System (INIS)

Kinnersly, S.R.

1983-11-01

A one-loop RETRAN-02 model of the Sizewell B Pre Construction Safety Report (PCSR) design, set up at Winfrith, is described and documented. The model is suitable for symmetrical pressurised transients. Comparison with data from the Sizewell B PCSR shows that the model is a good representation of that design. Known errors, limitations and deficiencies are described. The mode of storage and maintenance at Winfrith using PROMUS (Program Maintenance and Update System) is noted. It is recommended that users modify the standard data by adding replacement cards to the end so as to aid in identification, use and maintenance of local versions. (author)

Milrinone and levosimendan administered after reperfusion improve myocardial stunning in swine.

Science.gov (United States)

Shibata, Itsuko; Cho, Sungsam; Yoshitomi, Osamu; Ureshino, Hiroyuki; Maekawa, Takuji; Hara, Tetsuya; Sumikawa, Koji

2013-02-01

We assessed the effect of milrinone application timing after reperfusion against myocardial stunning as compared with levosimendan in swine. Furthermore, we examined the role of p38 mitogen-activated protein kinase (p38 MAPK) in the milrinone-induced cardioprotection. All swine were subjected to 12-minutes ischemia followed by 90-minutes reperfusion to generate stunned myocardium. Milrinone or levosimendan was administered intravenously either for 20 minutes starting just after reperfusion or for 70 minutes starting 20 minutes after reperfusion. In another group, SB203580, a selective p38 MAPK inhibitor, was administered with and without milrinone. Regional myocardial contractility was assessed by percent segment shortening (%SS). Milrinone starting just after reperfusion, but not starting 20 minutes after reperfusion, improved %SS at 30, 60, and 90 minutes after reperfusion compared with that in the control group. SB203580 abolished the beneficial effect of milrinone. On the other hand, levosimendan starting 20 minutes after reperfusion, but not for 20 minutes starting just after reperfusion, improved %SS at 60 and 90 minutes after reperfusion. Milrinone should be administered just after reperfusion to protect myocardial stunning through p38 MAPK, whereas levosimendan improvement of contractile function could be mainly dependent on its positive inotropic effect.

Pressure effect on crystal structure and superconductivity of La0.8Th0.2FeAsO

International Nuclear Information System (INIS)

Kumar, Ravhi S.; Antonio, Daniel; Cornelius, Andrew L.; Zhao, Yusheng; Kanagaraj, M.; Arumugam, S.; Sinogeikin, Stanislav; Prakash, J.; Thakur, Gohil S.; Ganguli, A.K.; Hartmann, Thomas

2011-01-01

We have studied the effect of pressure on the superconducting transition temperature (T c ) of thorium doped La 1-x Th x FeAsO (x = 0.2) superconductor under hydrostatic pressures up to 1.6 GPa by resistivity and magnetization experiments. Application of pressure increases the T c to 31 K with a positive pressure coefficient of ∝1 K/GPa. Low temperature X-ray diffraction studies performed at 7.8 K at high pressures show no pressure induced structural changes and the tetragonal P4/nmm structure is found to persist up to 31 GPa. (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

Social media as a student response system: new evidence on learning impact

Directory of Open Access Journals (Sweden)

Chelsea Liu

2018-04-01

Full Text Available The ubiquitousness of social media renders it a potentially powerful tool in higher education. This study explores the use of Twitter as a tool to enhance active learning and improve feedback during large-sized lectures. Students in a final-year undergraduate accounting course at an Australian university engaged in Twitter-based synchronous activities, including answering in-lecture quizzes and posting questions. This study explores two key questions: (1 ‘what encourages students to actively utilise social media in their learning process?’ and (2 ‘what pedagogical advantages are offered by social media in enhancing students’ learning experiences?’ Results of a student survey administered at the end of the course show that (1 students are more likely to participate in in-lecture Twitter activities if they are familiar with the technology, (2 Twitter activities encourage students to participate in active learning, (3 Twitter provides a platform enabling two-way student–instructor communication and (4 students find Twitter activities helpful regardless of whether they attend the lecture in real time or view online lecture recordings. These findings deepen our understanding of the pedagogical benefits of using Twitter as a student response system, which will assist educators to better harness the power of social media in the learning–teaching process.

Indirect and inclusive search for dark matter with AMS02 space spectrometer

International Nuclear Information System (INIS)

Brun, P.

2007-06-01

AMS02 is a particle physics detector designed for 3 years of data collecting aboard the International Space Station. Equipped with a superconducting magnet, it will allow to measure gamma and cosmic ray fluxes in the GeV to TeV region with high particle identification capabilities. Its performance is based on the redundancy of measurements in specific sub-detectors: a Time-Of-Flight counter, a Transition Radiation Detector, a Silicon Tracker, a Ring Imaging Cherenkov counter and an Electromagnetic calorimeter (Ecal). The Ecal is studied in details, in particular with the qualification of a stand-alone trigger devoted to gamma ray astronomy. This system allows the increase of the AMS02 sensitivity to photons, and the improvement of the reconstruction of electromagnetic events. The analog part of the trigger system has been tested with test benches and with a beam at CERN. The in-orbit calibration of the Ecal is studied, it may proceed in two steps. First, the Ecal cells responses have to be equalized with minimum ionizing particles data. Then an absolute calibration can be performed with cosmic electrons. For both the relative and the absolute calibration, possible procedures are defined and realistic calibration times are estimated. The second part deals with the indirect searches for dark matter and the study of the AMS02 sensitivity. Dark matter stands for 84% of the Universe mass and could consist in new particles. Dark matter particles are expected to surround our Galaxy and annihilate in high density regions. These annihilations could become observable exotic primary cosmic ray sources. Searches for anomalous excesses in (p-bar, e + , D-bar) and γ ray fluxes will be performed by AMS02. A numerical tool allowing us to perform predictions for these exotic fluxes within supersymmetry or extra-dimension is developed and is presented in details. Phenomenological studies regarding possible enhancements of these signals by over-dense regions of the halo have also

Measuring a Crisis: Questioning the Use of Naloxone Administrations as a Marker for Opioid Overdoses in a Large U.S. EMS System.

Science.gov (United States)

Grover, Joseph M; Alabdrabalnabi, Taibah; Patel, Mehul D; Bachman, Michael W; Platts-Mills, Timothy F; Cabanas, Jose G; Williams, Jefferson G

2018-01-01

The United States is currently experiencing a public health crisis of opioid overdoses. To determine where resources may be most needed, many public health officials utilize naloxone administration by EMS as an easily-measured surrogate marker for opioid overdoses in a community. Our objective was to evaluate whether naloxone administration by EMS accurately represents EMS calls for opioid overdose. We hypothesize that naloxone administration underestimates opioid overdose. We conducted a chart review of suspected overdose patients and any patients administered naloxone in Wake County, North Carolina, from January 2013 to December 2015. Patient care report narratives and other relevant data were extracted from electronic patient care records and the resultant database was analyzed by two EMS physicians. Cases were divided into categories including "known opioid use," "presumed opioid use," "no known opioid," "altered mental status," "cardiac arrest with known opioid use," "cardiac arrest with no known opioid use," or "suspected alcohol intoxication," and then further separated based on whether naloxone was administered. Patient categories were compared by patient demographics and incident year. Using the chart review classification as the gold standard, we calculated the sensitivity and positive predictive value (PPV) of naloxone administration for opioid overdose. A total of 4,758 overdose cases from years 2013-15 were identified. During the same period, 1,351 patients were administered naloxone. Of the 1,431 patients with known or presumed opioid use, 57% (810 patients) received naloxone and 43% (621 patients) did not. The sensitivity of naloxone administration for the identification of patients with known or presumed opioid use was 57% (95% CI: 54%-59%) and the PPV was 60% (95% CI: 57%-63%). Among patients receiving care in this large urban EMS system in the United States, the overall sensitivity and positive predictive value for naloxone administration for

A new radiation exposure record system

International Nuclear Information System (INIS)

Lyon, M.; Berndt, V.L.; Trevino, G.W.; Oakley, B.M.

1993-04-01

The Hanford Radiological Records Program (HRRP) serves all Hanford contractors as the single repository for radiological exposure for all Hanford employees, subcontractors, and visitors. The program administers and preserves all Hanford radiation exposure records. The program also maintains a Radiation Protection Historical File which is a historical file of Hanford radiation protection and dosimetry procedures and practices. Several years ago DOE declared the existing UNIVAC mainframe computer obsolete and the existing Occupational Radiation Exposure (ORE) system was slated to be redeveloped. The new system named the Radiological Exposure (REX) System is described in this document

Radiologically occult scaphoid and wrist fractures. Preliminary results in comparison of 0.2-T and 1.0-T units

International Nuclear Information System (INIS)

Breitenseher, M.J.; Trattnig, S.; Happel, B.; Bankier, A.; Rand, T.; Imhof, H.; Gaebler, C.; Kukla, C.

1997-01-01

The study was performed to determine the diagnostic value of different MR systems and field strengths in patients with occult scaphoid and wrist fractures. Twelve patients with clinical suspicion of a scaphoid fracture but normal plain radiographs were examined by MRI. A dedicated 0.2-T unit (Esaote) and a 1.0-T unit (NT10, Philips) were used. Coronal T1W-SE, STIR, and T2*W-GE sequences were obtained with both systems. Images were evaluated for a bone marrow abnormality, a trabecular or cortical fracture line, and were compared to the 6-week follow-up radiographs. Seven wrist fractures were found at 0.2 T and 1.0 T, proven in the follow-up radiographs. A bone marrow abnormality was present in all seven fractures on both systems. Trabecular and cortical fracture lines were visualized at 0.2 T in four cases and at 1.0 T in seven cases. Low-field MR imaging at 0.2 T and mid-field MR imaging at 1.0 T seem to be equivalent in the diagnosis of a fracture in radiographically occult scaphoid and wrist fractures. In the visualization of fracture details, important for therapeutic and prognostic considerations, 1.0 T seems to be superior. (orig.) [de

Pharmacokinetics of a new subcutaneous diclofenac formulation administered to three body sites: quadriceps, gluteus, and abdomen.

Science.gov (United States)

Salomone, Salvatore; Piazza, Cateno; Vitale, Daniela Cristina; Cardì, Francesco; Gugliotta, Barbara; Drago, Filippo

2014-02-01

To assess the relative bioavailability of a new subcutaneous (SC) diclofenac hydroxypropyl b-cyclodextrin (HPbCD) formulation administered to three body sites: quadriceps, gluteus, and abdomen. This was a pilot, single-dose, randomized, three-way crossover relative bioavailability study. A total of 12 healthy subjects received a single SC injection of diclofenac HPbCD 50 mg/1 mL in the quadriceps, gluteus, or abdomen. The AUC was comparable after SC diclofenac HPbCD in the quadriceps, gluteus, and abdomen. The Cmax was comparable after SC administration in the quadriceps or abdomen, and ~ 17% higher in the gluteus. The absorption was rapid (30 minutes) after administration of the treatment at any site. The treatment was well tolerated. The relative bioavailability of SC diclofenac HPbCD was comparable when administered to the quadriceps, gluteus, and abdomen. The new diclofenac formulation can therefore be administered subcutaneously to any of these sites without clinically significant differences. A further adequately powered study would be necessary to reveal any differences among injection sites in terms of peak plasma concentration.

Nonclinical Safety Assessment of SYN-004: An Oral β-lactamase for the Protection of the Gut Microbiome From Disruption by Biliary-Excreted, Intravenously Administered Antibiotics.

Science.gov (United States)

Kokai-Kun, John F; Bristol, J Andrew; Setser, John; Schlosser, Michael

2016-05-01

SYN-004 is a first in class, recombinant β-lactamase that degrades β-lactam antibiotics and has been formulated to be administered orally to patients receiving intravenous β-lactam antibiotics including cephalosporins. SYN-004 is intended to degrade unmetabolized antibiotics excreted into the intestines and thus has the potential to protect the gut microbiome from disruption by these antibiotics. Protection of the gut microbiome is expected to protect against opportunistic enteric infections such as Clostridium difficile infection as well as antibiotic-associated diarrhea. In order to demonstrate that oral SYN-004 is safe for human clinical trials, 2 Good Laboratory Practice-compliant toxicity studies were conducted in Beagle dogs. In both studies, SYN-004 was administered orally 3 times per day up to the maximum tolerated dose of the formulation. In the first study, doses of SYN-004 administered over 28 days were safe and well tolerated in dogs with the no-observed-adverse-effect level at the high dose of 57 mg/kg/day. Systemic absorption of SYN-004 was minimal and sporadic and showed no accumulation during the study. In the second study, doses up to 57 mg/kg/day were administered to dogs in combination with an intravenous dose of ceftriaxone (300 mg/kg) given once per day for 14 days. Coadministration of oral SYN-004 with intravenous ceftriaxone was safe and well tolerated, with SYN-004 having no noticeable effect on the plasma pharmacokinetics of ceftriaxone. These preclinical studies demonstrate that SYN-004 is well tolerated and, when coadministered with ceftriaxone, does not interfere with its systemic pharmacokinetics. These data supported advancing SYN-004 into human clinical trials. © The Author(s) 2015.

Design of a novel integration-deficient lentivector technology that incorporates genetic and posttranslational elements to target human dendritic cells.

Science.gov (United States)

Tareen, Semih U; Kelley-Clarke, Brenna; Nicolai, Christopher J; Cassiano, Linda A; Nelson, Lisa T; Slough, Megan M; Vin, Chintan D; Odegard, Jared M; Sloan, Derek D; Van Hoeven, Neal; Allen, James M; Dubensky, Thomas W; Robbins, Scott H

2014-03-01

As sentinels of the immune system, dendritic cells (DCs) play an essential role in regulating cellular immune responses. One of the main challenges of developing DC-targeted therapies includes the delivery of antigen to DCs in order to promote the activation of antigen-specific effector CD8 T cells. With the goal of creating antigen-directed immunotherapeutics that can be safely administered directly to patients, Immune Design has developed a platform of novel integration-deficient lentiviral vectors that target and deliver antigen-encoding nucleic acids to human DCs. This platform, termed ID-VP02, utilizes a novel genetic variant of a Sindbis virus envelope glycoprotein with posttranslational carbohydrate modifications in combination with Vpx, a SIVmac viral accessory protein, to achieve efficient targeting and transduction of human DCs. In addition, ID-VP02 incorporates safety features in its design that include two redundant mechanisms to render ID-VP02 integration-deficient. Here, we describe the characteristics that allow ID-VP02 to specifically transduce human DCs, and the advances that ID-VP02 brings to conventional third-generation lentiviral vector design as well as demonstrate upstream production yields that will enable manufacturing feasibility studies to be conducted.

Dicty_cDB: FC-AA02 [Dicty_cDB

Lifescience Database Archive (English)

Full Text Available FC (Link to library) FC-AA02 (Link to dictyBase) - - - Contig-U16527-1 FC-AA02Z (Li...nk to Original site) - - FC-AA02Z 458 - - - - Show FC-AA02 Library FC (Link to library) Clone ID FC-AA02 (Link to dic...linum small subunit ribosomal RNA gene, partial sequence. 149 2e-47 2 AY179984 |AY179984.1 Uncultured alveo... CP000930_2283( CP000930 |pid:none) Heliobacterium modesticaldum Ic... 33 2.3 AP009386_1894( AP009386 |pid:none) Burkholderia multi... EU955514 |pid:none) Zea mays clone 1535262 hypothetica... 50 2e-05 BA000023_1285

Absence of autoreactive CD4+ T-cells targeting HLA-DQA1*01:02/DQB1*06:02 restricted hypocretin/orexin epitopes in narcolepsy type 1 when detected by EliSpot.

Science.gov (United States)

Kornum, Birgitte Rahbek; Burgdorf, Kristoffer Sølvsten; Holm, Anja; Ullum, Henrik; Jennum, Poul; Knudsen, Stine

2017-08-15

Narcolepsy type 1, a neurological sleep disorder strongly associated with Human Leukocyte Antigen (HLA-)DQB1*06:02, is caused by the loss of hypothalamic neurons producing the wake-promoting neuropeptide hypocretin (hcrt, also known as orexin). This loss is believed to be caused by an autoimmune reaction. To test whether hcrt itself could be a possible target in the autoimmune attack, CD4 + T-cell reactivity towards six different 15-mer peptides from prepro-hypocretin with high predicted affinity to the DQA1*01:02/DQB1*06:02 MHC class II dimer was tested using EliSpot in a cohort of 22 narcolepsy patients with low CSF hcrt levels, and 23 DQB1*06:02 positive healthy controls. Our ELISpot assay had a detection limit of 1:10,000 cells. We present data showing that autoreactive CD4 + T-cells targeting epitopes from the hcrt precursor in the context of MHC-DQA1*01:02/DQB1*06:02 are either not present or present in a frequency is <1:10,000 among peripheral CD4 + T-cells from narcolepsy type 1 patients. Copyright © 2017 Elsevier B.V. All rights reserved.

Self-administered Gerocognitive Examination (SAGE): a brief cognitive assessment Instrument for mild cognitive impairment (MCI) and early dementia.

Science.gov (United States)

Scharre, Douglas W; Chang, Shu-Ing; Murden, Robert A; Lamb, James; Beversdorf, David Q; Kataki, Maria; Nagaraja, Haikady N; Bornstein, Robert A

2010-01-01

To develop a self-administered cognitive assessment instrument to facilitate the screening of mild cognitive impairment (MCI) and early dementia and determine its association with gold standard clinical assessments including neuropsychologic evaluation. Adults aged above 59 years with sufficient vision and English literacy were recruited from geriatric and memory disorder clinics, educational talks, independent living facilities, senior centers, and memory screens. After Self-administered Gerocognitive Examination (SAGE) screening, subjects were randomly selected to complete a clinical evaluation, neurologic examination, neuropsychologic battery, functional assessment, and mini-mental state examination (MMSE). Subjects were identified as dementia, MCI, or normal based on standard clinical criteria and neuropsychologic testing. Two hundred fifty-four participants took the SAGE screen and 63 subjects completed the extensive evaluation (21 normal, 21 MCI, and 21 dementia subjects). Spearman rank correlation between SAGE and neuropsychologic battery was 0.84 (0.76 for MMSE). SAGE receiver operating characteristics on the basis of clinical diagnosis showed 95% specificity (90% for MMSE) and 79% sensitivity (71% for MMSE) in detecting those with cognitive impairment from normal subjects. This study suggests that SAGE is a reliable instrument for detecting cognitive impairment and compares favorably with the MMSE. The self-administered feature may promote cognitive testing by busy clinicians prompting earlier diagnosis and treatment.

In-flight operations and status of the AMS-02 silicon tracker

OpenAIRE

Ambrosi, G.; Azzarello, P.; Battiston, R.; Bertucci, B.; Choumilov, E.; Choutko, V.; Crispoltoni, M.; Delgado, C.; Duranti, M.; Donnini, F.; D'Urso, D.; Fiandrini, E.; Formato, V.; Graziani, M.; Habiby, M.

2016-01-01

The AMS-02 detector is a large acceptance magnetic spectrometer operating on the International Space Station since May 2011. More than 60 billion events have been collected by the instrument as of today. One of the key subdetectors of AMS-02 is the microstrip silicon Tracker, designed to precisely measure the trajectory and absolute charge of cosmic rays in the GeV-TeV energy range. In addition, with the magnetic field, is also measuring the particle magnetic rigidity, defined as R = pc/Ze, a...

Musculoskeletal Health of 40-65 Year Old Males and Females in Kosova and the Impact of N05B, A02B (PPI, H2RA), H02AB and Lifestyle Factors on It.

Science.gov (United States)

Krasniqi, Ermira; Koni, Mynyr; Tschan, Harald; Krasniqi, Blerim; Kabashi, Antigona; Boshnjaku, Arben

2016-10-01

This observational, cross-sectional study investigates the impact of medication usage, physical activity (PA) and nutritional status on musculoskeletal health (MSH) in males and females aged 40-65 in the population of a post conflict, developing country. Bone Mineral Density (BMD), T-score and Z-score at distal forearm regions (measured by DEXA scan), together with isometric hand grip strength (dynamometer) were evaluated in a total of 162 subjects (53 Males, average age 55.15±7.12 and 109 Females, 54.27±5.1). Additionally, bio-anthropometric assessments, medication usage, PA level and nutritional status were assessed. Significant differences (p0.05) in BMD, T-score, and hand grip in total population, except for A02B where p<0.05 were found in Hand grip, as well as between female consumers and no consumers in all variables. Meanwhile, in total subjects consuming H02AB Glucocorticoids p<0.05 were observed in BMD and T-score, but not on hand grip. This study shows a low risk for MSH problems amongst the studied population in Kosova, while the consumption of H02AB medication group in both genders and A02B in females only for extended periods might effect MSH, therefore appropriate benefit/risk assessment should be made before prescribing these medications, notwithstanding age, gender, PA or nutritional status.

ZY3-02 Laser Altimeter On-orbit Geometrical Calibration and Test

Directory of Open Access Journals (Sweden)

TANG Xinming

2017-06-01

Full Text Available ZY3-02 is the first satellite equipped with a laser altimeter for earth observation in China .This laser altimeter is an experimental payload for land elevation measurement experiment. The ranging and pointing bias of the laser altimeter would change due to the launch vibration, the space environment difference or other factors, and that could bring plane and elevation errors of laser altimeter. In this paper, we propose an on-orbit geometric calibration method using a ground-based electro-optical detection system based on the analysis of ZY3-02 laser altimeter characteristic, and this method constructs the rigorous geometric calibration model, which consider the pointing and ranging bias as unknown systematic errors, and the unknown parameters are calibrated with laser spot's location captured by laser detectors and the minimum ranging error principle. With the ALOS-DSM data as reference, the elevation accuracy of the laser altimeter can be improved from 100~150 meters before calibration to 2~3 meters after calibration when the terrain slope is less than 2 degree. With several ground control points obtained with RTK in laser footprint for validation, the absolute elevation precision of laser altimeter in the flat area can reach about 1 meter after the calibration. The test results demonstrated the effectiveness and feasibility of the proposed method.

40 CFR 147.2500 - State-administered program.

Science.gov (United States)

2010-07-01

... State-administered program: (1) Chapter 144, Water, Sewage, Refuse, Mining and Air Pollution, Wisconsin... Section 147.2500 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS... Treatment Works, Wisconsin Administrative Code § 210.05 Natural Resources Board Order No. WQ-25-82, approved...

Epidural labor analgesia: A comparison of ropivacaine 0.125% versus 0.2% with fentanyl

Directory of Open Access Journals (Sweden)

Yogesh Kumar Chhetty

2013-01-01

Conclusion: We conclude that both the concentrations of ropivacaine (0.2% and 0.125% with fentanyl are effective in producing epidural labor analgesia. However, 0.2% concentration was found superior in terms of faster onset, prolonged duration, lesser breakthrough pain requiring lesser top-ups, and hence a lesser consumption of opioids.

Pavlovian conditioning between co-administered drugs: elicitation of an apomorphine-induced antiparkinsonian response by scopolamine.

Science.gov (United States)

Carey, R J

1991-01-01

Sprague-Dawley rats with unilateral 6-OHDA substantia nigra lesions were given combined scopolamine (0.5 mg/kg IP) and apomorphine (0.05 mg/kg SC) treatments. In this animal model, scopolamine, when administered separately, induces ipsilateral rotation and apomorphine, contralateral rotation. When these drugs are co-administered at 0.5 mg/kg and 0.05 mg/kg dose levels, respectively, animals rotate in the contralateral direction, creating the opportunity for the stimulus effect of scopolamine to become associated with the response effect of apomorphine. In tests with scopolamine (0.5 mg/kg), animals that previously had scopolamine and apomorphine co-administered rotated contralaterally in the test chamber, thereby behaving as if they had received apomorphine. Thus, scopolamine exhibited a functionally acquired conditioned stimulus (CS) property by eliciting the apomorphine response of contralateral rotation as a conditioned response. This acquired CS property was extinguished with separate scopolamine trials and reacquired following one scopolamine-apomorphine co-administration trial.

Antibody production in rabbits administered Freund's complete adjuvant and carprofen concurrently.

Science.gov (United States)

Fishback, Joanna E; Stronsky, Sabrina M; Green, Catherine A; Bean, Krystal D; Froude, Jeffrey W

2016-02-01

Freund's complete adjuvant (FCA) is a commonly used immunopotentiator that can boost polyclonal antibody production in animal models such as rabbits, but FCA is also known to cause inflammation and pain. It is important to balance the welfare of animals with the goal of efficiently producing antibodies, but little is known about how common treatments for pain and inflammation, such as non-steroidal anti-inflammatory drugs (NSAIDs), affect the production of polyclonal antibodies. The purpose of this study was to measure polyclonal antibody production in rabbits that were administered FCA either with or without a concurrent treatment of a NSAID, carprofen. Rabbits were divided into two groups and were administered identical treatments of an antigen with adjuvant, and the treatment group also received carprofen injections at different stages of the study. Carprofen treatment did not significantly affect polyclonal antibody production, which suggests that carprofen and other NSAIDs can be used alongside FCA in rabbits to achieve desired levels of antibody production while minimizing pain and distress associated with the use of FCA.

J/$\\psi$ production as a function of charged-particle pseudorapidity density in p-Pb collisions at $\\sqrt{s_{\\rm NN}} = 5.02$ TeV

OpenAIRE

Adamová, D.; Aggarwal, Madan Mohan; Alam, Sk Noor; Biswas, Rathijit; Zardoshti, Nima; Zarochentsev, Andrey; Zavada, Petr; Zavyalov, Nikolay; Zbroszczyk, Hanna Paulina; Zhalov, Mikhail; Zhang, Haitao; Zhang, Xiaoming; Zhang, Yonghong; Chunhui, Zhang; Biswas, Saikat

2018-01-01

We report measurements of the inclusive J/ ψ yield and average transverse momentum as a function of charged-particle pseudorapidity density dNch/dη in p–Pb collisions at sNN=5.02TeV with ALICE at the LHC. The observables are normalised to their corresponding averages in non-single diffractive events. An increase of the normalised J/ ψ yield with normalised dNch/dη , measured at mid-rapidity, is observed at mid-rapidity and backward rapidity. At forward rapidity, a saturation of the relative y...

In situ gel systems as 'smart' carriers for sustained ocular drug delivery.

Science.gov (United States)

Agrawal, Ashish Kumar; Das, Manasmita; Jain, Sanyog

2012-04-01

In situ gel systems refer to a class of novel delivery vehicles, composed of natural, semisynthetic or synthetic polymers, which present the unique property of sol-gel conversion on receipt of biological stimulus. The present review summarizes the latest developments in in situ gel technology, with regard to ophthalmic drug delivery. Starting with the mechanism of ocular absorption, the review expands on the fabrication of various polymeric in situ gel systems, made up of two or more polymers presenting multi-stimuli sensitivity, coupled with other interesting features, such as bio-adhesion, enhanced penetration or sustained release. Various key issues and challenges in this area have been addressed and critically analyzed. The advent of in situ gel systems has inaugurated a new transom for 'smart' ocular delivery. By virtue of possessing stimuli-responsive phase transition properties, these systems can easily be administered into the eye, similar to normal eye drops. Their unique gelling properties endow them with special features, such as prolonged retention at the site of administration, followed by sustained drug release. Despite the superiority of these systems as compared with conventional ophthalmic formulations, further investigations are necessary to address the toxicity issues, so as to minimize regulatory hurdles during commercialization.

HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 Haplotype Protects Autoantibody-Positive Relatives From Type 1 Diabetes Throughout the Stages of Disease Progression.

Science.gov (United States)

Pugliese, Alberto; Boulware, David; Yu, Liping; Babu, Sunanda; Steck, Andrea K; Becker, Dorothy; Rodriguez, Henry; DiMeglio, Linda; Evans-Molina, Carmella; Harrison, Leonard C; Schatz, Desmond; Palmer, Jerry P; Greenbaum, Carla; Eisenbarth, George S; Sosenko, Jay M

2016-04-01

The HLA-DRB1*15:01-DQA1*01:02-DQB1*06:02 haplotype is linked to protection from the development of type 1 diabetes (T1D). However, it is not known at which stages in the natural history of T1D development this haplotype affords protection. We examined a cohort of 3,358 autoantibody-positive relatives of T1D patients in the Pathway to Prevention (PTP) Study of the Type 1 Diabetes TrialNet. The PTP study examines risk factors for T1D and disease progression in relatives. HLA typing revealed that 155 relatives carried this protective haplotype. A comparison with 60 autoantibody-negative relatives suggested protection from autoantibody development. Moreover, the relatives with DRB1*15:01-DQA1*01:02-DQB1*06:02 less frequently expressed autoantibodies associated with higher T1D risk, were less likely to have multiple autoantibodies at baseline, and rarely converted from single to multiple autoantibody positivity on follow-up. These relatives also had lower frequencies of metabolic abnormalities at baseline and exhibited no overall metabolic worsening on follow-up. Ultimately, they had a very low 5-year cumulative incidence of T1D. In conclusion, the protective influence of DRB1*15:01-DQA1*01:02-DQB1*06:02 spans from autoantibody development through all stages of progression, and relatives with this allele only rarely develop T1D. © 2016 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

FE02 and visual observation for a CTBT OSI

International Nuclear Information System (INIS)

Kuang, F.

2004-01-01

FE02 field experiment conducted in Kazakhstan provided useful experience according to different OSI procedures. The effectiveness of conducting a visual observation during an OSI affects the accomplishment of the inspection mandate directly and substantially. The paper gives description of basic functions, stages and visual observation peculiarities at OSI pseudo-real and real scenario. An essential question on basic requirements to visual inspectors was also reviewed. (author)

DIAGNOSTIC CARDIAC CATHETERIZATION USING THE MEDRAD AVANTA FLUID MANAGEMENT SYSTEM AS COMPARED TO THE TRADITIONAL MANUAL INJECTION METHOD

Energy Technology Data Exchange (ETDEWEB)

Winniford, Michael D

2013-02-08

Nearly 4 million patient procedures performed annually in US cardiac catheterization laboratories utilize contrast media to achieve vessel opacification. The amount of contrast media used is variable and depends on the complexity of the procedure, the method of contrast delivery as well as the skill-level of the operator. Since the total amount of contrast used for each procedure can have both patient safety and economic implications, it is essential for cardiologists to have the ability to control contrast delivery such that optimal angiographic image quality is achieved using the least amount of contrast. Although the complication rate associated with cardiac catheterization remains low, the most common serious complication, contrast-induced nephropathy (CIN), is associated with poor prognosis and a high mortality rate. Numerous interventional strategies for preventing and reducing the severity of CIN have demonstrated varying degrees of clinical benefit, but none has been shown to reliably prevent this serious complication. To date, the most effective approach for reducing the risk of CIN is to properly hydrate the patient and to minimize the amount of contrast media administered. Automated injection systems are intended for use in virtually all cardiac catheterization procedures and have numerous features which can provide potential advantages over traditional methods. With automated injection technology the operator is able to control and precisely monitor contrast delivery. Additionally, the MEDRAD Avanta Fluid Management Injection System utilizes a sterile contrast reservoir which eliminates the need to discard unused contrast in individual opened containers following each procedure. Considering that an average of 50% of opened contrast media is wasted using manual injection methods, this savings can provide a substantial economic benefit. Automated systems also facilitate the use of smaller (5 French) catheter sizes. Precise flow control and the use of

The microstructures and electrochemical performances of La0.6Gd0.2Mg0.2Ni3.0Co0.5-xAlx (x=0-0.5) hydrogen storage alloys as negative electrodes for nickel/metal hydride secondary batteries

Science.gov (United States)

Li, Rongfeng; Xu, Peizhen; Zhao, Yamin; Wan, Jing; Liu, Xiaofang; Yu, Ronghai

2014-12-01

La0.6Gd0.2Mg0.2Ni3.0Co0.5-xAlx (x = 0-0.5) hydrogen storage alloys were prepared by induction melting followed by annealing treatment at 1173 K for 8 h. The effects of substitution Al for Co on the microstructures and electrochemical performances were studied systematically. The structure analyses show that all alloys consist of multiphase structures such as (La, Mg)2Ni7 phase, (La, Mg) Ni3 phase and LaNi5 phase. The abundance of (La, Mg)2Ni7 phase decreases while the abundance of LaNi5 phase and (La, Mg)Ni3 phase increases directly as the Al content increasing. The electrochemical tests show that the maximum discharge capacity of alloy electrodes are almost unchanged when x ≤ 0.2 while the cyclic stability of the alloy electrode are improved significantly after proper amount of Al substitution for Co. The alloy electrode with x = 0.1 exhibits the better balance between discharge capacity and cycling life than any others. Moreover, at the discharge current density of 900 mA g-1, the high rate dischargeability (HRD) of the alloy electrodes decreases with increasing Al substitution and the relative analyses reveal that the charge transfer on alloy surface is more important than the hydrogen diffusion in alloy bulk for the kinetic properties of the alloy electrodes.

Exon: CBRC-RNOR-02-0038 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RNOR-02-0038 ttaagcaccaagaggaccaagtaaaactccttgacaaacaaagcaaacggtttcatgatttcaaa...cacagtcgtcagtccaagattttaaacacagttgtctatccaaagtcgaaaaacaaaacaaaagccaaaaagacactggacaataccacagaaaacaacccagacaaataa ...

Exon: CBRC-RNOR-02-0090 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RNOR-02-0090 GAAAGGGAATTGGCCTACCATACAAGCAGGAGCAAAGCAACGTTTACCACGATTCGGGAGACTCTGAacacacacacacacacacacaca...cacacacacacacacacacacacacaccacagagagagagagagagagagagagagggagggagggagggagggagagaaaga

Retinal protective effects of topically administered agmatine on ischemic ocular injury caused by transient occlusion of the ophthalmic artery

Directory of Open Access Journals (Sweden)

S. Hong

2012-03-01

Full Text Available Agmatine, an endogenous polyamine and putative neuromodulator, is known to have neuroprotective effects on various neurons in the central nervous system. We determined whether or not topically administered agmatine could reduce ischemic retinal injury. Transient ocular ischemia was achieved by intraluminal occlusion of the middle cerebral artery of ddY mice (30-35 g for 2 h, which is known to also induce occlusion of the ophthalmic artery. In the agmatine group (N = 6, a 1.0 mM agmatine-containing ophthalmic solution was administered four times daily for 2 weeks before occlusion. In the control group (N = 6, a 0.1% hyaluronic acid ophthalmic solution was instilled at the same times. At 22 h after reperfusion, the eyeballs were enucleated and the retinal sections were stained by terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL. Transient ocular ischemia induced apoptosis of retinal cells in the entire retinal layer, and topically administered agmatine can significantly reduce this ischemic retinal injury. The proportion of apoptotic cells was definitely decreased (P < 0.001; Kruskal-Wallis test. Overall, we determined that topical agmatine application effectively decreases retinal damage in an in vivo ocular ischemic injury model. This implies that agmatine is a good candidate as a direct neuroprotective agent for eyes with ocular ischemic diseases.

Cerivastatin Nano-Liposome as a Potential Disease Modifying Approach for the Treatment of Pulmonary Arterial Hypertension.

Science.gov (United States)

Lee, Young; Pai, S Balakrishna; Bellamkonda, Ravi V; Thompson, David H; Singh, Jaipal

2018-04-25

In this study, we have investigated nano-liposome as an approach to tailor the pharmacology of cerivastatin as a disease modifying drug for pulmonary arterial hypertension (PAH). Cerivastatin encapsulated liposomes with an average diameter of 98±27 nm were generated by thin film and freeze-thaw process. The nano-liposomes demonstrated sustained drug release kinetics in vitro and inhibited proliferation of pulmonary artery smooth muscle cells with significantly less cellular cytotoxicity as compared to free cerivastatin. When delivered by inhalation to a rat model of monocrotalin induced PAH, cerivastatin significantly reduced pulmonary artery pressure from 55.13±9.82 mmHg to 35.56±6.59 mmHg (P < 0.001) and diminished pulmonary artery wall thickening. Echocardiography showed that cerivastatin significantly reduced right ventricle thickening (0.34±0.02 cm monocrotalin vs. 0.26±0.02 cm cerivastatin; P < 0.001) and increased pulmonary artery acceleration time (13.98±1.14 ms monocrotalin vs. 21.07±2.80 ms cerivastatin; P < 0.001). Nano-liposomal cerivastatin was equally effective or slightly better than cerivastatin in reducing pulmonary artery pressure (67.06±13.64 mmHg monocrotalin; 46.31±7.64 mmHg cerivastatin vs. 37.32±9.50 mmHg liposomal cerivastatin) and improving parameters of right ventricular function as measured by increasing pulmonary artery acceleration time (24.68±3.92 ms monocrotalin; 32.59±6.10 ms cerivastatin vs. 34.96±7.51 ms liposomal cerivastatin). More importantly, the rate and magnitude of toxic cerivastatin metabolite lactone generation from the intratracheally administered nano-liposomes was significantly lower as compared to intravenously administered free cerivastatin. These studies show that nano-liposome encapsulation improved in vitro and in vivo pharmacological and safety profile of cerivastatin and may represent a safer approach as a disease modifying therapy for PAH. The American Society for Pharmacology and Experimental

Validation of the Portuguese self-administered computerised 24-hour dietary recall among second-, third- and fourth-grade children

Science.gov (United States)

Current methods for assessing children's dietary intake, such as interviewer-administered 24-h dietary recall (24-h DR), are time consuming and resource intensive. Self-administered instruments offer a low-cost diet assessment method for use with children. The present study assessed the validity of ...

Releasing metal catalysts via phase transition: (NiO)0.05-(SrTi0.8Nb0.2O3)0.95 as a redox stable anode material for solid oxide fuel cells.

Science.gov (United States)

Xiao, Guoliang; Wang, Siwei; Lin, Ye; Zhang, Yanxiang; An, Ke; Chen, Fanglin

2014-11-26

Donor-doped perovskite-type SrTiO3 experiences stoichiometric changes at high temperatures in different Po2 involving the formation of Sr or Ti-rich impurities. NiO is incorporated into the stoichiometric strontium titanate, SrTi0.8Nb0.2O3-δ (STN), to form an A-site deficient perovskite material, (NiO)0.05-(SrTi0.8Nb0.2O3)0.95 (Ni-STN), for balancing the phase transition. Metallic Ni nanoparticles can be released upon reduction instead of forming undesired secondary phases. This material design introduces a simple catalytic modification method with good compositional control of the ceramic backbones, by which transport property and durability of solid oxide fuel cell anodes are largely determined. Using Ni-STN as anodes for solid oxide fuel cells, enhanced catalytic activity and remarkable stability in redox cycling have been achieved. Electrolyte-supported cells with the cell configuration of Ni-STN-SDC anode, La0.8Sr0.2Ga0.87Mg0.13O3 (LSGM) electrolyte, and La0.6Sr0.4Co0.2Fe0.8O3 (LSCF) cathode produce peak power densities of 612, 794, and 922 mW cm(-2) at 800, 850, and 900 °C, respectively, using H2 as the fuel and air as the oxidant. Minor degradation in fuel cell performance resulted from redox cycling can be recovered upon operating the fuel cells in H2. Such property makes Ni-STN a promising regenerative anode candidate for solid oxide fuel cells.

Antigenic and molecular characterization of isolates of the Italy 02 infectious bronchitis virus genotype.

Science.gov (United States)

Dolz, Roser; Pujols, Joan; Ordóñez, German; Porta, Ramon; Majó, Natàlia

2006-04-01

As part of an epidemiological surveillance of infectious bronchitis virus (IBV) in Spain, four Spanish field isolates showed high S1 spike sequence similarities with an IBV sequence from the GenBank database named Italy 02. Given that little was known about this new emergent IBV strain we have characterized the four isolates by sequencing the entire S1 part of the spike protein gene and have compared them with many reference IBV serotypes. In addition, cross-virus neutralization assays were conducted with the main IBV serotypes present in Europe. The four Spanish field strains and the Italy 02 S1 sequence from the NCBI database were established as a new genotype that showed maximum amino acid identities with the 4/91 serotype (81.7% to 83.7%), the D274 group that included D207, D274 and D3896 strains (79.8% to 81.7%), and the B1648 serotype (79.3% to 80%). Furthermore, on the basis of these results, it was demonstrated that the Italy 02 genotype had been circulating in Spain since as early as 1997. Based on the average ratio of synonymous:non-synonymous (dS/dN) amino acid substitutions within Italy 02 sequences, no positive selection pressures were related with changes observed in the S1 gene. Moreover, phylogenetic analysis of the S1 gene suggested that the Italy 02 genotype has undergone a recombination event. Virus neutralization assays demonstrated that little antigenic relatedness (less than 35%) exists between Italy 02 and some of the reference IBV serotypes, and indicated that Italy 02 is likely to be a new serotype.

Exon: CBRC-FRUB-02-0549 [SEVENS

Lifescience Database Archive (English)

Full Text Available cccacctcagacccatctgcaaacccagaaccacccacctcagacccaTCTGCAGACCCAGAACCACCTCCTGCCGACACCCAGCGCCACCAGGGCGAGCGGGGAACAGCATAA ... ...CBRC-FRUB-02-0549 aaccacccacctcagacccatctgcagacccagaaccacccacctcagacccatctgcagacccagaacca

Exon: CBRC-GGAL-02-0038 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-GGAL-02-0038 TCTGGCTTccatcaccaccagcaccaccaccaccagctccaccaccaccagcaccaccagtaccacctccaccagcaccaccagcacca...ccagctccaccaccagctccaccaccaccagcaccacctccaccagcaccaccaccaccaATGATAACTATTTTTGTGGCCCCACTGCTGCAGTAG ...

Exon: CBRC-RNOR-02-0049 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RNOR-02-0049 atggatgcctggagttcctttggccatctaaccttgatgaattccaggttcagtgagagaccTCCAGccaccacaccaccacacacacca...ccacacacatcaccacacacatcaccacacagcaccacacacaccaacacacataccaccacatactaccacacacaccacca

Exon: CBRC-RNOR-02-0085 [SEVENS

Lifescience Database Archive (English)

Full Text Available CBRC-RNOR-02-0085 GAACTGTGCAAAGTCTTTGACAAAAATTTTCACTGCCATTGCTATTATGTGATAAAAATGAGAAAGAGAGATAaagaaaaaa...ggaggaggaaggggaagagggaaaggaggaggggaggaggaagaagaagaagaagaagaagaaacaaaatgaaaaaaaaagaaaaagaaAGGGGAGGGTCAAGTCag ...

Absorption of Bupivacaine after Administration of a Lozenge as Topical Treatment for Pain from Oral Mucositis

DEFF Research Database (Denmark)

Mogensen, Stine; Sverrisdóttir, Eva; Sveinsdóttir, Kolbrún

2017-01-01

The aim was to investigate systemic exposure after administration of a novel bupivacaine lozenge in healthy individuals with normal mucosa and in head and neck cancer (HNC) patients with oral mucositis. A lozenge containing 5, 10, 25 and 50 mg bupivacaine, respectively, was administered as single...... bupivacaine lozenges were safe without systemic toxic levels of bupivacaine or risk of side effects. Based on PK simulations of repeated doses of 25 mg every two hours for 16 hr a day, the lozenges can be administered with minimum risk of exceeding the toxic limit....

34 CFR 462.41 - How must tests be administered in order to accurately measure educational gain?

Science.gov (United States)

2010-07-01

... measure educational gain? 462.41 Section 462.41 Education Regulations of the Offices of the Department of... EDUCATIONAL GAIN IN THE NATIONAL REPORTING SYSTEM FOR ADULT EDUCATION What Requirements Must States and Local Eligible Providers Follow When Measuring Educational Gain? § 462.41 How must tests be administered in order...

The effect of vitamin A supplementation administered with missing vaccines during national immunization days in Guinea-Bissau

DEFF Research Database (Denmark)

Benn, Christine Stabell; Martins, Cesario; Rodrigues, Amabelia

2009-01-01

BACKGROUND: WHO recommends high-dose Vitamin A supplementation (VAS) at vaccination contacts after 6 months of age. It has not been studied whether the effect of VAS on mortality depends on the type of vaccine. We have hypothesized that VAS administered with measles vaccine (MV) is more beneficial...... than VAS with diphtheria-tetanus-pertussis (DTP) vaccine. We assessed the effect of VAS administered with different vaccines during national immunization days (NIDs). METHODS: In 2003, VAS was distributed during NIDs in Guinea-Bissau. Children 6 months or older were given VAS, and if they were missing...... vaccines, these were often given as well. We compared survival between children who had received VAS alone, VAS with DTP or DTP + MV, or VAS with MV. We also compared the survival between participants and non-participants. We followed 6- to 17-month old children until 18 months of age and analysed survival...

Design and construction of the gamma ray transmission tomographer g-TAC-02

International Nuclear Information System (INIS)

Pavon Hernandez, Noriel; Ravelo Sanchez, Alberto; Idel, Pedro; Macias Perez, Rafael; Garcia Trapaga, Cesar; Campos Montenegro, Augusto

2000-01-01

An equipment for gamma ray transmission tomographer was designed and constructed in the Higher Institute of Nuclear Sciences and Technology. It was the g-TAC-01, based on a nuclear instrumentation, a mechanic instrumentation, and the control of the system from a personal computer. This first version permitted to obtain the know how of the technology of construction of equipment for tomography. The present work describes the second version of the gamma ray transmission tomographer: the g-TAC-02, with very important upgrading in the control session. Now the control system is a microcontroller based, electronic control system, designed to work in multiples forms: manual, automatic and with the computer

Effects of orally administered undenatured type II collagen against arthritic inflammatory diseases: a mechanistic exploration.

Science.gov (United States)

Bagchi, D; Misner, B; Bagchi, M; Kothari, S C; Downs, B W; Fafard, R D; Preuss, H G

2002-01-01

Arthritis afflicts approximately 43 million Americans or approximately 16.6% of the US population. The two most common and best known types of arthritis are osteoarthritis (OA) and rheumatoid arthritis (RA). A significant amount of scientific research has been done in attempts to explain what initiates forms of arthritis, how it is promoted and perpetuated and how to effectively intervene in the disease process and promote cartilage remodeling. Current pharmacological strategies mainly address immune suppression and antiinflammatory mechanisms and have had limited success. Recent research provides evidence that alterations in the three-dimensional configuration of glycoproteins are responsible for the recognition/response signaling that catalyzes T-cell attack. Oral administration of autoantigens has been shown to suppress a variety of experimentally induced autoimmune pathologies, including antigen-induced RA. The interaction between gut-associated lymphoid tissue in the duodenum and epitopes of orally administered undenatured type II collagen facilitates oral tolerance to the antigen and stems systemic T-cell attack on joint cartilage. Previous studies have shown that small doses of orally administered undenatured type II chicken collagen effectively deactivate killer T-cell attack. A novel glycosylated undenatured type II collagen material (UC-II) was developed to preserve biological activity. The presence of active epitopes in the UC-II collagen is confirmed by an enzyme-linked immunosorbent assay test and distinguishes this form from hydrolyzed or denatured collagen. Oral intake of small amounts of glycosylated UC-II presents active epitopes, with the correct three-dimensional structures, to Peyer's patches, which influences the signaling required for the development of immune tolerance. UC-II has demonstrated the ability to induce tolerance, effectively reducing joint pain and swelling in RA subjects. A pilot study was conducted for 42 days to evaluate the

Exon: CBRC-FRUB-02-0222 [SEVENS

Lifescience Database Archive (English)

Full Text Available TCGGCTGCTGCACCATCGTctgatgcaccatcggctgctgcaccatcggctgctgcatcagcacgaactgctgctgctgctgctgctgctgcaccggAAGCAG ... ...CBRC-FRUB-02-0222 GTGCTGCAggctctgcaggttctgcaggtaAACCGGGGTCATCACCTGCTGCACCATCGGCTGCTGCACCATCGTCTGATGCACCA