WorldWideScience

Sample records for synthesis-dependent strand annealing

  1. Human RECQ5 helicase promotes repair of DNA double-strand breaks by synthesis-dependent strand annealing

    Czech Academy of Sciences Publication Activity Database

    Paliwal, S.; Kanagaraj, R.; Sturzenegger, A.; Burdová, Kamila; Janščák, Pavel

    2014-01-01

    Roč. 42, č. 4 (2014), s. 2380-2390 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565; GA ČR GAP305/10/0281 Grant - others:Swiss National Science Foundation(CH) 31003A-129747; Swiss National Science Foundation(CH) 31003A_146206 Institutional support: RVO:68378050 Keywords : Human RECQ5 helicase * DNA double-strand breaks * mitotic homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  2. Rad51 ATP binding but not hydrolysis is required to recruit Rad10 in synthesis-dependent strand annealing sites inS. cerevisiae.

    Science.gov (United States)

    Karlin, Justin; Fischhaber, Paula L

    2013-06-01

    Several modes of eukaryotic of DNA double strand break repair (DSBR) depend on synapsis of complementary DNA. The Rad51 ATPase, the S. cerevisiae homolog of E. coli RecA, plays a key role in this process by catalyzing homology searching and strand exchange between an invading DNA strand and a repair template (e.g. sister chromatid or homologous chromosome). Synthesis dependent strand annealing (SDSA), a mode of DSBR, requires Rad51. Another repair enzyme, the Rad1-Rad10 endonuclease, acts in the final stages of SDSA, hydrolyzing 3' overhanging single-stranded DNA. Here we show in vivo by fluorescence microscopy that the ATP binding function of yeast Rad51 is required to recruit Rad10 SDSA sites indicating that Rad51 pre-synaptic filament formation must occur prior to the recruitment of Rad1-Rad10. Our data also show that Rad51 ATPase activity, an important step in Rad51 filament disassembly, is not absolutely required in order to recruit Rad1-Rad10 to DSB sites.

  3. RecO protein initiates DNA recombination and strand annealing through two alternative DNA binding mechanisms.

    Science.gov (United States)

    Ryzhikov, Mikhail; Gupta, Richa; Glickman, Michael; Korolev, Sergey

    2014-10-17

    Recombination mediator proteins (RMPs) are important for genome stability in all organisms. Several RMPs support two alternative reactions: initiation of homologous recombination and DNA annealing. We examined mechanisms of RMPs in both reactions with Mycobacterium smegmatis RecO (MsRecO) and demonstrated that MsRecO interacts with ssDNA by two distinct mechanisms. Zinc stimulates MsRecO binding to ssDNA during annealing, whereas the recombination function is zinc-independent and is regulated by interaction with MsRecR. Thus, different structural motifs or conformations of MsRecO are responsible for interaction with ssDNA during annealing and recombination. Neither annealing nor recombinase loading depends on MsRecO interaction with the conserved C-terminal tail of single-stranded (ss) DNA-binding protein (SSB), which is known to bind Escherichia coli RecO. However, similarly to E. coli proteins, MsRecO and MsRecOR do not dismiss SSB from ssDNA, suggesting that RMPs form a complex with SSB-ssDNA even in the absence of binding to the major protein interaction motif. We propose that alternative conformations of such complexes define the mechanism by which RMPs initiate the repair of stalled replication and support two different functions during recombinational repair of DNA breaks. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. BCR-ABL promotes the frequency of mutagenic single-strand annealing DNA repair

    Science.gov (United States)

    Fernandes, Margret S.; Reddy, Mamatha M.; Gonneville, Jeffrey R.; DeRoo, Scott C.; Podar, Klaus; Griffin, James D.; Weinstock, David M.

    2009-01-01

    Intracellular oxidative stress in cells transformed by the BCR-ABL oncogene is associated with increased DNA double-strand breaks. Imprecise repair of these breaks can result in the accumulation of mutations, leading to therapy-related drug resistance and disease progression. Using several BCR-ABL model systems, we found that BCR-ABL specifically promotes the repair of double-strand breaks through single-strand annealing (SSA), a mutagenic pathway that involves sequence repeats. Moreover, our results suggest that mutagenic SSA repair can be regulated through the interplay between BCR-ABL and extrinsic growth factors. Increased SSA activity required Y177 in BCR-ABL, as well as a functional PI3K and Ras pathway downstream of this site. Furthermore, our data hint at a common pathway for DSB repair whereby BCR-ABL, Tel-ABL, Tel-PDGFR, FLT3-ITD, and Jak2V617F all increase mutagenic repair. This increase in SSA may not be sufficiently suppressed by tyrosine kinase inhibitors in the stromal microenvironment. Therefore, drugs that target growth factor receptor signaling represent potential therapeutic agents to combat tyrosine kinase-induced genomic instability. PMID:19571320

  5. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  6. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  7. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  8. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  9. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  10. Semiconductor annealing

    International Nuclear Information System (INIS)

    Young, J.M.; Scovell, P.D.

    1982-01-01

    A process for annealing crystal damage in ion implanted semiconductor devices in which the device is rapidly heated to a temperature between 450 and 900 0 C and allowed to cool. It has been found that such heating of the device to these relatively low temperatures results in rapid annealing. In one application the device may be heated on a graphite element mounted between electrodes in an inert atmosphere in a chamber. (author)

  11. Semiconductor annealing

    International Nuclear Information System (INIS)

    Young, J.M.; Scovell, P.D.

    1981-01-01

    A process for annealing crystal damage in ion implanted semiconductor devices is described in which the device is rapidly heated to a temperature between 450 and 600 0 C and allowed to cool. It has been found that such heating of the device to these relatively low temperatures results in rapid annealing. In one application the device may be heated on a graphite element mounted between electrodes in an inert atmosphere in a chamber. The process may be enhanced by the application of optical radiation from a Xenon lamp. (author)

  12. Cascade annealing: an overview

    International Nuclear Information System (INIS)

    Doran, D.G.; Schiffgens, J.O.

    1976-04-01

    Concepts and an overview of radiation displacement damage modeling and annealing kinetics are presented. Short-term annealing methodology is described and results of annealing simulations performed on damage cascades generated using the Marlowe and Cascade programs are included. Observations concerning the inconsistencies and inadequacies of current methods are presented along with simulation of high energy cascades and simulation of longer-term annealing

  13. Physical Mapping Using Simulated Annealing and Evolutionary Algorithms

    DEFF Research Database (Denmark)

    Vesterstrøm, Jacob Svaneborg

    2003-01-01

    Physical mapping (PM) is a method of bioinformatics that assists in DNA sequencing. The goal is to determine the order of a collection of fragments taken from a DNA strand, given knowledge of certain unique DNA markers contained in the fragments. Simulated annealing (SA) is the most widely used...

  14. Sleep and protein synthesis-dependent synaptic plasticity: impacts of sleep loss and stress

    Science.gov (United States)

    Grønli, Janne; Soulé, Jonathan; Bramham, Clive R.

    2014-01-01

    Sleep has been ascribed a critical role in cognitive functioning. Several lines of evidence implicate sleep in the consolidation of synaptic plasticity and long-term memory. Stress disrupts sleep while impairing synaptic plasticity and cognitive performance. Here, we discuss evidence linking sleep to mechanisms of protein synthesis-dependent synaptic plasticity and synaptic scaling. We then consider how disruption of sleep by acute and chronic stress may impair these mechanisms and degrade sleep function. PMID:24478645

  15. Phage annealing proteins promote oligonucleotide-directed mutagenesis in Escherichia coli and mouse ES cells

    Directory of Open Access Journals (Sweden)

    Muyrers Joep PP

    2003-01-01

    Full Text Available Abstract Background The phage protein pairs, RecE/RecT from Rac or Redα/Redβ from λ, initiate efficient double strand break repair (DSBR in Escherichia coli that has proven very useful for DNA engineering. These phage pairs initiate DSBR either by annealing or by another mechanism that is not defined. Results Here we report that these proteins also mediate single strand oligonucleotide repair (ssOR at high efficiencies. The ssOR activity, unlike DSBR, does not require a phage exonuclease (RecE or Redα but only requires a phage annealing protein (RecT or Redβ. Notably, the P22 phage annealing protein Erf, which does not mediate the same DSBR reactions, also delivers ssOR activity. By altering aspects of the oligonucleotides, we document length and design parameters that affect ssOR efficiency to show a simple relationship to homologies either side of the repair site. Notably, ssOR shows strand bias. Oligonucleotides that can prime lagging strand replication deliver more ssOR than their leading complements. This suggests a model in which the annealing proteins hybridize the oligonucleotides to single stranded regions near the replication fork. We also show that ssOR is a highly efficient way to engineer BACs and can be detected in a eukaryotic cell upon expression of a phage annealing protein. Conclusion Phage annealing proteins can initiate the recombination of single stranded oligonucleotides into endogenous targets in Escherichia coli at very high efficiencies. This expands the repertoire of useful DNA engineering strategies, shows promise for applications in eukaryotic cells, and has implications for the unanswered questions regarding DSBR mediated by RecE/RecT and Redα/Redβ.

  16. Residual Resistivity Ratio (RRR) Measurements of LHC Superconducting NbTi Cable Strands

    CERN Document Server

    Charifoulline, Z

    2006-01-01

    The Rutherford-type superconducting NbTi cables of the LHC accelerator are currently manufactured by six industrial companies. As a part of the acceptance tests, the Residual Resistivity Ratio (RRR) of superconducting strands is systematically measured on virgin strands to qualify the strands before cabling and on extracted strands to qualify the cables and to check the final heat treatment (controlled oxidation to control interstrand resistance). More than 12000 samples of virgin and extracted strands have been measured during last five years. Results show good correlation with the measurements done by the companies and reflect well the technological process of cable production (strand annealing, cabling, cable heat treatment). This paper presents a description of the RRR-test station and the measurement procedure, the summary of the results over all suppliers and finally the correlation between RRR-values of the cables and the magnets.

  17. Late Protein Synthesis-Dependent Phases in CTA Long-Term Memory: BDNF Requirement

    Science.gov (United States)

    Martínez-Moreno, Araceli; Rodríguez-Durán, Luis F.; Escobar, Martha L.

    2011-01-01

    It has been proposed that long-term memory (LTM) persistence requires a late protein synthesis-dependent phase, even many hours after memory acquisition. Brain-derived neurotrophic factor (BDNF) is an essential protein synthesis product that has emerged as one of the most potent molecular mediators for long-term synaptic plasticity. Studies in the rat hippocampus have been shown that BDNF is capable to rescue the late-phase of long-term potentiation as well as the hippocampus-related LTM when protein synthesis was inhibited. Our previous studies on the insular cortex (IC), a region of the temporal cortex implicated in the acquisition and storage of conditioned taste aversion (CTA), have demonstrated that intracortical delivery of BDNF reverses the deficit in CTA memory caused by the inhibition of IC protein synthesis due to anisomycin administration during early acquisition. In this work, we first analyze whether CTA memory storage is protein synthesis-dependent in different time windows. We observed that CTA memory become sensible to protein synthesis inhibition 5 and 7 h after acquisition. Then, we explore the effect of BDNF delivery (2 μg/2 μl per side) in the IC during those late protein synthesis-dependent phases. Our results show that BDNF reverses the CTA memory deficit produced by protein synthesis inhibition in both phases. These findings support the notion that recurrent rounds of consolidation-like events take place in the neocortex for maintenance of CTA memory trace and that BDNF is an essential component of these processes. PMID:21960964

  18. LHC superconducting strand

    CERN Multimedia

    Patrice Loiez

    1999-01-01

    This cross-section through a strand of superconducting matieral as used in the LHC shows the 8000 Niobium-Titanium filaments embedded like a honeycomb in copper. When cooled to 1.9 degrees above absolute zero in the LHC accelerator, these filaments will have zero resistance and so will carry a high electric current with no energy loss.

  19. Strand SPA & Konverentsikeskus

    Index Scriptorium Estoniae

    2008-01-01

    Strand SPA & Konverentsikeskus on Pärnu suurim äri- ja konverentsiklientidele suunatud hotell, mis klientide seas on hinnatud just selle kompleksuse tõttu, kuna kõik, mida külaline vajab ja soovib, on olemas ühe katuse all

  20. Double-Strand DNA Break Repair in Mycobacteria.

    Science.gov (United States)

    Glickman, Michael S

    2014-10-01

    Discontinuity of both strands of the chromosome is a lethal event in all living organisms because it compromises chromosome replication. As such, a diversity of DNA repair systems has evolved to repair double-strand DNA breaks (DSBs). In part, this diversity of DSB repair systems has evolved to repair breaks that arise in diverse physiologic circumstances or sequence contexts, including cellular states of nonreplication or breaks that arise between repeats. Mycobacteria elaborate a set of three genetically distinct DNA repair pathways: homologous recombination, nonhomologous end joining, and single-strand annealing. As such, mycobacterial DSB repair diverges substantially from the standard model of prokaryotic DSB repair and represents an attractive new model system. In addition, the presence in mycobacteria of a DSB repair system that can repair DSBs in nonreplicating cells (nonhomologous end joining) or when DSBs arise between repeats (single-strand annealing) has clear potential relevance to Mycobacterium tuberculosis pathogenesis, although the exact role of these systems in M. tuberculosis pathogenesis is still being elucidated. In this article we will review the genetics of mycobacterial DSB repair systems, focusing on recent insights.

  1. Sea Turtle Stranding Network Reports

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Sea Turtle Stranding and Salvage Network (STSSN) was formally established in 1980 to collect information on and document the stranding of marine turtles along...

  2. Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

    DEFF Research Database (Denmark)

    Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun

    2009-01-01

    Saccharomyces cerevisiae Rad52 protein promotes homologous recombination by nucleating the Rad51 recombinase onto replication protein A-coated single-stranded DNA strands and also by directly annealing such strands. We show that the purified rad52-R70A mutant protein, with a compromised amino......-terminal DNA binding domain, is capable of Rad51 delivery to DNA but is deficient in DNA annealing. Results from chromatin immunoprecipitation experiments find that rad52-R70A associates with DNA double-strand breaks and promotes recruitment of Rad51 as efficiently as wild-type Rad52. Analysis of gene...... conversion intermediates reveals that rad52-R70A cells can mediate DNA strand invasion but are unable to complete the recombination event. These results provide evidence that DNA binding by the evolutionarily conserved amino terminus of Rad52 is needed for the capture of the second DNA end during homologous...

  3. Cable degration of SSC strand

    International Nuclear Information System (INIS)

    Warnes, W.H.; Dai, W.; Seuntjens, J.; Capone, D.W. II

    1992-01-01

    Cable degradation of a SSC 40mm cable was studied by comparing the virgin strand and extracted strand measurements of critical current for all thirty strands. Typical degradation values of a few percent are observed in these materials. Image analysis performed on the strand cross sections found the filament deformation to be commensurate with the measured degradation in critical current. A simple model for current sharing in cables with edge damage reduction of Ic was developed and described below. Suggestions for measurements of cable critical current using extracted strands are also presented

  4. The superconducting strand for the CMS solenoid conductor

    CERN Document Server

    Curé, B; Campi, D; Goodrich, L F; Horváth, I L; Kircher, F; Liikamaa, R; Seppälä, J; Smith, R P; Teuho, J; Vieillard, L

    2002-01-01

    The Compact Muon Solenoid (CMS) is one of the general-purpose detectors to be provided for the LHC project at CERN. The design field of the CMS superconducting magnet is 4 T, the magnetic length is 12.5 m and the free bore is 6 m. Approximately 2000 km of superconducting strand is under procurement for the conductor of the CMS superconducting solenoid. Each strand length is required to be an integral multiple of 2.75 km. The strand is composed of copper- stabilized multifilamentary Nb-Ti with Nb barrier. Individual strands are identified by distinctive patterns of Nb-Ti filaments selected during stacking of the monofilaments. The statistics of piece length, measurements of I/sub c/, n-value, copper RRR, (Cu+Nb)/Nb-Ti ratio, as well as the results of independent cross checks of these quantities, are presented. A study was performed on the CMS strands to investigate the critical current degradation due to various heat treatments. The degradation versus annealing temperature and duration are reported. (4 refs).

  5. Stranded costs and exit fees

    International Nuclear Information System (INIS)

    2002-01-01

    The New Brunswick Market Design Committee has been directed to examine the issue of stranded costs since it is a major component of restructuring within the electricity sector. When regulated monopolies are faced with competition, they could find that some of their embedded costs cannot be recovered. These costs are referred to as stranded costs. Common sources include large capital investments in uneconomic plants or expensive power purchase contracts or fuel supply contracts. In general, stranded costs do not include gains or losses associated with normal business risks experienced by regulated utilities. This report presents recommendations for mitigation of stranded costs, valuation methodologies and cost-recovery mechanisms. It also presents a summary of experience with stranded costs in other jurisdictions such as California, Rhode Island, Pennsylvania and Ontario. Stranded costs are often recovered through an obligatory charge on all customers, particularly in jurisdictions where retail competition exists. In the New Brunswick market, however, the only customers who can create stranded costs are those eligible to choose their own suppliers. It is argued that since most customers will not have a choice of electricity suppliers, they cannot generate stranded costs and therefore, should not have to pay costs stranded by others. A method to quantify stranded costs is presented, along with a review of transmission-related stranded costs in New Brunswick. Expansion of self-generation in New Brunswick could strand transmission assets. Currently, self-generators only contribute a small amount to fixed charges of the transmission system. However, under new recommended tariffs, the amount could increase. It is likely that the net amount of stranded transmission costs will not be large. 2 refs., 1 fig

  6. A euryarchaeal histone modulates strand displacement synthesis by replicative DNA polymerases.

    Science.gov (United States)

    Sun, Fei; Huang, Li

    2016-07-01

    Euryarchaeota and Crenarchaeota, the two main lineages of the domain Archaea, encode different chromatin proteins and differ in the use of replicative DNA polymerases. Crenarchaea possess a single family B DNA polymerase (PolB), which is capable of strand displacement modulated by the chromatin proteins Cren7 and Sul7d. Euryarchaea have two distinct replicative DNA polymerases, PolB and PolD, a family D DNA polymerase. Here we characterized the strand displacement activities of PolB and PolD from the hyperthermophilic euryarchaeon Pyrococcus furiosus and investigated the influence of HPfA1, a homolog of eukaryotic histones from P. furiosus, on these activities. We showed that both PolB and PolD were efficient in strand displacement. HPfA1 inhibited DNA strand displacement by both DNA polymerases but exhibited little effect on the displacement of a RNA strand annealed to single-stranded template DNA. This is consistent with the finding that HPfA1 bound more tightly to double-stranded DNA than to a RNA:DNA hybrid. Our results suggest that, although crenarchaea and euryarchaea differ in chromosomal packaging, they share similar mechanisms in modulating strand displacement by DNA polymerases during lagging strand DNA synthesis.

  7. Radiation annealing in cuprous oxide

    DEFF Research Database (Denmark)

    Vajda, P.

    1966-01-01

    Experimental results from high-intensity gamma-irradiation of cuprous oxide are used to investigate the annealing of defects with increasing radiation dose. The results are analysed on the basis of the Balarin and Hauser (1965) statistical model of radiation annealing, giving a square-root relati......Experimental results from high-intensity gamma-irradiation of cuprous oxide are used to investigate the annealing of defects with increasing radiation dose. The results are analysed on the basis of the Balarin and Hauser (1965) statistical model of radiation annealing, giving a square...

  8. Influence of alloying and secondary annealing on anneal hardening ...

    Indian Academy of Sciences (India)

    Unknown

    Influence of alloying and secondary annealing on anneal hardening effect at sintered copper alloys. SVETLANA NESTOROVIC. Technical Faculty Bor, University of Belgrade, Bor, Yugoslavia. MS received 11 February 2004; revised 29 October 2004. Abstract. This paper reports results of investigation carried out on sintered ...

  9. Competition between the DNA unwinding and strand pairing activities of the Werner and Bloom syndrome proteins

    Directory of Open Access Journals (Sweden)

    Orren David K

    2006-01-01

    Full Text Available Abstract Background The premature aging and cancer-prone Werner and Bloom syndromes are caused by defects in the RecQ helicase enzymes WRN and BLM, respectively. Recently, both WRN and BLM (as well as several other RecQ members have been shown to possess a strand annealing activity in addition to the requisite DNA unwinding activity. Since an annealing function would appear to directly oppose the action of a helicase, we have examined in this study the dynamic equilibrium between unwinding and annealing mediated by either WRN or BLM. Results Our investigation into the competition between annealing and unwinding demonstrates that, under standard reaction conditions, WRN- or BLM-mediated annealing can partially or completely mask unwinding as measured in standard helicase assays. Several strategies were employed to suppress the annealing activity so that the actual strength of WRN- or BLM-dependent unwinding could be more accurately assessed. Interestingly, if a DNA oligomer complementary to one strand of the DNA substrate to be unwound is added during the helicase reaction, both WRN and BLM unwinding is enhanced, presumably by preventing protein-mediated re-annealing. This strategy allowed measurement of WRN-catalyzed unwinding of long (80 base pair duplex regions and fully complementary, blunt-ended duplexes, both of which were otherwise quite refractory to the helicase activity of WRN. Similarly, the addition of trap strand stimulated the ability of BLM to unwind long and blunt-ended duplexes. The stimulatory effect of the human replication protein A (hRPA, the eukaryotic single-stranded DNA binding protein on both WRN- and BLM-dependent unwinding was also re-examined in light of its possible role in preventing re-annealing. Our results show that hRPA influences the outcome of WRN and BLM helicase assays by both inhibiting re-annealing and directly promoting unwinding, with the larger contribution from the latter mechanism. Conclusion These

  10. DOE's annealing prototype demonstration projects

    International Nuclear Information System (INIS)

    Warren, J.; Nakos, J.; Rochau, G.

    1997-01-01

    One of the challenges U.S. utilities face in addressing technical issues associated with the aging of nuclear power plants is the long-term effect of plant operation on reactor pressure vessels (RPVs). As a nuclear plant operates, its RPV is exposed to neutrons. For certain plants, this neutron exposure can cause embrittlement of some of the RPV welds which can shorten the useful life of the RPV. This RPV embrittlement issue has the potential to affect the continued operation of a number of operating U.S. pressurized water reactor (PWR) plants. However, RPV material properties affected by long-term irradiation are recoverable through a thermal annealing treatment of the RPV. Although a dozen Russian-designed RPVs and several U.S. military vessels have been successfully annealed, U.S. utilities have stated that a successful annealing demonstration of a U.S. RPV is a prerequisite for annealing a licensed U.S. nuclear power plant. In May 1995, the Department of Energy's Sandia National Laboratories awarded two cost-shared contracts to evaluate the feasibility of annealing U.S. licensed plants by conducting an anneal of an installed RPV using two different heating technologies. The contracts were awarded to the American Society of Mechanical Engineers (ASME) Center for Research and Technology Development (CRTD) and MPR Associates (MPR). The ASME team completed its annealing prototype demonstration in July 1996, using an indirect gas furnace at the uncompleted Public Service of Indiana's Marble Hill nuclear power plant. The MPR team's annealing prototype demonstration was scheduled to be completed in early 1997, using a direct heat electrical furnace at the uncompleted Consumers Power Company's nuclear power plant at Midland, Michigan. This paper describes the Department's annealing prototype demonstration goals and objectives; the tasks, deliverables, and results to date for each annealing prototype demonstration; and the remaining annealing technology challenges

  11. Radiation annealing in cuprous oxide

    DEFF Research Database (Denmark)

    Vajda, P.

    1966-01-01

    Experimental results from high-intensity gamma-irradiation of cuprous oxide are used to investigate the annealing of defects with increasing radiation dose. The results are analysed on the basis of the Balarin and Hauser (1965) statistical model of radiation annealing, giving a square...

  12. Complex shapes self-assembled from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2012-05-30

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA or RNA tiles into periodic and algorithmic two-dimensional lattices, extended ribbons and tubes, three-dimensional crystals, polyhedra and simple finite two-dimensional shapes. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a 'single-stranded tile' (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly. Although ribbons and tubes with controlled circumferences have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands--folded into a 3 nm-by-7 nm tile and attached to four neighbouring tiles--acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short synthetic DNA strands.

  13. Single--stranded DNA mycoplasmaviruses

    Energy Technology Data Exchange (ETDEWEB)

    Maniloff, J.; Das, J.; Nowak, J.A.

    1978-01-01

    Two general types of single--stranded DNA bacteriophases have been described, icosahedral virions (e.g., 0X174) and filamentous virions (e.g., M13). Mycoplasmavirus MVL51 appears to represent another type of single--stranded DNA phage, with a genome size close to that of 0X174 and a nonlytic mode of infection like that of filamentous phages. The bullet shaped MVL51 morphology is unlike that of other known phages.

  14. Radiobiology of DNA strand breakage

    International Nuclear Information System (INIS)

    Johansen, I.

    1975-01-01

    The yield of single-strand breaks in lambda DNA within lysogenic host bacteria was measured after exposure to 4-MeV electrons (50 msec) and rapid transfer (45 msec) to alkaline detergent. In nitrogen anoxia the yield was 1.2 x 10 -12 DNA single-strand breaks per rad per dalton, and under full oxygenation the yield increased to 5 x 10 -12 breaks per rad per dalton. A search for the presence of fast repair mechanisms failed to demonstrate the presence of any mechanism for repair of strand breaks operating within a fraction of a second. Strand breaks produced in the presence of oxygen were repaired in 30--40 sec, while breaks produced under anoxia were rejoined even slower. A functional product from the polAl gene was needed for the rejoining of the broken molecules. Intermediate levels of DNA strand breakage seen at low concentrations of oxygen are dependent on the concentration of cellular sulfhydryl compounds, suggesting that in strand breakage oxygen and hydrogen donors compete for reactions with radiation-induced transients in the DNA. Intercomparisons of data on radiation-induced lethality of cells and single-strand breaks in episomal DNA allow the distinction between two classes of radiation-induced radicals, R 1 and R 2 , with different chemical properties; R 1 reacts readily with oxygen and N-oxyls under formation of potentially lethal products. The reactivity of oxygen in this reaction is 30--40 times higher than that of TMPN. R 2 reacts 16 times more readily than R 1 with oxygen under formation of single-strand breaks in the DNA. R 2 does not react with N-oxyls

  15. The effect of annealing on the elastoplastic and viscoelastic responses of isotactic polypropylene

    DEFF Research Database (Denmark)

    Drozdov, Aleksey D.; Christiansen, Jesper de Claville

    2003-01-01

    to thermal treatment and on specimens annealed at 140 C, and (iii) in a series of tensile relaxation tests on non-annealed specimens. Constitutive equations are derived for the elastoplastic and non-linear viscoelastic responses of semicrystalline polymers. A polymer is treated as an equivalent transient....... The elastoplastic behavior is modelled as sliding of junctions in meso-domains with respect to their reference positions driven by macro-deformation. The viscoelastic response is attributed to detachment of active strands from temporary junctions and attachment of dangling chains to the network. Constitutive...

  16. The annealing helicase and branch migration activities of Drosophila HARP.

    Directory of Open Access Journals (Sweden)

    George A Kassavetis

    Full Text Available HARP (SMARCAL1, MARCAL1 is an annealing helicase that functions in the repair and restart of damaged DNA replication forks through its DNA branch migration and replication fork regression activities. HARP is conserved among metazoans. HARP from invertebrates differs by the absence of one of the two HARP-specific domain repeats found in vertebrates. The annealing helicase and branch migration activity of invertebrate HARP has not been documented. We found that HARP from Drosophila melanogaster retains the annealing helicase activity of human HARP, the ability to disrupt D-loops and to branch migrate Holliday junctions, but fails to regress model DNA replication fork structures. A comparison of human and Drosophila HARP on additional substrates revealed that both HARPs are competent in branch migrating a bidirectional replication bubble composed of either DNA:DNA or RNA:DNA hybrid. Human, but not Drosophila, HARP is also capable of regressing a replication fork structure containing a highly stable poly rG:dC hybrid. Persistent RNA:DNA hybrids in vivo can lead to replication fork arrest and genome instability. The ability of HARP to strand transfer hybrids may signify a hybrid removal function for this enzyme, in vivo.

  17. Fair Exchange in Strand Spaces

    Directory of Open Access Journals (Sweden)

    Joshua D. Guttman

    2009-10-01

    Full Text Available Many cryptographic protocols are intended to coordinate state changes among principals. Exchange protocols coordinate delivery of new values to the participants, e.g. additions to the set of values they possess. An exchange protocol is fair if it ensures that delivery of new values is balanced: If one participant obtains a new possession via the protocol, then all other participants will, too. Fair exchange requires progress assumptions, unlike some other protocol properties. The strand space model is a framework for design and verification of cryptographic protocols. A strand is a local behavior of a single principal in a single session of a protocol. A bundle is a partially ordered global execution built from protocol strands and adversary activities. The strand space model needs two additions for fair exchange protocols. First, we regard the state as a multiset of facts, and we allow strands to cause changes in this state via multiset rewriting. Second, progress assumptions stipulate that some channels are resilient-and guaranteed to deliver messages-and some principals are assumed not to stop at certain critical steps. This method leads to proofs of correctness that cleanly separate protocol properties, such as authentication and confidentiality, from invariants governing state evolution. G. Wang's recent fair exchange protocol illustrates the approach.

  18. HIV-1 nucleocapsid protein switches the pathway of transactivation response element RNA/DNA annealing from loop-loop "kissing" to "zipper".

    Science.gov (United States)

    Vo, My-Nuong; Barany, George; Rouzina, Ioulia; Musier-Forsyth, Karin

    2009-02-27

    The chaperone activity of HIV-1 (human immunodeficiency virus type 1) nucleocapsid protein (NC) facilitates multiple nucleic acid rearrangements that are critical for reverse transcription of the single-stranded RNA genome into double-stranded DNA. Annealing of the transactivation response element (TAR) RNA hairpin to a complementary TAR DNA hairpin is an essential step in the minus-strand transfer step of reverse transcription. Previously, we used truncated 27-nt mini-TAR RNA and DNA constructs to investigate this annealing reaction pathway in the presence and in the absence of HIV-1 NC. In this work, full-length 59-nt TAR RNA and TAR DNA constructs were used to systematically study TAR hairpin annealing kinetics. In the absence of NC, full-length TAR hairpin annealing is approximately 10-fold slower than mini-TAR annealing. Similar to mini-TAR annealing, the reaction pathway for TAR in the absence of NC involves the fast formation of an unstable "kissing" loop intermediate, followed by a slower conversion to an extended duplex. NC facilitates the annealing of TAR by approximately 10(5)-fold by stabilizing the bimolecular intermediate ( approximately 10(4)-fold) and promoting the subsequent exchange reaction ( approximately 10-fold). In contrast to the mini-TAR annealing pathway, wherein NC-mediated annealing can initiate through both loop-loop kissing and a distinct "zipper" pathway involving nucleation at the 3'-/5'-terminal ends, full-length TAR hairpin annealing switches predominantly to the zipper pathway in the presence of saturated NC.

  19. Influence of alloying and secondary annealing on anneal hardening ...

    Indian Academy of Sciences (India)

    Unknown

    Abstract. This paper reports results of investigation carried out on sintered copper alloys (Cu, 8 at%; Zn,. Ni, Al and Cu–Au with 4 at%Au). The alloys were subjected to cold rolling (30, 50 and 70%) and annealed isochronally up to recrystallization temperature. Changes in hardness and electrical conductivity were fol-.

  20. Management of the Bohunice RPVs annealing procedures

    International Nuclear Information System (INIS)

    Repka, M.

    1994-01-01

    The program of annealing regeneration procedure of RPVs units 1 and 2 of NPP V-1 (EBO) realization in the year 1993, is the topic of this paper. In the paper the following steps are described in detail: the preparation works, the annealing procedure realization schedule and safety management: starting with zero conditions, assembling of annealing apparatus, annealing procedure, cooling down and disassembling procedure of annealing apparatus. At the end the programs of annealing of both RPVs including the dosimetry measurements are discussed and evaluated. (author). 3 figs

  1. Pulsed Laser Annealing of Carbon

    Science.gov (United States)

    Abrahamson, Joseph P.

    This dissertation investigates laser heating of carbon materials. The carbon industry has been annealing carbon via traditional furnace heating since at least 1800, when Sir Humphry Davy produced an electric arc with carbon electrodes made from carbonized wood. Much knowledge has been accumulated about carbon since then and carbon materials have become instrumental both scientifically and technologically. However, to this day the kinetics of annealing are not known due to the slow heating and cooling rates of furnaces. Additionally, consensus has yet to be reached on the cause of nongraphitizability. Annealing trajectories with respect to time at temperature are observed from a commercial carbon black (R250), model graphitizable carbon (anthracene coke) and a model nongraphitizable carbon (sucrose char) via rapid laser heating. Materials were heated with 1064 nm and 10.6 im laser radiation from a Q-switched Nd:YAG laser and a continuous wave CO2 laser, respectively. A pulse generator was used reduce the CO2 laser pulse width and provide high temporal control. Time-temperature-histories with nanosecond temporal resolution and temperature reproducibility within tens of degrees Celsius were determined by spectrally resolving the laser induced incandescence signal and applying multiwavelength pyrometry. The Nd:YAG laser fluences include: 25, 50, 100, 200, 300, and 550 mJ/cm2. The maximum observed temperature ranged from 2,400 °C to the C2 sublimation temperature of 4,180 °C. The CO2 laser was used to collect a series of isothermal (1,200 and 2,600 °C) heat treatments versus time (100 milliseconds to 30 seconds). Laser heated samples are compared to furnace annealing at 1,200 and 2,600 °C for 1 hour. The material transformation trajectory of Nd:YAG laser heated carbon is different than traditional furnace heating. The traditional furnace annealing pathway is followed for CO2 laser heating as based upon equivalent end structures. The nanostructure of sucrose char

  2. Morphological, thermal and annealed microhardness ...

    Indian Academy of Sciences (India)

    Unknown

    blended with sugarcane bagasse which showed good me- chanical properties when investigated by SEM, thermal gravimetric analysis (TGA), DSC and tensile testing (Chiel- lini et al 2001). An increase in the engineering yield stress was observed, with a decline in tensile impact strength. With DSC on annealing, a small ...

  3. Morphological, thermal and annealed microhardness ...

    Indian Academy of Sciences (India)

    The present paper reports the preparation of full IPNs of gelatin and polyacrylonitrile. Various compositions of gluteraldehyde crosslinked gelatin and N,N′-methylene-bis-acrylamide crosslinked PAN were characterized by SEM and DSC techniques. The IPNs were also thermally pretreated by the annealing process.

  4. Rapid Synthesis of a Long Double-Stranded Oligonucleotide from a Single-Stranded Nucleotide Using Magnetic Beads and an Oligo Library.

    Directory of Open Access Journals (Sweden)

    Sumate Pengpumkiat

    Full Text Available Chemical synthesis of oligonucleotides is a widely used tool in the field of biochemistry. Several methods for gene synthesis have been introduced in the growing area of genomics. In this paper, a novel method of constructing dsDNA is proposed. Short (28-mer oligo fragments from a library were assembled through successive annealing and ligation processes, followed by PCR. First, two oligo fragments annealed to form a dsDNA molecule. The double-stranded oligo was immobilized onto magnetic beads (solid support via streptavidin-biotin binding. Next, single-stranded oligo fragments were added successively through ligation to form the complete DNA molecule. The synthesized DNA was amplified through PCR and gel electrophoresis was used to characterize the product. Sanger sequencing showed that more than 97% of the nucleotides matched the expected sequence. Extending the length of the DNA molecule by adding single-stranded oligonucleotides from a basis set (library via ligation enables a more convenient and rapid mechanism for the design and synthesis of oligonucleotides on the go. Coupled with an automated dispensing system and libraries of short oligo fragments, this novel DNA synthesis method would offer an efficient and cost-effective method for producing dsDNA.

  5. Simulated annealing model of acupuncture

    Science.gov (United States)

    Shang, Charles; Szu, Harold

    2015-05-01

    The growth control singularity model suggests that acupuncture points (acupoints) originate from organizers in embryogenesis. Organizers are singular points in growth control. Acupuncture can cause perturbation of a system with effects similar to simulated annealing. In clinical trial, the goal of a treatment is to relieve certain disorder which corresponds to reaching certain local optimum in simulated annealing. The self-organizing effect of the system is limited and related to the person's general health and age. Perturbation at acupoints can lead a stronger local excitation (analogous to higher annealing temperature) compared to perturbation at non-singular points (placebo control points). Such difference diminishes as the number of perturbed points increases due to the wider distribution of the limited self-organizing activity. This model explains the following facts from systematic reviews of acupuncture trials: 1. Properly chosen single acupoint treatment for certain disorder can lead to highly repeatable efficacy above placebo 2. When multiple acupoints are used, the result can be highly repeatable if the patients are relatively healthy and young but are usually mixed if the patients are old, frail and have multiple disorders at the same time as the number of local optima or comorbidities increases. 3. As number of acupoints used increases, the efficacy difference between sham and real acupuncture often diminishes. It predicted that the efficacy of acupuncture is negatively correlated to the disease chronicity, severity and patient's age. This is the first biological - physical model of acupuncture which can predict and guide clinical acupuncture research.

  6. Self-assembly of complex two-dimensional shapes from single-stranded DNA tiles.

    Science.gov (United States)

    Wei, Bryan; Vhudzijena, Michelle K; Robaszewski, Joanna; Yin, Peng

    2015-05-08

    Current methods in DNA nano-architecture have successfully engineered a variety of 2D and 3D structures using principles of self-assembly. In this article, we describe detailed protocols on how to fabricate sophisticated 2D shapes through the self-assembly of uniquely addressable single-stranded DNA tiles which act as molecular pixels on a molecular canvas. Each single-stranded tile (SST) is a 42-nucleotide DNA strand composed of four concatenated modular domains which bind to four neighbors during self-assembly. The molecular canvas is a rectangle structure self-assembled from SSTs. A prescribed complex 2D shape is formed by selecting the constituent molecular pixels (SSTs) from a 310-pixel molecular canvas and then subjecting the corresponding strands to one-pot annealing. Due to the modular nature of the SST approach we demonstrate the scalability, versatility and robustness of this method. Compared with alternative methods, the SST method enables a wider selection of information polymers and sequences through the use of de novo designed and synthesized short DNA strands.

  7. TALEN-Induced Double-Strand Break Repair of CTG Trinucleotide Repeats.

    Science.gov (United States)

    Mosbach, Valentine; Poggi, Lucie; Viterbo, David; Charpentier, Marine; Richard, Guy-Franck

    2018-02-20

    Trinucleotide repeat expansions involving CTG/CAG triplets are responsible for several neurodegenerative disorders, including myotonic dystrophy and Huntington's disease. Because expansions trigger the disease, contracting repeat length could be a possible approach to gene therapy for these disorders. Here, we show that a TALEN-induced double-strand break was very efficient at contracting expanded CTG repeats in yeast. We show that RAD51, POL32, and DNL4 are dispensable for double-strand break repair within CTG repeats, the only required genes being RAD50, SAE2, and RAD52. Resection was totally abolished in the absence of RAD50 on both sides of the break, whereas it was reduced in a sae2Δ mutant on the side of the break containing the longest repeat tract, suggesting that secondary structures at double-strand break ends must be removed by the Mre11-Rad50 complex and Sae2. Following the TALEN double-strand break, single-strand annealing occurred between both sides of the repeat tract, leading to repeat contraction. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. TALEN-Induced Double-Strand Break Repair of CTG Trinucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Valentine Mosbach

    2018-02-01

    Full Text Available Trinucleotide repeat expansions involving CTG/CAG triplets are responsible for several neurodegenerative disorders, including myotonic dystrophy and Huntington’s disease. Because expansions trigger the disease, contracting repeat length could be a possible approach to gene therapy for these disorders. Here, we show that a TALEN-induced double-strand break was very efficient at contracting expanded CTG repeats in yeast. We show that RAD51, POL32, and DNL4 are dispensable for double-strand break repair within CTG repeats, the only required genes being RAD50, SAE2, and RAD52. Resection was totally abolished in the absence of RAD50 on both sides of the break, whereas it was reduced in a sae2Δ mutant on the side of the break containing the longest repeat tract, suggesting that secondary structures at double-strand break ends must be removed by the Mre11-Rad50 complex and Sae2. Following the TALEN double-strand break, single-strand annealing occurred between both sides of the repeat tract, leading to repeat contraction.

  9. Heavy Metal Exposure Influences Double Strand Break DNA Repair Outcomes.

    Directory of Open Access Journals (Sweden)

    Maria E Morales

    Full Text Available Heavy metals such as cadmium, arsenic and nickel are classified as carcinogens. Although the precise mechanism of carcinogenesis is undefined, heavy metal exposure can contribute to genetic damage by inducing double strand breaks (DSBs as well as inhibiting critical proteins from different DNA repair pathways. Here we take advantage of two previously published culture assay systems developed to address mechanistic aspects of DNA repair to evaluate the effects of heavy metal exposures on competing DNA repair outcomes. Our results demonstrate that exposure to heavy metals significantly alters how cells repair double strand breaks. The effects observed are both specific to the particular metal and dose dependent. Low doses of NiCl2 favored resolution of DSBs through homologous recombination (HR and single strand annealing (SSA, which were inhibited by higher NiCl2 doses. In contrast, cells exposed to arsenic trioxide preferentially repaired using the "error prone" non-homologous end joining (alt-NHEJ while inhibiting repair by HR. In addition, we determined that low doses of nickel and cadmium contributed to an increase in mutagenic recombination-mediated by Alu elements, the most numerous family of repetitive elements in humans. Sequence verification confirmed that the majority of the genetic deletions were the result of Alu-mediated non-allelic recombination events that predominantly arose from repair by SSA. All heavy metals showed a shift in the outcomes of alt-NHEJ repair with a significant increase of non-templated sequence insertions at the DSB repair site. Our data suggest that exposure to heavy metals will alter the choice of DNA repair pathway changing the genetic outcome of DSBs repair.

  10. Heavy Metal Exposure Influences Double Strand Break DNA Repair Outcomes.

    Science.gov (United States)

    Morales, Maria E; Derbes, Rebecca S; Ade, Catherine M; Ortego, Jonathan C; Stark, Jeremy; Deininger, Prescott L; Roy-Engel, Astrid M

    2016-01-01

    Heavy metals such as cadmium, arsenic and nickel are classified as carcinogens. Although the precise mechanism of carcinogenesis is undefined, heavy metal exposure can contribute to genetic damage by inducing double strand breaks (DSBs) as well as inhibiting critical proteins from different DNA repair pathways. Here we take advantage of two previously published culture assay systems developed to address mechanistic aspects of DNA repair to evaluate the effects of heavy metal exposures on competing DNA repair outcomes. Our results demonstrate that exposure to heavy metals significantly alters how cells repair double strand breaks. The effects observed are both specific to the particular metal and dose dependent. Low doses of NiCl2 favored resolution of DSBs through homologous recombination (HR) and single strand annealing (SSA), which were inhibited by higher NiCl2 doses. In contrast, cells exposed to arsenic trioxide preferentially repaired using the "error prone" non-homologous end joining (alt-NHEJ) while inhibiting repair by HR. In addition, we determined that low doses of nickel and cadmium contributed to an increase in mutagenic recombination-mediated by Alu elements, the most numerous family of repetitive elements in humans. Sequence verification confirmed that the majority of the genetic deletions were the result of Alu-mediated non-allelic recombination events that predominantly arose from repair by SSA. All heavy metals showed a shift in the outcomes of alt-NHEJ repair with a significant increase of non-templated sequence insertions at the DSB repair site. Our data suggest that exposure to heavy metals will alter the choice of DNA repair pathway changing the genetic outcome of DSBs repair.

  11. Quantum annealing for combinatorial clustering

    Science.gov (United States)

    Kumar, Vaibhaw; Bass, Gideon; Tomlin, Casey; Dulny, Joseph

    2018-02-01

    Clustering is a powerful machine learning technique that groups "similar" data points based on their characteristics. Many clustering algorithms work by approximating the minimization of an objective function, namely the sum of within-the-cluster distances between points. The straightforward approach involves examining all the possible assignments of points to each of the clusters. This approach guarantees the solution will be a global minimum; however, the number of possible assignments scales quickly with the number of data points and becomes computationally intractable even for very small datasets. In order to circumvent this issue, cost function minima are found using popular local search-based heuristic approaches such as k-means and hierarchical clustering. Due to their greedy nature, such techniques do not guarantee that a global minimum will be found and can lead to sub-optimal clustering assignments. Other classes of global search-based techniques, such as simulated annealing, tabu search, and genetic algorithms, may offer better quality results but can be too time-consuming to implement. In this work, we describe how quantum annealing can be used to carry out clustering. We map the clustering objective to a quadratic binary optimization problem and discuss two clustering algorithms which are then implemented on commercially available quantum annealing hardware, as well as on a purely classical solver "qbsolv." The first algorithm assigns N data points to K clusters, and the second one can be used to perform binary clustering in a hierarchical manner. We present our results in the form of benchmarks against well-known k-means clustering and discuss the advantages and disadvantages of the proposed techniques.

  12. Loviisa Unit One: Annealing - healing

    Energy Technology Data Exchange (ETDEWEB)

    Kohopaeae, J.; Virsu, R. [ed.; Henriksson, A. [ed.

    1997-11-01

    Unit 1 of the Loviisa nuclear powerplant was annealed in connection with the refuelling outage in the summer of 1996. This type of heat treatment restored the toughness properties of the pressure vessel weld, which had been embrittled be neutron radiation, so that it is almost equivalent to a new weld. The treatment itself was an ordinary metallurgical procedure that took only a few days. But the material studies that preceded it began over fifteen years ago and have put IVO at the forefront of world-wide expertise in the area of radiation embrittlement

  13. Simulated annealing with constant thermodynamic speed

    International Nuclear Information System (INIS)

    Salamon, P.; Ruppeiner, G.; Liao, L.; Pedersen, J.

    1987-01-01

    Arguments are presented to the effect that the optimal annealing schedule for simulated annealing proceeds with constant thermodynamic speed, i.e., with dT/dt = -(v T)/(ε-√C), where T is the temperature, ε- is the relaxation time, C ist the heat capacity, t is the time, and v is the thermodynamic speed. Experimental results consistent with this conjecture are presented from simulated annealing on graph partitioning problems. (orig.)

  14. Keystream Generator Based On Simulated Annealing

    Directory of Open Access Journals (Sweden)

    Ayad A. Abdulsalam

    2011-01-01

    Full Text Available Advances in the design of keystream generator using heuristic techniques are reported. A simulated annealing algorithm for generating random keystream with large complexity is presented. Simulated annealing technique is adapted to locate these requirements. The definitions for some cryptographic properties are generalized, providing a measure suitable for use as an objective function in a simulated annealing algorithm, seeking randomness that satisfy both correlation immunity and the large linear complexity. Results are presented demonstrating the effectiveness of the method.

  15. Semantic search via concept annealing

    Science.gov (United States)

    Dunkelberger, Kirk A.

    2007-04-01

    Annealing, in metallurgy and materials science, is a heat treatment wherein the microstructure of a material is altered, causing changes in its properties such as strength and hardness. We define concept annealing as a lexical, syntactic, and semantic expansion capability (the removal of defects and the internal stresses that cause term- and phrase-based search failure) coupled with a directed contraction capability (semantically-related terms, queries, and concepts nucleate and grow to replace those originally deformed by internal stresses). These two capabilities are tied together in a control loop mediated by the information retrieval precision and recall metrics coupled with intuition provided by the operator. The specific representations developed have been targeted at facilitating highly efficient and effective semantic indexing and searching. This new generation of Find capability enables additional processing (i.e. all-source tracking, relationship extraction, and total system resource management) at rates, precisions, and accuracies previously considered infeasible. In a recent experiment, an order magnitude reduction in time to actionable intelligence and nearly three orderss magnitude reduction in false alarm rate was achieved.

  16. Saccharomyces cerevisiae Hrq1 helicase activity is affected by the sequence but not the length of single-stranded DNA.

    Science.gov (United States)

    Rogers, Cody M; Bochman, Matthew L

    2017-05-13

    Mutations in the human RecQ4 DNA helicase are associated with three different diseases characterized by genomic instability. To gain insight into how RecQ4 dysfunction leads to these pathologies, several groups have used the Saccharomyces cerevisiae RecQ4 homolog Hrq1 as an experimental model. Hrq1 displays many of the same functions as RecQ4 in vivo and in vitro. However, there is some disagreement in the literature about the effects of single-stranded DNA (ssDNA) length on Hrq1 helicase activity and the ability of Hrq1 to anneal complementary ssDNA oligonucleotides into duplex DNA. Here, we present a side-by-side comparison of Hrq1 and RecQ4 helicase activity, demonstrating that in both cases, long random-sequence 3' ssDNA tails inhibit DNA unwinding in vitro in a length-dependent manner. This appears to be due to the formation of secondary structures in the random-sequence ssDNA because Hrq1 preferentially unwound poly(dT)-tailed forks independent of ssDNA length. Further, RecQ4 is capable of ssDNA strand annealing and annealing-dependent strand exchange, but Hrq1 lacks these activities. These results establish the importance of DNA sequence in Hrq1 helicase activity, and the absence of Hrq1 strand annealing activity explains the previously identified discrepancies between S. cerevisiae Hrq1 and human RecQ4. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Complex shapes self–assembled from single–stranded DNA tiles

    Science.gov (United States)

    Wei, Bryan; Dai, Mingjie; Yin, Peng

    2014-01-01

    Programmed self-assembly of strands of nucleic acid has proved highly effective for creating a wide range of structures with desired shapes1–25. A particularly successful implementation is DNA origami, in which a long scaffold strand is folded by hundreds of short auxiliary strands into a complex shape9, 14–16,18–21,25. Modular strategies are in principle simpler and more versatile and have been used to assemble DNA2–5,8,10–13,17,23 or RNA7,22 tiles into periodic3,4,7,22 and algorithmic5 two-dimensional lattices, extended ribbons10,12 and tubes4,12,13, three-dimensional crystals17, polyhedra11 and simple finite two-dimensional shapes7,8. But creating finite yet complex shapes from a large number of uniquely addressable tiles remains challenging. Here we solve this problem with the simplest tile form, a ‘single-stranded tile’ (SST) that consists of a 42-base strand of DNA composed entirely of concatenated sticky ends and that binds to four local neighbours during self-assembly12. Although ribbons and tubes with controlled circumferences12 have been created using the SST approach, we extend it to assemble complex two-dimensional shapes and tubes from hundreds (in some cases more than one thousand) distinct tiles. Our main design feature is a self-assembled rectangle that serves as a molecular canvas, with each of its constituent SST strands—folded into a 3nm-by-7 nm tile and attached to four neighbouring tiles—acting as a pixel. A desired shape, drawn on the canvas, is then produced by one-pot annealing of all those strands that correspond to pixels covered by the target shape; the remaining strands are excluded. We implement the strategy with a master strand collection that corresponds to a 310-pixel canvas, and then use appropriate strand subsets to construct 107 distinct and complex two-dimensional shapes, thereby establishing SST assembly as a simple, modular and robust framework for constructing nanostructures with prescribed shapes from short

  18. GPU accelerated population annealing algorithm

    Science.gov (United States)

    Barash, Lev Yu.; Weigel, Martin; Borovský, Michal; Janke, Wolfhard; Shchur, Lev N.

    2017-11-01

    Population annealing is a promising recent approach for Monte Carlo simulations in statistical physics, in particular for the simulation of systems with complex free-energy landscapes. It is a hybrid method, combining importance sampling through Markov chains with elements of sequential Monte Carlo in the form of population control. While it appears to provide algorithmic capabilities for the simulation of such systems that are roughly comparable to those of more established approaches such as parallel tempering, it is intrinsically much more suitable for massively parallel computing. Here, we tap into this structural advantage and present a highly optimized implementation of the population annealing algorithm on GPUs that promises speed-ups of several orders of magnitude as compared to a serial implementation on CPUs. While the sample code is for simulations of the 2D ferromagnetic Ising model, it should be easily adapted for simulations of other spin models, including disordered systems. Our code includes implementations of some advanced algorithmic features that have only recently been suggested, namely the automatic adaptation of temperature steps and a multi-histogram analysis of the data at different temperatures. Program Files doi:http://dx.doi.org/10.17632/sgzt4b7b3m.1 Licensing provisions: Creative Commons Attribution license (CC BY 4.0) Programming language: C, CUDA External routines/libraries: NVIDIA CUDA Toolkit 6.5 or newer Nature of problem: The program calculates the internal energy, specific heat, several magnetization moments, entropy and free energy of the 2D Ising model on square lattices of edge length L with periodic boundary conditions as a function of inverse temperature β. Solution method: The code uses population annealing, a hybrid method combining Markov chain updates with population control. The code is implemented for NVIDIA GPUs using the CUDA language and employs advanced techniques such as multi-spin coding, adaptive temperature

  19. THE THREE-STRANDED CORD

    Directory of Open Access Journals (Sweden)

    Walter Redmond

    2013-11-01

    Full Text Available The Schoolmen did much of their most interesting and original philosophizing in theology. An example is the dilemma in Renaissance Scholasticism on free will: how can we act freely if God causes and knows our actions? Basic issues are involved here: the antinomy between freedom and determination, modal semantics, tense logic, the logical status of counterfacts. Mexican Jesuits Matías Blanco (d. 1734 and Antonio Peralta (d. 1736 wrote books on the subject. We describe here the “disjunctive” solution that Blanco advanced in his Funiculus triplex (The Three-Stranded Cord, published posthumously in Mexico in 1746. When someone is faced with choosing between B and C, conjectures Blanco, God does not actualize either, but rather their disjunction B-or-C. Blanco calls for a truce in the “war” among the contending schools so that they may consider his solution–for he thinks it may indeed be acceptable to all.

  20. Understanding the microwave annealing of silicon

    Directory of Open Access Journals (Sweden)

    Chaochao Fu

    2017-03-01

    Full Text Available Though microwave annealing appears to be very appealing due to its unique features, lacking an in-depth understanding and accurate model hinder its application in semiconductor processing. In this paper, the physics-based model and accurate calculation for the microwave annealing of silicon are presented. Both thermal effects, including ohmic conduction loss and dielectric polarization loss, and non-thermal effects are thoroughly analyzed. We designed unique experiments to verify the mechanism and extract relevant parameters. We also explicitly illustrate the dynamic interaction processes of the microwave annealing of silicon. This work provides an in-depth understanding that can expedite the application of microwave annealing in semiconductor processing and open the door to implementing microwave annealing for future research and applications.

  1. Control of contact resistance by strand surface coating in 36-strands NbTi CICC's

    NARCIS (Netherlands)

    Nijhuis, Arend; ten Kate, Herman H.J.; Duchateau, Jean-Luc; Decool, Patrick

    2001-01-01

    The stability and AC loss of NbTi cable-in-conduit conductors (CICCs) is largely determined by the interstrand contact resistance (Rc). Rc is predominantly established by the strand surface properties. Five 36-strand CICCs, fully identical except for the plating of the strand surface or the presence

  2. Structural Insights into the HIV-1 Minus-strand Strong-stop DNA.

    Science.gov (United States)

    Chen, Yingying; Maskri, Ouerdia; Chaminade, Françoise; René, Brigitte; Benkaroun, Jessica; Godet, Julien; Mély, Yves; Mauffret, Olivier; Fossé, Philippe

    2016-02-12

    An essential step of human immunodeficiency virus type 1 (HIV-1) reverse transcription is the first strand transfer that requires base pairing of the R region at the 3'-end of the genomic RNA with the complementary r region at the 3'-end of minus-strand strong-stop DNA (ssDNA). HIV-1 nucleocapsid protein (NC) facilitates this annealing process. Determination of the ssDNA structure is needed to understand the molecular basis of NC-mediated genomic RNA-ssDNA annealing. For this purpose, we investigated ssDNA using structural probes (nucleases and potassium permanganate). This study is the first to determine the secondary structure of the full-length HIV-1 ssDNA in the absence or presence of NC. The probing data and phylogenetic analysis support the folding of ssDNA into three stem-loop structures and the presence of four high-affinity binding sites for NC. Our results support a model for the NC-mediated annealing process in which the preferential binding of NC to four sites triggers unfolding of the three-dimensional structure of ssDNA, thus facilitating interaction of the r sequence of ssDNA with the R sequence of the genomic RNA. In addition, using gel retardation assays and ssDNA mutants, we show that the NC-mediated annealing process does not rely on a single pathway (zipper intermediate or kissing complex). © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Unraveling the strands of Saturn's F ring

    Science.gov (United States)

    Murray, C.D.; Gordon, M.K.; Giuliatti, Winter S.M.

    1997-01-01

    Several high-resolution Voyager 2 images of Saturn's F ring show that it is composed of at least four separate, non-intersecting strands extending ~45?? in longitude. Voyager 1 images show that the two brightest strands appear to intersect, giving rise to a "braided" morphology. From a study of all available Voyager images the detectable radial structure is cataloged and reviewed. Previous indications that there is fine material interior to the orbit of the F ring are confirmed. Evidence is presented that a model of four strands with comparable eccentricities and nearly aligned perichrones is consistent with all the Voyager observations. The observed perichrone offset of the two brightest strands suggests a minimum radial separation of ~20 km, which implies intersection of these strands when their finite radial widths are taken into account. The longitude range of such an intersection includes that observed in the Voyager 1 "braid" images. The proximity of these two strands at some longitudes may account for the apparent differences in the ring between the Voyager encounters, as well as provide a source for the short-lived features detected in the Hubble Space Telescope images of the F ring. There is no evidence that the locations of the individual strands are determined by resonant perturbations with known satellites. It is proposed that the radial structure is formed by the localized action of small satellites orbiting within the strand region. ?? 1997 Academic Press.

  4. Precision Laser Annealing of Focal Plane Arrays

    Energy Technology Data Exchange (ETDEWEB)

    Bender, Daniel A. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); DeRose, Christopher [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Starbuck, Andrew Lea [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Verley, Jason C. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jenkins, Mark W. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-09-01

    We present results from laser annealing experiments in Si using a passively Q-switched Nd:YAG microlaser. Exposure with laser at fluence values above the damage threshold of commercially available photodiodes results in electrical damage (as measured by an increase in photodiode dark current). We show that increasing the laser fluence to values in excess of the damage threshold can result in annealing of a damage site and a reduction in detector dark current by as much as 100x in some cases. A still further increase in fluence results in irreparable damage. Thus we demonstrate the presence of a laser annealing window over which performance of damaged detectors can be at least partially reconstituted. Moreover dark current reduction is observed over the entire operating range of the diode indicating that device performance has been improved for all values of reverse bias voltage. Additionally, we will present results of laser annealing in Si waveguides. By exposing a small (<10 um) length of a Si waveguide to an annealing laser pulse, the longitudinal phase of light acquired in propagating through the waveguide can be modified with high precision, <15 milliradian per laser pulse. Phase tuning by 180 degrees is exhibited with multiple exposures to one arm of a Mach-Zehnder interferometer at fluence values below the morphological damage threshold of an etched Si waveguide. No reduction in optical transmission at 1550 nm was found after 220 annealing laser shots. Modeling results for laser annealing in Si are also presented.

  5. Cylinder packing by simulated annealing

    Directory of Open Access Journals (Sweden)

    M. Helena Correia

    2000-12-01

    Full Text Available This paper is motivated by the problem of loading identical items of circular base (tubes, rolls, ... into a rectangular base (the pallet. For practical reasons, all the loaded items are considered to have the same height. The resolution of this problem consists in determining the positioning pattern of the circular bases of the items on the rectangular pallet, while maximizing the number of items. This pattern will be repeated for each layer stacked on the pallet. Two algorithms based on the meta-heuristic Simulated Annealing have been developed and implemented. The tuning of these algorithms parameters implied running intensive tests in order to improve its efficiency. The algorithms developed were easily extended to the case of non-identical circles.Este artigo aborda o problema de posicionamento de objetos de base circular (tubos, rolos, ... sobre uma base retangular de maiores dimensões. Por razões práticas, considera-se que todos os objetos a carregar apresentam a mesma altura. A resolução do problema consiste na determinação do padrão de posicionamento das bases circulares dos referidos objetos sobre a base de forma retangular, tendo como objetivo a maximização do número de objetos estritamente posicionados no interior dessa base. Este padrão de posicionamento será repetido em cada uma das camadas a carregar sobre a base retangular. Apresentam-se dois algoritmos para a resolução do problema. Estes algoritmos baseiam-se numa meta-heurística, Simulated Annealling, cuja afinação de parâmetros requereu a execução de testes intensivos com o objetivo de atingir um elevado grau de eficiência no seu desempenho. As características dos algoritmos implementados permitiram que a sua extensão à consideração de círculos com raios diferentes fosse facilmente conseguida.

  6. Human RAD52 Captures and Holds DNA Strands, Increases DNA Flexibility, and Prevents Melting of Duplex DNA: Implications for DNA Recombination

    Directory of Open Access Journals (Sweden)

    Ineke Brouwer

    2017-03-01

    Full Text Available Human RAD52 promotes annealing of complementary single-stranded DNA (ssDNA. In-depth knowledge of RAD52-DNA interaction is required to understand how its activity is integrated in DNA repair processes. Here, we visualize individual fluorescent RAD52 complexes interacting with single DNA molecules. The interaction with ssDNA is rapid, static, and tight, where ssDNA appears to wrap around RAD52 complexes that promote intra-molecular bridging. With double-stranded DNA (dsDNA, interaction is slower, weaker, and often diffusive. Interestingly, force spectroscopy experiments show that RAD52 alters the mechanics dsDNA by enhancing DNA flexibility and increasing DNA contour length, suggesting intercalation. RAD52 binding changes the nature of the overstretching transition of dsDNA and prevents DNA melting, which is advantageous for strand clamping during or after annealing. DNA-bound RAD52 is efficient at capturing ssDNA in trans. Together, these effects may help key steps in DNA repair, such as second-end capture during homologous recombination or strand annealing during RAD51-independent recombination reactions.

  7. Marine mammal strandings in the New Caledonia region, Southwest Pacific.

    Science.gov (United States)

    Borsa, Philippe

    2006-04-01

    Four hundred twenty three marine mammals, in 72 stranding events, were recorded between 1877 and 2005 in New Caledonia, the Loyalty Islands, and Vanuatu in the southwest Pacific. Sixteen species were represented in this count, including: minke whale, Balaenoptera acutorostrata (1 single stranding), sei whale, B. borealis (1 single stranding), blue whale, B. musculus (1 single stranding), humpback whale, Megaptera novaeangliae (2 single strandings), giant sperm whale, Physeter macrocephalus (18 single strandings, 2 pair strandings), pygmy sperm whale, Kogia breviceps (5 single strandings), dwarf sperm whale, K. sima (2 single strandings, 1 triple stranding), Blainville's beaked whale, Mesoplodon densirostris (2 single strandings), short-finned pilot whale, Globicephala macrorhynchus (4 strandings, 56 individuals), melon-headed whale, Peponocephala electra (1 single stranding and 2 mass strandings totalling 231 individuals), common dolphin, Delphinus delphis (1 single stranding), spinner dolphin, Stenella longirostris (1 pair stranding and 2 mass strandings of groups of approximately 30 individuals each), Indian Ocean bottlenose dolphin, Tursiops aduncus (2 single strandings), dugong, Dugong dugon (14 single strandings), and New Zealand fur seal, Arctocephalus forsteri (3 single strandings). A stranded rorqual identified as an Antarctic minke whale (B. bonaerensis), with coloration patterns that did not match known descriptions, was also reported. Sei whale was recorded for the first time in the tropical Southwest Pacific region and Antarctic minke whale, melon-headed whale, and Indian Ocean bottlenose dolphin were recorded for the first time in New Caledonia. Strandings of sperm whales were most frequent in the spring, but also occurred in autumn months, suggesting a seasonal pattern of occurrence possibly related to seasonal migration. One stranded humpback whale bore the scars of a killer whale's attack and one dugong was injured by a shark. Scars left by

  8. Enthalpy relaxation and annealing effect in polystyrene.

    Science.gov (United States)

    Sakatsuji, Waki; Konishi, Takashi; Miyamoto, Yoshihisa

    2013-07-01

    The effects of thermal history on the enthalpy relaxation in polystyrene are studied by differential scanning calorimetry. The temperature dependence of the specific heat in the liquid and the glassy states, that of relaxation time, and the exponent of the Kohlrausch-Williams-Watts function are determined by measurements of the thermal response against sinusoidal temperature variation. A phenomenological model equation previously proposed to interpret the memory effect in the frozen state is applied to the enthalpy relaxation and the evolution of entropy under a given thermal history is calculated. The annealing below the glass transition temperature produces two effects on enthalpy relaxation: the decay of excess entropy with annealing time in the early stage of annealing and the increase in relaxation time due to physical aging in the later stage. The crossover of these effects is reflected in the variation of temperature of the maximum specific heat observed in the heating process after annealing and cooling.

  9. Annealing behavior of high permeability amorphous alloys

    International Nuclear Information System (INIS)

    Rabenberg, L.

    1980-06-01

    Effects of low temperature annealing on the magnetic properties of the amorphous alloy Co 71 4 Fe 4 6 Si 9 6 B 14 4 were investigated. Annealing this alloy below 400 0 C results in magnetic hardening; annealing above 400 0 C but below the crystallization temperature results in magnetic softening. Above the crystallization temperature the alloy hardens drastically and irreversibly. Conventional and high resolution transmission electron microscopy were used to show that the magnetic property changes at low temperatures occur while the alloy is truly amorphous. By imaging the magnetic microstructures, Lorentz electron microscopy has been able to detect the presence of microscopic inhomogeneities in this alloy. The low temperature annealing behavior of this alloy has been explained in terms of atomic pair ordering in the presence of the internal molecular field. Lorentz electron microscopy has been used to confirm this explanation

  10. Global warming: Temperature estimation in annealers

    Directory of Open Access Journals (Sweden)

    Jack Raymond

    2016-11-01

    Full Text Available Sampling from a Boltzmann distribution is NP-hard and so requires heuristic approaches. Quantum annealing is one promising candidate. The failure of annealing dynamics to equilibrate on practical time scales is a well understood limitation, but does not always prevent a heuristically useful distribution from being generated. In this paper we evaluate several methods for determining a useful operational temperature range for annealers. We show that, even where distributions deviate from the Boltzmann distribution due to ergodicity breaking, these estimates can be useful. We introduce the concepts of local and global temperatures that are captured by different estimation methods. We argue that for practical application it often makes sense to analyze annealers that are subject to post-processing in order to isolate the macroscopic distribution deviations that are a practical barrier to their application.

  11. Structural relaxation in annealed hyperquenched basaltic glasses

    DEFF Research Database (Denmark)

    Guo, Xiaoju; Mauro, John C.; Potuzak, M.

    2012-01-01

    The enthalpy relaxation behavior of hyperquenched (HQ) and annealed hyperquenched (AHQ) basaltic glass is investigated through calorimetric measurements. The results reveal a common onset temperature of the glass transition for all the HQ and AHQ glasses under study, indicating that the primary...... relaxation is activated at the same temperature regardless of the initial departure from equilibrium. The analysis of secondary relaxation at different annealing temperatures provides insights into the enthalpy recovery of HQ glasses....

  12. Irradiation embrittlement and optimisation of annealing

    International Nuclear Information System (INIS)

    1993-01-01

    This conference is composed of 30 papers grouped in 6 sessions related to the following themes: neutron irradiation effects in pressure vessel steels and weldments used in PWR, WWER and BWR nuclear plants; results from surveillance programmes (irradiation induced damage and annealing processes); studies on the influence of variations in irradiation conditions and mechanisms, and modelling; mitigation of irradiation effects, especially through thermal annealing; mechanical test procedures and specimen size effects

  13. Boosting quantum annealer performance via sample persistence

    Science.gov (United States)

    Karimi, Hamed; Rosenberg, Gili

    2017-07-01

    We propose a novel method for reducing the number of variables in quadratic unconstrained binary optimization problems, using a quantum annealer (or any sampler) to fix the value of a large portion of the variables to values that have a high probability of being optimal. The resulting problems are usually much easier for the quantum annealer to solve, due to their being smaller and consisting of disconnected components. This approach significantly increases the success rate and number of observations of the best known energy value in samples obtained from the quantum annealer, when compared with calling the quantum annealer without using it, even when using fewer annealing cycles. Use of the method results in a considerable improvement in success metrics even for problems with high-precision couplers and biases, which are more challenging for the quantum annealer to solve. The results are further enhanced by applying the method iteratively and combining it with classical pre-processing. We present results for both Chimera graph-structured problems and embedded problems from a real-world application.

  14. Nanocrystalline magnetic materials obtained by flash annealing

    Directory of Open Access Journals (Sweden)

    Murakami R.K.

    1999-01-01

    Full Text Available The aim of the present work was to produce enhanced-remanence nanocrystalline magnetic material by crystallizing amorphous or partially amorphous Pr4.5Fe77B18.5 alloys by the flash annealing process, also known as the dc-Joule heating process, and to determine the optimal conditions for obtaining good magnetic coupling between the magnetic phases present in this material. Ribbons of Pr4.5Fe77B18.5 were produced by melt spinning and then annealed for 10-30 s at temperatures 500 - 640 °C by passing current through the sample to develop the enhanced-remanence nanocrystalline magnetic material. These materials were studied by X-ray diffraction, differential thermal analysis and magnetic measurements. Coercivity increases of up to 15% were systematically observed in relation to furnace-annealed material. Two different samples were carefully examined: (i a sample annealed at 600 °C which showed the highest coercive field Hc and remanence ratio Mr/Ms and (ii a sample annealed at 520 °C which showed phase separation in the second quadrant demagnetization curve. Our results are in agreement with other studies which show that flash annealing improves the magnetic properties of some amorphous ferromagnetic ribbons.

  15. Energy Saving in Industrial Annealing Furnaces

    Directory of Open Access Journals (Sweden)

    Fatma ÇANKA KILIÇ

    2018-03-01

    Full Text Available In this study, an energy efficiency studies have been carried out in a natural gas-fired rolling mill annealing furnace of an industrial establishment. In this context, exhaust gas from the furnace has been examined in terms of waste heat potential. In the examinations that have been made in detail; waste heat potential was found as 3.630,31 kW. Technical and feasibility studies have been carried out to realize electricity production through an Organic Rankine Cycle (ORC system for evaluating the waste heat potential of the annealing furnace. It has been calculated that 1.626.378,88 kWh/year of electricity can be generated by using the exhaust gas waste heat of the annealing furnace through an ORC system to produce electric energy with a net efficiency of 16%. The financial value of this energy was determined as 436.032,18 TL/year and the simple repayment period of the investment was 8,12 years. Since the annealing period of the annealing furnace is 2800 hours/year, the investment has not been found to be feasible in terms of the feasibility studies. However, the investment suitability can be assured when the annealing furnace is operating at full capacity for 8,000 hours or more annually.

  16. The stranding anomaly as population indicator

    DEFF Research Database (Denmark)

    Peltier, Helene; Baagøe, Hans J.; Camphuysen, Kees C. J.

    2013-01-01

    Ecological indicators for monitoring strategies are expected to combine three major characteristics: ecological significance, statistical credibility, and cost-effectiveness. Strategies based on stranding networks rank highly in cost-effectiveness, but their ecological significance and statistica...

  17. Bubbles in live-stranded dolphins.

    Science.gov (United States)

    Dennison, S; Moore, M J; Fahlman, A; Moore, K; Sharp, S; Harry, C T; Hoppe, J; Niemeyer, M; Lentell, B; Wells, R S

    2012-04-07

    Bubbles in supersaturated tissues and blood occur in beaked whales stranded near sonar exercises, and post-mortem in dolphins bycaught at depth and then hauled to the surface. To evaluate live dolphins for bubbles, liver, kidneys, eyes and blubber-muscle interface of live-stranded and capture-release dolphins were scanned with B-mode ultrasound. Gas was identified in kidneys of 21 of 22 live-stranded dolphins and in the hepatic portal vasculature of 2 of 22. Nine then died or were euthanized and bubble presence corroborated by computer tomography and necropsy, 13 were released of which all but two did not re-strand. Bubbles were not detected in 20 live wild dolphins examined during health assessments in shallow water. Off-gassing of supersaturated blood and tissues was the most probable origin for the gas bubbles. In contrast to marine mammals repeatedly diving in the wild, stranded animals are unable to recompress by diving, and thus may retain bubbles. Since the majority of beached dolphins released did not re-strand it also suggests that minor bubble formation is tolerated and will not lead to clinically significant decompression sickness.

  18. Origin of reverse annealing effect in hydrogen-implanted silicon

    Energy Technology Data Exchange (ETDEWEB)

    Di, Zengfeng [Los Alamos National Laboratory; Nastasi, Michael A [Los Alamos National Laboratory; Wang, Yongqiang [Los Alamos National Laboratory

    2009-01-01

    In contradiction to conventional damage annealing, thermally annealed H-implanted Si exhibits an increase in damage or reverse annealing behavior, whose mechanism has remained elusive. On the basis of quantitative high resolution transmission electron microscopy combined with channeling Rutherford backscattering analysis, we conclusively elucidate that the reverse annealing effect is due to the nucleation and growth of hydrogen-induce platelets. Platelets are responsible for an increase in the height and width the channeling damage peak following increased isochronal anneals.

  19. Mechanical properties of rubberwood oriented strand lumber (OSL: The effect of strand length

    Directory of Open Access Journals (Sweden)

    Buhnnum Kyokong

    2005-09-01

    Full Text Available Effect of strand length on mechanical properties (tension, compression and bending of oriented strand lumber (OSL made of rubberwood (Hevea brasiliensis Muell. Arg. was reported. Three strand lengths of 50 mm, 100 mm, and 150 mm with 1 mm thickness and 15 mm width were used. The strands were mixed with 5% pMDI glue (weight basis in a tumble mixer. The OSL specimens were formed by hot pressing process of unidirectionally aligned strands. Average specific gravity and moisture content were 0.76 and 8.34%, respectively. Tension and compression tests were carried out for directions both parallel and perpendicular to grain while bending test was performed only in parallel direction. Ultimate stresses and moduli of elasticity were examined from the stress-strain curves. It was found that for the parallel-to-grain direction, the longer strand OSL gave higher strength. The role of the strand length did not appear for the direction normal to the grain. The relationship between the mechanical properties of OSL and strand length was well described by the modified Hankinson formula.

  20. Initiation signals for complementary strand DNA synthesis on single-stranded plasmid DNA

    NARCIS (Netherlands)

    van der Ende, A.; Teertstra, R.; van der Avoort, H. G.; Weisbeek, P. J.

    1983-01-01

    The bacteriophage 0X174 origin for (+) strand DNA synthesis, when inserted in a plasmid, is in vivo a substrate for the initiator A protein, that is produced by infecting phages. The result of this interaction is the packaging of single-stranded plasmid DNA into preformed phage coats. These plasmid

  1. Coating Thickness of the LHC Superconducting Strands

    CERN Document Server

    Charras, N

    2003-01-01

    In order to determine the time of heat treatment to give to the superconducting Rutherford-type cable, it is essential to know the stabrite (SnAg5%) coating thickness on the superconducting strands. Depending on the heat treatment time applied, the cable will have a contact resistance between strands conform to the LHC specifications. A study on the tin layers thickness was carried out. It concerns the internal and the external strands for all the firms producing these strands for the LHC. The level of control of the tinning process was established for each firm, and correlations between different measuring techniques of the tin layers were achieved, based on the keys process parameters. Finally, a correlation's relationship was found to get an equivalent value of Atomic Adsorption Spectrometry (AAS) from a coulometric result. The AAS measurement gives the total amount of tin in the strand and is the reference nowadays. Thanks to this equivalence, the number of real AAS measurements carried out can be lowered...

  2. Deterministic quantum annealing expectation-maximization algorithm

    Science.gov (United States)

    Miyahara, Hideyuki; Tsumura, Koji; Sughiyama, Yuki

    2017-11-01

    Maximum likelihood estimation (MLE) is one of the most important methods in machine learning, and the expectation-maximization (EM) algorithm is often used to obtain maximum likelihood estimates. However, EM heavily depends on initial configurations and fails to find the global optimum. On the other hand, in the field of physics, quantum annealing (QA) was proposed as a novel optimization approach. Motivated by QA, we propose a quantum annealing extension of EM, which we call the deterministic quantum annealing expectation-maximization (DQAEM) algorithm. We also discuss its advantage in terms of the path integral formulation. Furthermore, by employing numerical simulations, we illustrate how DQAEM works in MLE and show that DQAEM moderate the problem of local optima in EM.

  3. Traffic Flow Optimization Using a Quantum Annealer

    Directory of Open Access Journals (Sweden)

    Florian Neukart

    2017-12-01

    Full Text Available Quantum annealing algorithms belong to the class of metaheuristic tools, applicable for solving binary optimization problems. Hardware implementations of quantum annealing, such as the quantum processing units (QPUs produced by D-Wave Systems, have been subject to multiple analyses in research, with the aim of characterizing the technology’s usefulness for optimization and sampling tasks. In this paper, we present a real-world application that uses quantum technologies. Specifically, we show how to map certain parts of a real-world traffic flow optimization problem to be suitable for quantum annealing. We show that time-critical optimization tasks, such as continuous redistribution of position data for cars in dense road networks, are suitable candidates for quantum computing. Due to the limited size and connectivity of current-generation D-Wave QPUs, we use a hybrid quantum and classical approach to solve the traffic flow problem.

  4. Thermal annealing of tilted fiber Bragg gratings

    Science.gov (United States)

    González-Vila, Á.; Rodríguez-Cobo, L.; Mégret, P.; Caucheteur, C.; López-Higuera, J. M.

    2016-05-01

    We report a practical study of the thermal decay of cladding mode resonances in tilted fiber Bragg gratings, establishing an analogy with the "power law" evolution previously observed on uniform gratings. We examine how this process contributes to a great thermal stability, even improving it by means of a second cycle slightly increasing the annealing temperature. In addition, we show an improvement of the grating spectrum after annealing, with respect to the one just after inscription, which suggests the application of this method to be employed to improve saturation issues during the photo-inscription process.

  5. Hardening by annealing: insights from different alloys

    International Nuclear Information System (INIS)

    Renk, O; Pippan, R; Hohenwarter, A; Schuh, B; Li, J H

    2015-01-01

    In contrast to the general notion about the annealing behavior of coarse grained materials, hardening phenomena in nanocrystalline materials can occur. Although the phenomena have already been recognized several years ago, the mechanisms behind are still controversially discussed. For example, the influence of solutes segregated to grain boundaries on the strengthening mechanism is unclear. We present a combination of atom probe tomography and mechanical data to reveal the role of segregations to the strengthening. The results show that despite large modifications of the boundary chemistry the mechanical behavior remains widely unaffected. Additionally, it will be shown that hardening upon annealing can only occur below a material-specific grain size threshold value. (paper)

  6. Connecting localized DNA strand displacement reactions

    Science.gov (United States)

    Mullor Ruiz, Ismael; Arbona, Jean-Michel; Lad, Amitkumar; Mendoza, Oscar; Aimé, Jean-Pierre; Elezgaray, Juan

    2015-07-01

    Logic circuits based on DNA strand displacement reactions have been shown to be versatile enough to compute the square root of four-bit numbers. The implementation of these circuits as a set of bulk reactions faces difficulties which include leaky reactions and intrinsically slow, diffusion-limited reaction rates. In this paper, we consider simple examples of these circuits when they are attached to platforms (DNA origamis). As expected, constraining distances between DNA strands leads to faster reaction rates. However, it also induces side-effects that are not detectable in the solution-phase version of this circuitry. Appropriate design of the system, including protection and asymmetry between input and fuel strands, leads to a reproducible behaviour, at least one order of magnitude faster than the one observed under bulk conditions.Logic circuits based on DNA strand displacement reactions have been shown to be versatile enough to compute the square root of four-bit numbers. The implementation of these circuits as a set of bulk reactions faces difficulties which include leaky reactions and intrinsically slow, diffusion-limited reaction rates. In this paper, we consider simple examples of these circuits when they are attached to platforms (DNA origamis). As expected, constraining distances between DNA strands leads to faster reaction rates. However, it also induces side-effects that are not detectable in the solution-phase version of this circuitry. Appropriate design of the system, including protection and asymmetry between input and fuel strands, leads to a reproducible behaviour, at least one order of magnitude faster than the one observed under bulk conditions. Electronic supplementary information (ESI) available. See DOI: 10.1039/C5NR02434J

  7. Modular annealing apparatus for in situ reactor vessel annealing and related method of assembly

    International Nuclear Information System (INIS)

    Bau, F.I.; Mavretish, R.S.

    1992-01-01

    This patent describes a method for annealing a nuclear reactor vessel in a containment building. It comprises pre-fabricating a plurality of heater segments at a location outside the containment building; transporting the plurality of heater segments to the containment building; removing the core and internals and storing same; installing temporary shielding for the stored internals; introducing each of the plurality of heater segments through an equipment hatch in the containment building; assembling the plurality of heater segments to form an annealing apparatus; and annealing the reactor vessel

  8. Asymmetric strand segregation: epigenetic costs of genetic fidelity?

    Directory of Open Access Journals (Sweden)

    Diane P Genereux

    2009-06-01

    Full Text Available Asymmetric strand segregation has been proposed as a mechanism to minimize effective mutation rates in epithelial tissues. Under asymmetric strand segregation, the double-stranded molecule that contains the oldest DNA strand is preferentially targeted to the somatic stem cell after each round of DNA replication. This oldest DNA strand is expected to have fewer errors than younger strands because some of the errors that arise on daughter strands during their synthesis fail to be repaired. Empirical findings suggest the possibility of asymmetric strand segregation in a subset of mammalian cell lineages, indicating that it may indeed function to increase genetic fidelity. However, the implications of asymmetric strand segregation for the fidelity of epigenetic information remain unexplored. Here, I explore the impact of strand-segregation dynamics on epigenetic fidelity using a mathematical-modelling approach that draws on the known molecular mechanisms of DNA methylation and existing rate estimates from empirical methylation data. I find that, for a wide range of starting methylation densities, asymmetric -- but not symmetric -- strand segregation leads to systematic increases in methylation levels if parent strands are subject to de novo methylation events. I found that epigenetic fidelity can be compromised when enhanced genetic fidelity is achieved through asymmetric strand segregation. Strand segregation dynamics could thus explain the increased DNA methylation densities that are observed in structured cellular populations during aging and in disease.

  9. Intelligent medical image processing by simulated annealing

    International Nuclear Information System (INIS)

    Ohyama, Nagaaki

    1992-01-01

    Image processing is being widely used in the medical field and already has become very important, especially when used for image reconstruction purposes. In this paper, it is shown that image processing can be classified into 4 categories; passive, active, intelligent and visual image processing. These 4 classes are explained at first through the use of several examples. The results show that the passive image processing does not give better results than the others. Intelligent image processing, then, is addressed, and the simulated annealing method is introduced. Due to the flexibility of the simulated annealing, formulated intelligence is shown to be easily introduced in an image reconstruction problem. As a practical example, 3D blood vessel reconstruction from a small number of projections, which is insufficient for conventional method to give good reconstruction, is proposed, and computer simulation clearly shows the effectiveness of simulated annealing method. Prior to the conclusion, medical file systems such as IS and C (Image Save and Carry) is pointed out to have potential for formulating knowledge, which is indispensable for intelligent image processing. This paper concludes by summarizing the advantages of simulated annealing. (author)

  10. Influence of Intercritical Annealing Temperature on Mechanical ...

    African Journals Online (AJOL)

    The fracture surfaces of the impact test samples were examined using the scanning electron microscope (SEM). Micros structural evolution of the samples was also examined with an optical microscope. The results showed that all the evaluated mechanical properties were improved by intercritical annealing, with the ...

  11. Finite-time thermodynamics and simulated annealing

    International Nuclear Information System (INIS)

    Andresen, B.

    1989-01-01

    When the general, global optimization technique simulated annealing was introduced by Kirkpatrick et al. (1983), this mathematical algorithm was based on an analogy to the statistical mechanical behavior of real physical systems like spin glasses, hence the name. In the intervening span of years the method has proven exceptionally useful for a great variety of extremely complicated problems, notably NP-problems like the travelling salesman, DNA sequencing, and graph partitioning. Only a few highly optimized heuristic algorithms (e.g. Lin, Kernighan 1973) have outperformed simulated annealing on their respective problems (Johnson et al. 1989). Simulated annealing in its current form relies only on the static quantity 'energy' to describe the system, whereas questions of rate, as in the temperature path (annealing schedule, see below), are left to intuition. We extent the connection to physical systems and take over further components from thermodynamics like ensemble, heat capacity, and relaxation time. Finally we refer to finite-time thermodynamics (Andresen, Salomon, Berry 1984) for a dynamical estimate of the optimal temperature path. (orig.)

  12. influence of intercritical annealing temperature on mechanical

    African Journals Online (AJOL)

    User

    Keywords: intercritical annealing, dual phase steel, mechanical properties, microstructure. 1. INTRODUCTION. Steel, is world's most “advanced” material. It is the most widely used engineering material, essentially due to the fact that it can be manufactured at very competitive cost in large quantities to very precise.

  13. Thermal annealing in neutron-irradiated tribromobenzenes

    DEFF Research Database (Denmark)

    Siekierska, K.E.; Halpern, A.; Maddock, A. G.

    1968-01-01

    The distribution of 82Br among various products in neutron-irradiated isomers of tribromobenzene has been investigated, and the effect of thermal annealing examined. Reversed-phase partition chromatography was employed for the determination of radioactive organic products, and atomic bromine...

  14. The (not so immortal strand hypothesis

    Directory of Open Access Journals (Sweden)

    Cristian Tomasetti

    2015-03-01

    Significance: Utilizing an approach that is fundamentally different from previous efforts to confirm or refute the immortal strand hypothesis, we provide evidence against non-random segregation of DNA during stem cell replication. Our results strongly suggest that parental DNA is passed randomly to stem cell daughters and provides new insight into the mechanism of DNA replication in stem cells.

  15. SAKAMATA : A tool to avoid whale strandings

    NARCIS (Netherlands)

    Benders, F.P.A.; Beerens, S.P.; Verboom, W.C.

    2002-01-01

    World-wide a concern exists about the influence of man-made noise on marine life, and particularly of high power sonar. Most concern lies with marine mammals that use acoustics for hunting, communication and/or navigation. This concern is fed by recent strandings of whales that could be related to

  16. SAKAMATA : A tool to avoid whale strandings

    NARCIS (Netherlands)

    Benders, F.P.A.; Beerens, S.P.; Verboom, W.C.

    2004-01-01

    World-wide a concern exists about the influence of man-made noise on marine life, and particularly of high power sonar. Most concern lies with marine mammals that use acoustics for hunting, communication and/or navigation. This concern is fed by recent strandings of whales that could be related to

  17. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  18. Double-Stranded Peptide Nucleic Acids

    DEFF Research Database (Denmark)

    2001-01-01

    A novel class of compounds, known as peptide nucleic acids, form double-stranded structures with one another and with ssDNA. The peptide nucleic acids generally comprise ligands such as naturally occurring DNA bases attached to a peptide backbone through a suitable linker....

  19. Scalable effective-temperature reduction for quantum annealers via nested quantum annealing correction

    Science.gov (United States)

    Vinci, Walter; Lidar, Daniel A.

    2018-02-01

    Nested quantum annealing correction (NQAC) is an error-correcting scheme for quantum annealing that allows for the encoding of a logical qubit into an arbitrarily large number of physical qubits. The encoding replaces each logical qubit by a complete graph of degree C . The nesting level C represents the distance of the error-correcting code and controls the amount of protection against thermal and control errors. Theoretical mean-field analyses and empirical data obtained with a D-Wave Two quantum annealer (supporting up to 512 qubits) showed that NQAC has the potential to achieve a scalable effective-temperature reduction, Teff˜C-η , with 0 learning applications. Since we demonstrate that NQAC achieves error correction via a reduction of the effective-temperature of the quantum annealing device, our results address the problem of the "temperature scaling law for quantum annealers," which requires the temperature of quantum annealers to be reduced as problems of larger sizes are attempted to be solved.

  20. KARAKTERISTIK ORIENTED STRAND BOARD DARI KAYU AKASIA DAN AFRIKA BERDASARKAN PENYUSUNAN ARAH STRAND

    Directory of Open Access Journals (Sweden)

    Nurhaida

    2008-04-01

    Full Text Available The research objectives arc to evaluate physical and mechanical properties of OSB based on strands orientation; and to evaluate physical and mechanical properties of OSB made from akasia wood (Acacia mangium Wild and afrika wood (Maesopsis eminii Engl. Akasia and afrika wood are used for OSB strand material with phenol formaldehyde (PF as adhesives and addition of paraffin. OSB made in this research is consist of three plies whereas are differed into eight (8 strand orientations. In the making process, hot press was carried out at 160OC and pressure 25kg.cm-2 for 15 minutes. Determination of OSB physical and mechanical properties is referred to JIS A 5908-2003. Result showed that strand orientations has no affect to OSB physical properties except for linicr swelling 24h, but it significantly influence all mechanical properties of OSB. Wood species have an effect on mechanical properties of OSB in the dry test, wet MOE lengthwise test and OSB physical properties, particularly to OSB density and water absorbing capability at 2h and 24h. All of OSB physical properties arc meet JIS A 5908-2003 standard, but not all of the mechanical properties such as dry MOE lengthwise, dry MOE and MOR widthwise. The best physical and mechanical properties is presented by OSB made from akasia wood in strand orientation F, G, Band C whereas all parameters meet JIS A 5908-2003 standard. In comparation with strand orientation B that is frequent used in industry, strand orientation F and G arc proficient to raise the modulus elasticity value (MOE and strength (MOR as much as 167.81-231.65% and 89.73-109.87%, respectively; especially in widthwise board application. Furthermore, strand orientation F and G arc more flexible as structural components

  1. Corrosion characteristics of unprotected post-tensioning strands under stress.

    Science.gov (United States)

    2014-05-01

    An investigation was conducted to determine the effect of stress condition : and environmental exposure on corrosion of post-tensioned strands during ungrouted periods. : Exposures for periods of up to 4 weeks of stressed, as-received strand placed i...

  2. Computational Bottlenecks of Quantum Adiabatic Annealing

    Science.gov (United States)

    Knysh, Sergey

    2015-03-01

    Quantum annealing in a transverse field with rate dΓ / dt inversely proportional to the system size N suppresses non-adiabatic transitions for fully connected spin glass such as the Sherrington-Kirpatrick (SK) model at the quantum critical point. This alone is not sufficient to ensure that the problem is solvable in polynomial time. I conjecture the appearance of small gaps associated with macroscopic tunneling events deep in the spin glass phase. This effect is demonstrated rigorously for the annealing of a toy model that shares a set of crtical exponents with SK model: Hopfield network with two Gaussian patterns. It presents with 0 . 15 lnN additional bottlenecks with gaps that scale as a stretched exponential exp[-c (NΓ) 3 / 4]. Further, I extend the analysis to the ρ-landscapes model (random energy model with correlations) which more faithfully represents real spin glasses.

  3. Dynamical Frustration in ANNNI Model and Annealing

    Science.gov (United States)

    Sen, Parongama; Das, Pratap K.

    Simulated annealing is usually applied to systems with frustration, like spin glasses and optimisation problems, where the energy landscape is complex with many spurious minima. There are certain other systems, however, which have very simple energy landscape picture and ground states, but still the system fails to reach its ground state during a energy-lowering dynamical process. This situation corresponds to "dynamical frustration ". We have specifically considered the case of the axial next nearest neighbour (ANNNI) chain, where such a situation is encountered. In Sect. II, we elaborate the notion of dynamic frustration with examples and in Sect. III, the dynamics in ANNNI model is discussed in detail. The results of application of the classical and quantum annealing are discussed in Sects. IV and V. Summary and some concluding comments are given in the last section.

  4. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    assembled liquid crystals and three-dimensional hydrogels of graphene oxidewith double-stranded DNA by simple mixing in an aqueous buffer media without unwinding double-strandedDNA to single-stranded DNA. The GO/dsDNA hydrogels have ...

  5. A mass stranding of the squid martialia hyadesi Rochebrune and ...

    African Journals Online (AJOL)

    1997-02-11

    Feb 11, 1997 ... All animals were immature, with females in lower stages of maturity than males. No predatory marine mammals were seen in the area during or after the stranding event. An interpretation of the stranding is presented with reference to historical reports of squid strandings worldwide. Evidence suggests some ...

  6. Simulated annealing algorithm for optimal capital growth

    Science.gov (United States)

    Luo, Yong; Zhu, Bo; Tang, Yong

    2014-08-01

    We investigate the problem of dynamic optimal capital growth of a portfolio. A general framework that one strives to maximize the expected logarithm utility of long term growth rate was developed. Exact optimization algorithms run into difficulties in this framework and this motivates the investigation of applying simulated annealing optimized algorithm to optimize the capital growth of a given portfolio. Empirical results with real financial data indicate that the approach is inspiring for capital growth portfolio.

  7. Optimization Via Open System Quantum Annealing

    Science.gov (United States)

    2016-01-07

    be solved by a quantum evolution from a strong transverse field to a spin glass Hamiltonian (also known as quantum annealing or QA). We have...reduced to Quadratic Unconstrained Binary Optimization (QUBO), which can be solved by a quantum evolution from a strong transverse field to a spin...Excellence grant for Education , Research and Engineering: The number of undergraduates funded by your agreement who graduated during this period and

  8. G-Strands on symmetric spaces

    Science.gov (United States)

    2017-01-01

    We study the G-strand equations that are extensions of the classical chiral model of particle physics in the particular setting of broken symmetries described by symmetric spaces. These equations are simple field theory models whose configuration space is a Lie group, or in this case a symmetric space. In this class of systems, we derive several models that are completely integrable on finite dimensional Lie group G, and we treat in more detail examples with symmetric space SU(2)/S1 and SO(4)/SO(3). The latter model simplifies to an apparently new integrable nine-dimensional system. We also study the G-strands on the infinite dimensional group of diffeomorphisms, which gives, together with the Sobolev norm, systems of 1+2 Camassa–Holm equations. The solutions of these equations on the complementary space related to the Witt algebra decomposition are the odd function solutions. PMID:28413343

  9. Double-stranded DNA dissociates into single strands when dragged into a poor solvent.

    Science.gov (United States)

    Cui, Shuxun; Yu, Jin; Kühner, Ferdinand; Schulten, Klaus; Gaub, Hermann E

    2007-11-28

    DNA displays a richness of biologically relevant supramolecular structures, which depend on both sequence and ambient conditions. The effect of dragging double-stranded DNA (dsDNA) from water into poor solvent on the double-stranded structure is still unclear because of condensation. Here, we employed single molecule techniques based on atomic force microscopy and molecular dynamics (MD) simulations to investigate the change in structure and mechanics of DNA during the ambient change. We found that the two strands are split apart when the dsDNA is pulled at one strand from water into a poor solvent. The findings were corroborated by MD simulations where dsDNA was dragged from water into poor solvent, revealing details of the strand separation at the water/poor solvent interface. Because the structure of DNA is of high polarity, all poor solvents show a relatively low polarity. We speculate that the principle of spontaneous unwinding/splitting of dsDNA by providing a low-polarity (in other word, hydrophobic) micro-environment is exploited as one of the catalysis mechanisms of helicases.

  10. The multiple personalities of Watson and Crick strands

    Directory of Open Access Journals (Sweden)

    Graur Dan

    2011-02-01

    Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.

  11. Method of preparing and applying single stranded DNA probes to double stranded target DNAs in situ

    Science.gov (United States)

    Gray, J.W.; Pinkel, D.

    1991-07-02

    A method is provided for producing single stranded non-self-complementary nucleic acid probes, and for treating target DNA for use therewith. The probe is constructed by treating DNA with a restriction enzyme and an exonuclease to form template/primers for a DNA polymerase. The digested strand is resynthesized in the presence of labeled nucleoside triphosphate precursor. Labeled single stranded fragments are separated from the resynthesized fragments to form the probe. Target DNA is treated with the same restriction enzyme used to construct the probe, and is treated with an exonuclease before application of the probe. The method significantly increases the efficiency and specificity of hybridization mixtures by increasing effective probe concentration by eliminating self-hybridization between both probe and target DNAs, and by reducing the amount of target DNA available for mismatched hybridizations. No Drawings

  12. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA...... and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  13. Mycobacteria exploit three genetically distinct DNA double-strand break repair pathways.

    Science.gov (United States)

    Gupta, Richa; Barkan, Daniel; Redelman-Sidi, Gil; Shuman, Stewart; Glickman, Michael S

    2011-01-01

    Bacterial pathogens rely on their DNA repair pathways to resist genomic damage inflicted by the host. DNA double-strand breaks (DSBs) are especially threatening to bacterial viability. DSB repair by homologous recombination (HR) requires nucleases that resect DSB ends and a strand exchange protein that facilitates homology search. RecBCD and RecA perform these functions in Escherichia coli and constitute the major pathway of error-free DSB repair. Mycobacteria, including the human pathogen M. tuberculosis, elaborate an additional error-prone pathway of DSB repair via non-homologous end-joining (NHEJ) catalysed by Ku and DNA ligase D (LigD). Little is known about the relative contributions of HR and NHEJ to mycobacterial chromosome repair, the factors that dictate pathway choice, or the existence of additional DSB repair pathways. Here we demonstrate that Mycobacterium smegmatis has three DSB repair pathway options: HR, NHEJ and a novel mechanism of single-strand annealing (SSA). Inactivation of NHEJ or SSA is compensated by elevated HR. We find that mycobacterial RecBCD does not participate in HR or confer resistance to ionizing radiation (IR), but is required for the RecA-independent SSA pathway. In contrast, the mycobacterial helicase-nuclease AdnAB participates in the RecA-dependent HR pathway, and is a major determinant of resistance to IR and oxidative DNA damage. These findings reveal distinctive features of mycobacterial DSB repair, most notably the dedication of the RecBCD and AdnAB helicase-nuclease machines to distinct repair pathways. © 2010 Blackwell Publishing Ltd.

  14. Interference Alignment Using Variational Mean Field Annealing

    DEFF Research Database (Denmark)

    Badiu, Mihai Alin; Guillaud, Maxime; Fleury, Bernard Henri

    2014-01-01

    We study the problem of interference alignment in the multiple-input multiple- output interference channel. Aiming at minimizing the interference leakage power relative to the receiver noise level, we use the deterministic annealing approach to solve the optimization problem. In the corresponding...... for interference alignment. We also show that the iterative leakage minimization algorithm by Gomadam et al. and the alternating minimization algorithm by Peters and Heath, Jr. are instances of our method. Finally, we assess the performance of the proposed algorithm through computer simulations....

  15. Simulated annealing for tensor network states

    International Nuclear Information System (INIS)

    Iblisdir, S

    2014-01-01

    Markov chains for probability distributions related to matrix product states and one-dimensional Hamiltonians are introduced. With appropriate ‘inverse temperature’ schedules, these chains can be combined into a simulated annealing scheme for ground states of such Hamiltonians. Numerical experiments suggest that a linear, i.e., fast, schedule is possible in non-trivial cases. A natural extension of these chains to two-dimensional settings is next presented and tested. The obtained results compare well with Euclidean evolution. The proposed Markov chains are easy to implement and are inherently sign problem free (even for fermionic degrees of freedom). (paper)

  16. Binary Sparse Phase Retrieval via Simulated Annealing

    Directory of Open Access Journals (Sweden)

    Wei Peng

    2016-01-01

    Full Text Available This paper presents the Simulated Annealing Sparse PhAse Recovery (SASPAR algorithm for reconstructing sparse binary signals from their phaseless magnitudes of the Fourier transform. The greedy strategy version is also proposed for a comparison, which is a parameter-free algorithm. Sufficient numeric simulations indicate that our method is quite effective and suggest the binary model is robust. The SASPAR algorithm seems competitive to the existing methods for its efficiency and high recovery rate even with fewer Fourier measurements.

  17. Implantation annealing in GaAs by incoherent light

    International Nuclear Information System (INIS)

    Davies, D.E.; Ryan, T.G.; Soda, K.J.; Comer, J.J.

    1983-01-01

    Implanted GaAs has been successfully activated through concentrating the output of quartz halogen lamps to anneal in times of the order of 1 sec. The resulting layers are not restricted by the reduced mobilities and thermal instabilities of laser annealed GaAs. Better activation can be obtained than with furnace annealing but this generally requires maximum temperatures >= 1050degC. (author)

  18. Benefits of Intercritical Annealing in Quenching and Partitioning Steel

    Science.gov (United States)

    Wang, X.; Liu, L.; Liu, R. D.; Huang, M. X.

    2018-03-01

    Compared to the quenching and partitioning (Q&P) steel produced by full austenization annealing, the Q&P steel produced by the intercritical annealing shows a similar ultimate tensile stress but a larger tensile ductility. This property is attributable to the higher volume fraction and the better mechanical stability of the retained austenite after the intercritical annealing. Moreover, intercritical annealing produces more ferrite and fewer martensite phases in the microstructure, making an additional contribution to a higher work hardening rate and therefore a better tensile ductility.

  19. Magnetic field annealing for improved creep resistance

    Science.gov (United States)

    Brady, Michael P.; Ludtka, Gail M.; Ludtka, Gerard M.; Muralidharan, Govindarajan; Nicholson, Don M.; Rios, Orlando; Yamamoto, Yukinori

    2015-12-22

    The method provides heat-resistant chromia- or alumina-forming Fe-, Fe(Ni), Ni(Fe), or Ni-based alloys having improved creep resistance. A precursor is provided containing preselected constituents of a chromia- or alumina-forming Fe-, Fe(Ni), Ni(Fe), or Ni-based alloy, at least one of the constituents for forming a nanoscale precipitate MaXb where M is Cr, Nb, Ti, V, Zr, or Hf, individually and in combination, and X is C, N, O, B, individually and in combination, a=1 to 23 and b=1 to 6. The precursor is annealed at a temperature of 1000-1500.degree. C. for 1-48 h in the presence of a magnetic field of at least 5 Tesla to enhance supersaturation of the M.sub.aX.sub.b constituents in the annealed precursor. This forms nanoscale M.sub.aX.sub.b precipitates for improved creep resistance when the alloy is used at service temperatures of 500-1000.degree. C. Alloys having improved creep resistance are also disclosed.

  20. Superplasticity of Annealed H13 Steel

    Directory of Open Access Journals (Sweden)

    Zhenxin Duan

    2017-07-01

    Full Text Available H13 steel is a widely used hot work die material. A new type of hot working method is imperative to develop complex and precise dies. In this paper, the heat treatment of H13 steel (AISI was carried out by annealing, the final structure is a point or spherical pearlite, and the grain size is about 30–40 μm. The tensile properties of the annealed microstructure were investigated at 650, 750, and 850 °C with the strain rates of 1 × 10−3 s−1, 5 × 10−4 s−1, and 1 × 10−4 s−1. The tensile fracture and microstructure were analyzed by SEM and HREM. The results show that the tensile samples reach superplasticity at the strain rate of 1 × 10−4 s−1 in the temperature range of 750–850 °C. When the temperature is 850 °C, the maximum elongation rate reaches 112.5%. This demonstrates the possibility of making superplastic forming molds. During the tensile process, the refined M23C6 and other high hardness carbides which are dispersed uniformly in the matrix, effectively inhibits grain growth and hinders dislocation movement, leading to the improvement of plasticity.

  1. Mean Field Analysis of Quantum Annealing Correction.

    Science.gov (United States)

    Matsuura, Shunji; Nishimori, Hidetoshi; Albash, Tameem; Lidar, Daniel A

    2016-06-03

    Quantum annealing correction (QAC) is a method that combines encoding with energy penalties and decoding to suppress and correct errors that degrade the performance of quantum annealers in solving optimization problems. While QAC has been experimentally demonstrated to successfully error correct a range of optimization problems, a clear understanding of its operating mechanism has been lacking. Here we bridge this gap using tools from quantum statistical mechanics. We study analytically tractable models using a mean-field analysis, specifically the p-body ferromagnetic infinite-range transverse-field Ising model as well as the quantum Hopfield model. We demonstrate that for p=2, where the phase transition is of second order, QAC pushes the transition to increasingly larger transverse field strengths. For p≥3, where the phase transition is of first order, QAC softens the closing of the gap for small energy penalty values and prevents its closure for sufficiently large energy penalty values. Thus QAC provides protection from excitations that occur near the quantum critical point. We find similar results for the Hopfield model, thus demonstrating that our conclusions hold in the presence of disorder.

  2. Superplasticity of Annealed H13 Steel.

    Science.gov (United States)

    Duan, Zhenxin; Pei, Wen; Gong, Xuebo; Chen, Hua

    2017-07-28

    H13 steel is a widely used hot work die material. A new type of hot working method is imperative to develop complex and precise dies. In this paper, the heat treatment of H13 steel (AISI) was carried out by annealing, the final structure is a point or spherical pearlite, and the grain size is about 30-40 μm. The tensile properties of the annealed microstructure were investigated at 650, 750, and 850 °C with the strain rates of 1 × 10 -3 s -1 , 5 × 10 -4 s -1 , and 1 × 10 -4 s -1 . The tensile fracture and microstructure were analyzed by SEM and HREM. The results show that the tensile samples reach superplasticity at the strain rate of 1 × 10 -4 s -1 in the temperature range of 750-850 °C. When the temperature is 850 °C, the maximum elongation rate reaches 112.5%. This demonstrates the possibility of making superplastic forming molds. During the tensile process, the refined M 23 C₆ and other high hardness carbides which are dispersed uniformly in the matrix, effectively inhibits grain growth and hinders dislocation movement, leading to the improvement of plasticity.

  3. A coherent quantum annealer with Rydberg atoms

    Science.gov (United States)

    Glaetzle, A. W.; van Bijnen, R. M. W.; Zoller, P.; Lechner, W.

    2017-06-01

    There is a significant ongoing effort in realizing quantum annealing with different physical platforms. The challenge is to achieve a fully programmable quantum device featuring coherent adiabatic quantum dynamics. Here we show that combining the well-developed quantum simulation toolbox for Rydberg atoms with the recently proposed Lechner-Hauke-Zoller (LHZ) architecture allows one to build a prototype for a coherent adiabatic quantum computer with all-to-all Ising interactions and, therefore, a platform for quantum annealing. In LHZ an infinite-range spin-glass is mapped onto the low energy subspace of a spin-1/2 lattice gauge model with quasi-local four-body parity constraints. This spin model can be emulated in a natural way with Rubidium and Caesium atoms in a bipartite optical lattice involving laser-dressed Rydberg-Rydberg interactions, which are several orders of magnitude larger than the relevant decoherence rates. This makes the exploration of coherent quantum enhanced optimization protocols accessible with state-of-the-art atomic physics experiments.

  4. MEDICAL STAFF SCHEDULING USING SIMULATED ANNEALING

    Directory of Open Access Journals (Sweden)

    Ladislav Rosocha

    2015-07-01

    Full Text Available Purpose: The efficiency of medical staff is a fundamental feature of healthcare facilities quality. Therefore the better implementation of their preferences into the scheduling problem might not only rise the work-life balance of doctors and nurses, but also may result into better patient care. This paper focuses on optimization of medical staff preferences considering the scheduling problem.Methodology/Approach: We propose a medical staff scheduling algorithm based on simulated annealing, a well-known method from statistical thermodynamics. We define hard constraints, which are linked to legal and working regulations, and minimize the violations of soft constraints, which are related to the quality of work, psychic, and work-life balance of staff.Findings: On a sample of 60 physicians and nurses from gynecology department we generated monthly schedules and optimized their preferences in terms of soft constraints. Our results indicate that the final value of objective function optimized by proposed algorithm is more than 18-times better in violations of soft constraints than initially generated random schedule that satisfied hard constraints.Research Limitation/implication: Even though the global optimality of final outcome is not guaranteed, desirable solutionwas obtained in reasonable time. Originality/Value of paper: We show that designed algorithm is able to successfully generate schedules regarding hard and soft constraints. Moreover, presented method is significantly faster than standard schedule generation and is able to effectively reschedule due to the local neighborhood search characteristics of simulated annealing.

  5. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  6. Stranded cost recovery in electricity market reforms in the US

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd, D.; Karimov, R.; Tishler, A.

    2003-01-01

    An important element of an electricity market reform is stranded cost recovery. This paper explains the cause of stranded costs, describes four recovery mechanisms, evaluates these mechanisms using the criteria of recovery certainty, economic efficiency and equity, reviews the financial performance of 12 utilities in the US in connection to stranded cost recovery, and shows why the mechanism used in California has contributed to the reform failure in that state. (Author)

  7. Molecular Process Producing Oncogene Fusion in Lung Cancer Cells by Illegitimate Repair of DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Yoshitaka Seki

    2015-09-01

    Full Text Available Constitutive activation of oncogenes by fusion to partner genes, caused by chromosome translocation and inversion, is a critical genetic event driving lung carcinogenesis. Fusions of the tyrosine kinase genes ALK (anaplastic lymphoma kinase, ROS1 (c-ros oncogene 1, or RET (rearranged during transfection occur in 1%–5% of lung adenocarcinomas (LADCs and their products constitute therapeutic targets for kinase inhibitory drugs. Interestingly, ALK, RET, and ROS1 fusions occur preferentially in LADCs of never- and light-smokers, suggesting that the molecular mechanisms that cause these rearrangements are smoking-independent. In this study, using previously reported next generation LADC genome sequencing data of the breakpoint junction structures of chromosome rearrangements that cause oncogenic fusions in human cancer cells, we employed the structures of breakpoint junctions of ALK, RET, and ROS1 fusions in 41 LADC cases as “traces” to deduce the molecular processes of chromosome rearrangements caused by DNA double-strand breaks (DSBs and illegitimate joining. We found that gene fusion was produced by illegitimate repair of DSBs at unspecified sites in genomic regions of a few kb through DNA synthesis-dependent or -independent end-joining pathways, according to DSB type. This information will assist in the understanding of how oncogene fusions are generated and which etiological factors trigger them.

  8. Investigation of annealing-treatment on structural and optical ...

    Indian Academy of Sciences (India)

    Administrator

    This conforms to the results already reported by Moustaghfir et al (2003). A higher annealing tempera- ture enhances the formation of larger and more closely packed crystals. The increase of the refractive index with increasing annealing temperature can be partly attributed to improvement in film quality with the reduction in.

  9. Effect of annealing temperature on the structural–microstructural and ...

    Indian Academy of Sciences (India)

    In order to get good quality reproducible films of Tl : HTSC system, we have studied the different annealing conditions to finally achieve the optimized annealing condition. In the present investigation, Tl–Ca–Ba–Cu–O superconducting films have been prepared on YSZ (100) and MgO (100) single crystal substrates via ...

  10. Effect of isochronal annealing on phase transformation studies of ...

    Indian Academy of Sciences (India)

    Abstract. The effect of isochronal annealing on the phase transformation in iron oxide nanoparticles is reported in this work. Iron oxide nanoparticles were successfully synthesized using an ash supported technique followed by annealing for 2 h at various temperatures between 300 and 700◦C. It was observed using X-ray ...

  11. Effect of annealing treatment on optical properties and ...

    Indian Academy of Sciences (India)

    2018-03-28

    Mar 28, 2018 ... C. UV–visible spectrophotometer showed that the annealing treatment of the first WO3 layer enhanced the transparency of films in the visible region. The innovations of the present study have been based on the annealing of the films and finding an optimum thickness for the Ag film at 12–14 nm.

  12. Effect of heat moisture treatment and annealing on physicochemical ...

    African Journals Online (AJOL)

    Red sorghum starch was physically modified by annealing and heat moisture treatment. The swelling power and solubility increased with increasing temperature range (60-90°), while annealing and heatmoisture treatment decreased swelling power and solubility of starch. Solubility and swelling were pH dependent with ...

  13. Simulated annealing approach for solving economic load dispatch ...

    African Journals Online (AJOL)

    user

    Abstract. This paper presents Simulated Annealing (SA) algorithm for optimization inspired by the process of annealing in ... Various classical optimization techniques were used to solve the ELD problem, for example: lambda iteration approach, ...... Research of fuzzy self-adaptive immune algorithm and its application.

  14. Effect of isochronal annealing on phase transformation studies of ...

    Indian Academy of Sciences (India)

    The effect of isochronal annealing on the phase transformation in iron oxide nanoparticles is reported in this work. Iron oxide nanoparticles were successfully synthesized using an ash supported technique followed by annealing for 2 h at various temperatures between 300 and 700° C. It was observed using X-ray diffraction ...

  15. Effect of annealing process of iron powder on magnetic properties ...

    Indian Academy of Sciences (India)

    Administrator

    The amplitude permeability and magnetic loss of the cores reached the maximum and minimum values, respectively. The magnetic loss of the cores was separated into hysteresis loss and eddy current loss by Stoppels Method which were decreased by the annealing process. Keywords. Reduced iron powders; annealing ...

  16. A note on simulated annealing to computer laboratory scheduling ...

    African Journals Online (AJOL)

    Simulated Annealing algorithm is used in solving real life problem of Computer Laboratory scheduling in order to maximize the use of scarce and insufficient resources. KEY WORDS: Simulated Annealing (SA), Computer Laboratory Scheduling, Statistical Thermodynamics, Energy Function, and Heuristic etc. Global Jnl of ...

  17. Response of neutron-irradiated RPV steels to thermal annealing

    Energy Technology Data Exchange (ETDEWEB)

    Iskander, S.K.; Sokolov, M.A.; Nanstad, R.K.

    1997-03-01

    One of the options to mitigate the effects of irradiation on reactor pressure vessels (RPVs) is to thermally anneal them to restore the fracture toughness properties that have been degraded by neutron irradiation. This paper summarizes experimental results of work performed at the Oak Ridge National Laboratory (ORNL) to study the annealing response of several irradiated RPV steels.

  18. Improvements in or relating to laser annealed electronic devices

    International Nuclear Information System (INIS)

    Barraclough, K.G.; Cullis, A.G.; Webber, H.C.

    1981-01-01

    A method of producing laser annealed electronic devices is described. The technique involves irradiating semiconductor material such as silicon or germanium to produce a neutron transmuted semiconductor material and laser annealing a selected region or regions in a slice of the transmuted material to a sub-micron depth. (U.K.)

  19. Effect of annealing on magnetic properties and silicide formation at ...

    Indian Academy of Sciences (India)

    coercivity decreases and remanence increases. The values of remanence of pristine Co/Si and annealed at 300°C are. 0⋅80 and 0⋅98, respectively. 3.3 AFM measurement. Morphological changes of silicide surface during high temperature annealing have been investigated by AFM in terms of the RMS surface roughness.

  20. Stored energy and annealing behavior of heavily deformed aluminium

    DEFF Research Database (Denmark)

    Kamikawa, Naoya; Huang, Xiaoxu; Kondo, Yuka

    2012-01-01

    are quantified such as boundary spacing, misorientation angle and dislocation density for 99.99% aluminium deformed by accumulative roll-bonding to a strain of 4.8. Two different annealing processes have been applied; (i) one-step annealing for 0.5 h at 100-400°C and (ii) two-step annealing for 6 h at 175°C......It has been demonstrated in previous work that a two-step annealing treatment, including a low-temperature, long-time annealing and a subsequent high-temperature annealing, is a promising route to control the microstructure of a heavily deformed metal. In the present study, structural parameters...... followed by 0.5 h annealing at 200-600°C, where the former treatment leads to discontinuous recrystallization and the latter to uniform structural coarsening. This behavior has been analyzed in terms of the relative change during annealing of energy stored as elastic energy in the dislocation structure...

  1. Angular filter refractometry analysis using simulated annealing.

    Science.gov (United States)

    Angland, P; Haberberger, D; Ivancic, S T; Froula, D H

    2017-10-01

    Angular filter refractometry (AFR) is a novel technique used to characterize the density profiles of laser-produced, long-scale-length plasmas [Haberberger et al., Phys. Plasmas 21, 056304 (2014)]. A new method of analysis for AFR images was developed using an annealing algorithm to iteratively converge upon a solution. A synthetic AFR image is constructed by a user-defined density profile described by eight parameters, and the algorithm systematically alters the parameters until the comparison is optimized. The optimization and statistical uncertainty calculation is based on the minimization of the χ 2 test statistic. The algorithm was successfully applied to experimental data of plasma expanding from a flat, laser-irradiated target, resulting in an average uncertainty in the density profile of 5%-20% in the region of interest.

  2. Coupled Quantum Fluctuations and Quantum Annealing

    Science.gov (United States)

    Hormozi, Layla; Kerman, Jamie

    We study the relative effectiveness of coupled quantum fluctuations, compared to single spin fluctuations, in the performance of quantum annealing. We focus on problem Hamiltonians resembling the the Sherrington-Kirkpatrick model of Ising spin glass and compare the effectiveness of different types of fluctuations by numerically calculating the relative success probabilities and residual energies in fully-connected spin systems. We find that for a small class of instances coupled fluctuations can provide improvement over single spin fluctuations and analyze the properties of the corresponding class. Disclaimer: This research was funded by ODNI, IARPA via MIT Lincoln Laboratory under Air Force Contract No. FA8721-05-C-0002. The views and conclusions contained herein are those of the authors and should not be interpreted as necessarily representing the official policies or endorsements, either expressed or implied, of ODNI, IARPA, or the US Government.

  3. Inferring hierarchical clustering structures by deterministic annealing

    International Nuclear Information System (INIS)

    Hofmann, T.; Buhmann, J.M.

    1996-01-01

    The unsupervised detection of hierarchical structures is a major topic in unsupervised learning and one of the key questions in data analysis and representation. We propose a novel algorithm for the problem of learning decision trees for data clustering and related problems. In contrast to many other methods based on successive tree growing and pruning, we propose an objective function for tree evaluation and we derive a non-greedy technique for tree growing. Applying the principles of maximum entropy and minimum cross entropy, a deterministic annealing algorithm is derived in a meanfield approximation. This technique allows us to canonically superimpose tree structures and to fit parameters to averaged or open-quote fuzzified close-quote trees

  4. Annealing effects on cathodoluminescence of zircon

    Science.gov (United States)

    Tsuchiya, Y.; Nishido, H.; Noumi, Y.

    2011-12-01

    U-Pb zircon dating (e. g., SHRIMP) is an important tool to interpret a history of the minerals at a micrometer-scale, where cathodoluminescence (CL) imaging allows us to recognize internal zones and domains with different chemical compositions and structural disorder at high spatial resolution. The CL of zircon is attributed by various types of emission centers, which are extrinsic ones such as REE impurities and intrinsic ones such as structural defects. Metamictization resulted from radiation damage to the lattice by alpha particles from the decay of U and Th mostly causes an effect on the CL features of zircon as a defect center. However, slightly radiation-damaged zircon, which is almost nondetectable by XRD, has not been characterized using CL method. In this study, annealing effects on CL of zircon has been investigated to clarify a recovery process of the damaged lattice at low radiation dose. A single crystal of zircon from Malawi was selected for CL measurements. It contains HfO2: 2.30 w.t %, U: 241 ppm and Th: 177 ppm. Two plate samples perpendicular to c and a axes were prepared for annealing experiments during 12 hours from room temperature to 1400 degree C. Color CL images were captured using a cold-cathode microscope (Luminoscope: Nuclide ELM-3R). CL spectral measurements were conducted using an SEM (JEOL: JSM-5410) combined with a grating monochromator (Oxford: Mono CL2) to measure CL spectra ranging from 300 to 800 nm in 1 nm steps with a temperature controlled stage. The dispersed CL was collected by a photoncounting method using a photomultiplier tube (Hamamatsu: R2228) and converted to digital data. All CL spectra were corrected for the total instrumental response. Spectral analysis reveals an anisotropy of the CL emission bands related to intrinsic defect center in blue region, radiation-induced defect center from 500 to 700 nm, and trivalent Dy impurity center at 480 and 580 nm, but their relative intensities are almost constant. CL on the

  5. Efficiency of quantum vs. classical annealing in nonconvex learning problems.

    Science.gov (United States)

    Baldassi, Carlo; Zecchina, Riccardo

    2018-02-13

    Quantum annealers aim at solving nonconvex optimization problems by exploiting cooperative tunneling effects to escape local minima. The underlying idea consists of designing a classical energy function whose ground states are the sought optimal solutions of the original optimization problem and add a controllable quantum transverse field to generate tunneling processes. A key challenge is to identify classes of nonconvex optimization problems for which quantum annealing remains efficient while thermal annealing fails. We show that this happens for a wide class of problems which are central to machine learning. Their energy landscapes are dominated by local minima that cause exponential slowdown of classical thermal annealers while simulated quantum annealing converges efficiently to rare dense regions of optimal solutions. Copyright © 2018 the Author(s). Published by PNAS.

  6. Getting Frustrated: Modelling Emotion Contagion in Stranded Passengers

    NARCIS (Netherlands)

    van der Wal, C. Natalie; Couwenberg, Maik; Bosse, T.

    2017-01-01

    Train passengers can get stranded due to a variety of events, such as a delay, technical malfunctioning or a natural disaster. Stranded passengers can get frustrated, which could escalate in misbehaviours. Examples are verbal and physical violence or dangerous behaviours such as opening emergency

  7. Cetacean strandings along the coast of Izmir Bay, Turkey

    NARCIS (Netherlands)

    Guclusoy, H.; Veryeri, N.; Cirik, S.

    2004-01-01

    The present paper provides information on the stranding of cetaceans in Izmir Bay, Aegean Sea, between 1992 and 2004. The data were collected opportunistically during sightings and stranding data collection for Monk Seals. A total of 12 cetaceans, namely Bottle-nosed Dolphin, Tursiops truncatus

  8. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.

    1987-01-01

    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  9. Magnetization and loss measurements on Nb3Sn and NbTi strands for ITER and LHC

    International Nuclear Information System (INIS)

    Foitl, M.

    2001-05-01

    this work, magnetization and loss measurements on 20 different strand samples which were taken from different billets supplied by two manufacturers of NbTi strands are reported, which with the use of an Integrating Coil Magnetometer as well as micro Hall sensors magnetization loops of single strands were studied. Variations in the strand magnetization could be either correlated with systematical irregularities in the strand characteristics (e.g. filament diameter) or with variations of the strand's critical current density jC. The second part of this work is related to the annealing process of superconducting magnets manufactured from internal tin Nb3Sn strands to be used for the magnetic confinement of fusion plasma. After the successful generation of plasma burning pulses of several seconds duration (Joint European Torus, JET), magnetic fusion energy research has reached a point where a tokamak burning plasma facility, in which the thermonuclear heating balances transport and radiation losses for periods of 500 s or longer, can be seriously contemplated as a next step. Achieving this goal would be a major step forward, both in science and technology, towards the ultimate goal of magnetic fusion generation of electrical power. Therefore the main objectives of the International Thermonuclear Experimental Reactor (ITER) will be the demonstration of the scientific and technological feasibility of fusion energy on a scale close to that of an eventual thermonuclear power reactor. The magnitude of the magnetic field (∼ 11.8 T) needed to confine stable a plasma of sufficient pressure to generate ∼ 0.5 GW of fusion power is comparable to the limiting magnetic fields that a toroidal superconducting magnet system can produce. In order to achieve the best magnet performance possible, the toroidal field (TF) coils made of superconducting Nb3Sn cable-in-conduit type conductors have to be optimized with respect to the maximum transport current and transient field losses

  10. The Bipolar Filaments Formed by Herpes Simplex Virus Type 1 SSB/Recombination Protein (ICP8) Suggest a Mechanism for DNA Annealing

    Energy Technology Data Exchange (ETDEWEB)

    Makhov, A.M.; Simon, M.; Sen, A.; Yu, X.; Griffith, J. D.; Egelman, E. H.

    2009-02-20

    Herpes simplex virus type 1 encodes a multifunctional protein, ICP8, which serves both as a single-strand binding protein and as a recombinase, catalyzing reactions involved in replication and recombination of the viral genome. In the presence of divalent ions and at low temperature, previous electron microscopic studies showed that ICP8 will form long left-handed helical filaments. Here, electron microscopic image reconstruction reveals that the filaments are bipolar, with an asymmetric unit containing two subunits of ICP8 that constitute a symmetrical dimer. This organization of the filament has been confirmed using scanning transmission electron microscopy. The pitch of the filaments is {approx} 250 {angstrom}, with {approx} 6.2 dimers per turn. Docking of a crystal structure of ICP8 into the reconstructed filament shows that the C-terminal domain of ICP8, attached to the body of the subunit by a flexible linker containing {approx} 10 residues, is packed into a pocket in the body of a neighboring subunit in the crystal in a similar manner as in the filament. However, the interactions between the large N-terminal domains are quite different in the filament from that observed in the crystal. A previously proposed model for ICP8 binding single-stranded DNA (ssDNA), based upon the crystal structure, leads to a model for a continuous strand of ssDNA near the filament axis. The bipolar nature of the ICP8 filaments means that a second strand of ssDNA would be running through this filament in the opposite orientation, and this provides a potential mechanism for how ICP8 anneals complementary ssDNA into double-stranded DNA, where each strand runs in opposite directions.

  11. The changes of ADI structure during high temperature annealing

    Directory of Open Access Journals (Sweden)

    A. Krzyńska

    2010-01-01

    Full Text Available The results of structure investigations of ADI during it was annealing at elevated temperature are presented. Ductile iron austempered at temperature 325oC was then isothermally annealed 360 minutes at temperature 400, 450, 500 and 550oC. The structure investigations showed that annealing at these temperatures caused substantial structure changes and thus essential hardness decrease, which is most useful property of ADI from point of view its practical application. Degradation advance of the structure depends mainly on annealing temperature, less on the time of the heat treatment. It was concluded that high temperature annealing caused precipitation of Fe3C type carbides, which morphology and distribution depend on temperature. In case of 400oC annealing the carbides precipitates inside bainitic ferrite lath in specific crystallographic planes and partly at the grain boundaries. The annealing at the temperature 550oC caused disappearing of characteristic for ADI needle or lath – like morphology, which is replaced with equiaxed grains. In this case Fe3C carbides take the form very fine precipitates with spheroidal geometry.

  12. Grain coarsening mechanism of Cu thin films by rapid annealing

    International Nuclear Information System (INIS)

    Sasajima, Yasushi; Kageyama, Junpei; Khoo, Khyoupin; Onuki, Jin

    2010-01-01

    Cu thin films have been produced by an electroplating method using nominal 9N anode and nominal 6N CuSO 4 .5H 2 O electrolyte. Film samples were heat-treated by two procedures: conventional isothermal annealing in hydrogen atmosphere (abbreviated as H 2 annealing) and rapid thermal annealing with an infrared lamp (abbreviated as RTA). After heat treatment, the average grain diameters and the grain orientation distributions were examined by electron backscattering pattern analysis. The RTA samples (400 o C for 5 min) have a larger average grain diameter, more uniform grain distribution and higher ratio of (111) orientation than H 2 annealed samples (400 o C for 30 min). This means that RTA can produce films with coarser and more uniformly distributed grains than H 2 annealing within a short time, i.e. only a few minutes. To clarify the grain coarsening mechanism, grain growth by RTA was simulated using the phase field method. The simulated grain diameter reaches its maximum at a heating rate which is the same order as that in the actual RTA experiment. The maximum grain diameter is larger than that obtained by H 2 annealing with the same annealing time at the isothermal stage as in RTA. The distribution of the misorientation was analyzed which led to a proposed grain growth model for the RTA method.

  13. Synthesis dependent characteristics of Sr1−xMnxTiO3 (x=0.03, 0.05, 0.07 and 0.09)

    International Nuclear Information System (INIS)

    Preethi Meher, K.R.S.; Bogicevic, Christine; Janolin, Pierre-Eymeric; Varma, K.B.R.

    2012-01-01

    Sr 1−x Mn x TiO 3 (where x=0.03, 0.05, 0.07 and 0.09) was synthesized via different routes that include solid-state, oxalate precipitation and freeze drying. In oxalate precipitation technique, compositions corresponding to 3 and 5 mol% doping of Mn were monophasic whereas the higher compositions revealed the presence of the secondary phases such as MnO, Mn 3 O 4 etc., as confirmed by high resolution X-ray diffraction (XRD) studies. The decomposition behavior of the precursors prepared using oxalate precipitation method corresponding to the above mentioned compositions was studied. Nanopowders of compositions pertaining to 5 to 9 mol% of Mn doping were obtained using freeze–drying technique. The average crystallite size of these nanopowders was found to be in the 35 to 65 nm range. The microstructural studies carried out on the sintered ceramics, fabricated using powders synthesized by different routes established the fine grained nature ( 1−x Mn x TiO 3 (x=0.03 and 0.05) obtained by oxalate precipitation technique along with that of the nanopowders for x=0.05, 0.07 and 0.09 obtained by freeze drying method, microstructural characterization and synthesis dependent dielectric behavior. Highlights: ► Monophasic samples obtained for compositions Sr 1−x Mn x TiO 3 with x=0.03 and 0.05. ► Nanopowders of Sr 1−x Mn x TiO 3 with x=0.05, 0.07 and 0.09 were synthesized by freeze–drying method. ► Phase purity of samples synthesized using freeze drying method were studied at different sintering temperatures. ► Analysis of Raman spectra for samples prepared by both oxalate precipitation and freeze–drying. ► Microstructure dependent dielectric characteristics have been illustrated.

  14. Gamma-ray induced double-strand breaks in DNA resulting from randomly-inflicted single-strand breaks: temporal local denaturation, a new radiation phenomenon?

    NARCIS (Netherlands)

    Schans, G.P. van der

    1978-01-01

    The induction of single- and double-strand breaks in DNA by γ-rays has been measured. The maximum number of nucleotide paris (a) between two independently induced single-strand breaks in opposite strands of the DNA which cannot prevent the occurrence of a double-strand break was found to amount to

  15. Acute Pyelonephritis with Perinephric Stranding on CT

    Directory of Open Access Journals (Sweden)

    Ronald Goubert

    2018-01-01

    Full Text Available History of present illness: A 54-year old female presented to the emergency department with complaints of fevers, dysuria, urinary frequency, and diffuse abdominal pain. Her temperature was 103°F, but the remainder of her vital signs were normal. Upon physical examination, the patient had tenderness to palpation in the left upper and left lower abdomen and left costovertebral angle tenderness. Due to the location of pain (diverticulitis is in the differential for left-sided abdominal pain in this age group and patient’s reported history of nephrolithiasis, a computed tomography (CT scan of the abdomen and pelvis with intravenous (IV contrast was ordered because the physician felt this could best work up both of these possible conditions. Significant findings: A CT abdomen and pelvis with IV contrast showed neither nephrolithiasis nor diverticulitis, and instead showed heterogeneous enhancement of the left kidney with mild edematous enlargement and striated left nephrogram. Significant perinephric stranding (red arrows was also noted and was consistent with severe acute pyelonephritis. Discussion: Acute pyelonephritis (APN is a bacterial infection of the renal parenchyma which can present with a spectrum of symptoms including flank pain, high-grade fever, vomiting, and urinary tract symptoms.1,2 The diagnosis of APN can be made based on these clinical features with associated laboratory findings of bacteriuria, pyuria, positive urine cultures, and leukocytosis.1,2,7 Early diagnosis and treatment of APN is essential to prevent complications such as renal abscess or infarct, which could lead to renal failure, sepsis, and shock.3 CT has a sensitivity and specificity of 86.8% and 87.5%, respectively, for diagnosing APN. Common findings include striated nephrograms or perinephric fat stranding.2 However, imaging is not required for diagnosis and is typically reserved for patients who are immunocompromised, have severe symptoms, or show no clinical

  16. Annealed Scaling for a Charged Polymer

    International Nuclear Information System (INIS)

    Caravenna, F.; Hollander, F. den; Pétrélis, N.; Poisat, J.

    2016-01-01

    This paper studies an undirected polymer chain living on the one-dimensional integer lattice and carrying i.i.d. random charges. Each self-intersection of the polymer chain contributes to the interaction Hamiltonian an energy that is equal to the product of the charges of the two monomers that meet. The joint probability distribution for the polymer chain and the charges is given by the Gibbs distribution associated with the interaction Hamiltonian. The focus is on the annealed free energy per monomer in the limit as the length of the polymer chain tends to infinity. We derive a spectral representation for the free energy and use this to prove that there is a critical curve in the parameter plane of charge bias versus inverse temperature separating a ballistic phase from a subballistic phase. We show that the phase transition is first order. We prove large deviation principles for the laws of the empirical speed and the empirical charge, and derive a spectral representation for the associated rate functions. Interestingly, in both phases both rate functions exhibit flat pieces, which correspond to an inhomogeneous strategy for the polymer to realise a large deviation. The large deviation principles in turn lead to laws of large numbers and central limit theorems. We identify the scaling behaviour of the critical curve for small and for large charge bias. In addition, we identify the scaling behaviour of the free energy for small charge bias and small inverse temperature. Both are linked to an associated Sturm-Liouville eigenvalue problem. A key tool in our analysis is the Ray-Knight formula for the local times of the one-dimensional simple random walk. This formula is exploited to derive a closed form expression for the generating function of the annealed partition function, and for several related quantities. This expression in turn serves as the starting point for the derivation of the spectral representation for the free energy, and for the scaling theorems

  17. The phase diagram of annealed Ge(111)/Ga

    DEFF Research Database (Denmark)

    Molinàs-Mata, P.; Böhringer, M.; Artacho, E.

    1995-01-01

    A study of the annealed phases of Ge(111)/Ga for coverages above 0.05 ML is presented. The surfaces are investigated by low-energy electron diffraction, scanning tunneling microscopy, and partly by photoemission and surface X-ray diffraction using synchrotron radiation. For Ga coverages beyond 0.......05 ML and up to about 2 ML and annealing temperatures higher than 500 degrees C four different phases appear. They all can be characterized as being discommensurate. Surprisingly, no commensurate superstructure appears on annealed Ge(111)/Ga....

  18. Structural study of conventional and bulk metallic glasses during annealing

    International Nuclear Information System (INIS)

    Pineda, E.; Hidalgo, I.; Bruna, P.; Pradell, T.; Labrador, A.; Crespo, D.

    2009-01-01

    Metallic glasses with conventional glass-forming ability (Al-Fe-Nd, Fe-Zr-B, Fe-B-Nb compositions) and bulk metallic glasses (Ca-Mg-Cu compositions) were studied by synchrotron X-ray diffraction during annealing throughout glass transition and crystallization temperatures. The analysis of the first diffraction peak position during the annealing process allowed us to follow the free volume change during relaxation and glass transition. The structure factor and the radial distribution function of the glasses were obtained from the X-ray measurements. The structural changes occurred during annealing are analyzed and discussed.

  19. Anisotropic annealing of fission fragments in synthetic quartz

    CERN Document Server

    Sawamura, T; Narita, M

    1999-01-01

    A study on the thermal annealing behavior of fission fragments in synthetic quartz crystals was performed for application of synthetic quartz to track detectors under high temperature circumstances: x-, y-, and z-cut quartz plates were exposed to fission fragments from sup 2 sup 5 sup 2 Cf and were annealed up to 750 deg. C. It was found that track retention depended on the crystallographic structure: the annealing temperature, where the number of etched tracks was sharply reduced, was 550 deg. C for the x- and y-cut plates and 750 deg. C for z-cut plates. Track sizes decrease and disperse with reductions in the track retention.

  20. Radiation damage and annealing in plutonium tetrafluoride

    Energy Technology Data Exchange (ETDEWEB)

    McCoy, Kaylyn; Casella, Amanda; Sinkov, Sergey; Sweet, Lucas; McNamara, Bruce; Delegard, Calvin; Jevremovic, Tatjana

    2017-12-01

    Plutonium tetrafluoride that was separated prior to 1966 at the Hanford Site in Washington State was analyzed at the Pacific Northwest National Laboratory (PNNL) in 2015 and 2016. The plutonium tetrafluoride, as received, was an off-normal color and considering the age of the plutonium, there were questions about the condition of the material. These questions had to be answered in order to determine the suitability of the material for future use or long-term storage. Therefore, Thermogravimetric/Differential Thermal Analysis and X-ray Diffraction evaluations were conducted to determine the plutonium’s crystal structure, oxide content, and moisture content; these analyses reported that the plutonium was predominately amorphous and tetrafluoride, with an oxide content near ten percent. Freshly fluorinated plutonium tetrafluoride is known to be monoclinic. During the initial Thermogravimetric/Differential Thermal analyses, it was discovered that an exothermic event occurred within the material near 414°C. X-ray Diffraction analyses were conducted on the annealed tetrafluoride. The X-ray Diffraction analyses indicated that some degree of recrystallization occurred in conjunction with the 414°C event. The following commentary describes the series of Thermogravimetric/Differential Thermal and X-ray Diffraction analyses that were conducted as part of this investigation at PNNL, in collaboration with the University of Utah Nuclear Engineering Program.

  1. Current redistribution in cables made of insulated, soldered, or oxidized strands

    International Nuclear Information System (INIS)

    Turck, B.

    1979-07-01

    Current redistributions are compared in cables made of insulated strands, soldered, or oxidized strands and insulated strands with periodic joints. After discussing the different current redistributions in the cases of a rapidly changing current and a dc current, several particular situations are investigated: what happens if a strand is broken, or if a local normal zone appears that does not affect all the strands equally, the detection of this normal zone, and the influence of short circuits between strands

  2. SARNA-Predict: accuracy improvement of RNA secondary structure prediction using permutation-based simulated annealing.

    Science.gov (United States)

    Tsang, Herbert H; Wiese, Kay C

    2010-01-01

    Ribonucleic acid (RNA), a single-stranded linear molecule, is essential to all biological systems. Different regions of the same RNA strand will fold together via base pair interactions to make intricate secondary and tertiary structures that guide crucial homeostatic processes in living organisms. Since the structure of RNA molecules is the key to their function, algorithms for the prediction of RNA structure are of great value. In this article, we demonstrate the usefulness of SARNA-Predict, an RNA secondary structure prediction algorithm based on Simulated Annealing (SA). A performance evaluation of SARNA-Predict in terms of prediction accuracy is made via comparison with eight state-of-the-art RNA prediction algorithms: mfold, Pseudoknot (pknotsRE), NUPACK, pknotsRG-mfe, Sfold, HotKnots, ILM, and STAR. These algorithms are from three different classes: heuristic, dynamic programming, and statistical sampling techniques. An evaluation for the performance of SARNA-Predict in terms of prediction accuracy was verified with native structures. Experiments on 33 individual known structures from eleven RNA classes (tRNA, viral RNA, antigenomic HDV, telomerase RNA, tmRNA, rRNA, RNaseP, 5S rRNA, Group I intron 23S rRNA, Group I intron 16S rRNA, and 16S rRNA) were performed. The results presented in this paper demonstrate that SARNA-Predict can out-perform other state-of-the-art algorithms in terms of prediction accuracy. Furthermore, there is substantial improvement of prediction accuracy by incorporating a more sophisticated thermodynamic model (efn2).

  3. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  4. Template role of double-stranded RNA in tombusvirus replication.

    Science.gov (United States)

    Kovalev, Nikolay; Pogany, Judit; Nagy, Peter D

    2014-05-01

    Replication of plus-strand RNA [(+)RNA] viruses of plants is a relatively simple process that involves complementary minus-strand RNA [(-)RNA] synthesis and subsequent (+)RNA synthesis. However, the actual replicative form of the (-)RNA template in the case of plant (+)RNA viruses is not yet established unambiguously. In this paper, using a cell-free replication assay supporting a full cycle of viral replication, we show that replication of Tomato bushy stunt virus (TBSV) leads to the formation of double-stranded RNA (dsRNA). Using RNase digestion, DNAzyme, and RNA mobility shift assays, we demonstrate the absence of naked (-)RNA templates during replication. Time course experiments showed the rapid appearance of dsRNA earlier than the bulk production of new (+)RNAs, suggesting an active role for dsRNA in replication. Radioactive nucleotide chase experiments showed that the mechanism of TBSV replication involves the use of dsRNA templates in strand displacement reactions, where the newly synthesized plus strand replaces the original (+)RNA in the dsRNA. We propose that the use of dsRNA as a template for (+)RNA synthesis by the viral replicase is facilitated by recruited host DEAD box helicases and the viral p33 RNA chaperone protein. Altogether, this replication strategy allows TBSV to separate minus- and plus-strand syntheses in time and regulate asymmetrical RNA replication that leads to abundant (+)RNA progeny. Positive-stranded RNA viruses of plants use their RNAs as the templates for replication. First, the minus strand is synthesized by the viral replicase complex (VRC), which then serves as a template for new plus-strand synthesis. To characterize the nature of the (-)RNA in the membrane-bound viral replicase, we performed complete RNA replication of Tomato bushy stunt virus (TBSV) in yeast cell-free extracts and in plant extracts. The experiments demonstrated that the TBSV (-)RNA is present as a double-stranded RNA that serves as the template for TBSV

  5. Solvent vapor annealing of an insoluble molecular semiconductor

    KAUST Repository

    Amassian, Aram

    2010-01-01

    Solvent vapor annealing has been proposed as a low-cost, highly versatile, and room-temperature alternative to thermal annealing of organic semiconductors and devices. In this article, we investigate the solvent vapor annealing process of a model insoluble molecular semiconductor thin film - pentacene on SiO 2 exposed to acetone vapor - using a combination of optical reflectance and two-dimensional grazing incidence X-ray diffraction measurements performed in situ, during processing. These measurements provide valuable and new insight into the solvent vapor annealing process; they demonstrate that solvent molecules interact mainly with the surface of the film to induce a solid-solid transition without noticeable swelling, dissolving or melting of the molecular material. © 2010 The Royal Society of Chemistry.

  6. Structural changes during annealing of GaInAsN

    International Nuclear Information System (INIS)

    Kurtz, Sarah; Webb, J.; Gedvilas, L.; Friedman, D.; Geisz, J.; Olson, J.; King, R.; Joslin, D.; Karam, N.

    2001-01-01

    The alloy GaInAsN has great potential as a lower-band-gap material lattice matched to GaAs, but there is little understanding of what causes its poor optoelectronic properties and why these improve with annealing. This study provides information about the structural changes that occur when GaInAsN is annealed. The Fourier transform infrared spectra exhibit two primary features: a triplet at ∼470 cm-1 (Ga--N stretch) and two or three bands at ∼3100 cm-1 (N--H stretch). The change in the Ga--N stretch absorption can be explained if the nitrogen environment is converted from NGa 4 to NInGa 3 after annealing. The N--H stretch is also changed after annealing, implying a second, and unrelated, structural change

  7. Performance of two different quantum annealing correction codes

    Science.gov (United States)

    Mishra, Anurag; Albash, Tameem; Lidar, Daniel A.

    2016-02-01

    Quantum annealing is a promising approach for solving optimization problems, but like all other quantum information processing methods, it requires error correction to ensure scalability. In this work, we experimentally compare two quantum annealing correction (QAC) codes in the setting of antiferromagnetic chains, using two different quantum annealing processors. The lower-temperature processor gives rise to higher success probabilities. The two codes differ in a number of interesting and important ways, but both require four physical qubits per encoded qubit. We find significant performance differences, which we explain in terms of the effective energy boost provided by the respective redundantly encoded logical operators of the two codes. The code with the higher energy boost results in improved performance, at the expense of a lower-degree encoded graph. Therefore, we find that there exists an important trade-off between encoded connectivity and performance for quantum annealing correction codes.

  8. Stochastic search in structural optimization - Genetic algorithms and simulated annealing

    Science.gov (United States)

    Hajela, Prabhat

    1993-01-01

    An account is given of illustrative applications of genetic algorithms and simulated annealing methods in structural optimization. The advantages of such stochastic search methods over traditional mathematical programming strategies are emphasized; it is noted that these methods offer a significantly higher probability of locating the global optimum in a multimodal design space. Both genetic-search and simulated annealing can be effectively used in problems with a mix of continuous, discrete, and integer design variables.

  9. Simulated annealing image reconstruction for positron emission tomography

    International Nuclear Information System (INIS)

    Sundermann, E.; Lemahieu, I.; Desmedt, P.

    1994-01-01

    In Positron Emission Tomography (PET) images have to be reconstructed from moisy projection data. The noise on the PET data can be modeled by a Poison distribution. In this paper, we present the results of using the simulated annealing technique to reconstruct PET images. Various parameter settings of the simulated annealing algorithm are discussed and optimized. The reconstructed images are of good quality and high contrast, in comparison to other reconstruction techniques. (authors)

  10. Far-infrared spectroscopy of thermally annealed tungsten silicide films

    International Nuclear Information System (INIS)

    Amiotti, M.; Borghesi, A.; Guizzetti, G.; Nava, F.; Santoro, G.

    1991-01-01

    The far-infrared transmittance spectrum of tungsten silicide has been observed for the first time. WSi 2 polycrystalline films were prepared by coevaporation and chemical-vapour deposition on silicon wafers, and subsequently thermally annealed at different temperatures. The observed structures are interpreted, on the basis of the symmetry properties of the crystal, such as infrared-active vibrational modes. Moreover, the marked lineshape dependence on annealing temperature enables this technique to analyse the formation of the solid silicide phases

  11. Population annealing: Theory and application in spin glasses

    OpenAIRE

    Wang, Wenlong; Machta, Jonathan; Katzgraber, Helmut G.

    2015-01-01

    Population annealing is an efficient sequential Monte Carlo algorithm for simulating equilibrium states of systems with rough free energy landscapes. The theory of population annealing is presented, and systematic and statistical errors are discussed. The behavior of the algorithm is studied in the context of large-scale simulations of the three-dimensional Ising spin glass and the performance of the algorithm is compared to parallel tempering. It is found that the two algorithms are similar ...

  12. Two-dimensional strandness-dependent electrophoresis: a method to characterize single-stranded DNA, double-stranded DNA, and RNA-DNA hybrids in complex samples.

    Science.gov (United States)

    Gunnarsson, Gudmundur H; Gudmundsson, Bjarki; Thormar, Hans G; Alfredsson, Arni; Jonsson, Jon J

    2006-03-01

    We describe two-dimensional strandness-dependent electrophoresis (2D-SDE) for quantification and length distribution analysis of single-stranded (ss) DNA fragments, double-stranded (ds) DNA fragments, RNA-DNA hybrids, and nicked DNA fragments in complex samples. In the first dimension nucleic acid molecules are separated based on strandness and length in the presence of 7 M urea. After the first-dimension electrophoresis all nucleic acid fragments are heat denatured in the gel. During the second-dimension electrophoresis all nucleic acid fragments are single-stranded and migrate according to length. 2D-SDE takes about 90 min and requires only basic skills and equipment. We show that 2D-SDE has many applications in analyzing complex nucleic acid samples including (1) estimation of renaturation efficiency and kinetics, (2) monitoring cDNA synthesis, (3) detection of nicked DNA fragments, and (4) estimation of quality and in vitro damage of nucleic acid samples. Results from 2D-SDE should be useful to validate techniques such as complex polymerase chain reaction, subtractive hybridization, cDNA synthesis, cDNA normalization, and microarray analysis. 2D-SDE could also be used, e.g., to characterize biological nucleic acid samples. Information obtained with 2D-SDE cannot be readily obtained with other methods. 2D-SDE can be used for preparative isolation of ssDNA fragments, dsDNA fragments, and RNA-DNA hybrids.

  13. Conventional treatment planning optimization using simulated annealing

    International Nuclear Information System (INIS)

    Morrill, S.M.; Langer, M.; Lane, R.G.

    1995-01-01

    Purpose: Simulated annealing (SA) allows for the implementation of realistic biological and clinical cost functions into treatment plan optimization. However, a drawback to the clinical implementation of SA optimization is that large numbers of beams appear in the final solution, some with insignificant weights, preventing the delivery of these optimized plans using conventional (limited to a few coplanar beams) radiation therapy. A preliminary study suggested two promising algorithms for restricting the number of beam weights. The purpose of this investigation was to compare these two algorithms using our current SA algorithm with the aim of producing a algorithm to allow clinically useful radiation therapy treatment planning optimization. Method: Our current SA algorithm, Variable Stepsize Generalized Simulated Annealing (VSGSA) was modified with two algorithms to restrict the number of beam weights in the final solution. The first algorithm selected combinations of a fixed number of beams from the complete solution space at each iterative step of the optimization process. The second reduced the allowed number of beams by a factor of two at periodic steps during the optimization process until only the specified number of beams remained. Results of optimization of beam weights and angles using these algorithms were compared using a standard cadre of abdominal cases. The solution space was defined as a set of 36 custom-shaped open and wedged-filtered fields at 10 deg. increments with a target constant target volume margin of 1.2 cm. For each case a clinically-accepted cost function, minimum tumor dose was maximized subject to a set of normal tissue binary dose-volume constraints. For this study, the optimized plan was restricted to four (4) fields suitable for delivery with conventional therapy equipment. Results: The table gives the mean value of the minimum target dose obtained for each algorithm averaged over 5 different runs and the comparable manual treatment

  14. Thermalization, Freeze-out, and Noise: Deciphering Experimental Quantum Annealers

    Science.gov (United States)

    Marshall, Jeffrey; Rieffel, Eleanor G.; Hen, Itay

    2017-12-01

    By contrasting the performance of two quantum annealers operating at different temperatures, we address recent questions related to the role of temperature in these devices and their function as "Boltzmann samplers." Using a method to reliably calculate the degeneracies of the energy levels of large-scale spin-glass instances, we are able to estimate the instance-dependent effective temperature from the output of annealing runs. Our results corroborate the "freeze-out" picture which posits two regimes, one in which the final state corresponds to a Boltzmann distribution of the final Hamiltonian with a well-defined "effective temperature" determined at a freeze-out point late in the annealing schedule, and another regime in which such a distribution is not necessarily expected. We find that the output distributions of the annealers do not, in general, correspond to a classical Boltzmann distribution for the final Hamiltonian. We also find that the effective temperatures at different programing cycles fluctuate greatly, with the effect worsening with problem size. We discuss the implications of our results for the design of future quantum annealers to act as more-effective Boltzmann samplers and for the programing of such annealers.

  15. Optimization using quantum mechanics: quantum annealing through adiabatic evolution

    International Nuclear Information System (INIS)

    Santoro, Giuseppe E; Tosatti, Erio

    2006-01-01

    We review here some recent work in the field of quantum annealing, alias adiabatic quantum computation. The idea of quantum annealing is to perform optimization by a quantum adiabatic evolution which tracks the ground state of a suitable time-dependent Hamiltonian, where 'ℎ' is slowly switched off. We illustrate several applications of quantum annealing strategies, starting from textbook toy-models-double-well potentials and other one-dimensional examples, with and without disorder. These examples display in a clear way the crucial differences between classical and quantum annealing. We then discuss applications of quantum annealing to challenging hard optimization problems, such as the random Ising model, the travelling salesman problem and Boolean satisfiability problems. The techniques used to implement quantum annealing are either deterministic Schroedinger's evolutions, for the toy models, or path-integral Monte Carlo and Green's function Monte Carlo approaches, for the hard optimization problems. The crucial role played by disorder and the associated non-trivial Landau-Zener tunnelling phenomena is discussed and emphasized. (topical review)

  16. Formation of oxygen related donors in step-annealed CZ–silicon

    Indian Academy of Sciences (India)

    The effect of step-annealing necessitated by the difficulties being faced in the long duration annealing treatments to be given to CZ–silicon has been studied. One pre-anneal of 10 h followed by annealing of 10 h causes a decrease in the absorption coefficient for carbon (c). Oxygen and carbon both accelerate thermal ...

  17. Rapid hardening induced by electric pulse annealing in nanostructured pure aluminum

    DEFF Research Database (Denmark)

    Zeng, Wei; Shen, Yao; Zhang, Ning

    2012-01-01

    Nanostructured pure aluminum was fabricated by heavy cold-rolling and then subjected to recovery annealing either by applying electric pulse annealing or by traditional air furnace annealing. Both annealing treatments resulted in an increase in yield strength due to the occurrence of a “dislocation...

  18. Genetic and environmental influence on DNA strand break repair

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander

    2013-01-01

    factors are likely to influence DNA repair capacity. In order to gain more insight into the genetic and environmental contribution to the molecular basis of DNA repair, we have performed a human twin study, where we focused on the consequences of some of the most abundant types of DNA damage (single-strand...... breaks), and some of the most hazardous lesions (DNA double-strand breaks). DNA damage signaling response (Gamma-H2AX signaling), relative amount of endogenous damage, and DNA-strand break repair capacities were studied in peripheral blood mononuclear cells from 198 twins (94 monozygotic and 104...... dizygotic). We did not detect genetic effects on the DNA-strand break variables in our study. Environ. Mol. Mutagen., 2013. © 2013 Wiley Periodicals, Inc....

  19. Electrical Interconnection Of Superconducting Strands By Electrolytic CU Deposition.

    CERN Document Server

    Scheuerlein, C; Heck, S; Ams, A

    2011-01-01

    The electrical interconnection of Nb3Sn/Cu strands is a key issue for the construction of superconducting devices such as Nb3Sn based insertion devices for third generation light sources. As an alternative connection method for brittle superconducting strands like Nb3Sn/Cu, test joints have been produced by electrolytic deposition of Cu. The resistance of first test joints produced by electrolytic Cu deposition with a strand overlap length of 3 cm at 4.2 K is about 10 n$\\omega$, similar to the resistance measured for joints produced by soft soldering with the same strand overlap length. Interconnection by electrolytic Cu deposition can be done before or after the reaction heat treatment, and it produces a mechanically strong connection. Simulations have been performed with Comsol multiphysics in order to estimate the influence of deposit imperfections on the joint resistance, and to compare the resistance of joints made with different techniques

  20. Corrosion performance of prestressing strands in contact with dissimilar grouts.

    Science.gov (United States)

    2013-01-01

    To improve the corrosion protection provided to prestressing strands, anti-bleed grouts are used to fill voids in post-tensioning : ducts that result from bleeding and shrinkage of older Portland Cement grouts. Environmental differences caused by exp...

  1. Site-selective probing of cTAR destabilization highlights the necessary plasticity of the HIV-1 nucleocapsid protein to chaperone the first strand transfer

    Science.gov (United States)

    Godet, Julien; Kenfack, Cyril; Przybilla, Frédéric; Richert, Ludovic; Duportail, Guy; Mély, Yves

    2013-01-01

    The HIV-1 nucleocapsid protein (NCp7) is a nucleic acid chaperone required during reverse transcription. During the first strand transfer, NCp7 is thought to destabilize cTAR, the (−)DNA copy of the TAR RNA hairpin, and subsequently direct the TAR/cTAR annealing through the zipping of their destabilized stem ends. To further characterize the destabilizing activity of NCp7, we locally probe the structure and dynamics of cTAR by steady-state and time resolved fluorescence spectroscopy. NC(11–55), a truncated NCp7 version corresponding to its zinc-finger domain, was found to bind all over the sequence and to preferentially destabilize the penultimate double-stranded segment in the lower part of the cTAR stem. This destabilization is achieved through zinc-finger–dependent binding of NC to the G10 and G50 residues. Sequence comparison further revealed that C•A mismatches close to the two G residues were critical for fine tuning the stability of the lower part of the cTAR stem and conferring to G10 and G50 the appropriate mobility and accessibility for specific recognition by NC. Our data also highlight the necessary plasticity of NCp7 to adapt to the sequence and structure variability of cTAR to chaperone its annealing with TAR through a specific pathway. PMID:23511968

  2. The N-terminal strand modulates immunoglobulin light chain fibrillogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Pozo-Yauner, Luis del, E-mail: ldelpozo@inmegen.gob.mx [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); Wall, Jonathan S. [Departments of Radiology and Medicine, The University of Tennessee Medical Center, 1924 Alcoa Highway, Knoxville, TN (United States); González Andrade, Martín [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); Sánchez-López, Rosana [Instituto de Biotecnología, Universidad Nacional Autónoma de México, Av. Universidad 2001, Col. Chamilpa Cuernavaca, Morelos C.P. 62210 (Mexico); Rodríguez-Ambriz, Sandra L. [Centro de Desarrollo de Productos Bióticos, Instituto Politécnico Nacional, Calle CEPROBI No. 8, Col. San Isidro, Yautepec, Morelos C.P. 62731 (Mexico); Pérez Carreón, Julio I. [Instituto Nacional de Medicina Genómica, Periférico Sur No. 4809, Col. Arenal Tepepan, Delegación Tlalpan, México, D.F. C.P. 14610 (Mexico); and others

    2014-01-10

    Highlights: •We evaluated the impact of mutations in the N-terminal strand of 6aJL2 protein. •Mutations destabilized the protein in a position-dependent manner. •Destabilizing mutations accelerated the fibrillogenesis by shortening the lag time. •The effect on the kinetic of fibril elongation by seeding was of different nature. •The N-terminal strand is buried in the fibrillar state of 6aJL2 protein. -- Abstract: It has been suggested that the N-terminal strand of the light chain variable domain (V{sub L}) protects the molecule from aggregation by hindering spurious intermolecular contacts. We evaluated the impact of mutations in the N-terminal strand on the thermodynamic stability and kinetic of fibrillogenesis of the V{sub L} protein 6aJL2. Mutations in this strand destabilized the protein in a position-dependent manner, accelerating the fibrillogenesis by shortening the lag time; an effect that correlated with the extent of destabilization. In contrast, the effect on the kinetics of fibril elongation, as assessed in seeding experiments was of different nature, as it was not directly dependant on the degree of destabilization. This finding suggests different factors drive the nucleation-dependent and elongation phases of light chain fibrillogenesis. Finally, taking advantage of the dependence of the Trp fluorescence upon environment, four single Trp substitutions were made in the N-terminal strand, and changes in solvent exposure during aggregation were evaluated by acrylamide-quenching. The results suggest that the N-terminal strand is buried in the fibrillar state of 6aJL2 protein. This finding suggest a possible explanation for the modulating effect exerted by the mutations in this strand on the aggregation behavior of 6aJL2 protein.

  3. The risk of stranded assets for utilities in Canada

    International Nuclear Information System (INIS)

    Schroeder, W.

    1998-01-01

    The problems of dealing with stranded assets in Canada and the United States were discussed. Compared to the United States, the risk associated with stranded assets for utilities in Canada was considered to be relatively low because of the following factors: (1) low variable cost, (2) isolation, (3) lack of transmission interconnection capacity, (4) lack of tight synchronization in North America, (5) the likelihood of an increase in natural gas prices, (6) the absence of jurisdictional disputes such as FERC versus the states, (7) social considerations, (8) the learning curve, (9) politics, (10) weak balance sheets, (11) relatively low electricity prices, (12) the weak Canadian dollar, and (13) the possibility of refinancing at lower interest rates. Ontario Hydro, New Brunswick and Nova Scotia Power are the three Canadian utilities that may have stranded costs. For Ontario Hydro and New Brunswick Power the stranded costs would be related to nuclear generator problems, whereas for Nova Scotia Power, the stranded costs would be related to the thermal generating base, the threat from Sable Island Gas and the changing tax structure of the utility. Some other reasons why stranded assets could be created in Canada would include low variable costs and high fixed costs, over capacity of at least 30 per cent in generation, limited domestic energy growth, competitive threat from gas, reliability and safety of nuclear plants, and technology change. Five factors in terms of which stranded assets can be expressed are: (1) variable cost definition, (2) total cost definition, (3) operating profit definition, (4) wide geographic definition, and (5) free market definition. In calculating stranded assets, the number of years over which the assets are recovered and the discount rate are considered to be key factors. 26 tabs

  4. Mismatch repair balances leading and lagging strand DNA replication fidelity.

    Directory of Open Access Journals (Sweden)

    Scott A Lujan

    Full Text Available The two DNA strands of the nuclear genome are replicated asymmetrically using three DNA polymerases, α, δ, and ε. Current evidence suggests that DNA polymerase ε (Pol ε is the primary leading strand replicase, whereas Pols α and δ primarily perform lagging strand replication. The fact that these polymerases differ in fidelity and error specificity is interesting in light of the fact that the stability of the nuclear genome depends in part on the ability of mismatch repair (MMR to correct different mismatches generated in different contexts during replication. Here we provide the first comparison, to our knowledge, of the efficiency of MMR of leading and lagging strand replication errors. We first use the strand-biased ribonucleotide incorporation propensity of a Pol ε mutator variant to confirm that Pol ε is the primary leading strand replicase in Saccharomyces cerevisiae. We then use polymerase-specific error signatures to show that MMR efficiency in vivo strongly depends on the polymerase, the mismatch composition, and the location of the mismatch. An extreme case of variation by location is a T-T mismatch that is refractory to MMR. This mismatch is flanked by an AT-rich triplet repeat sequence that, when interrupted, restores MMR to > 95% efficiency. Thus this natural DNA sequence suppresses MMR, placing a nearby base pair at high risk of mutation due to leading strand replication infidelity. We find that, overall, MMR most efficiently corrects the most potentially deleterious errors (indels and then the most common substitution mismatches. In combination with earlier studies, the results suggest that significant differences exist in the generation and repair of Pol α, δ, and ε replication errors, but in a generally complementary manner that results in high-fidelity replication of both DNA strands of the yeast nuclear genome.

  5. Withdrawal Strength of Dowels in Plywood and Oriented Strand Board

    OpenAIRE

    ERDİL, Yusuf Z.; ECKELMAN, Carl A.

    2001-01-01

    Plywood and oriented strand board (OSB) are being used increasingly in the construction of upholstered furniture frames. Yet there is little information available concerning the holding strength of various fasteners, and, in particular, dowels in these materials. A study was conducted accordingly, to obtain basic information about the holding strength of dowels in both plywood and oriented strand board. Results of the tests were incorporated into predictive expressions that allow designers to...

  6. False killer whale Pseudorca crassidens mass stranding at Long ...

    African Journals Online (AJOL)

    A mass stranding of false killer whales Pseudorca crassidens at Long Beach near the village of Kommetjie (34°8.18′ S, 18°9.77′ E) on the Cape Peninsula, South Africa, in May 2009 is described. The estimated size of stranded group was 55 animals, which is close to the median size of P. crassidens groups that have ...

  7. Hearing Loss in Stranded Odontocete Dolphins and Whales

    Science.gov (United States)

    Mann, David; Hill-Cook, Mandy; Manire, Charles; Greenhow, Danielle; Montie, Eric; Powell, Jessica; Wells, Randall; Bauer, Gordon; Cunningham-Smith, Petra; Lingenfelser, Robert; DiGiovanni, Robert; Stone, Abigale; Brodsky, Micah; Stevens, Robert; Kieffer, George; Hoetjes, Paul

    2010-01-01

    The causes of dolphin and whale stranding can often be difficult to determine. Because toothed whales rely on echolocation for orientation and feeding, hearing deficits could lead to stranding. We report on the results of auditory evoked potential measurements from eight species of odontocete cetaceans that were found stranded or severely entangled in fishing gear during the period 2004 through 2009. Approximately 57% of the bottlenose dolphins and 36% of the rough-toothed dolphins had significant hearing deficits with a reduction in sensitivity equivalent to severe (70–90 dB) or profound (>90 dB) hearing loss in humans. The only stranded short-finned pilot whale examined had profound hearing loss. No impairments were detected in seven Risso's dolphins from three different stranding events, two pygmy killer whales, one Atlantic spotted dolphin, one spinner dolphin, or a juvenile Gervais' beaked whale. Hearing impairment could play a significant role in some cetacean stranding events, and the hearing of all cetaceans in rehabilitation should be tested. PMID:21072206

  8. Hearing loss in stranded odontocete dolphins and whales.

    Directory of Open Access Journals (Sweden)

    David Mann

    Full Text Available The causes of dolphin and whale stranding can often be difficult to determine. Because toothed whales rely on echolocation for orientation and feeding, hearing deficits could lead to stranding. We report on the results of auditory evoked potential measurements from eight species of odontocete cetaceans that were found stranded or severely entangled in fishing gear during the period 2004 through 2009. Approximately 57% of the bottlenose dolphins and 36% of the rough-toothed dolphins had significant hearing deficits with a reduction in sensitivity equivalent to severe (70-90 dB or profound (>90 dB hearing loss in humans. The only stranded short-finned pilot whale examined had profound hearing loss. No impairments were detected in seven Risso's dolphins from three different stranding events, two pygmy killer whales, one Atlantic spotted dolphin, one spinner dolphin, or a juvenile Gervais' beaked whale. Hearing impairment could play a significant role in some cetacean stranding events, and the hearing of all cetaceans in rehabilitation should be tested.

  9. T-ARMS PCR genotyping of SNP rs445709131 using thermostable strand displacement polymerase.

    Science.gov (United States)

    Alyethodi, Rafeeque R; Singh, Umesh; Kumar, Sushil; Alex, Rani; Deb, Rajib; Sengar, Gyanendra S; Raja, T V; Prakash, B

    2018-02-15

    In a recent publication, we reported the successful use of tetra primer-amplification refractory mutation system based polymerase chain reaction (T-ARMS-PCR) for genotyping of rs445709131-SNP responsible for the bovine leukocyte adhesion deficiency (BLAD) in cattle. The SNP is characterized by higher GC content of the surrounding region, hence, the previous protocol utilized dimethyl sulfoxide as PCR enhancer. Here, the reaction cocktail was modified with the use of thermostable strand displacement polymerase (SD polymerase) instead of commonly used Taq DNA Polymerase. The amplification efficiency, reaction sensitivity, specificity, and need of PCR enhancer in reactions containing SD polymerase and Taq polymerase were compared. T-ARMS-PCR assay is influenced by multiple factors for the correct genotyping necessitating extensive optimization at the initial stages. The described modification enabled generation of all amplicons by 25 cycles whereas the assay with Taq polymerase needed a minimum of 35 cycles. The modified assay amplified all amplicons at a wider range of annealing temperature (50-60 °C), without the addition of dimethyl sulfoxide. The replacement of Taq polymerase with SD polymerase may be beneficial in the T-ARMS assay for development of user-friendly, faster assay which is less affected by the reaction and cyclic conditions.

  10. Cu-Ti Formation in Nb-Ti/Cu Superconducting Strand Monitored by in situ Techniques

    CERN Document Server

    Pong, I; Pong, Ian; Gerardin, Alexandre; Scheuerlein, Christian; Bottura, Luca

    2010-01-01

    In order to investigate the high temperature exposure effect on Nb-Ti/Cu superconducting strands, as might be encountered in joining by soldering and in cabling annealing, X-ray diffraction and resistometry measurements were performed in situ during heat treatment, and complemented by conventional metallography, mechanical tests and superconducting properties measurements. Changes of the Nb-Ti nanostructure at temperatures above 300 degrees C are manifested in the degradation of critical current in an applied external magnetic field, although degradation at self field was insignificant up to 400 degrees C for several minutes. Above 500 degrees C, the formation of various Cu-Ti intermetallic compounds, due to Ti diffusion from Nb-Ti into Cu, is detected by in situ XRD albeit not resolvable by SEM-EDS. There is a ductile to brittle transition near 600 degrees C, and liquid formation is observed below 900 degrees C. The formation of Cu-Ti causes a delayed reduction of the residual resistivity ratio (RRR) and adv...

  11. A quantitative model of the major pathways for radiation-induced DNA double-strand break repair

    International Nuclear Information System (INIS)

    Belov, O.V.; Krasavin, E.A.; Lyashko, M.S.; Batmunkh, M.; Sweilam, N.H.

    2014-01-01

    We have developed a model approach to simulate the major pathways of DNA double-strand break (DSB) repair in mammalian and human cells. The proposed model shows a possible mechanistic explanation of the basic regularities of DSB processing through the nonhomologous end-joining (NHEJ), homologous recombination (HR), and single-strand annealing (SSA). It reconstructs the time-courses of radiation-induced foci specific to particular repair processes including the major intermediate stages. The model is validated for ionizing radiations of a wide range of linear energy transfer (0.2-236 keV/μm) including a relatively broad spectrum of heavy ions. The appropriate set of reaction rate constants was suggested to satisfy the kinetics of DSB rejoining for the considered types of exposure. The simultaneous assessment of three repair pathways allows one to describe their possible biological relations in response to radiation. With the help of the proposed approach, we reproduce several experimental data sets on γ-H2AX foci remaining in different types of cells including those defective in NHEJ, HR, or SSA functions.

  12. Note: Improving long-term stability of hot-wire anemometer sensors by means of annealing.

    Science.gov (United States)

    Lundström, H

    2015-08-01

    Annealing procedures for hot-wire sensors of platinum and platinum-plated tungsten have been investigated experimentally. It was discovered that the two investigated sensor metals behave quite differently during the annealing process, but for both types annealing may improve long-term stability considerably. Measured drift of sensors both without and with prior annealing is presented. Suggestions for suitable annealing temperatures and times are given.

  13. Red Tide Strands South African Rock Lobsters

    Science.gov (United States)

    2002-01-01

    Although some red tides form a healthy part of phytoplankton production, recurrent harmful or toxic blooms also occur, with results depending upon the type of plankton and on atmospheric and oceanic conditions. At Elands Bay in South Africa's Western Cape province, about 1000 tons of rock lobsters beached themselves during February 2002, when the decay of dense blooms of phytoplankton caused a rapid reduction in the oxygen concentration of nearshore waters. The lobsters (or crayfish, as they are known locally) moved toward the breaking surf in search of oxygen, but were stranded by the retreating tide. The Multi-angle Imaging SpectroRadiometer's nadir camera acquired these red, green, blue composites on February 2 and 18, 2002, during Terra orbits 11315 and 11548. The colors have been accentuated to highlight the bloom, and land and water have been enhanced separately. The two views show the shoreward migration of the algal bloom. Each image represents an area of about 205 kilometers x 330 kilometers. Elands Bay is situated near the mouth of the Doring River, about 75 kilometers northeast of the jutting Cape Columbine. The term 'red tide' is used to refer to a number of different types of phytoplankton blooms of various hues. The wine color of certain parts of this bloom are consistent with the ciliate species Mesodinium rubrum, which has been associated with recurring harmful algal blooms along the Western Cape coast. Under these conditions, the lobsters are not poisoned. During the recent event, government and military staff transported as many of the living lobsters as possible to areas that were less affected by the red tide. At the same time, people came from across South Africa to gather the undersized creatures for food. The effects of the losses on the maritime economy are expected to be felt over the next few years. MISR was built and is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Office of Earth Science, Washington, DC. The Terra

  14. Liquid nitrogen enhancement of partially annealed fission tracks in glass

    International Nuclear Information System (INIS)

    Pilione, L.J.; Gold, D.P.

    1976-01-01

    It is known that the number density of fission tracks in solids is reduced if the sample is heated before chemical etching, and the effect of annealing must be allowed for before an age can be assigned to the sample. The extent of annealing can be determined by measuring the reduction of track parameters (diameter and/or length) and comparison with unannealed tracks. Correct ages can be obtained by careful calibration studies of track density reduction against track diameter or length reduction at different annealing temperatures and times. For crystallised minerals, however, the resulting correction techniques are not generally valid. In the experimental work described glass samples were partially annealed and then immersed in liquid N 2 for various periods, and it was shown that the properties of the glass and the track parameters could be altered so as to observe tracks that would normally be erased by annealing. The results of track density measurements against liquid N 2 immersion times are shown graphically. A gain of about 40% was achieved after 760 hours immersion time. The size of the tracks was not noticeably affected by the immersion. It was thought that thermal shock might be the cause of the track enhancement, but it was found that repeated immersion for about 2 hours did not lead to an increase in track density. Other studies suggest that the mechanism that erases the tracks through annealing may be partially reversed when the temperature of the sample is significantly lowered for a sufficient length of time. Further work is under way to find whether or not the process of enhancement is a reversal of the annealing process. Similar enhancement effects using liquid N 2 have been observed for d-particle tracks in polycarbonate detectors. (U.K.)

  15. Deficiency of double-strand DNA break repair does not impair Mycobacterium tuberculosis virulence in multiple animal models of infection.

    Science.gov (United States)

    Heaton, Brook E; Barkan, Daniel; Bongiorno, Paola; Karakousis, Petros C; Glickman, Michael S

    2014-08-01

    Mycobacterium tuberculosis persistence within its human host requires mechanisms to resist the effector molecules of host immunity, which exert their bactericidal effects through damaging pathogen proteins, membranes, and DNA. Substantial evidence indicates that bacterial pathogens, including M. tuberculosis, require DNA repair systems to repair the DNA damage inflicted by the host during infection, but the role of double-strand DNA break (DSB) repair systems is unclear. Double-strand DNA breaks are the most cytotoxic form of DNA damage and must be repaired for chromosome replication to proceed. M. tuberculosis elaborates three genetically distinct DSB repair systems: homologous recombination (HR), nonhomologous end joining (NHEJ), and single-strand annealing (SSA). NHEJ, which repairs DSBs in quiescent cells, may be particularly relevant to M. tuberculosis latency. However, very little information is available about the phenotype of DSB repair-deficient M. tuberculosis in animal models of infection. Here we tested M. tuberculosis strains lacking NHEJ (a Δku ΔligD strain), HR (a ΔrecA strain), or both (a ΔrecA Δku strain) in C57BL/6J mice, C3HeB/FeJ mice, guinea pigs, and a mouse hollow-fiber model of infection. We found no difference in bacterial load, histopathology, or host mortality between wild-type and DSB repair mutant strains in any model of infection. These results suggest that the animal models tested do not inflict DSBs on the mycobacterial chromosome, that other repair pathways can compensate for the loss of NHEJ and HR, or that DSB repair is not required for M. tuberculosis pathogenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. The importance of becoming double-stranded: Innate immunity and the kinetic model of HIV-1 central plus strand synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Poeschla, Eric, E-mail: poeschla.eric@mayo.edu

    2013-06-20

    Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins, and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import.

  17. The importance of becoming double-stranded: Innate immunity and the kinetic model of HIV-1 central plus strand synthesis

    International Nuclear Information System (INIS)

    Poeschla, Eric

    2013-01-01

    Central initiation of plus strand synthesis is a conserved feature of lentiviruses and certain other retroelements. This complication of the standard reverse transcription mechanism produces a transient “central DNA flap” in the viral cDNA, which has been proposed to mediate its subsequent nuclear import. This model has assumed that the important feature is the flapped DNA structure itself rather than the process that produces it. Recently, an alternative kinetic model was proposed. It posits that central plus strand synthesis functions to accelerate conversion to the double-stranded state, thereby helping HIV-1 to evade single-strand DNA-targeting antiviral restrictions such as APOBEC3 proteins, and perhaps to avoid innate immune sensor mechanisms. The model is consistent with evidence that lentiviruses must often synthesize their cDNAs when dNTP concentrations are limiting and with data linking reverse transcription and uncoating. There may be additional kinetic advantages for the artificial genomes of lentiviral gene therapy vectors. - Highlights: • Two main functional models for HIV central plus strand synthesis have been proposed. • In one, a transient central DNA flap in the viral cDNA mediates HIV-1 nuclear import. • In the other, multiple kinetic consequences are emphasized. • One is defense against APOBEC3G, which deaminates single-stranded DNA. • Future questions pertain to antiviral restriction, uncoating and nuclear import

  18. High pressure annealing of Europium implanted GaN

    KAUST Repository

    Lorenz, K.

    2012-02-09

    GaN epilayers were implanted with Eu to fluences of 1×10^13 Eu/cm2 and 1×10^15 Eu/cm2. Post-implant thermal annealing was performed in ultra-high nitrogen pressures at temperatures up to 1450 ºC. For the lower fluence effective structural recovery of the crystal was observed for annealing at 1000 ºC while optical activation could be further improved at higher annealing temperatures. The higher fluence samples also reveal good optical activation; however, some residual implantation damage remains even for annealing at 1450 ºC which leads to a reduced incorporation of Eu on substitutional sites, a broadening of the Eu luminescence lines and to a strongly reduced fraction of optically active Eu ions. Possibilities for further optimization of implantation and annealing conditions are discussed.© (2012) COPYRIGHT Society of Photo-Optical Instrumentation Engineers (SPIE). Downloading of the abstract is permitted for personal use only.

  19. Experimental quantum annealing: case study involving the graph isomorphism problem

    Science.gov (United States)

    Zick, Kenneth M.; Shehab, Omar; French, Matthew

    2015-01-01

    Quantum annealing is a proposed combinatorial optimization technique meant to exploit quantum mechanical effects such as tunneling and entanglement. Real-world quantum annealing-based solvers require a combination of annealing and classical pre- and post-processing; at this early stage, little is known about how to partition and optimize the processing. This article presents an experimental case study of quantum annealing and some of the factors involved in real-world solvers, using a 504-qubit D-Wave Two machine and the graph isomorphism problem. To illustrate the role of classical pre-processing, a compact Hamiltonian is presented that enables a reduced Ising model for each problem instance. On random N-vertex graphs, the median number of variables is reduced from N2 to fewer than N log2 N and solvable graph sizes increase from N = 5 to N = 13. Additionally, error correction via classical post-processing majority voting is evaluated. While the solution times are not competitive with classical approaches to graph isomorphism, the enhanced solver ultimately classified correctly every problem that was mapped to the processor and demonstrated clear advantages over the baseline approach. The results shed some light on the nature of real-world quantum annealing and the associated hybrid classical-quantum solvers. PMID:26053973

  20. Laser annealing heals radiation damage in avalanche photodiodes

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Jin Gyu [University of Waterloo, Institute for Quantum Computing, Waterloo, ON (Canada); University of Waterloo, Department of Electrical and Computer Engineering, Waterloo, ON (Canada); Anisimova, Elena; Higgins, Brendon L.; Bourgoin, Jean-Philippe [University of Waterloo, Institute for Quantum Computing, Waterloo, ON (Canada); University of Waterloo, Department of Physics and Astronomy, Waterloo, ON (Canada); Jennewein, Thomas [University of Waterloo, Institute for Quantum Computing, Waterloo, ON (Canada); University of Waterloo, Department of Physics and Astronomy, Waterloo, ON (Canada); Canadian Institute for Advanced Research, Quantum Information Science Program, Toronto, ON (Canada); Makarov, Vadim [University of Waterloo, Institute for Quantum Computing, Waterloo, ON (Canada); University of Waterloo, Department of Electrical and Computer Engineering, Waterloo, ON (Canada); University of Waterloo, Department of Physics and Astronomy, Waterloo, ON (Canada)

    2017-12-15

    Avalanche photodiodes (APDs) are a practical option for space-based quantum communications requiring single-photon detection. However, radiation damage to APDs significantly increases their dark count rates and thus reduces their useful lifetimes in orbit. We show that high-power laser annealing of irradiated APDs of three different models (Excelitas C30902SH, Excelitas SLiK, and Laser Components SAP500S2) heals the radiation damage and several APDs are restored to typical pre-radiation dark count rates. Of nine samples we test, six APDs were thermally annealed in a previous experiment as another solution to mitigate the radiation damage. Laser annealing reduces the dark count rates further in all samples with the maximum dark count rate reduction factor varying between 5.3 and 758 when operating at -80 C. This indicates that laser annealing is a more effective method than thermal annealing. The illumination power to reach these reduction factors ranges from 0.8 to 1.6 W. Other photon detection characteristics, such as photon detection efficiency, timing jitter, and afterpulsing probability, fluctuate but the overall performance of quantum communications should be largely unaffected by these variations. These results herald a promising method to extend the lifetime of a quantum satellite equipped with APDs. (orig.)

  1. Partially Annealed Disorder and Collapse of Like-Charged Macroions

    Science.gov (United States)

    Mamasakhlisov, Yevgeni S.; Naji, Ali; Podgornik, Rudolf

    2008-11-01

    Charged systems with partially annealed charge disorder are investigated using field-theoretic and replica methods. Charge disorder is assumed to be confined to macroion surfaces surrounded by a cloud of mobile neutralizing counterions in an aqueous solvent. A general formalism is developed by assuming that the disorder is partially annealed (with purely annealed and purely quenched disorder included as special cases), i.e., we assume in general that the disorder undergoes a slow dynamics relative to fast-relaxing counterions making it possible thus to study the stationary-state properties of the system using methods similar to those available in equilibrium statistical mechanics. By focusing on the specific case of two planar surfaces of equal mean surface charge and disorder variance, it is shown that partial annealing of the quenched disorder leads to renormalization of the mean surface charge density and thus a reduction of the inter-plate repulsion on the mean-field or weak-coupling level. In the strong-coupling limit, charge disorder induces a long-range attraction resulting in a continuous disorder-driven collapse transition for the two surfaces as the disorder variance exceeds a threshold value. Disorder annealing further enhances the attraction and, in the limit of low screening, leads to a global attractive instability in the system.

  2. On simulated annealing phase transitions in phylogeny reconstruction.

    Science.gov (United States)

    Strobl, Maximilian A R; Barker, Daniel

    2016-08-01

    Phylogeny reconstruction with global criteria is NP-complete or NP-hard, hence in general requires a heuristic search. We investigate the powerful, physically inspired, general-purpose heuristic simulated annealing, applied to phylogeny reconstruction. Simulated annealing mimics the physical process of annealing, where a liquid is gently cooled to form a crystal. During the search, periods of elevated specific heat occur, analogous to physical phase transitions. These simulated annealing phase transitions play a crucial role in the outcome of the search. Nevertheless, they have received comparably little attention, for phylogeny or other optimisation problems. We analyse simulated annealing phase transitions during searches for the optimal phylogenetic tree for 34 real-world multiple alignments. In the same way in which melting temperatures differ between materials, we observe distinct specific heat profiles for each input file. We propose this reflects differences in the search landscape and can serve as a measure for problem difficulty and for suitability of the algorithm's parameters. We discuss application in algorithmic optimisation and as a diagnostic to assess parameterisation before computationally costly, large phylogeny reconstructions are launched. Whilst the focus here lies on phylogeny reconstruction under maximum parsimony, it is plausible that our results are more widely applicable to optimisation procedures in science and industry. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  3. Enhancing quantum annealing performance for the molecular similarity problem

    Science.gov (United States)

    Hernandez, Maritza; Aramon, Maliheh

    2017-05-01

    Quantum annealing is a promising technique which leverages quantum mechanics to solve hard optimization problems. Considerable progress has been made in the development of a physical quantum annealer, motivating the study of methods to enhance the efficiency of such a solver. In this work, we present a quantum annealing approach to measure similarity among molecular structures. Implementing real-world problems on a quantum annealer is challenging due to hardware limitations such as sparse connectivity, intrinsic control error, and limited precision. In order to overcome the limited connectivity, a problem must be reformulated using minor-embedding techniques. Using a real data set, we investigate the performance of a quantum annealer in solving the molecular similarity problem. We provide experimental evidence that common practices for embedding can be replaced by new alternatives which mitigate some of the hardware limitations and enhance its performance. Common practices for embedding include minimizing either the number of qubits or the chain length and determining the strength of ferromagnetic couplers empirically. We show that current criteria for selecting an embedding do not improve the hardware's performance for the molecular similarity problem. Furthermore, we use a theoretical approach to determine the strength of ferromagnetic couplers. Such an approach removes the computational burden of the current empirical approaches and also results in hardware solutions that can benefit from simple local classical improvement. Although our results are limited to the problems considered here, they can be generalized to guide future benchmarking studies.

  4. Efficient Embedding of Integer Programming Problems on Quantum Annealers

    Science.gov (United States)

    Venturelli, Davide; Trummer, Immanuel

    Quantum Annealers are being considered as a possible platform to solve challenging Integer Optimization Problems (IOP). Hard-coding an IOP as an Ising model onto an annealer is however no easy task due to the severe restrictions imposed mostly by the connectivity of the graph implemented by the hardware architecture, as it has widely discussed for the D-Wave machines. The current approaches employ graph minor embedding algorithms that require a significant overhead of resources (number of qubits, computing power) with respect to the number of logical variables in the IOP. This overhead is arguably the primary problems for practitioners of quantum annealing. We present a new method to deterministically embed an arbitrary IOP in a generic class of annealing chip layouts such that the asymptotic scaling beats all the current methods. It is shown on the latest D-Wave chips to allow programming of problems, relevant for database and space sciences, with approximately 5-10x more variables with respect to the published approaches. The method is efficient in the sense that a valid embedding can be computed at run-time in polynomial time. The discussed methods can inform the design of next-generation of quantum annealers.

  5. Role of stranded gas in increasing global gas supplies

    Science.gov (United States)

    Attanasi, E.D.; Freeman, P.A.

    2013-01-01

    This report synthesizes the findings of three regional studies in order to evaluate, at the global scale, the contribution that stranded gas resources can make to global natural gas supplies. Stranded gas, as defined for this study, is natural gas in discovered conventional gas and oil fields that is currently not commercially producible for either physical or economic reasons. The regional studies evaluated the cost of bringing the large volumes of undeveloped gas in stranded gas fields to selected markets. In particular, stranded gas fields of selected Atlantic Basin countries, north Africa, Russia, and central Asia are screened to determine whether the volumes are sufficient to meet Europe’s increasing demand for gas imports. Stranded gas fields in Russia, central Asia, Southeast Asia, and Australia are also screened to estimate development, production, and transport costs and corresponding gas volumes that could be supplied to Asian markets in China, India, Japan, and South Korea. The data and cost analysis presented here suggest that for the European market and the markets examined in Asia, the development of stranded gas provides a way to meet projected gas import demands for the 2020-to-2040 period. Although this is a reconnaissance-type appraisal, it is based on volumes of gas that are associated with individual identified fields. Individual field data were carefully examined. Some fields were not evaluated because current technology was insufficient or it appeared the gas was likely to be held off the export market. Most of the evaluated stranded gas can be produced and delivered to markets at costs comparable to historical prices. Moreover, the associated volumes of gas are sufficient to provide an interim supply while additional technologies are developed to unlock gas diffused in shale and hydrates or while countries transition to making a greater use of renewable energy sources.

  6. New Views on Strand Asymmetry in Insect Mitochondrial Genomes

    Science.gov (United States)

    Wei, Shu-Jun; Shi, Min; Chen, Xue-Xin; Sharkey, Michael J.; van Achterberg, Cornelis; Ye, Gong-Yin; He, Jun-Hua

    2010-01-01

    Strand asymmetry in nucleotide composition is a remarkable feature of animal mitochondrial genomes. Understanding the mutation processes that shape strand asymmetry is essential for comprehensive knowledge of genome evolution, demographical population history and accurate phylogenetic inference. Previous studies found that the relative contributions of different substitution types to strand asymmetry are associated with replication alone or both replication and transcription. However, the relative contributions of replication and transcription to strand asymmetry remain unclear. Here we conducted a broad survey of strand asymmetry across 120 insect mitochondrial genomes, with special reference to the correlation between the signs of skew values and replication orientation/gene direction. The results show that the sign of GC skew on entire mitochondrial genomes is reversed in all species of three distantly related families of insects, Philopteridae (Phthiraptera), Aleyrodidae (Hemiptera) and Braconidae (Hymenoptera); the replication-related elements in the A+T-rich regions of these species are inverted, confirming that reversal of strand asymmetry (GC skew) was caused by inversion of replication origin; and finally, the sign of GC skew value is associated with replication orientation but not with gene direction, while that of AT skew value varies with gene direction, replication and codon positions used in analyses. These findings show that deaminations during replication and other mutations contribute more than selection on amino acid sequences to strand compositions of G and C, and that the replication process has a stronger affect on A and T content than does transcription. Our results may contribute to genome-wide studies of replication and transcription mechanisms. PMID:20856815

  7. New views on strand asymmetry in insect mitochondrial genomes.

    Directory of Open Access Journals (Sweden)

    Shu-Jun Wei

    Full Text Available Strand asymmetry in nucleotide composition is a remarkable feature of animal mitochondrial genomes. Understanding the mutation processes that shape strand asymmetry is essential for comprehensive knowledge of genome evolution, demographical population history and accurate phylogenetic inference. Previous studies found that the relative contributions of different substitution types to strand asymmetry are associated with replication alone or both replication and transcription. However, the relative contributions of replication and transcription to strand asymmetry remain unclear. Here we conducted a broad survey of strand asymmetry across 120 insect mitochondrial genomes, with special reference to the correlation between the signs of skew values and replication orientation/gene direction. The results show that the sign of GC skew on entire mitochondrial genomes is reversed in all species of three distantly related families of insects, Philopteridae (Phthiraptera, Aleyrodidae (Hemiptera and Braconidae (Hymenoptera; the replication-related elements in the A+T-rich regions of these species are inverted, confirming that reversal of strand asymmetry (GC skew was caused by inversion of replication origin; and finally, the sign of GC skew value is associated with replication orientation but not with gene direction, while that of AT skew value varies with gene direction, replication and codon positions used in analyses. These findings show that deaminations during replication and other mutations contribute more than selection on amino acid sequences to strand compositions of G and C, and that the replication process has a stronger affect on A and T content than does transcription. Our results may contribute to genome-wide studies of replication and transcription mechanisms.

  8. Accurate strand-specific quantification of viral RNA.

    Directory of Open Access Journals (Sweden)

    Nicole E Plaskon

    Full Text Available The presence of full-length complements of viral genomic RNA is a hallmark of RNA virus replication within an infected cell. As such, methods for detecting and measuring specific strands of viral RNA in infected cells and tissues are important in the study of RNA viruses. Strand-specific quantitative real-time PCR (ssqPCR assays are increasingly being used for this purpose, but the accuracy of these assays depends on the assumption that the amount of cDNA measured during the quantitative PCR (qPCR step accurately reflects amounts of a specific viral RNA strand present in the RT reaction. To specifically test this assumption, we developed multiple ssqPCR assays for the positive-strand RNA virus o'nyong-nyong (ONNV that were based upon the most prevalent ssqPCR assay design types in the literature. We then compared various parameters of the ONNV-specific assays. We found that an assay employing standard unmodified virus-specific primers failed to discern the difference between cDNAs generated from virus specific primers and those generated through false priming. Further, we were unable to accurately measure levels of ONNV (- strand RNA with this assay when higher levels of cDNA generated from the (+ strand were present. Taken together, these results suggest that assays of this type do not accurately quantify levels of the anti-genomic strand present during RNA virus infectious cycles. However, an assay permitting the use of a tag-specific primer was able to distinguish cDNAs transcribed from ONNV (- strand RNA from other cDNAs present, thus allowing accurate quantification of the anti-genomic strand. We also report the sensitivities of two different detection strategies and chemistries, SYBR(R Green and DNA hydrolysis probes, used with our tagged ONNV-specific ssqPCR assays. Finally, we describe development, design and validation of ssqPCR assays for chikungunya virus (CHIKV, the recent cause of large outbreaks of disease in the Indian Ocean

  9. Manufacture of Strand Board Bonded with Disposal Expanded Polystyrene as Binder

    OpenAIRE

    Hermawan, Andi; Ohuchi, Takeshi; Fujimoto, Noboru; 大内, 毅; 藤本, 登留

    2010-01-01

    The objective of this study was to evaluate the physical and mechanical properties of strand board bonded with disposal expanded polystyrene (EPS) as binder. The strand board was manufactured using strand made from Douglas-fir beams selected from construction scrap wood. The strands were oriented, and two types of three-layer (face-core-face) strand board were manufactured: one in which the board bounded with only disposal EPS (P board), and the other in which the board bonded with disposal...

  10. Ketahanan Papan Unting (Oriented Strand Board) terhadap Serangan Rayap Tanah dan Rayap Kayu Kering

    OpenAIRE

    Gea, Bud diman

    2011-01-01

    Oriented strand board is panel of wood raw material from which strand composed of cross and upright structure. In order to oriented strand board can be used for interior and exterior needs, than necessary to be applied various thenology of quality improvement like durabelities and endurance of oriented strand board. For it does found endurance oriented strand board from attack of ground termite and wood dry termite, necessary doing grave yard trial and wood dry termite trial. This research ta...

  11. Formability of Annealed Ni-Ti Shape Memory Alloy Sheet

    Science.gov (United States)

    Fann, K. J.; Su, J. Y.; Chang, C. H.

    2018-03-01

    Ni-Ti shape memory alloy has two specific properties, superelasiticity and shape memory effect, and thus is widely applied in diverse industries. To extend its application, this study attempts to investigate the strength and cold formability of its sheet blank, which is annealed at various temperatures, by hardness test and by Erichsen-like cupping test. As a result, the higher the annealing temperature, the lower the hardness, the lower the maximum punch load as the sheet blank fractured, and the lower the Erichsen-like index or the lower the formability. In general, the Ni-Ti sheet after annealing has an Erichsen-like index between 8 mm and 9 mm. This study has also confirmed via DSC that the Ni-Ti shape memory alloy possesses the austenitic phase and shows the superelasticity at room temperature.

  12. Rapid Thermal annealing of silicon layers amorphized by ion implantation

    International Nuclear Information System (INIS)

    Hasenack, C.M.

    1986-01-01

    The recrystallization behavior and the supression mechanisms of the residual defects of silicon layers amorphized by ion implantation, were investigated. The samples were annealed with the aid of a rapid thermal annealing (RTA) system at temperature range from 850 to 1200 0 C, and annealing time up to 120 s. Random and aligned Rutherford backscattering spectroscopy were used to analyse the samples. Similarities in the recrystallization behavior for layers implanted with ions of the same chemical groups such as As or Sb; Ge, Sn or Pb, In or Ga, are observed. The results show that the effective supression of resisual defects of the recrystallired layers is vinculated to the redistribution of impurities via thermal diffusion. (author) [pt

  13. NRC assessment of the Department of Energy annealing demonstration project

    International Nuclear Information System (INIS)

    Jackson, D.A.; Malik, S.N.

    1997-01-01

    Thermal annealing is the only known method for mitigating the effects of neutron irradiation embrittlement in reactor pressure vessel (RPV) steels. In May 1996, the US Department of Energy (DOE) in conjunction with the American Society of Mechanical Engineers, Westinghouse, Cooperheat, Electric Power Research Institute (with participating utilities), Westinghouse Owner's Group, Consumers Power, Electricite' de France, Duquesne Light and the Central Research Institute of the Electric Power Industry (Japan) sponsored an annealing demonstration project (ADP) at Marble Hill. The Marble Hill Plant, located in Madison, Indiana, is a Westinghouse 4 loop design. The plant was nearly 70% completed when the project was canceled. Hence, the RPV was never irradiated. The paper will present highlights from the NRCs independent evaluation of the Marble Hill Annealing Demonstration Project

  14. Morphology and annealing kinetics of ion tracks in minerals

    Directory of Open Access Journals (Sweden)

    Ewing R. C.

    2012-10-01

    Full Text Available We have studied the morphology and annealing kinetics of ion tracks in Durango apatite using synchrotron small angle X-ray scattering. The non-destructive, artefact-free technique enables us to determine the track radii with a resolution of fractions of a nanometre. The tracks were generated using different heavy ions with energies between 185 MeV and 2.6 GeV. The track morphology is consistent with the formation of long cylindrical amorphous tracks. The annealing kinetics, measured by SAXS in combination with ex situ and in situ annealing experiments, suggests structural relaxation followed by recrystallisation of the damaged material. The measurement methodology shown here provides a new means for in-depth studies of ion-track formation in minerals under a wide variety of geological conditions.

  15. Molecular dynamics simulation of annealed ZnO surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Min, Tjun Kit; Yoon, Tiem Leong [School of Physics, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia); Lim, Thong Leng [Faculty of Engineering and Technology, Multimedia University, Melaka Campus, 75450 Melaka (Malaysia)

    2015-04-24

    The effect of thermally annealing a slab of wurtzite ZnO, terminated by two surfaces, (0001) (which is oxygen-terminated) and (0001{sup ¯}) (which is Zn-terminated), is investigated via molecular dynamics simulation by using reactive force field (ReaxFF). We found that upon heating beyond a threshold temperature of ∼700 K, surface oxygen atoms begin to sublimate from the (0001) surface. The ratio of oxygen leaving the surface at a given temperature increases as the heating temperature increases. A range of phenomena occurring at the atomic level on the (0001) surface has also been explored, such as formation of oxygen dimers on the surface and evolution of partial charge distribution in the slab during the annealing process. It was found that the partial charge distribution as a function of the depth from the surface undergoes a qualitative change when the annealing temperature is above the threshold temperature.

  16. Mean field annealing approach to large residual-statics estimation

    Science.gov (United States)

    Cary, Peter W.; Upham, Warren

    1993-12-01

    We present a new method for solving the large residual-statics problem, called mean field annealing, which may be capable of overcoming some of the limitations of stochastic methods. Mean field annealing is a global-search method that is governed by a purely deterministic set of equations. The mean field annealing method approaches global optimization problems in a fundamentally different way from stochastic global-search methods. The mean field approach never samples individual trial solutions in model space. Instead, the mean field equations, which are solved at successively lower temperatures with a fixed-point method, involve solving for the probability distributions of each variable rather than solving for the variables themselves. The probability distribution of each variable is resolved separately by replacing all other variables that occur in the energy function by their expectation values.

  17. Doped ZnO nanowires obtained by thermal annealing.

    Science.gov (United States)

    Shan, C X; Liu, Z; Wong, C C; Hark, S K

    2007-02-01

    Doped ZnO nanowires were prepared in a very simple and inexpensive thermal annealing method using ZnSe nanowires as a precursor. As doped, P doped, and As/P codoped ZnO nanowires were obtained in this method. X-ray diffraction shows that the zincblende ZnSe nanowires were converted to doped wurtzite ZnO nanowires. The incorporation of the dopants was confirmed by energy dispersive X-ray spectroscopy. The doping concentration could be adjusted by changing the annealing temperature and duration. Scanning electron microscopy indicated that the morphology of the ZnSe nanowires was essentially retained after the annealing and doping process. Photoluminescence spectroscopy also verified the incorporation of the dopants into the nanowires.

  18. Phase annealing for the conditional simulation of spatial random fields

    Science.gov (United States)

    Hörning, S.; Bárdossy, A.

    2018-03-01

    Simulated annealing (SA) is a popular geostatistical simulation method as it provides great flexibility. In this paper possible problems of conditioning its realizations are discussed. A statistical test to recognize whether the observations are well embedded in their simulated neighborhood or not is developed. A new simulated annealing method, phase annealing (PA), is presented which makes it possible to avoid poor embedding of observations. PA is based on the Fourier representation of the spatial field. Instead of the individual pixel values, phases corresponding to different Fourier components are modified (i.e. shifted) in order to match prescribed statistics. The method treats neighborhoods together and thus avoids singularities at observation locations. It is faster than SA and can be used for the simulation of high resolution fields. Examples demonstrate the applicability of the method.

  19. Toward understanding dynamic annealing processes in irradiated ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Myers, Michael Thomas [Texas A & M Univ., College Station, TX (United States)

    2013-05-01

    High energy particle irradiation inevitably generates defects in solids. The ballistic formation and thermalization of the defect creation process occur rapidly, and are believed to be reasonably well understood. However, knowledge of the evolution of defects after damage cascade thermalization, referred to as dynamic annealing, is quite limited. Unraveling the mechanisms associated with dynamic annealing is crucial since such processes play an important role in the formation of stable postirradiation disorder in ion-beam-processing of semiconductors, and determines the “radiation tolerance” of many nuclear materials. The purpose of this dissertation is to further our understanding of the processes involved in dynamic annealing. In order to achieve this, two main tasks are undertaken.

  20. Chaotic Multiquenching Annealing Applied to the Protein Folding Problem

    Directory of Open Access Journals (Sweden)

    Juan Frausto-Solis

    2014-01-01

    Full Text Available The Chaotic Multiquenching Annealing algorithm (CMQA is proposed. CMQA is a new algorithm, which is applied to protein folding problem (PFP. This algorithm is divided into three phases: (i multiquenching phase (MQP, (ii annealing phase (AP, and (iii dynamical equilibrium phase (DEP. MQP enforces several stages of quick quenching processes that include chaotic functions. The chaotic functions can increase the exploration potential of solutions space of PFP. AP phase implements a simulated annealing algorithm (SA with an exponential cooling function. MQP and AP are delimited by different ranges of temperatures; MQP is applied for a range of temperatures which goes from extremely high values to very high values; AP searches for solutions in a range of temperatures from high values to extremely low values. DEP phase finds the equilibrium in a dynamic way by applying least squares method. CMQA is tested with several instances of PFP.

  1. Reduction of Annealing Times for Energy Conservation in Aluminum

    Energy Technology Data Exchange (ETDEWEB)

    Anthony D. Rollett; Hasso Weiland; Mohammed Alvi; Abhijit Brahme

    2005-08-31

    Carnegie Mellon University was teamed with the Alcoa Technical Center with support from the US Dept. of Energy (Office of Industrial Technology) and the Pennsylvania Technology Investment Authority (PTIA) to make processing of aluminum less costly and more energy efficient. Researchers in the Department of Materials Science and Engineering have investigated how annealing processes in the early stages of aluminum processing affect the structure and properties of the material. Annealing at high temperatures consumes significant amounts of time and energy. By making detailed measurements of the crystallography and morphology of internal structural changes they have generated new information that will provide a scientific basis for shortening processing times and consuming less energy during annealing.

  2. The Effect of Basepair Mismatch on DNA Strand Displacement.

    Science.gov (United States)

    Broadwater, D W Bo; Kim, Harold D

    2016-04-12

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  3. DNA-directed mutations. Leading and lagging strand specificity

    Science.gov (United States)

    Sinden, R. R.; Hashem, V. I.; Rosche, W. A.

    1999-01-01

    The fidelity of replication has evolved to reproduce B-form DNA accurately, while allowing a low frequency of mutation. The fidelity of replication can be compromised, however, by defined order sequence DNA (dosDNA) that can adopt unusual or non B-DNA conformations. These alternative DNA conformations, including hairpins, cruciforms, triplex DNAs, and slipped-strand structures, may affect enzyme-template interactions that potentially lead to mutations. To analyze the effect of dosDNA elements on spontaneous mutagenesis, various mutational inserts containing inverted repeats or direct repeats were cloned in a plasmid containing a unidirectional origin of replication and a selectable marker for the mutation. This system allows for analysis of mutational events that are specific for the leading or lagging strands during DNA replication in Escherichia coli. Deletions between direct repeats, involving misalignment stabilized by DNA secondary structure, occurred preferentially on the lagging strand. Intermolecular strand switch events, correcting quasipalindromes to perfect inverted repeats, occurred preferentially during replication of the leading strand.

  4. Microstructural characterization of intercritically annealed low alloy PM steels

    International Nuclear Information System (INIS)

    Gueral, A.; Tekeli, S.

    2007-01-01

    In this study, the applicability of intercritical annealing heat treatment, which is usually practiced to high strength low alloy ingot steels (HSLA), to low alloy powder metallurgy (PM) processed steels was investigated. With this heat treatment, it was intended to produce a dual-phase steel structure (ferrite + martensite) in PM steel. The effect of various amount of graphite addition on microstructure was also examined. For these purposes, atomized iron powder (Ancorsteel 1000) was mixed with 0.3 and 0.5 wt% graphite powder. The mixed powders were cold pressed at 700 MPa with single action and sintered at 1120 deg. C for 30 min under pure argon gas atmosphere. Some of the sintered specimens were directly annealed at intercritical heat treatment temperatures of 724, 735 and 760 deg. C and rapidly water quenched. Through these heat treatments, ferrite + martensite microstructure with coarse grain size were produced. The other sintered specimens were first austenitized at 890 deg. C for 12 min before intercritically annealing and then rapidly water quenched to produce fully martensitic structure. These specimens with fully martensitic microstructure were subsequently annealed at intercritical annealing temperatures of 724, 735 and 760 deg. C and rapidly water quenched. Ferrite + martensite microstructure with fine grain size was obtained by this route. The experimental results showed that martensite volume fraction increased with increasing intercritical annealing temperature as well as increasing graphite content. It is thought that mechanical properties of PM steels can be controlled by these heat treatments which are an alternative to traditional heat treatments of quenching + tempering applied usually to PM steels

  5. Modernization of two gas-fired shaft annealing furnaces

    Energy Technology Data Exchange (ETDEWEB)

    Barthof, G.; Porst, G.; Raczek, S.

    1986-04-01

    The objective was to modernize two existing shaft-type annealing furnaces used for the heat treatment of grey iron castings with the aim of reducing the consumption of gaseous fuel, minimize the formation of scale, decrease maintenance expense and apply more automatic control to the annealing process. This was to be achieved by an optimum combination of new types of construction materials and advanced firing and control equipment. The author describes the furnace in its condition prior to and after reconstruction. The operating results obtained after reconstruction were found to justify the costs incurred. The payback period is roughly one year.

  6. Dependence of boron cluster dissolution on the annealing ambient

    International Nuclear Information System (INIS)

    Radic, Ljubo; Lilak, Aaron D.; Law, Mark E.

    2002-01-01

    Boron is introduced into silicon via implantation to form p-type layers. This process creates damage in the crystal that upon annealing causes enhanced diffusion and clustering of the boron layer. Reactivation of the boron is not a well-understood process. In this letter we experimentally investigate the effect of the annealing ambient on boron reactivation kinetics. An oxidizing ambient which injects silicon interstitials is compared to an inert ambient. Contrary to published theory, an excess of interstitials does not accelerate the reactivation process

  7. A theoretical comparison of evolutionary algorithms and simulated annealing

    Energy Technology Data Exchange (ETDEWEB)

    Hart, W.E.

    1995-08-28

    This paper theoretically compares the performance of simulated annealing and evolutionary algorithms. Our main result is that under mild conditions a wide variety of evolutionary algorithms can be shown to have greater performance than simulated annealing after a sufficiently large number of function evaluations. This class of EAs includes variants of evolutionary strategie and evolutionary programming, the canonical genetic algorithm, as well as a variety of genetic algorithms that have been applied to combinatorial optimization problems. The proof of this result is based on a performance analysis of a very general class of stochastic optimization algorithms, which has implications for the performance of a variety of other optimization algorithm.

  8. Increased electrical conductivity of peptides through annealing process

    Directory of Open Access Journals (Sweden)

    Seok Daniel Namgung

    2017-08-01

    Full Text Available Biocompatible biologically occurring polymer is suggested as a component of human implantable devices since conventional inorganic materials are apt to trigger inflammation and toxicity problem within human body. Peptides consisting of aromatic amino acid, tyrosine, are chosen, and enhancement on electrical conductivity is studied. Annealing process gives rise to the decrease on resistivity of the peptide films and the growth of the carrier concentration is a plausible reason for such a decrease on resistivity. The annealed peptides are further applied to an active layer of field effect transistor, in which low on/off current ratio (∼10 is obtained.

  9. Adiabatic quantum computation and quantum annealing theory and practice

    CERN Document Server

    McGeoch, Catherine C

    2014-01-01

    Adiabatic quantum computation (AQC) is an alternative to the better-known gate model of quantum computation. The two models are polynomially equivalent, but otherwise quite dissimilar: one property that distinguishes AQC from the gate model is its analog nature. Quantum annealing (QA) describes a type of heuristic search algorithm that can be implemented to run in the ``native instruction set'''' of an AQC platform. D-Wave Systems Inc. manufactures {quantum annealing processor chips} that exploit quantum properties to realize QA computations in hardware. The chips form the centerpiece of a nov

  10. Effect of annealing on field emission properties of nanodiamond coating

    Energy Technology Data Exchange (ETDEWEB)

    Zhai, C.X., E-mail: zhaicatty@126.co [School of Information Science and Technology, Northwest University, Xi' an 710127, Shaanxi (China); Yun, J.N.; Zhao, L.L.; Zhang, Z.Y.; Wang, X.W.; Chen, Y.Y. [School of Information Science and Technology, Northwest University, Xi' an 710127, Shaanxi (China)

    2011-03-01

    Field electron emission of detonation nanodiamond (ND) coated on a titanium substrate by electrophoretic deposition is investigated. It is found that thermal annealing can significantly improve the field emission properties of the ND layer, which can be mainly attributed to the formation of the TiC phase between diamond and Ti. The first-principles calculated results show that the formation of transition layers can lower the interface barrier and enhance the field electron emission of ND coating. Besides, the transformation of diamond to graphite after annealing has been revealed by Raman spectra. This transformation also benefits the electron emission enhancement.

  11. Crystallographic refinement by simulated annealing: Application to crambin

    International Nuclear Information System (INIS)

    Bruenger, A.T.; Yale Univ., New Haven, CT; Harvard Univ., Cambridge, MA; Karplus, M.; Petsko, G.A.

    1989-01-01

    A detailed description of the method of crystallographic refinement by simulated annealing is presented. To test the method, it has been applied to a 1.5 A resolution X-ray structure of crambin. The dependence of the success of the simulated annealing protocol with respect to the temperature of the heating stage is discussed. Optimal success is achieved at relatively high temperatures. Regardless of the protocol used, the molecular-dynamics refined structure always yields an improved R factor compared with restrained least-squares refinement without manual re-fitting. The differences between the various refined structures and the corresponding electron density maps are discussed. (orig.)

  12. DNA turnover and strand breaks in Escherichia coli

    International Nuclear Information System (INIS)

    Hanawalt, P.; Grivell, A.; Nakayama, H.

    1975-01-01

    The extent of DNA turnover has been measured in a dnaB mutant of Escherichia coli, temperature sensitive for semiconservative DNA replication. At the nonpermissive temperature about 0.02 percent of the deoxynucleotides in DNA are exchanged per generation period. This turnover rate is markedly depressed in the presence of rifampicin. During thymine starvation strand breaks accumulate in the DNA of E. coli strains that are susceptible to thymineless death. Rifampicin suppresses the appearance of these breaks, consistent with our hypothesis that transcription may be accompanied by repairable single-strand breaks in DNA. DNA turnover is enhanced severalfold in strands containing 5-bromodeoxyuridine in place of thymidine, possibly because the analog (or the deoxyuridine, following debromination) is sometimes recognized and excised

  13. Availability: A Metric for Nucleic Acid Strand Displacement Systems

    Science.gov (United States)

    2016-01-01

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks. PMID:26875531

  14. Interpretation of microstructure evolution during self-annealing and thermal annealing of nanocrystalline electrodeposits—A comparative study

    DEFF Research Database (Denmark)

    Pantleon, Karen; Somers, Marcel A. J.

    2010-01-01

    Electrodeposition results in a non-equilibrium state of the as-deposited nanocrystalline microstructure, which evolves towards an energetically more favorable state as a function of time and/or temperature upon deposition. Real-time investigation of the evolving microstructure in copper, silver......-annealing kinetics of copper and silver electrodeposits as well as the annealing kinetics of electrodeposited nickel. Similarities and characteristic differences of the kinetics and mechanisms of microstructure evolution in the various electrodeposits are discussed and the experimental results are attempted...... and nickel electrodeposits was achieved by time-resolved X-ray diffraction line profile analysis and crystallographic texture analysis during room temperature storage and during isothermal annealing at elevated temperatures. These in-situ studies with unique time resolution allowed quantification of the self...

  15. Crystal structure of four-stranded Oxytricha telomeric DNA

    Science.gov (United States)

    Kang, C.; Zhang, X.; Ratliff, R.; Moyzis, R.; Rich, A.

    1992-01-01

    The sequence d(GGGGTTTTGGGG) from the 3' overhang of the Oxytricha telomere has been crystallized and its three-dimensional structure solved to 2.5 A resolution. The oligonucleotide forms hairpins, two of which join to make a four-stranded helical structure with the loops containing four thymine residues at either end. The guanine residues are held together by cyclic hydrogen bonding and an ion is located in the centre. The four guanine residues in each segment have a glycosyl conformation that alternates between anti and syn. There are two four-stranded molecules in the asymmetric unit showing that the structure has some intrinsic flexibility.

  16. Viable deletions of the M13 complementary strand origin

    OpenAIRE

    Kim, Myoung Hee; Hines, Jane C.; Ray, Dan S.

    1981-01-01

    The single-stranded DNA of bacteriophage M13 is converted to a duplex replicative form by a mechanism involving RNA-primed initiation at a single unique site on the viral DNA. The DNA sequence that specifies the RNA primer is contained largely within one of two adjacent hairpin structures protected from DNase degradation by RNA polymerase. We have used in vitro techniques to construct a series of M13 mutants having deletions in the region of the complementary strand origin. Deletions of the d...

  17. Genetic transformation of Neisseria gonorrhoeae shows a strand preference

    OpenAIRE

    Duffin, Paul M.; Seifert, H. Steven

    2012-01-01

    Natural transformation is the main means of horizontal genetic exchange in the obligate human pathogen Neisseria gonorrhoeae. Neisseria spp. have been shown to preferentially take up and transform their own DNA by recognizing a non-palindromic 10 or 12 nucleotide DNA uptake sequence (DUS10 or DUS12). We investigated the ability of the DUS12 to enhance single-stranded DNA (ssDNA) transformation. Given the non-palindromic nature of the DUS12, we tested whether both strands of the DUS equally en...

  18. Industry participation workshop: Chromium electroplating of superconductor strand. Proceedings

    International Nuclear Information System (INIS)

    1994-01-01

    The primary objective of the workshop was to inform US plating vendors about the opportunity to participate in the effort on Cr plating of large quantities of superconducting wires required for the ITER and the TPX projects and DOE's interest in developing several reliable and high quality suppliers of Chromium plating services for the superconducting strand industry. The objective was also to inform plating vendors about the Cr plating technology developed in LLNL and invite interested plating vendors to get the technology. Finally the workshop was intended to inform the plating vendors about the plan to get verification of capability of two to four vendors for Cr plating of superconducting strands

  19. A single-stranded RNA copy of the Giardia lamblia virus double-stranded RNA genome is present in the infected Giardia lamblia.

    OpenAIRE

    Furfine, E S; White, T C; Wang, A L; Wang, C C

    1989-01-01

    An isolate of Giardia lamblia infected with the double-stranded RNA virus (GLV) has two major species of RNA that are not present in an uninfected isolate. One of these species is the previously characterized double-stranded RNA genome of GLV (1). The second species of RNA appears to be a full length copy of one strand of the double-stranded RNA genome. This full length single-stranded RNA is not present in viral particles isolated from the growth medium. The cellular concentration of the sin...

  20. Ball milling and annealing of Co-50 at% W Powders

    CSIR Research Space (South Africa)

    Bolokang, AS

    2013-04-01

    Full Text Available annealing of unmilled compacts yielded metastable phases. Upon 10 and 20 h ball milling of Co-W powder, no alloying was obtained. Although milling did not yield significant crystal changes in W and Co ground state struc- tures, its effect is evident during...

  1. Thermal annealing of protocrystalline a-Si:H

    NARCIS (Netherlands)

    Muller, T.F.G.; Arendse, C.J.; Halindintwali, S.; Knoesen, D.; Schropp, R.E.I.

    2011-01-01

    It proves difficult to obtain a set of protocrystalline silicon materials with different characteristics from the same deposition chamber to study the exact nature of these transition region materials. Hot-wire deposited protocrystalline silicon was thus isochronically annealed at different

  2. Meta-Modeling by Symbolic Regression and Pareto Simulated Annealing

    NARCIS (Netherlands)

    Stinstra, E.; Rennen, G.; Teeuwen, G.J.A.

    2006-01-01

    The subject of this paper is a new approach to Symbolic Regression.Other publications on Symbolic Regression use Genetic Programming.This paper describes an alternative method based on Pareto Simulated Annealing.Our method is based on linear regression for the estimation of constants.Interval

  3. Effect of annealing process of iron powder on magnetic properties ...

    Indian Academy of Sciences (India)

    Iron powder magnetic cores are used as soft magnetic rotors, in micro special motors such as BS brake motors, refrigerator compressor motors and brushless servo motors. Heat treatment of iron powder played an important role in the magnetic properties and loss of the motor cores. After the annealing process, the cracks ...

  4. The effects of Mg incorporation and annealing temperature on the ...

    Indian Academy of Sciences (India)

    Home; Journals; Pramana – Journal of Physics; Volume 88; Issue 2. The effects of Mg incorporation and annealing temperature on the physicochemical properties and antibacterial activity against {\\it Listeria monocytogenes} of ZnO nanoparticles. NIMA SHADAN ALI ABDOLAHZADEH ZIABARI RAFIEH MERAAT KAMYAR ...

  5. A Deterministic Annealing Approach to Clustering AIRS Data

    Science.gov (United States)

    Guillaume, Alexandre; Braverman, Amy; Ruzmaikin, Alexander

    2012-01-01

    We will examine the validity of means and standard deviations as a basis for climate data products. We will explore the conditions under which these two simple statistics are inadequate summaries of the underlying empirical probability distributions by contrasting them with a nonparametric, method called Deterministic Annealing technique

  6. Effect of annealing atmosphere on microstructure, optical and ...

    Indian Academy of Sciences (India)

    2018-02-05

    Feb 5, 2018 ... Indian Academy of Sciences https://doi.org/10.1007/s12034-017-1542-6. Effect of annealing atmosphere on microstructure, optical and electronic properties of spray-pyrolysed In-doped Zn(O,S) thin films. MARGI JANI, DHYEY RAVAL, RANJAN KUMAR PATI, INDRAJIT MUKHOPADHYAY and ABHIJIT RAY.

  7. Effect of annealing process of iron powder on magnetic properties ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Iron powder magnetic cores are used as soft magnetic rotors, in micro special motors such as BS brake motors, refrigerator compressor motors and brushless servo motors. Heat treatment of iron powder played an important role in the magnetic properties and loss of the motor cores. After the annealing process,.

  8. Correction of measured multiplicity distributions by the simulated annealing method

    International Nuclear Information System (INIS)

    Hafidouni, M.

    1993-01-01

    Simulated annealing is a method used to solve combinatorial optimization problems. It is used here for the correction of the observed multiplicity distribution from S-Pb collisions at 200 GeV/c per nucleon. (author) 11 refs., 2 figs

  9. Effects of nitrogen annealing on surface structure, silicide formation ...

    Indian Academy of Sciences (India)

    pure) bulk cobalt which was held in water cooled copper cru- cibles. All the samples were coated with 50 Å of cobalt at a rate of 0·1 Å/s. The deposition rate was ... sivity and due to the resultant shortage in the cobalt atoms, monosilicides are formed instead of di-metal silicides. At annealing temperatures higher than 600.

  10. Hafnium implanted in iron 1. Lattice location and annealing behavior

    NARCIS (Netherlands)

    de Bakker, J.M.G.J.; Pleiter, F; Smulders, P.J M

    1993-01-01

    Perturbed angular correlation, Rutherford backscattering and channelling experiments were conducted to study the lattice location and annealing behaviour of 110 keV hafnium ions implanted into iron single crystals. It was found that a fraction of 11-25% of the implanted hafnium atoms are located at

  11. Self-Organization and Annealed Disorder in a Fracturing Process

    DEFF Research Database (Denmark)

    Caldarelli, Guido; Di Tolla, Francesco; Petri, Alberto

    1996-01-01

    We show that a vectorial model for inhomogeneous elastic media self-organizes under external stress. An onset of crack avalanches of every duration and length scale compatible with the lattice size is observed. The behavior is driven by the introduction of annealed disorder, i.e., by lowering the...

  12. Influence of degree of deformation in rolling on anneal hardening ...

    Indian Academy of Sciences (India)

    Unknown

    The hardness, strength and electrical conductivity were measured and X-ray and DSC analyses performed. Anneal hardening effect was observed in the alloy in the temperature range 180–300°C, followed by an increase in the electrical conductivity. The amount of strengthening increases with increasing degree of prior.

  13. Coupled Qubits for Next Generation Quantum Annealing: Improving Coherence

    Science.gov (United States)

    Weber, Steven; Samach, Gabriel; Hover, David; Rosenberg, Danna; Yoder, Jonilyn; Kim, David K.; Kerman, Andrew; Oliver, William D.

    Quantum annealing is an optimization technique which potentially leverages quantum tunneling to enhance computational performance. Existing quantum annealers use superconducting flux qubits with short coherence times, limited primarily by the use of large persistent currents. Here, we examine an alternative approach, using flux qubits with smaller persistent currents and longer coherence times. We demonstrate tunable coupling, a basic building-block for quantum annealing, between two such qubits. Furthermore, we characterize qubit coherence as a function of coupler setting and investigate the effect of flux noise in the coupler loop on qubit coherence. Our results provide insight into the available design space for next-generation quantum annealers with improved coherence. This research was funded by the Office of the Director of National Intelligence (ODNI), Intelligence Advanced Research Projects Activity (IARPA) and by the Assistant Secretary of Defense for Research & Engineering under Air Force Contract No. FA8721-05-C-0002. The views and conclusions contained herein are those of the authors and should not be interpreted as necessarily representing the official policies or endorsements, either expressed or implied, of ODNI, IARPA, or the US Government.

  14. Thermal annealing of femtosecond laser written structures in silica glass

    NARCIS (Netherlands)

    Witcher, J.J.; Reichman, W.B.; Fletcher, L.B.; Troy, N.W.; Krol, D.M.

    2013-01-01

    We have investigated the thermal stability of femtosecond laser modification inside fused silica. Raman and FL spectroscopy show that fs-laser induced non-bridging oxygen hole center (NBOHC) defects completely disappear at 300 °C, whereas changes in Si-O ring structures only anneal out after heat

  15. Embrittlement recovery due to annealing of reactor pressure vessel steels

    International Nuclear Information System (INIS)

    Eason, E.D.; Wright, J.E.; Nelson, E.E.; Odette, G.R.; Mader, E.V.

    1995-01-01

    The irradiation embrittlement of nuclear reactor pressure vessels (RPV) can be reduced by thermal annealing at temperatures higher than the normal operating conditions. The objective of this work was to analyze the pertinent data and develop quantitative models for estimating the recovery in 30 ft-lb (41 J) Charpy transition temperature and Charpy upper shelf energy due to annealing. An analysis data base was developed, reviewed for completeness and accuracy, and documented as part of this work. Models were developed based on a combination of statistical techniques, including pattern recognition and transformation analysis, and the current understanding of the mechanisms governing embrittlement and recovery. The quality of models fitted in this project was evaluated by considering both the Charpy annealing data used for fitting and a surrogate hardness data base. This work demonstrates that microhardness recovery is i good surrogate for shift recovery and that there is a high level of consistency between he observed annealing trends and fundamental models of embrittlement and recovery processes

  16. Embrittlement recovery due to annealing of reactor pressure vessel steels

    International Nuclear Information System (INIS)

    Eason, E.D.; Wright, J.E.; Nelson, E.E.; Odette, G.R.; Mader, E.V.

    1998-01-01

    The irradiation embrittlement of nuclear reactor pressure vessels (RPV) can be reduced by thermal annealing at temperatures higher than the normal operating conditions. The objective of this work was to analyze the pertinent data and develop quantitative models for estimating the recovery in 41 J (30 ft-lb) Charpy transition temperature (TT) and Charpy upper shelf energy (USE) due to annealing. An analysis data base was developed, reviewed for completeness and accuracy, and documented as part of this work. Models were developed based on a combination of statistical techniques, including pattern recognition and transformation analysis, and the current understanding of the mechanisms governing embrittlement and recovery. The quality of models fitted in this project was evaluated by considering both the Charpy annealing data used for fitting and a surrogate hardness data base. This work demonstrates that microhardness recovery is a good surrogate for shift recovery and that there is a high level of consistency between the observed annealing trends and fundamental models of embrittlement and recovery processes. (orig.)

  17. Effect of annealing on phase transition in poly (vinylidene fluoride ...

    Indian Academy of Sciences (India)

    The -phase poly (vinylidene fluoride) (PVDF) films are usually prepared using dimethyl sulfoxide (DMSO) solvent, regardless of preparation temperature. Here we report the crystallization of both and -phase PVDF films by varying preparation temperature using DMSO solvent. The -phase PVDF films were annealed ...

  18. Influence of degree of deformation in rolling on anneal hardening ...

    Indian Academy of Sciences (India)

    Unknown

    Influence of degree of deformation in rolling on anneal hardening effect of a cast copper alloy. SVETLANA NESTOROVIC*, DESIMIR MARKOVIC and LJUBICA IVANIC. Technical Faculty Bor, University of Belgrade, Belgrade, Yugoslavia. MS received 15 May 2003. Abstract. This paper reports results of investigations carried ...

  19. The afforestation problem: a heuristic method based on simulated annealing

    DEFF Research Database (Denmark)

    Vidal, Rene Victor Valqui

    1992-01-01

    This paper presents the afforestation problem, that is the location and design of new forest compartments to be planted in a given area. This optimization problem is solved by a two-step heuristic method based on simulated annealing. Tests and experiences with this method are also presented....

  20. Direct Immersion Annealing of Block Copolymer Thin Films

    Science.gov (United States)

    Karim, Alamgir

    We demonstrate ordering of thin block copolymer (BCP) films via direct immersion annealing (DIA) at enhanced rate leading to stable morphologies. The BCP films are immersed in carefully selected mixtures of good and marginal solvents that can impart enhanced polymer mobility, while inhibiting film dissolution. DIA is compatible with roll-to-roll assembly manufacturing and has distinct advantages over conventional thermal annealing and batch processing solvent-vapor annealing methods. We identify three solvent composition-dependent BCP film ordering regimes in DIA for the weakly interacting polystyrene -poly(methyl methacrylate) (PS -PMMA) system: rapid short range order, optimal long-range order, and a film instability regime. Kinetic studies in the ``optimal long-range order'' processing regime as a function of temperature indicate a significant reduction of activation energy for BCP grain growth compared to oven annealing at conventional temperatures. An attractive feature of DIA is its robustness to ordering other BCP (e.g. PS-P2VP) and PS-PMMA systems exhibiting spherical, lamellar and cylindrical ordering. Inclusion of nanoparticles in these films at high concentrations and fast ordering kinetics study with neutron reflectivity and SANS will be discussed. This is (late) Contributed Talk Abstract for Dillon Medal Symposium at DPOLY - discussed with DPOLY Chair Dvora Perahia.

  1. Dielectric properties of plasma sprayed silicates subjected to additional annealing

    Czech Academy of Sciences Publication Activity Database

    Ctibor, Pavel; Sedláček, J.; Nevrlá, Barbara; Neufuss, Karel

    2017-01-01

    Roč. 10, č. 2 (2017), s. 105-114 ISSN 2008-2134 Institutional support: RVO:61389021 Keywords : Annealing * Dielectric properties * Plasma spraying * Silicates * Electrical properties * Insulators Subject RIV: JK - Corrosion ; Surface Treatment of Materials OBOR OECD: Coating and films http://pccc.icrc.ac.ir/Articles/1/18/990/

  2. Infrared absorption studies of the annealing of irradiated diamonds

    International Nuclear Information System (INIS)

    Woods, G.S.

    1984-01-01

    Natural (types Ia and IIa) and synthetic (type Ib) diamonds have been irradiated with energetic electrons and neutrons and then heated at temperatures up to 1400 deg C. Attendant changes in the infrared absorption spectra, especially above the Raman frequency (1332 cm -1 ), have been monitored. The most prominent absorption to develop in the infrared region proper, on annealing both type Ia and type Ib specimens, whether electron- or neutron-irradiated is the H1a line at 1450 cm -1 . Measurements taken of neutron-irradiated type Ia specimens show that the strength of this line is specimen-dependent, and that it is a linear function of radiation dose. Isochronal annealing studies show that the onset of the line occurs during heating at 250 deg C for type Ia specimens and at 650 deg C for type Ib specimens. The absorption begins to weaken during heating at 1100 deg C, but it is very persistent, surviving an anneal of 4 hours at 1400 deg C, albeit with diminished intensity. Three other weaker lines at 1438, 1358 and 1355 cm -1 develop with the 1450 cm -1 line, but differ from it and from each other in subsequent annealing behaviour. Other lines were observed; these are reported and discussed. (author)

  3. Effect of annealing atmosphere on microstructure, optical and ...

    Indian Academy of Sciences (India)

    61

    Effect of annealing atmosphere on microstructure, optical and electronic properties of spray pyrolysed indium doped Zn(O,S) thin films. Margi Jani1, DhyeyRaval1,Ranjan Kumar Pati1, Indrajit Mukhopadhyay1. andAbhijit Ray1*. 1Solar Research and Development Center, School of Solar Energy, PanditDeendayal.

  4. Property change during nanosecond pulse laser annealing of ...

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Bulletin of Materials Science; Volume 35; Issue 3. Property change during nanosecond pulse laser annealing of amorphous NiTi thin film. S K Sadrnezhaad Noushin Yasavol Mansoureh Ganjali Sohrab Sanjabi. Volume 35 Issue 3 June 2012 pp 357-364 ...

  5. Low temperature electron irradiation and annealing of pure cadmium

    International Nuclear Information System (INIS)

    Menendez, M.A.

    1979-01-01

    Cadmium after electron irradiation below 2 0 K, was studied and the damage production rate in Dc was found to be (4.13 +- .16) x 10 -26 Ωcm/(e - /cm 2 ) for irradiation with 2.5 MeV electrons at 1.5 0 K. New annealing peaks were observed at 1.825 0 K and at about 2 0 K with activation energies of (2.6 +- .1) x 10 -3 eV and (2.77 +- .34) x 10 -3 eV, respectively. The peak at about 2 0 K exhibits dose-dependence, but it is better described by first order kinetics; this peak is believed to correspond to the long-range migration of the self-interstitial, preferentially to impurities where they form clusters. It has been found that subthreshold irradiation results in the annealing of damage already present. This radiation annealing effect may be a contributing factor to the seesaw effect. Another physical process may contribute to the seesaw effect, namely, the trapping of interstitials at impurities and their subsequent detrapping during annealing

  6. Air atmosphere annealing effects on LSO:Ce crystal

    Czech Academy of Sciences Publication Activity Database

    Ding, D.; Feng, H.; Ren, G.; Nikl, Martin; Qin, L.; Pan, S.; Yang, F.

    2010-01-01

    Roč. 57, č. 3 (2010), s. 1272-1277 ISSN 0018-9499 R&D Projects: GA MŠk ME08034 Institutional research plan: CEZ:AV0Z10100521 Keywords : annealing * cerium * LSO * luminescence Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.519, year: 2010

  7. Property change during nanosecond pulse laser annealing of ...

    Indian Academy of Sciences (India)

    Property change during nanosecond pulse laser annealing of amorphous. NiTi thin film ... near equiatomic Ni/Ti composition to produce partially crystallized highly sensitive R-phase spots surrounded by amorphous regions. Scanning ... ratio, shape recovery, damping capacity, chemical resistance, biocompatibility and ...

  8. Thermal annealing and ionic abrasion in ZnTe

    International Nuclear Information System (INIS)

    Bensahel, D.

    1975-01-01

    Thermal annealing of the ZnTe crystal is studied first in order to obtain information on the aspect of the penetration profile. Ionic abrasion is then investigated to find out whether it produces the same effects as ionic implantation, especially for luminescence [fr

  9. Competitive annealing of multiple DNA origami: formation of chimeric origami

    International Nuclear Information System (INIS)

    Majikes, Jacob M; Nash, Jessica A; LaBean, Thomas H

    2016-01-01

    Scaffolded DNA origami are a robust tool for building discrete nanoscale objects at high yield. This strategy ensures, in the design process, that the desired nanostructure is the minimum free energy state for the designed set of DNA sequences. Despite aiming for the minimum free energy structure, the folding process which leads to that conformation is difficult to characterize, although it has been the subject of much research. In order to shed light on the molecular folding pathways, this study intentionally frustrates the folding process of these systems by simultaneously annealing the staple pools for multiple target or parent origami structures, forcing competition. A surprising result of these competitive, simultaneous anneals is the formation of chimeric DNA origami which inherit structural regions from both parent origami. By comparing the regions inherited from the parent origami, relative stability of substructures were compared. This allowed examination of the folding process with typical characterization techniques and materials. Anneal curves were then used as a means to rapidly generate a phase diagram of anticipated behavior as a function of staple excess and parent staple ratio. This initial study shows that competitive anneals provide an exciting way to create diverse new nanostructures and may be used to examine the relative stability of various structural motifs. (paper)

  10. Coalescence during annealing of quiescent immiscible polymer blends

    Czech Academy of Sciences Publication Activity Database

    Dimzoski, Bojan; Fortelný, Ivan; Šlouf, Miroslav; Nevoralová, Martina; Michálková, Danuše; Mikešová, Jana

    -, 011 (2011), s. 1-12 ISSN 1618-7229 R&D Projects: GA AV ČR IAA200500903 Institutional research plan: CEZ:AV0Z40500505 Keywords : coalescence * polymer blends * annealing Subject RIV: BJ - Thermodynamics Impact factor: 0.515, year: 2011 http://www.e-polymers.org/journal/papers/bdimzoski_010311.pdf

  11. The effect of humidity on annealing of polymer optical fibre bragg gratings

    DEFF Research Database (Denmark)

    Woyessa, Getinet; Nielsen, Kristian; Bang, Ole

    2015-01-01

    The effect of humidity on annealing of PMMA based microstructured polymer optical fiber (mPOF) Bragg gratings is studied. Polymer optical fibers (POFs) are annealed in order to release stress formed during the fabrication process. Un-annealed fibers will have high hysteresis and low sensitivity...... to humidity, particularly when operated at high temperature. Typically annealing of PMMA POFs is done at 80oC in an oven with no humidity control and therefor at low humidity. The response to humidity of PMMA FBGs annealed at different levels of humidity at the same temperature has also been studied. PMMA...... FBGs annealed at high humidity have response with no hysteresis and an improved sensitivity which are independent of temperature compared to FBGs annealed at the same temperature but at lower humidity. In addition, PMMA FBG annealed at high humidity showed a permanent blue shift more than 200nm, which...

  12. Elimination of double strand nuclease activity from S1 nuclease prepared from crude alpha amylase.

    Science.gov (United States)

    Hahn, W E; Van Ness, J

    1976-01-01

    Single strand-specific s1 nuclease prepared as previously described from crude alpha amylase by DEAE-cellulose chromatography also contains nuclease which degrades double strand nucleic acid. The double strand activity can be removed by repeating the DEAE-cellulose chromatography procedure at least two additional times. S1 nuclease prepared by this procedure does not degrade double strand sheared DNA as measured by Sephadex chromatography. Under the same conditions single strand DNA is completely degraded. Thus, S1 nuclease prepared by this procedure is suitable for use in removing single strand regions in DNA/DNA duplexes and DNA/RNA hybrids. PMID:940774

  13. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There

  14. DNA strand exchange catalyzed by molecular crowding in PEG solutions

    KAUST Repository

    Feng, Bobo

    2010-01-01

    DNA strand exchange is catalyzed by molecular crowding and hydrophobic interactions in concentrated aqueous solutions of polyethylene glycol, a discovery of relevance for understanding the function of recombination enzymes and with potential applications to DNA nanotechnology. © 2010 The Royal Society of Chemistry.

  15. Detection of polymorphisms in leptin gene using single strand ...

    African Journals Online (AJOL)

    student

    Sachs B1 variant. Nucleic Acids Res. 19, 405-406. Barroso, A., Dunner, S. & Cañon, J., 1998. Technical note: detection of bovine kappa-casein variants A, B,. C and E by means of Polymerase Chain Reaction-Single Strand Conformation ...

  16. Guide Strand 3'-End Modifications Regulate siRNA Specificity.

    Science.gov (United States)

    Valenzuela, Rachel A P; Onizuka, Kazumitsu; Ball-Jones, Alexi A; Hu, Tiannan; Suter, Scott R; Beal, Peter A

    2016-12-14

    Short interfering RNA (siRNA)-triggered gene knockdown through the RNA interference (RNAi) pathway is widely used to study gene function, and siRNA-based therapeutics are in development. However, as the guide strand of an siRNA can function like a natural microRNA (miRNA), siRNAs often repress hundreds of off-target transcripts with complementarity only to the seed region (nucleotides 2-8) of the guide strand. Here, we describe novel guide strand 3'-end modifications derived from 1-ethynylribose (1-ER) and copper-catalyzed azide-alkyne cycloaddition reactions and evaluate their impact on target versus miRNA-like off-target knockdown. Surprisingly, when positioned at the guide strand 3'-end, the parent 1-ER modification substantially reduced off-target knockdown while having no measurable effect on on-target knockdown potency. In addition, these modifications were shown to modulate siRNA affinity for the hAgo2 PAZ domain. However, the change in PAZ domain binding affinity was not sufficient to predict the modification's effect on miRNA-like off targeting. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Characterization of Nb3Sn Strand for ITER

    Energy Technology Data Exchange (ETDEWEB)

    Cheggour, Najib; Goodrich, Loren F

    2012-05-03

    We have an ongoing research program for characterization of superconductor composite strands, the principal output of which is sensitive measurements of critical current Ic over a broad range of the essential parameters: longitudinal strain µ, temperature T, and magnetic field B. This features a new apparatus for integrated measurement of Ic(µ,T,B) on the same, long-conductor sample without remounting.

  18. Short Communication A near mass stranding of cetaceans in St ...

    African Journals Online (AJOL)

    A group of 70 false killer whales Pseudorca crassidens and 124 bottlenose dolphins Tursiops sp., and a separate group of 13 Risso's dolphins Grampus griseus, assembled close inshore off a known mass-stranding site in St Helena Bay, South Africa, in October 2003. However, only a single Risso's dolphin attempted to ...

  19. Chromatin remodelers in the DNA double strand break response

    NARCIS (Netherlands)

    Smeenk, Godelieve

    2012-01-01

    During my PhD project, I studied the role of several chromatin remodelers in the DNA double strand break (DSB) response. We discovered that both CHD4 and SMARCA5 are required for ubiquitin signaling through the E3 ubiquitin ligases RNF8 and RNF168, which is a central signaling event in the response

  20. Applications of Strand-Specific in situ Hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Goodwin, E.H.; Meyne, J.; Bailey, S.M.; Quigley, D.; Smith, L.; Tennyson, R.

    1997-01-01

    This is the final report of a three-year, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). Fluorescence in situ hybridization (FISH) is used to determine the location of specific DNA sequences on chromosomes. It is an effective tool in genomic mapping and is finding increasing use in medical diagnosis. A ''strand-specific'' version of FISH has been developed in the Life Sciences Division of LANL. The new procedure, named CO-FISH, reveals not only location but also the 5'-to-3'direction of a target sequence, such as the sense strand of a gene. This project was designed to investigate applications of the new technique. Strand-specific FISH was found to be useful and informative for genomic mapping of repetitive DNA sequences. The method provide a valuable new tool for investigating the mechanisms of aneuploidy inducing agents and the cytogenetic phenomena called lateral asymmetry. Finally, using strand-specific FISH, the authors were able to detect certain types of chromosome aberrations (isochromosomes, inversions and Robertsonian translocations) that can be difficult to observe with standard techniques.

  1. Facile synthesis of Graphene Oxide/Double-stranded DNA ...

    Indian Academy of Sciences (India)

    DNA to single-stranded DNA. The GO/dsDNA hydrogels have shown controlled porosity by changing the concentration of the components. The strong binding between dsDNA and graphene is proved by Raman spectroscopy. Keywords. Graphene oxide; DNA; hydrogels; liquid crystals; self-assembly. 1. Introduction.

  2. 75 FR 8113 - Prestressed Concrete Steel Wire Strand From China

    Science.gov (United States)

    2010-02-23

    ... INTERNATIONAL TRADE COMMISSION [Investigation Nos. 701-TA-464 and 731-TA-1160 (Final)] Prestressed Concrete Steel Wire Strand From China AGENCY: United States International Trade Commission. ACTION: Revised schedule for the subject investigations. DATES: Effective Date: February 16, 2010. FOR FURTHER INFORMATION...

  3. 75 FR 4104 - Prestressed Concrete Steel Wire Strand From China

    Science.gov (United States)

    2010-01-26

    ... retarded, by reason of subsidized and less-than-fair-value imports from China of prestressed concrete steel... in prestressed concrete (both pre-tensioned and post- tensioned) applications. The product definition..., producers, or exporters in China of prestressed concrete steel wire strand, and that such products are being...

  4. Short Communication A stranding of Balaenoptera borealis (Lesson ...

    African Journals Online (AJOL)

    Short Communication A stranding of Balaenoptera borealis (Lesson 1828) from Patagonia, Argentina, with notes on parasite infestation and diet. MS Leonardi, MF Grandi, NA García, G Svendsen, MA Romero, R González, EA Crespo ...

  5. The effect of pre-annealing on the structural evolution and optical ...

    Indian Academy of Sciences (India)

    65

    Ag thin films of 5nm thickness were deposited on glass substrates by thermal evaporation. The films were divided into two sets out of which one set was not annealed and the other set was subjected to pre-annealing at 300oC for 2 hrs in air. The un-annealed and pre-annealed films were exposed to iodine vapours at room ...

  6. Optimized Laser Thermal Annealing on Germanium for High Dopant Activation and Low Leakage Current

    DEFF Research Database (Denmark)

    Shayesteh, Maryam; O' Connell, Dan; Gity, Farzan

    2014-01-01

    In this paper, state-of-the-art laser thermal annealing is used to fabricate Ge diodes. We compared the effect of laser thermal annealing (LTA) and rapid thermal annealing (RTA) on dopant activation and electrical properties of phosphorus and Arsenic-doped n +/p junctions. Using LTA, high carrier...

  7. Electro-optical characteristics of indium tin oxide (ITO) films: effect of thermal annealing

    Energy Technology Data Exchange (ETDEWEB)

    Morgan, D.V.; Salehi, A.; Aliyu, Y.H.; Bunce, R.W. [University of Wales College of Cardiff (United Kingdom). School of Electrical, Electronics and System Engineering

    1996-02-01

    The effect of thermal annealing on the electrical and optical characteristics of ITO films prepared by reactive sputtering and thermal evaporation have been studied. The effect of the thermal annealing is to improve the conductivity and the optical transmission in the shorter wavelength region. The conductivity of the films increases with annealing temperature, this behaviour is associated with grain growth in the film. (author)

  8. Nitrogen aggregation in Ib type synthetic diamonds at low pressure and high-temperature annealing

    International Nuclear Information System (INIS)

    Kazyuchits, N.M.; Rusetskij, M.S.; Latushko, Ya.I.; Kazyuchits, V.N.; Zajtsev, A.M.

    2015-01-01

    A new technique for annealing of diamonds at low pressure and high temperature (LPHT) is considered. The absorption spectra of synthetic Ib diamonds are given before and after annealing. This is evident from a comparison of the spectra that nitrogen aggregation process takes place at the LPHT annealing diamond. (authors)

  9. 78 FR 31577 - Diffusion-Annealed, Nickel-Plated Flat-Rolled Steel Products From Japan

    Science.gov (United States)

    2013-05-24

    ...)] Diffusion-Annealed, Nickel-Plated Flat-Rolled Steel Products From Japan Determination On the basis of the... reason of imports from Japan of diffusion-annealed, nickel-plated flat-rolled steel products, provided... diffusion-annealed, nickel-plated flat-rolled steel products from Japan. Accordingly, effective March 27...

  10. Strand asymmetry and codon usage bias in the chloroplast genome of Euglena gracilis

    Science.gov (United States)

    Morton, Brian R.

    1999-01-01

    It is shown that the two strands of the chloroplast genome from Euglena gracilis are asymmetric with regards to nucleotide composition. This asymmetry switches at both the origin of replication and a location that is halfway around the circular genome from the origin. In both halves of the genome the leading strand is G+T-rich, having a bias toward G over C and T over A, and the lagging strand is A+C-rich. This asymmetry is probably the result of a difference in mutation dynamics between the leading and lagging strands. In addition to composition asymmetry, the two strands differ with regards to coding content. In both halves of the genome the vast majority of genes are coded by the leading strand. These two aspects of strand asymmetry are then applied to a statistical test for selection on codon usage. The results indicate that selection on codon usage is limited to genes on the leading strand; no gene on the A+C-rich lagging strand shows evidence for selection, suggesting that highly expressed genes are coded predominantly on the strand of DNA that is the leading strand during replication. On the basis of these observations it is proposed that the coding strand bias is generated by selection to code highly expressed genes on the leading strand to coordinate the direction of replication and transcription, thereby increasing the potential rate of both reactions. PMID:10220429

  11. TrmBL2 from Pyrococcus furiosus Interacts Both with Double-Stranded and Single-Stranded DNA.

    Directory of Open Access Journals (Sweden)

    Sebastian Wierer

    Full Text Available In many hyperthermophilic archaea the DNA binding protein TrmBL2 or one of its homologues is abundantly expressed. TrmBL2 is thought to play a significant role in modulating the chromatin architecture in combination with the archaeal histone proteins and Alba. However, its precise physiological role is poorly understood. It has been previously shown that upon binding TrmBL2 covers double-stranded DNA, which leads to the formation of a thick and fibrous filament. Here we investigated the filament formation process as well as the stabilization of DNA by TrmBL2 from Pyroccocus furiosus in detail. We used magnetic tweezers that allow to monitor changes of the DNA mechanical properties upon TrmBL2 binding on the single-molecule level. Extended filaments formed in a cooperative manner and were considerably stiffer than bare double-stranded DNA. Unlike Alba, TrmBL2 did not form DNA cross-bridges. The protein was found to bind double- and single-stranded DNA with similar affinities. In mechanical disruption experiments of DNA hairpins this led to stabilization of both, the double- (before disruption and the single-stranded (after disruption DNA forms. Combined, these findings suggest that the biological function of TrmBL2 is not limited to modulating genome architecture and acting as a global repressor but that the protein acts additionally as a stabilizer of DNA secondary structure.

  12. Inter-strand resistance measurements in the termination of the ITER SULTAN samples

    International Nuclear Information System (INIS)

    Cau, F; Bruzzone, P

    2009-01-01

    In cabled conductors a perfect uniformity of the current among the strands is hardly reached, due to the non-homogeneity of the contact resistance distribution between the strands and the copper of the electrical terminations. In the case of large current unbalance, the overloaded strands hit the critical surface at high field early, developing a current sharing voltage, which drives the redistribution of the current, mainly in the electrical terminations where the inter-strand resistance is lower than in the high field conductor. If the inter-strand resistance in the termination is low, the voltage levels are sufficiently low to allow an effective redistribution of the current to the less loaded strands. The inter-strand resistance of three different termination layouts of ITER short length samples is measured to make a database available which can be used to qualify the layout of the joints and their capability of redistributing the current among the strands.

  13. Strain measurements by neutron diffraction on Nb3Sn cable with stainless steel reinforcement strands

    International Nuclear Information System (INIS)

    Takahashi, K; Oguro, H; Awaji, S; Watanabe, K; Harjo, S; Aizawa, K

    2012-01-01

    Internal lattice strains under a tensile load for a seven-strand cable consisting of three pre-bent CuNb/Nb 3 Sn and four stainless steel strands were measured by neutron diffraction at room temperature in order to investigate the improvement of mechanical properties of Nb 3 Sn strands. Stress–lattice strain curves of Nb 3 Sn and stainless steel strands were obtained, and the effective stress for a Nb 3 Sn strand was estimated by considering the load sharing of a stainless strand. It was found that the reinforcement with stainless steel strands is an effective way to reduce an applied electromagnetic tensile load for Nb 3 Sn strands for superconducting magnet application. (paper)

  14. Corrosion characteristics of post-tensioning strands in ungrouted ducts : summary.

    Science.gov (United States)

    2011-01-01

    To prevent corrosion of post-tensioning strands, FDOT construction specifications currently require post-tensioning ducts to be grouted within seven calendar days of strand installation. This period challenges construction schedules on large projects...

  15. Functions of Human Rad51 and Other Recombination Factors in DNA Double-Strand Break Repair

    National Research Council Canada - National Science Library

    Sigurdsson, Stefan

    2004-01-01

    ... of. DNA double strand breaks. Genetic and biochemical studies have suggested that the function of genes of the RAD52 group is highly conserved from yeast to humans and interestingly the efficiency of DNA double strand break...

  16. 75 FR 32747 - Prestressed Concrete Steel Wire Strand from Mexico: Rescission of Antidumping Duty Administrative...

    Science.gov (United States)

    2010-06-09

    ... DEPARTMENT OF COMMERCE INTERNATIONAL TRADE ADMINISTRATION [A-201-831] Prestressed Concrete Steel Wire Strand from Mexico: Rescission of Antidumping Duty Administrative Review AGENCY: Import... request an administrative review of the antidumping duty order on prestressed concrete steel wire strand...

  17. Cyclical Annealing Technique To Enhance Reliability of Amorphous Metal Oxide Thin Film Transistors.

    Science.gov (United States)

    Chen, Hong-Chih; Chang, Ting-Chang; Lai, Wei-Chih; Chen, Guan-Fu; Chen, Bo-Wei; Hung, Yu-Ju; Chang, Kuo-Jui; Cheng, Kai-Chung; Huang, Chen-Shuo; Chen, Kuo-Kuang; Lu, Hsueh-Hsing; Lin, Yu-Hsin

    2018-02-26

    This study introduces a cyclical annealing technique that enhances the reliability of amorphous indium-gallium-zinc-oxide (a-IGZO) via-type structure thin film transistors (TFTs). By utilizing this treatment, negative gate-bias illumination stress (NBIS)-induced instabilities can be effectively alleviated. The cyclical annealing provides several cooling steps, which are exothermic processes that can form stronger ionic bonds. An additional advantage is that the total annealing time is much shorter than when using conventional long-term annealing. With the use of cyclical annealing, the reliability of the a-IGZO can be effectively optimized, and the shorter process time can increase fabrication efficiency.

  18. Influence of phosphate esters on the annealing properties of starch

    DEFF Research Database (Denmark)

    Wischmann, Bente; Muhrbeck, Per

    1998-01-01

    The effects of annealing on native potato, waxy maize, and phosphorylated waxy maize starches were compared. Phosphorylated waxy maize starch responded to annealing in a manner between that of the naturally phosphorylated potato starch and that of the native waxy maize starch. The gelatinisation...... end-point temperature was increased, whereas in the native waxy maize it was decreased. On the other hand, the onset temperature change was much larger in potato starch than in the two waxy maize starches. Steeping also yielded intermediate effects on the phosphorylated waxy maize starch....... It was concluded that the phosphate groups have similar effects as they do in the native, naturally phosphorylated potato starch, although the substitution pattern is not entirely the same in the artificially phosphorylated starch....

  19. Nickel silicide formation using multiple-pulsed laser annealing

    International Nuclear Information System (INIS)

    Setiawan, Y.; Lee, P. S.; Pey, K. L.; Wang, X. C.; Lim, G. C.; Chow, F. L.

    2007-01-01

    The effect of multiple-pulsed laser irradiation on Ni silicide formation in Ni(Ti)/Si system was studied. A layered structure consisting of both crystalline NiSi 2 and Ni-rich Ni-Si amorphous phases with a protective TiO x overlayer was formed after five-pulsed laser annealing at 0.4 J cm -2 . Different solidification velocities caused by a variation in the atomic concentration across the melt have led to the formation of this layered structure. On the other hand, by increasing the number of laser pulses, a continuous layer of polycrystalline NiSi was obtained after a 20-pulsed laser annealing at 0.3 J cm -2 laser fluence. Its formation is attributed to a better elemental mixing which occurred during subsequent pulses. Enhancement of surface absorption and remelting of the phases formed is proposed as the mechanism governing the continuous NiSi layer formation

  20. Radiation annealing of gallium arsenide implanted with sulphur

    CERN Document Server

    Ardyshev, V M

    2002-01-01

    Sulfur ions were implanted in a semi-insulating GaAs. Photon annealing (805 deg C/(10-12) s) and the thermal one (800 deg C/30 min) were conducted under SiO sub 2 -films coating obtained by different ways. Contents of GaAs components in films were determined from Rutherford backscattering spectra; concentration profiles of electrons were measured by the voltage-capacitance method. Diffusion of sulfur was shown to go in two directions - to the surface and into bulk of GaAs. The first process was induced by vacancies that had been formed near the surface of semiconductors during the dielectric coating. The coefficient of the bulk-diffusion and diffusion-to-surface of sulfur ions under photon annealing was twice as much as that under thermal one. The doping efficiency was also larger

  1. Parallel simulated annealing algorithms for cell placement on hypercube multiprocessors

    Science.gov (United States)

    Banerjee, Prithviraj; Jones, Mark Howard; Sargent, Jeff S.

    1990-01-01

    Two parallel algorithms for standard cell placement using simulated annealing are developed to run on distributed-memory message-passing hypercube multiprocessors. The cells can be mapped in a two-dimensional area of a chip onto processors in an n-dimensional hypercube in two ways, such that both small and large cell exchange and displacement moves can be applied. The computation of the cost function in parallel among all the processors in the hypercube is described, along with a distributed data structure that needs to be stored in the hypercube to support the parallel cost evaluation. A novel tree broadcasting strategy is used extensively for updating cell locations in the parallel environment. A dynamic parallel annealing schedule estimates the errors due to interacting parallel moves and adapts the rate of synchronization automatically. Two novel approaches in controlling error in parallel algorithms are described: heuristic cell coloring and adaptive sequence control.

  2. Selection of views to materialize using simulated annealing algorithms

    Science.gov (United States)

    Zhou, Lijuan; Liu, Chi; Wang, Hongfeng; Liu, Daixin

    2002-03-01

    A data warehouse contains lots of materialized views over the data provided by the distributed heterogeneous databases for the purpose of efficiently implementing decision-support or OLAP queries. It is important to select the right view to materialize that answer a given set of queries. The goal is the minimization of the combination of the query evaluation and view maintenance costs. In this paper, we have addressed and designed algorithms for selecting a set of views to be materialized so that the sum of processing a set of queries and maintaining the materialized views is minimized. We develop an approach using simulated annealing algorithms to solve it. First, we explore simulated annealing algorithms to optimize the selection of materialized views. Then we use experiments to demonstrate our approach. The results show that our algorithm works better. We implemented our algorithms and a performance study of the algorithms shows that the proposed algorithm gives an optimal solution.

  3. Effect of annealing treatment on optical properties and ...

    Indian Academy of Sciences (India)

    68

    deposition method (PVD) by using of electron-beam evaporation at the vacuum chamber at 10-5. Torr. ... while silver deposited on the annealed WO3 layer at 300 °C. UV-visible spectrophotometer showed that the ... metals like Au and Cu at λ < 0.5 μm and at ≈ 0.8 μm for Ag [8], silver with both the lowest refractive index ...

  4. Reverse degradation of nickel graphene junction by hydrogen annealing

    Directory of Open Access Journals (Sweden)

    Zhenjun Zhang

    2016-02-01

    Full Text Available Metal contacts are fundamental building components for graphene based electronic devices and their properties are greatly influenced by interface quality during device fabrication, leading to resistance variation. Here we show that nickel graphene junction degrades after air exposure, due to interfacial oxidation, thus creating a tunneling barrier. Most importantly, we demonstrate that hydrogen annealing at moderate temperature (300 0C is an effective technique to reverse the degradation.

  5. Annealing behavior and selected applications of ion-implanted alloys

    International Nuclear Information System (INIS)

    Myers, S.M.

    Thermally activated processes cause ion-implanted metals to evolve from the initial state toward thermodynamic equilibrium. The degree of equilibration is strongly dependent upon temperature and is considered for three temperature regimes which are distinguished by the varying mobilities of interstitial and substitutional atoms. In addition, perturbations resulting from the irradiation environment are discussed. Examples are given of the use of implanted and annealed alloys in studies of diffusion, phase diagrams, and solute trapping

  6. Dating thermal events at Cerro Prieto using fission track annealing

    Energy Technology Data Exchange (ETDEWEB)

    Sanford, S.J.; Elders, W..

    1981-01-01

    Data from laboratory experiments and geologic fading studies were compiled from published sources to produce lines of iso-annealing for apatite in time-temperature space. Fission track ages were calculated for samples from two wells at Cerro Prieto, one with an apparently simple and one with an apparently complex thermal history. Temperatures were estimated by empirical vitrinite reflectance geothermometry, fluid inclusion homogenization and oxygen isotope equilibrium. These estimates were compared with logs of measured borehole temperatures.

  7. Annealing properties of potato starches with different degrees of phosphorylation

    DEFF Research Database (Denmark)

    Muhrbeck, Per; Svensson, E

    1996-01-01

    Changes in the gelatinization temperature interval and gelatinization enthalpy with annealing time at 50 degrees C were followed for a number of potato starch samples, with different degrees of phosphorylation, using differential scanning calorimetry. The gelatinization temperature increased...... for the samples with the highest degree of phosphorylation. The phosphate level remained almost unaffected during the entire process. Therefore, the effects observed are not caused by hydrolysis of the phosphate esters, bur rather by their reorientation toward positions causing less interference of molecular...

  8. Infrared reflectiity and transmissivity of boron implanted, laser annealed silicon

    International Nuclear Information System (INIS)

    Engstrom, H.

    1979-01-01

    The mid-infrared reflectance and transmittance of boron implanted, laser annealed silicon was measured. A Drude model of free holes was used to obtain the dielectric constant of the implanted layer. A least squares adjustment of (1) the ratio of boron concentration to effective hole mass; and (2) the relaxation time gave a fairly good fit to the data and permitted determination of these parameters

  9. Adenovirus DNA replication in vitro: Duplication of single-stranded DNA containing a panhandle structure

    NARCIS (Netherlands)

    Leegwater, P.A.J.; Rombouts, R.F.A.; Vliet, P.C. van der

    1988-01-01

    Adenovirus DNA replicates by displacement of one of the parental strands followed by duplication of the displaced parental single strand (complementary strand synthesis). Displacement synthesis has been performed in a reconstituted system composed of viral and cellular proteins, employing either the

  10. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  11. DNA strand breaks, repair, and survival in x-irradiated mammalian cells

    International Nuclear Information System (INIS)

    Dugle, D.L.; Gillespie, C.J.; Chapman, J.D.

    1976-01-01

    The yields of unrepairable single- and double-strand breaks in the DNA of x-irradiated Chinese hamster cells were measured by low-speed neutral and alkaline sucrose density gradient sedimentation in order to investigate the relation between these lesions and reproductive death. After maximal single-strand rejoining, at all doses, the number of residual single-strand breaks was twice the number of residual double-strand breaks. Both double-strand and unrepairable single-strand breaks were proportional to the square of absorbed dose, in the range 10-50 krad. No rejoining of double-strand breaks was observed. These observations suggest that, in mammalian cells, most double-strand breaks are not repairable, while all single-strand breaks are repaired except those that are sufficiently close on complementary strands to constitute double-strand breaks. Comparison with cell survival measurements at much lower doses suggests that loss of reproductive capacity corresponds to induction of approximately one double-strand break

  12. Probing electronic coupling between adenine bases in RNA strands from synchrotron radiation circular dichroism experiments

    DEFF Research Database (Denmark)

    Nielsen, Lisbeth Munksgård; Hoffmann, Søren Vrønning; Nielsen, Steen Brøndsted

    2012-01-01

    Circular dichroism spectra (176–330 nm) of RNA adenine oligomers, (rA)n (n = 1–10, 12, 15, and 20), reveal electronic coupling between two bases in short strands. The number of interacting bases in long strands is more and larger than that reported previously for the corresponding DNA strands....

  13. 75 FR 36678 - Prestressed Concrete Steel Wire Strand From China; Determinations

    Science.gov (United States)

    2010-06-28

    ... prestressed concrete steel wire strand (PC strand), provided for in subheading 7312.10.30 of the Harmonized... Publication 4162 (June 2010), entitled Prestressed Concrete Steel Wire Strand from China: Investigation Nos... INTERNATIONAL TRADE COMMISSION [Investigation Nos. 701-TA-464 and 731-TA-1160 (Final)] Prestressed...

  14. 77 FR 2958 - Prestressed Concrete Steel Wire Strand From Thailand: Correction to Notice of Opportunity To...

    Science.gov (United States)

    2012-01-20

    ... DEPARTMENT OF COMMERCE International Trade Administration [A-549-820] Prestressed Concrete Steel Wire Strand From Thailand: Correction to Notice of Opportunity To Request Administrative Review AGENCY... prestressed concrete steel wire strand (``PC Strand'') from Thailand. See Antidumping or Countervailing Duty...

  15. Magnetic annealing of plated high saturation magnetization soft magnetic FeCo alloy films

    International Nuclear Information System (INIS)

    Sun, N.X.; Mehdizadeh, S.; Bonhote, C.; Xiao, Q.F.; York, B.

    2005-01-01

    Plated high saturation magnetization soft magnetic FeCo films were annealed in magnetic field; their stress, microstructure, and magnetic properties were investigated. The FeCo films consistently showed a reduced tensile stress after magnetic annealing at temperatures above 255 deg. C. The annealing temperature was found to be the primary factor in reducing the tensile stress, while annealing time was secondary. The FeCo films showed improved soft magnetic properties when subjected to an easy axis annealing with reduced coercivities along both the easy axis and hard axis. Hard axis annealing on these FeCo films caused a switched easy and hard axis in these films when the annealing temperature is above 255 deg. C

  16. Rapid magnetic hardening by rapid thermal annealing in NdFeB-based nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Chu, K.-T.; Jin, Z Q; Chakka, Vamsi M; Liu, J P [Department of Physics, University of Texas at Arlington, Arlington, TX 76019 (United States)

    2005-11-21

    A systematic study of heat treatments and magnetic hardening of NdFeB-based melt-spun nanocomposite ribbons have been carried out. Comparison was made between samples treated by rapid thermal annealing and by conventional furnace annealing. Heating rates up to 200 K s{sup -1} were adopted in the rapid thermal processing. It was observed that magnetic hardening can be realized in an annealing time as short as 1 s. Coercivity of 10.2 kOe in the nanocomposites has been obtained by rapid thermal annealing for 1 s, and prolonged annealing did not give any increase in coercivity. Detailed results on the effects of annealing time, temperature and heating rate have been obtained. The dependence of magnetic properties on the annealing parameters has been investigated. Structural characterization revealed that there is a close correlation between magnetic hardening and nanostructured morphology. The coercivity mechanism was also studied by analysing the magnetization minor loops.

  17. Effect of post annealing temperatures on microstructures and mechanical properties of cryorolled 5052 aluminium sheet alloy

    Science.gov (United States)

    Anas, N. M.; Umar, Z. A. A.; Zuhailawati, H.; Anasyida, A. S.

    2017-07-01

    The effect of post annealing temperature of cryorolled 5052 Al alloy after cryorolling process at 30% thickness reduction was investigated, focusing on the evolution of microstructures and mechanical properties. The evolution of microstructure was investigated using optical microscopy (OM). The mechanical behaviour of the samples have been evaluated through Vickers hardness and tensile test performed at room temperature. The results showed that the post annealing on cryorolled 5052 Al alloy have enhanced the ductility with sacrificing the hardness and strength. The lattice strain of post annealed 5052 Al alloy decreased with increasing of annealing temperatures. The evolution of microstructure of the post annealed 5052 Al alloy showed equiaxed grains at 200°C and grain coarsening as post annealing temperature increases to 350°C. The result of crystallite size confirmed the grain size increased as the post annealing temperature rises.

  18. Nuclear techniques of analysis in diamond synthesis and annealing

    Energy Technology Data Exchange (ETDEWEB)

    Jamieson, D. N.; Prawer, S.; Gonon, P.; Walker, R.; Dooley, S.; Bettiol, A.; Pearce, J. [Melbourne Univ., Parkville, VIC (Australia). School of Physics

    1996-12-31

    Nuclear techniques of analysis have played an important role in the study of synthetic and laser annealed diamond. These measurements have mainly used ion beam analysis with a focused MeV ion beam in a nuclear microprobe system. A variety of techniques have been employed. One of the most important is nuclear elastic scattering, sometimes called non-Rutherford scattering, which has been used to accurately characterise diamond films for thickness and composition. This is possible by the use of a database of measured scattering cross sections. Recently, this work has been extended and nuclear elastic scattering cross sections for both natural boron isotopes have been measured. For radiation damaged diamond, a focused laser annealing scheme has been developed which produces near complete regrowth of MeV phosphorus implanted diamonds. In the laser annealed regions, proton induced x-ray emission has been used to show that 50 % of the P atoms occupy lattice sites. This opens the way to produce n-type diamond for microelectronic device applications. All these analytical applications utilize a focused MeV microbeam which is ideally suited for diamond analysis. This presentation reviews these applications, as well as the technology of nuclear techniques of analysis for diamond with a focused beam. 9 refs., 6 figs.

  19. Nuclear techniques of analysis in diamond synthesis and annealing

    International Nuclear Information System (INIS)

    Jamieson, D. N.; Prawer, S.; Gonon, P.; Walker, R.; Dooley, S.; Bettiol, A.; Pearce, J.

    1996-01-01

    Nuclear techniques of analysis have played an important role in the study of synthetic and laser annealed diamond. These measurements have mainly used ion beam analysis with a focused MeV ion beam in a nuclear microprobe system. A variety of techniques have been employed. One of the most important is nuclear elastic scattering, sometimes called non-Rutherford scattering, which has been used to accurately characterise diamond films for thickness and composition. This is possible by the use of a database of measured scattering cross sections. Recently, this work has been extended and nuclear elastic scattering cross sections for both natural boron isotopes have been measured. For radiation damaged diamond, a focused laser annealing scheme has been developed which produces near complete regrowth of MeV phosphorus implanted diamonds. In the laser annealed regions, proton induced x-ray emission has been used to show that 50 % of the P atoms occupy lattice sites. This opens the way to produce n-type diamond for microelectronic device applications. All these analytical applications utilize a focused MeV microbeam which is ideally suited for diamond analysis. This presentation reviews these applications, as well as the technology of nuclear techniques of analysis for diamond with a focused beam. 9 refs., 6 figs

  20. Annealing-induced change in quantum dot chain formation mechanism

    Directory of Open Access Journals (Sweden)

    Tyler D. Park

    2014-12-01

    Full Text Available Self-assembled InGaAs quantum dot chains were grown using a modified Stranski-Krastanov method in which the InGaAs layer is deposited under a low growth temperature and high arsenic overpressure, which suppresses the formation of dots until a later annealing process. The dots are capped with a 100 nm GaAs layer. Three samples, having three different annealing temperatures of 460°C, 480°C, and 500°C, were studied by transmission electron microscopy. Results indicate two distinct types of dot formation processes: dots in the 460°C and 480°C samples form from platelet precursors in a one-to-one ratio whereas the dots in the sample annealed at 500°C form through the strain-driven self-assembly process, and then grow larger via an additional Ostwald ripening process whereby dots grow into larger dots at the expense of smaller seed islands. There are consequently significant morphological differences between the two types of dots, which explain many of the previously-reported differences in optical properties. Moreover, we also report evidence of indium segregation within the dots, with little or no indium intermixing between the dots and the surrounding GaAs barrier.

  1. Chromium depletion from stainless steels during vacuum annealing

    International Nuclear Information System (INIS)

    Smith, A.F.; Hales, R.

    1977-01-01

    During selective chromium oxidation of stainless steels the changes in chromium concentration at the metal surface and in the metal have an important bearing on the overall oxidation performance. It has been proposed that an analogue of chromium behaviour during selective oxidation is obtained from volatilisation of chromium during high temperature vacuum annealing. In the present report the evaporation of chromium from 316 type of steel, vacuum annealed at 1,000 0 C, has been investigated by means of energy dispersive X-ray analysis and by neutron activation analysis. It was established that chromium loss from austenitic stainless steels is rate controlled by interdiffusion in the alloy. As predicted the chromium concentration at the metal surface decreased with increasing vacuum annealing time. The chromium depletion profile in the metal was in good agreement with the previously derived model apart from an anomalous region near the surface. Here the higher resolution of the neutron activation technique indicated a zone within approximately 2μm of the surface where the chromium concentration decreased more steeply than expected. (orig.) [de

  2. Regrowth zones in laser annealed radiation damaged diamond

    International Nuclear Information System (INIS)

    Jamieson, D.N.; Prawer, S.; Dooley, S.P.; Kalish, R.; Technion-Israel Inst. of Tech., Haifa

    1993-01-01

    Focused laser annealing of ion implanted diamond with a 15 μm diameter laser spot produces as variety of effects that depend on the power density of the laser. Channeling Contrast Microscopy (CCM) provides a relatively straight forward, rapid, method to analyse the annealed regions of the diamond to characterize the effects. In order of increasing laser power density, effects that are observed include: regrowth of the end of range damage of the ion implantation, formation of a buried graphitic layer and complete graphitization of the surface of the diamond down to the bottom of the original damage layer. Information provided by CCM leads to an understanding the causes of these effects and provides insight into the carbon phase diagram in the neighbourhood of the graphite to diamond phase transition. Analysis of the effects of laser annealing by CCM are complicated by the swelling of the diamond lattice caused by the original ion implantation, compaction following regrowth and the effect of the analysis beam irradiation itself. 12 refs., 5 figs

  3. Damage and in-situ annealing during ion implantation

    International Nuclear Information System (INIS)

    Sadana, D.K.; Washburn, J.; Byrne, P.F.; Cheung, N.W.

    1982-11-01

    Formation of amorphous (α) layers in Si during ion implantation in the energy range 100 keV-11 MeV and temperature range liquid nitrogen (LN)-100 0 C has been investigated. Cross-sectional transmission electron microscopy (XTEM) shows that buried amorphous layers can be created for both room temperature (RT) and LN temperature implants, with a wider 100 percent amorphous region for the LN cooled case. The relative narrowing of the α layer during RT implantation is attributed to in-situ annealing. Implantation to the same fluence at temperatures above 100 0 C does not produce α layers. To further investigate in situ annealing effects, specimens already containing buried α layers were further irradiated with ion beams in the temperature range RT-400 0 C. It was found that isolated small α zones (less than or equal to 50 diameter) embedded in the crystalline matrix near the two α/c interfaces dissolved into the crystal but the thickness of the 100 percent α layer was not appreciably affected by further implantation at 200 0 C. A model for in situ annealing during implantation is presented

  4. Microstructural evolution of nanostructure 7075 aluminum alloy during isothermal annealing

    Energy Technology Data Exchange (ETDEWEB)

    Yazdian, N. [Department of Materials Engineering, Nanotechnology and Advanced Materials Institute, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of); Karimzadeh, F., E-mail: karimzadeh_f@cc.iut.ac.i [Department of Materials Engineering, Nanotechnology and Advanced Materials Institute, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of); Tavoosi, M. [Department of Materials Engineering, Nanotechnology and Advanced Materials Institute, Isfahan University of Technology, Isfahan 84156-83111 (Iran, Islamic Republic of)

    2010-03-18

    This work focuses on structural changes of nanostructure 7075 aluminum alloy (Al7075) during isothermal annealing. Nanostructured Al7075 was synthesized by mechanical alloying. The produced structure was isothermally heat-treated at 125-500 {sup o}C for 1-3 h under argon atmosphere. The as-milled and annealed powders were characterized by scanning electron microscopy (SEM) and X-ray diffraction (XRD). The results showed that after 15 h of milling, an Al-Zn-Mg-Cu supersaturated solid solution with a grain size of 35 nm was obtained. By increasing the milling time up to 15 h, the MgZn phase precipitated from supersaturated solid solution. Large variety of precipitants including MgZn, MgZn{sub 2} (at temperatures range between 200 and 400 {sup o}C), AlCuMg and Al{sub 2}Cu (at temperatures range between 300 and 500 {sup o}C) were formed during isothermal annealing.

  5. Quantification of annealed microstructures in ARB processed aluminum

    International Nuclear Information System (INIS)

    Kamikawa, Naoya; Tsuji, Nobuhiro; Huang, Xiaoxu; Hansen, Niels

    2006-01-01

    High-purity aluminum (99.99% purity) deformed by accumulative roll bonding to an equivalent strain of 4.8 has been characterized by transmission electron microscopy and electron backscatter diffraction techniques in the deformed state and after various annealing treatments. These two techniques are compared and discussed. The majority of the structure in the as-deformed state is composed of equiaxed crystallites surrounded mostly by high-angle boundaries with misorientation angle above 15 o . However, regions that contain a high concentration of low-angle boundaries with misorientation angle below 15 o in a lamellar structure elongated along the rolling direction have also been observed. The microstructure is correlated with the local texture as the equiaxed structure contains a mixture of texture components whereas the lamellar structure has orientations corresponding to rolling or shear texture components. Annealing of deformed specimens causes structural coarsening without removing the regions with a high concentration of low-angle boundaries. Heat treatment for a short period of time (0.5 h) leads to the start of recrystallization at 200 deg. C, whereas a heat treatment at 175 deg. C for an extended period (6 h) allows heat treatments to be carried out at temperatures above 200 deg. C without initiation of recrystallization. The two-step process is a promising route for producing almost uniform equiaxed structures by annealing of samples that have been deformed to large strains

  6. Maximum-Entropy Inference with a Programmable Annealer

    Science.gov (United States)

    Chancellor, Nicholas; Szoke, Szilard; Vinci, Walter; Aeppli, Gabriel; Warburton, Paul A.

    2016-03-01

    Optimisation problems typically involve finding the ground state (i.e. the minimum energy configuration) of a cost function with respect to many variables. If the variables are corrupted by noise then this maximises the likelihood that the solution is correct. The maximum entropy solution on the other hand takes the form of a Boltzmann distribution over the ground and excited states of the cost function to correct for noise. Here we use a programmable annealer for the information decoding problem which we simulate as a random Ising model in a field. We show experimentally that finite temperature maximum entropy decoding can give slightly better bit-error-rates than the maximum likelihood approach, confirming that useful information can be extracted from the excited states of the annealer. Furthermore we introduce a bit-by-bit analytical method which is agnostic to the specific application and use it to show that the annealer samples from a highly Boltzmann-like distribution. Machines of this kind are therefore candidates for use in a variety of machine learning applications which exploit maximum entropy inference, including language processing and image recognition.

  7. Metode Simulated Annealing untuk Optimasi Penjadwalan Perkuliahan Perguruan Tinggi

    Directory of Open Access Journals (Sweden)

    Wiktasari Sari

    2016-12-01

    Full Text Available Course scheduling an assignment of courses and lecturers in the available time slots involving certain restrictions. Simulated annealing is a heuristic method can be used as search method and provide acceptable solutions with good results. The research aims to make scheduling courses at the college using simulated annealing using five variables data that lecturer courses, the time slot is comprised of the day and the time period and class room. The research has two objective functions to be generated, the first is the assignment of a lecturer on courses that will be of teaching, second lecturers and their assignment course on the time slot and the room available. The objective function is calculated by taking into account the restrictions involved to produce the optimal solution. The validation is performed by testing to simulated annealing method with an varian average of 77.791% of the data variance can reach a solution with a standard deviation of 3.931509. In this research given the method of solution in the use of the remaining search space to be reused by the data that is unallocated.

  8. Dynamic protein assembly by programmable DNA strand displacement

    Science.gov (United States)

    Chen, Rebecca P.; Blackstock, Daniel; Sun, Qing; Chen, Wilfred

    2018-03-01

    Inspired by the remarkable ability of natural protein switches to sense and respond to a wide range of environmental queues, here we report a strategy to engineer synthetic protein switches by using DNA strand displacement to dynamically organize proteins with highly diverse and complex logic gate architectures. We show that DNA strand displacement can be used to dynamically control the spatial proximity and the corresponding fluorescence resonance energy transfer between two fluorescent proteins. Performing Boolean logic operations enabled the explicit control of protein proximity using multi-input, reversible and amplification architectures. We further demonstrate the power of this technology beyond sensing by achieving dynamic control of an enzyme cascade. Finally, we establish the utility of the approach as a synthetic computing platform that drives the dynamic reconstitution of a split enzyme for targeted prodrug activation based on the sensing of cancer-specific miRNAs.

  9. Hybrid fur rendering: combining volumetric fur with explicit hair strands

    DEFF Research Database (Denmark)

    Andersen, Tobias Grønbeck; Falster, Viggo; Frisvad, Jeppe Revall

    2016-01-01

    Hair is typically modeled and rendered using either explicitly defined hair strand geometry or a volume texture of hair densities. Taken each on their own, these two hair representations have difficulties in the case of animal fur as it consists of very dense and thin undercoat hairs in combination...... with coarse guard hairs. Explicit hair strand geometry is not well-suited for the undercoat hairs, while volume textures are not well-suited for the guard hairs. To efficiently model and render both guard hairs and undercoat hairs, we present a hybrid technique that combines rasterization of explicitly...... defined guard hairs with ray marching of a prismatic shell volume with dynamic resolution. The latter is the key to practical combination of the two techniques, and it also enables a high degree of detail in the undercoat. We demonstrate that our hybrid technique creates a more detailed and soft fur...

  10. Identification of Cis-Acting Elements on Positive-Strand Subgenomic mRNA Required for the Synthesis of Negative-Strand Counterpart in Bovine Coronavirus

    Directory of Open Access Journals (Sweden)

    Po-Yuan Yeh

    2014-07-01

    Full Text Available It has been demonstrated that, in addition to genomic RNA, sgmRNA is able to serve as a template for the synthesis of the negative-strand [(−-strand] complement. However, the cis-acting elements on the positive-strand [(+-strand] sgmRNA required for (−-strand sgmRNA synthesis have not yet been systematically identified. In this study, we employed real-time quantitative reverse transcription polymerase chain reaction to analyze the cis-acting elements on bovine coronavirus (BCoV sgmRNA 7 required for the synthesis of its (−-strand counterpart by deletion mutagenesis. The major findings are as follows. (1 Deletion of the 5'-terminal leader sequence on sgmRNA 7 decreased the synthesis of the (−-strand sgmRNA complement. (2 Deletions of the 3' untranslated region (UTR bulged stem-loop showed no effect on (−-strand sgmRNA synthesis; however, deletion of the 3' UTR pseudoknot decreased the yield of (−-strand sgmRNA. (3 Nucleotides positioned from −15 to −34 of the sgmRNA 7 3'-terminal region are required for efficient (−-strand sgmRNA synthesis. (4 Nucleotide species at the 3'-most position (−1 of sgmRNA 7 is correlated to the efficiency of (−-strand sgmRNA synthesis. These results together suggest, in principle, that the 5'- and 3'-terminal sequences on sgmRNA 7 harbor cis-acting elements are critical for efficient (−-strand sgmRNA synthesis in BCoV.

  11. Marine Mammals Ashore: A Field Guide for Strandings. Second Edition

    Science.gov (United States)

    2005-01-01

    particularly gillnets, has driven the vaquita to critically low numbers and is a serious threat to other porpoise species throughout their range~ ...... For the... vaquita , as well as all baleen whales except minke, Bryde’s, and gray whales, are also listed under the Endangered Species Act. Stranding response to...Habits: Coastal in bays, estuaries and rivers; frequent offshore banks; weaning at 8-12 months; occur singly, in pairs, or in small groups. Vaquita

  12. Improved single-strand DNA sizing accuracy in capillary electrophoresis.

    OpenAIRE

    Rosenblum, B B; Oaks, F; Menchen, S; Johnson, B

    1997-01-01

    Interpolation algorithms can be developed to size unknown single-stranded (ss) DNA fragments based on their electrophoretic mobilities, when they are compared with the mobilities of standard fragments of known sizes; however, sequence-specific anomalous electrophoretic migration can affect the accuracy and precision of the called sizes of the fragments. We used the anomalous migration of ssDNA fragments to optimize denaturation conditions for capillary electrophoresis. The capillary electroph...

  13. Five strands of math tasks big book : grades pk-2

    CERN Document Server

    Reed, Nat; Forest, Chris

    2009-01-01

    For grades PK-2, our Common Core State Standards-based resource meets the five strands of math concepts addressed by the NCTM standards and encourages the students to learn and review the concepts in unique ways. Included are challenging problem-solving tasks which will push the boundaries of critical thought and demonstrate to students the importance of mathematical problems in Number & Operations, Geometry, Measurement, Data Analysis & Probability and Algebra using real world situations.

  14. Oriented strand board: new material for building construction

    International Nuclear Information System (INIS)

    Paridah Md Tahir; Ong, L.L.

    2001-01-01

    The paper will attempt to show the suitability and competitiveness of oriented strand board (OSB) in building construction. One important factor underlining the success of this product is the availability of the wood raw material. Plantation timbers such as rubberwood, paraserianthes falcataria, acacia crassicarpa, A. auriculiformis and A. mangium have been identified as the major source of this industry. We will focus on the domestic market as well as export market especially on the Asia Pacific region

  15. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  16. A novel protein that recognizes DNA strand break

    Energy Technology Data Exchange (ETDEWEB)

    Narumi, Issay; Satoh, Katsuya; Kikuchi, Masahiro [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment

    2002-03-01

    By analyzing a DNA damage-sensitive mutant of the radioresistant bacterium Deinococcus radiodurans, we discovered that a novel protein participates in the extreme radiation resistance of this bacterium. The protein (designated PprA for promoting prominent repair) can recognize DNA strand breaks. PprA could bind to double-stranded DNA (dsDNA) in the open circular form and to linear dsDNA, but could not bind to either dsDNA in the closed circular form or single-stranded DNA (ssDNA). Further, under conditions where a substantial amount of degradation of naked DNA fragments would normally result from the activity of E. coli exonuclease III, no DNA degradation was observed when the DNA fragments were preincubated with PprA. These suggest that PprA would protect irradiation-damaged DNA from exonuclease-mediated degradation and consequent DNA repair processes could function. Beside DNA-binding ability, PprA could promote the activities of DNA repair enzymes such as DNA ligase and RecA, suggesting that PprA functions as a DNA repair-promoting protein to potentiate the effectiveness of DNA repair. These properties enable PprA to use the widespread application in vivo and in vitro. (author)

  17. Paul Strand y las paradojas de la modernidad americana

    Directory of Open Access Journals (Sweden)

    Vicente Sánchez Biosca

    2010-06-01

    Full Text Available As contribuições de Strand para o cinema estão estreitamente relacionadas com seus trabalhos fotográficos da época e mesmo com um olhar que, apesar de suas múltiplas diferenças, possui muitos pontos em comum. Se em Manhatta (1920, Strand (em colaboração com Sheeler oferece uma síntese da natureza e da modernidade, em Redes (1934 o que predomina, em contrapartida, é a experiência da arte muralista mexicana e a influência de Eisenstein (em suas andanças por México são os fatores que determinam seus esforços na construção de uma épica dos operários. Mas sem dúvida, o projeto mais ambicioso de Strand (ao mando da produtora Frontier Films foi Native Land, o filme que atendeu às demandas do American Popular Front e as moldou nas palavras dos fundadores da pátria americana.

  18. Commercial possibilities for stranded conventional gas from Alaska's North Slope

    Science.gov (United States)

    Attanasi, E.D.; Freeman, P.A.

    2014-01-01

    Stranded gas resources are defined for this study as gas resources in discrete accumulations that are not currently commercially producible, or producible at full potential, for either physical or economic reasons. Approximately 35 trillion cubic feet (TCF) of stranded gas was identified on Alaska’s North Slope. The commercialization of this resource requires facilities to transport gas to markets where sales revenue will be sufficient to offset the cost of constructing and operating a gas delivery system. With the advent of the shale gas revolution, plans for a gas pipeline to the conterminous US have been shelved (at least temporarily) and the State and resource owners are considering a liquefied natural gas (LNG) export project that targets Asian markets. This paper focuses on competitive conditions for Asian gas import markets by estimating delivered costs of competing supplies from central Asia, Russia, Indonesia, Malaysia, and Australia in the context of a range of import gas demand projections for the period from 2020 to 2040. These suppliers’ costs are based on the cost of developing, producing, and delivering to markets tranches of the nearly 600 TCF of recoverable gas from their own conventional stranded gas fields. The results of these analyses imply that Alaska’s gas exports to Asia will likely encounter substantial competitive challenges. The sustainability of Asia’s oil-indexed LNG pricing is also discussed in light of a potentially intense level of competition.

  19. Human DNA polymerase η accommodates RNA for strand extension.

    Science.gov (United States)

    Su, Yan; Egli, Martin; Guengerich, F Peter

    2017-11-03

    Ribonucleotides are the natural analogs of deoxyribonucleotides, which can be misinserted by DNA polymerases, leading to the most abundant DNA lesions in genomes. During replication, DNA polymerases tolerate patches of ribonucleotides on the parental strands to different extents. The majority of human DNA polymerases have been reported to misinsert ribonucleotides into genomes. However, only PrimPol, DNA polymerase α, telomerase, and the mitochondrial human DNA polymerase (hpol) γ have been shown to tolerate an entire RNA strand. Y-family hpol η is known for translesion synthesis opposite the UV-induced DNA lesion cyclobutane pyrimidine dimer and was recently found to incorporate ribonucleotides into DNA. Here, we report that hpol η is able to bind DNA/DNA, RNA/DNA, and DNA/RNA duplexes with similar affinities. In addition, hpol η, as well as another Y-family DNA polymerase, hpol κ, accommodates RNA as one of the two strands during primer extension, mainly by inserting dNMPs opposite unmodified templates or DNA lesions, such as 8-oxo-2'-deoxyguanosine or cyclobutane pyrimidine dimer, even in the presence of an equal amount of the DNA/DNA substrate. The discovery of this RNA-accommodating ability of hpol η redefines the traditional concept of human DNA polymerases and indicates potential new functions of hpol η in vivo . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Programmable autonomous synthesis of single-stranded DNA

    Science.gov (United States)

    Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng

    2018-02-01

    DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.

  1. The UL8 subunit of the helicase-primase complex of herpes simplex virus promotes DNA annealing and has a high affinity for replication forks.

    Science.gov (United States)

    Bermek, Oya; Weller, Sandra K; Griffith, Jack D

    2017-09-22

    During lytic infection, herpes simplex virus (HSV) DNA is replicated by a mechanism involving DNA recombination. For instance, replication of the HSV-1 genome produces X- and Y-branched structures, reminiscent of recombination intermediates. HSV-1's replication machinery includes a trimeric helicase-primase composed of helicase (UL5) and primase (UL52) subunits and a third subunit, UL8. UL8 has been reported to stimulate the helicase and primase activities of the complex in the presence of ICP8, an HSV-1 protein that functions as an annealase, a protein that binds complementary single-stranded DNA (ssDNA) and facilitates its annealing to duplex DNA. UL8 also influences the intracellular localization of the UL5/UL52 subunits, but UL8's catalytic activities are not known. In this study we used a combination of biochemical techniques and transmission electron microscopy. First, we report that UL8 alone forms protein filaments in solution. Moreover, we also found that UL8 binds to ssDNAs >50-nucletides long and promotes the annealing of complementary ssDNA to generate highly branched duplex DNA structures. Finally, UL8 has a very high affinity for replication fork structures containing a gap in the lagging strand as short as 15 nucleotides, suggesting that UL8 may aid in directing or loading the trimeric complex onto a replication fork. The properties of UL8 uncovered here suggest that UL8 may be involved in the generation of the X- and Y-branched structures that are the hallmarks of HSV replication. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Laser annealing and defect study of chalcogenide photovoltaic materials

    Science.gov (United States)

    Bhatia, Ashish

    Cu(In,Ga)Se2 (CIGSe), CuZnSn(S,Se)4(CZTSSe), etc., are the potential chalcogenide semiconductors being investigated for next-generation thin film photovoltaics (TFPV). While the champion cell efficiency of CIGSe has exceeded 20%, CZTSSe has crossed the 10% mark. This work investigates the effect of laser annealing on CISe films, and compares the electrical characteristics of CIGSe (chalcopyrite) and CZTSe (kesterite) solar cells. Chapter 1 through 3 provide a background on semiconductors and TFPV, properties of chalcopyrite and kesterite materials, and their characterization using deep level transient spectroscopy (DLTS) and thermal admittance spectroscopy (TAS). Chapter 4 investigates electrochemical deposition (nonvacuum synthesis) of CISe followed by continuous wave laser annealing (CWLA) using a 1064 nm laser. It is found that CWLA at ≈ 50 W/cm2 results in structural changes without melting and dewetting of the films. While Cu-poor samples show about 40% reduction in the full width at half maximum of the respective x-ray diffraction peaks, identically treated Cu-rich samples register more than 80% reduction. This study demonstrates that an entirely solid-phase laser annealing path exists for chalcopyrite phase formation and crystallization. Chapter 5 investigates the changes in defect populations after pulse laser annealing in submelting regime of electrochemically deposited and furnace annealed CISe films. DLTS on Schottky diodes reveal that the ionization energy of the dominant majority carrier defect state changes nonmonotonically from 215+/-10 meV for the reference sample, to 330+/-10 meV for samples irradiated at 20 and 30 mJ/cm2, and then back to 215+/-10 meV for samples irradiated at 40 mJ/cm2. A hypothesis involving competing processes of diffusion of Cu and laser-induced generation of In vacancies may explain this behavior. Chapter 6 compares the electrical characteristics of chalcopyrite and kesterite materials. Experiments reveal CZTSe cell has an

  3. The effect of strand bias in Illumina short-read sequencing data

    Directory of Open Access Journals (Sweden)

    Guo Yan

    2012-11-01

    Full Text Available Abstract Background When using Illumina high throughput short read data, sometimes the genotype inferred from the positive strand and negative strand are significantly different, with one homozygous and the other heterozygous. This phenomenon is known as strand bias. In this study, we used Illumina short-read sequencing data to evaluate the effect of strand bias on genotyping quality, and to explore the possible causes of strand bias. Result We collected 22 breast cancer samples from 22 patients and sequenced their exome using the Illumina GAIIx machine. By comparing the consistency between the genotypes inferred from this sequencing data with the genotypes inferred from SNP chip data, we found that, when using sequencing data, SNPs with extreme strand bias did not have significantly lower consistency rates compared to SNPs with low or no strand bias. However, this result may be limited by the small subset of SNPs present in both the exome sequencing and the SNP chip data. We further compared the transition and transversion ratio and the number of novel non-synonymous SNPs between the SNPs with low or no strand bias and those with extreme strand bias, and found that SNPs with low or no strand bias have better overall quality. We also discovered that the strand bias occurs randomly at genomic positions across these samples, and observed no consistent pattern of strand bias location across samples. By comparing results from two different aligners, BWA and Bowtie, we found very consistent strand bias patterns. Thus strand bias is unlikely to be caused by alignment artifacts. We successfully replicated our results using two additional independent datasets with different capturing methods and Illumina sequencers. Conclusion Extreme strand bias indicates a potential high false-positive rate for SNPs.

  4. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands

    Energy Technology Data Exchange (ETDEWEB)

    Bates, R.C.; Snyder, C.E.; Banerjee, P.T.; Mitra, S.

    1984-02-01

    Autonomous parvoviruses are thought to uniquely encapsidate single-stranded DNA of minus polarity. In contrast, the defective adeno-associated viruses separately encapsidate equal amounts of plus and minus DNA strands. The uniqueness of minus strand encapsidation is reexamined for the autonomous parvoviruses. Although it was found that Kilham rat virus and H-1 virus encapsidate varying but small amounts of complementary-strand DNA, it was unexpected to find that LuIII virus encapsidated equal amounts of plus and minus DNA. The extracted LuIII DNA possessed properties of double-stranded replicative-form DNA, including insensitivity to S1 endonuclease, cleavage by restriction enzymes, and conversion to unit-length, single-stranded DNA when electrophoresed under denaturing conditions. However, the inability of this DNA to form single-stranded DNA circles when denatured and then renatured in the presence of formamide and the lack of double-stranded DNA circle formation after treatment with exonuclease III and reannealing shows a lack of sequence homology of the 3' and 5' termini of LuIII DNA, in contrast to adeno-associated virus DNA. Digestion of LuIII double-stranded DNA with EcoRI and HincII and separation of plus and minus DNA strands on composite agarose-acrylamide gels identified a heterogeneity present only in the plus DNA strand. These results suggest that strand specificity of viral DNA encapsidation is not a useful property for differentiation between the autonomous and defective parvoviruses. Furthermore, encapsidation by LuIII of equal amounts of complementary DNA strands in contrast to encapsidation of minus strands by H-1 virus, when propagated in the same host cell type, suggests that selection of strands for encapsidation is a virus-coded rather than host-controlled event.

  5. Bottlenose dolphin (Tursiops truncatus) strandings in South Carolina, 1992-1996

    OpenAIRE

    McFee, Wayne E.; Hopkins-Murphy, Sally R.

    2002-01-01

    From 1992 to 1996, 153 bottlenose dolphin stranded in South Carolina, accounting for 73% of all marine mammal strandings during this period. The objectives of our study were to evaluate data from these strandings to deter-mine 1) annual trends in strandings, 2) seasonal and spatial distribution trends, 3) life history parameters such as sex ratio and age classes, 3) seasonal trends in reproduction, and 4) the extent to which humans have played a role in causing these strandings (human inter-a...

  6. Activation of 2'-5' oligoadenylate synthetase by single-stranded and double-stranded RNA aptamers

    DEFF Research Database (Denmark)

    Hartmann, R; Norby, P L; Martensen, P M

    1998-01-01

    A number of small RNA molecules that are high affinity ligands for the 46-kDa form of human 2'-5' oligoadenylate synthetase have been identified by the SELEX method. Surface plasmon resonance analysis indicates that these RNAs bind to the enzyme with dissociation constants in the nanomolar range....... Competition experiments indicate that the binding site for the small RNAs on the 2'-5' oligoadenylate synthetase molecule at least partially overlaps that for the synthetic double-stranded RNA, poly(I).poly(C). Several of the RNAs function as potent activators of 2'-5' oligoadenylate synthetase in vitro......-stranded RNA, can also be activated by RNA ligands with little secondary structure. Since 2'-5' oligoadenylate synthetase possesses no homology to other known RNA-binding proteins, the development of small specific ligands by SELEX should facilitate studies of RNA-protein interactions and may reveal novel...

  7. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...Society for Marine Mammalogy 2013 Biennial Conference on the Biology of Marine Mammals in New Zealand. Dr. Fahlman’s graduate student Lauren Gonzalez...Harabin, Metabolism and thermoregulation in guinea pigs in hyperbaric hydrogen: Effects of pressure. Journal of Thermal Biology , 1997. 22(1): p. 31-41

  8. Improvement on the electrical characteristics of Pd/HfO{sub 2}/6H-SiC MIS capacitors using post deposition annealing and post metallization annealing

    Energy Technology Data Exchange (ETDEWEB)

    Esakky, Papanasam, E-mail: papanasamte@gmail.com; Kailath, Binsu J

    2017-08-15

    Highlights: • Post deposition annealing (PDA) and post metallization annealing (PMA) on the electrical characteristics of Pd/HfO{sub 2}/6H-SiC MIS capacitors. • Post deposition N{sub 2}O plasma annealing inhibits crystallization of HfO{sub 2} during high temperature annealing. • Plasma annealing followed by RTA in N{sub 2} results in formation of hafnium silicate at the HfO{sub 2}-SiC interface. • PDA reduces interface state density (D{sub it}) and gate leakage current density (J{sub g}) by order. • PMA in forming gas for 40 min results in better passivation and reduces D{sub it} by two orders and J{sub g} by thrice. - Abstract: HfO{sub 2} as a gate dielectric enables high electric field operation of SiC MIS structure and as gas sensor HfO{sub 2}/SiC capacitors offer higher sensitivity than SiO{sub 2}/SiC capacitors. The issue of higher density of oxygen vacancies and associated higher leakage current necessitates better passivation of HfO{sub 2}/SiC interface. Effect of post deposition annealing in N{sub 2}O plasma and post metallization annealing in forming gas on the structural and electrical characteristics of Pd/HfO{sub 2}/SiC MIS capacitors are reported in this work. N{sub 2}O plasma annealing suppresses crystallization during high temperature annealing thereby improving the thermal stability and plasma annealing followed by rapid thermal annealing in N{sub 2} result in formation of Hf silicate at the HfO{sub 2}/SiC interface resulting in order of magnitude lower density of interface states and gate leakage current. Post metallization annealing in forming gas for 40 min reduces interface state density by two orders while gate leakage current density is reduced by thrice. Post deposition annealing in N{sub 2}O plasma and post metallization annealing in forming gas are observed to be effective passivation techniques improving the electrical characteristics of HfO{sub 2}/SiC capacitors.

  9. Unpaired 5' ppp-nucleotides, as found in arenavirus double-stranded RNA panhandles, are not recognized by RIG-I.

    Science.gov (United States)

    Marq, Jean-Baptiste; Kolakofsky, Daniel; Garcin, Dominique

    2010-06-11

    Arenavirus and bunyavirus RNA genomes are unusual in that they are found in circular nucleocapsids, presumably due to the annealing of their complementary terminal sequences. Moreover, arenavirus genome synthesis initiates with GTP at position +2 of the template rather than at the precise 3' end (position +1). After formation of a dinucleotide, 5' pppGpC(OH) is then realigned on the template before this primer is extended. The net result of this "prime and realign" mechanism of genome initiation is that 5' pppG is found as an unpaired 5' nucleotide when the complementary genome ends anneal to form a double-stranded (dsRNA) panhandle. Using 5' pppRNA made in vitro and purified so that all dsRNA side products are absent, we have determined that both this 5' nucleotide overhang, as well as mismatches within the dsRNA (as found in some arenavirus genomes), clearly reduce the ability of these model dsRNAs to induce interferon upon transfection into cells. The presence of this unpaired 5' ppp-nucleotide is thus another way that some viruses appear to use to avoid detection by cytoplasmic pattern recognition receptors.

  10. Metallographic investigation of fracture behavior in ITER-style Nb$_{3}$Sn superconducting strands

    CERN Document Server

    Jewell, M C; Larbalestier, D C; Nijhuis, A

    2009-01-01

    In this work we specify the extent to which fracture in two ITER-style Nb$_{3}$Sn composite strands occurs in a collective or individual manner, under mechanical tension and bending from the TARSIS apparatus at the University of Twente. A bronze-route strand from European Advanced Superconductors (EAS), which has very uniform, well-spaced filaments, has a widely distributed (200 μm) fracture field and exhibits a composite of individual and collective cracks. An internal tin strand from Oxford Instruments – Superconducting Technology (OST) demonstrates much more localized, collective fracture behavior. The filaments in this strand are about four times larger (in area) than the filaments in the EAS strand, and also agglomerate significantly during heat treatment upon conversion of the Nb to Nb$_{3}$Sn. These results demonstrate that the architecture of the strand can play a significant role in determining the mechanical toughness of the composite, and that strand design should incorporate mechanical consider...

  11. Social factors mediating human-carnivore coexistence: Understanding thematic strands influencing coexistence in Central Romania.

    Science.gov (United States)

    Dorresteijn, Ine; Milcu, Andra Ioana; Leventon, Julia; Hanspach, Jan; Fischer, Joern

    2016-05-01

    Facilitating human-carnivore coexistence depends on the biophysical environment but also on social factors. Focusing on Central Romania, we conducted 71 semi-structured interviews to explore human-bear (Ursus arctos) coexistence. Qualitative content and discourse analysis identified three socially mediated thematic strands, which showed different ways in which perceived interactions between people, bears and the environment shape coexistence. The "landscape-bear strand" described perceptions of the way in which the landscape offers resources for the bear, while the "landscape-human strand" related to ways in which humans experience the landscape. The "management strand" related to the way bears was managed. All three strands highlight both threats and opportunities for the peaceful coexistence of people and bears. Management and policy interventions could be improved by systematically considering the possible effects of interventions on each of the three strands shaping coexistence. Future research should explore the relevance of the identified thematic strands in other settings worldwide.

  12. Silicon nanoparticle synthesis by short-period thermal anneals at atmospheric pressure in argon

    International Nuclear Information System (INIS)

    Spencer, Gregory; Anyamesem-Mensah, Benedict; Galloway, Heather C.; Bandyopadhyay, Anup; Frasier, Daniel

    2011-01-01

    Silicon nanoparticles have been studied for a wide variety of applications including nanoelectronic, photovoltaic, and optoelectronic devices. In this work, silicon nanoparticles were synthesized by short-period annealing of silicon-on-insulator substrates to temperatures ranging between 600 and 900 deg. C in argon gas at atmospheric pressure. Two different top silicon layers were deposited by ion-beam sputtering onto oxidized substrates. The thinner 6 nm top layer samples were annealed to temperatures for 30 s periods while thicker 15 nm top layer samples were annealed for 60 s periods. For both sets of samples, nanoparticles were observed to form at all the anneal temperatures through imaging by AFM. One long-period UHV anneal study, with 30-min anneal times, observed nanoparticle formation at temperatures similar to the current work while another similar long-period UHV anneal reported nanoparticle formation only above well-defined formation temperatures that depended upon the starting top layer thickness. In the current work, the average nanoparticle radius was found to increase both with the final anneal temperature and anneal period. For the highest anneal temperatures of the 6 nm top layer samples, a changing surface topography indicated that the thinner Si source layer was becoming depleted and the nanoparticle formation process was nearing completion. No such changes were observed for the thicker 15 nm samples at the same temperatures.

  13. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  14. Ising formulation of associative memory models and quantum annealing recall

    Science.gov (United States)

    Santra, Siddhartha; Shehab, Omar; Balu, Radhakrishnan

    2017-12-01

    Associative memory models, in theoretical neuro- and computer sciences, can generally store at most a linear number of memories. Recalling memories in these models can be understood as retrieval of the energy minimizing configuration of classical Ising spins, closest in Hamming distance to an imperfect input memory, where the energy landscape is determined by the set of stored memories. We present an Ising formulation for associative memory models and consider the problem of memory recall using quantum annealing. We show that allowing for input-dependent energy landscapes allows storage of up to an exponential number of memories (in terms of the number of neurons). Further, we show how quantum annealing may naturally be used for recall tasks in such input-dependent energy landscapes, although the recall time may increase with the number of stored memories. Theoretically, we obtain the radius of attractor basins R (N ) and the capacity C (N ) of such a scheme and their tradeoffs. Our calculations establish that for randomly chosen memories the capacity of our model using the Hebbian learning rule as a function of problem size can be expressed as C (N ) =O (eC1N) , C1≥0 , and succeeds on randomly chosen memory sets with a probability of (1 -e-C2N) , C2≥0 with C1+C2=(0.5-f ) 2/(1 -f ) , where f =R (N )/N , 0 ≤f ≤0.5 , is the radius of attraction in terms of the Hamming distance of an input probe from a stored memory as a fraction of the problem size. We demonstrate the application of this scheme on a programmable quantum annealing device, the D-wave processor.

  15. Simulated annealing band selection approach for hyperspectral imagery

    Science.gov (United States)

    Chang, Yang-Lang; Fang, Jyh-Perng; Hsu, Wei-Lieh; Chang, Lena; Chang, Wen-Yen

    2010-09-01

    In hyperspectral imagery, greedy modular eigenspace (GME) was developed by clustering highly correlated bands into a smaller subset based on the greedy algorithm. Unfortunately, GME is hard to find the optimal set by greedy scheme except by exhaustive iteration. The long execution time has been the major drawback in practice. Accordingly, finding the optimal (or near-optimal) solution is very expensive. Instead of adopting the band-subset-selection paradigm underlying this approach, we introduce a simulated annealing band selection (SABS) approach, which takes sets of non-correlated bands for high-dimensional remote sensing images based on a heuristic optimization algorithm, to overcome this disadvantage. It utilizes the inherent separability of different classes embedded in high-dimensional data sets to reduce dimensionality and formulate the optimal or near-optimal GME feature. Our proposed SABS scheme has a number of merits. Unlike traditional principal component analysis, it avoids the bias problems that arise from transforming the information into linear combinations of bands. SABS can not only speed up the procedure to simultaneously select the most significant features according to the simulated annealing optimization scheme to find GME sets, but also further extend the convergence abilities in the solution space based on simulated annealing method to reach the global optimal or near-optimal solution and escape from local minima. The effectiveness of the proposed SABS is evaluated by NASA MODIS/ASTER (MASTER) airborne simulator data sets and airborne synthetic aperture radar images for land cover classification during the Pacrim II campaign. The performance of our proposed SABS is validated by supervised k-nearest neighbor classifier. The experimental results show that SABS is an effective technique of band subset selection and can be used as an alternative to the existing dimensionality reduction method.

  16. Reduced-Complexity Deterministic Annealing for Vector Quantizer Design

    Directory of Open Access Journals (Sweden)

    Ortega Antonio

    2005-01-01

    Full Text Available This paper presents a reduced-complexity deterministic annealing (DA approach for vector quantizer (VQ design by using soft information processing with simplified assignment measures. Low-complexity distributions are designed to mimic the Gibbs distribution, where the latter is the optimal distribution used in the standard DA method. These low-complexity distributions are simple enough to facilitate fast computation, but at the same time they can closely approximate the Gibbs distribution to result in near-optimal performance. We have also derived the theoretical performance loss at a given system entropy due to using the simple soft measures instead of the optimal Gibbs measure. We use thederived result to obtain optimal annealing schedules for the simple soft measures that approximate the annealing schedule for the optimal Gibbs distribution. The proposed reduced-complexity DA algorithms have significantly improved the quality of the final codebooks compared to the generalized Lloyd algorithm and standard stochastic relaxation techniques, both with and without the pairwise nearest neighbor (PNN codebook initialization. The proposed algorithms are able to evade the local minima and the results show that they are not sensitive to the choice of the initial codebook. Compared to the standard DA approach, the reduced-complexity DA algorithms can operate over 100 times faster with negligible performance difference. For example, for the design of a 16-dimensional vector quantizer having a rate of 0.4375 bit/sample for Gaussian source, the standard DA algorithm achieved 3.60 dB performance in 16 483 CPU seconds, whereas the reduced-complexity DA algorithm achieved the same performance in 136 CPU seconds. Other than VQ design, the DA techniques are applicable to problems such as classification, clustering, and resource allocation.

  17. Annealing behaviour of MeV erbium implanted lithium niobate

    Energy Technology Data Exchange (ETDEWEB)

    Gortmaker, P.; McCallum, J.C. [Royal Melbourne Inst. of Tech., VIC (Australia)

    1993-12-31

    Lithium niobate (LiNbO{sub 3}) is a crystalline ceramic commonly used in the fabrication of optoelectronic devices. Recently, rare earth doping of LiNbO{sub 3} has become a topic of particular interest. The electronic configuration of rare earth elements such as Erbium (Er) and Neodymium (Nd) allows them to lase in nearly any host matrix making fabrication of a whole range of new optoelectronic devices possible. At present, the doping technique, for LiNbO{sub 3} are centred upon diffusion technology, but the diffusion profiles for the rare earths are not generally well-matched to the optical modes of the device. The aim of this research is to develop MeV implantation and annealing conditions of rare earth doped LiNbO{sub 3} that would be compatible with optoelectronic device fabrication. To determine the characteristics of the rare earth elements in the LiNbO{sub 3} host material over the depth range of interest in optoelectronic device applications, high energy Rutherford backscattering spectrometry and ion channeling (RBS-C) must be used. Presented here are the Er depth profile and lattice damage results obtained from 5 MeV RBS-C measurements on samples of LiNbO{sub 3} implanted with various doses of MeV Erbium and subsequently thermally annealed at a temperature of 1000 deg C. It was found that there is a peak implant concentration (2 x 10{sup 16} Er/cm{sup 2}) for which erbium no longer goes substitutional in the lattice, and the implantation damage is not fully removed by annealing. 8 refs., 3 figs.

  18. Irradiation-induced swelling in solution annealed AISI 316

    International Nuclear Information System (INIS)

    Bates, J.F.; Weiner, R.A.; Korenko, M.K.

    1978-11-01

    Swelling in solution annealed AISI 316 has been empirically described as a function of temperature and fluence. An equation, suitable for design purposes, has been developed from an analysis of all of the available swelling data and complementary investigations. The equation is bi-linear in nature and incorporates different temperature dependent functions for both the maximum linear swelling rate parameter and the incubation parameter. The equation describing the swelling rate parameter differs from previous functions in that a constant swelling rate occurs from around 450 to 500 0 C followed by a peak swelling rate at around 570 0 C

  19. Thermal annealing of natural, radiation-damaged pyrochlore

    Energy Technology Data Exchange (ETDEWEB)

    Zietlow, Peter; Beirau, Tobias; Mihailova, Boriana; Groat, Lee A.; Chudy, Thomas; Shelyug, Anna; Navrotsky, Alexandra; Ewing, Rodney C.; Schlüter, Jochen; Škoda, Radek; Bismayer, Ulrich

    2017-01-01

    Abstract

    Radiation damage in minerals is caused by the α-decay of incorporated radionuclides, such as U and Th and their decay products. The effect of thermal annealing (400–1000 K) on radiation-damaged pyrochlores has been investigated by Raman scattering, X-ray powder diffraction (XRD), and combined differential scanning calorimetry/thermogravimetry (DSC/TG). The analysis of three natural radiation-damaged pyrochlore samples from Miass/Russia [6.4 wt% Th, 23.1·10

  20. Annealed Demon Algorithms Solving the Environmental / Economic Dispatch Problem

    Directory of Open Access Journals (Sweden)

    Aristidis VLACHOS

    2013-06-01

    Full Text Available This paper presents an efficient and reliable Annealed Demon (AD algorithm for the Environmental/Economic Dispatch (EEB problem. The EED problem is a multi-objective non-linear optimization problem with constraints. This problem is one of the fundamentals issues in power system operation. The system of generation associates thermal generators and emissions which involves sulphur oxides (SO2 and nitrogen oxides (NOx. The aim is to minimize total fuel cost of the system and control emission. The proposed AD algorithm is applied for EED of a simple power system.

  1. Development and anneal of radiation damage in salt

    International Nuclear Information System (INIS)

    Garcia Celma, A.; Donker, H.; Soppe, W.J.; Miralles, L.

    1993-12-01

    Laboratory gamma-irradiations at a constant temperature (100 C) were carried out in two sorts of experiments, one at variable and another at approximately constant dose rates. The damage developed during irradiation was analyzed by thermal analysis, microstructural analysis and small angle neutron scattering. The results were compared with the yields of the Jain-Lidiard model for each experiment. Experiments at a constant dose rate were planned to obtain information on radiation damage development and anneal in conditions as near as possible to those of radioactive waste repository concepts. For this reason the dose rates were kept low. (orig./DG)

  2. Structural defects in laser- and electron-beam annealed silicon

    International Nuclear Information System (INIS)

    Narayan, J.

    1979-01-01

    Laser and electron beam pulses provide almost an ideal source of heat by which thin layers of semiconductors can be rapidly melted and solidified with heating and cooling rates exceeding 10 80 C/sec. Microstructural modifications obtained as a function of laser parameters are examined and it is shown that both laser and electron beam pulses can be used to remove displacement damage, dislocations, dislocation loops and precipitates. Annealing of defects underneath the oxide layers in silicon is possible within a narrow energy window. The formation of cellular structure provides a rather clear evidence of melting which leads to segregation and supercooling, and subsequent cell formation

  3. Testing of irradiated and annealed 15H2MFA materials

    International Nuclear Information System (INIS)

    Gillemot, F.; Uri, G.

    1994-01-01

    A set of surveillance samples made from 15H2MFA material has been studied in the laboratory of AEKI. Miniature notched tensile specimens were cut from some remnants of irradiated and broke surveillance charpy remnants. The Absorbed Specific Fracture Energy (ASFE) was measured on the specimens. A cutting machine and testing technique were elaborated for the measurements. The second part of the Charpy remnants was annealed at 460 deg. C and 490 deg. C for 6-8 hours. The specimens were tested similarity and the results were compared. (author). 5 refs, 9 figs

  4. Combined Simulated Annealing Algorithm for the Discrete Facility Location Problem

    Directory of Open Access Journals (Sweden)

    Jin Qin

    2012-01-01

    Full Text Available The combined simulated annealing (CSA algorithm was developed for the discrete facility location problem (DFLP in the paper. The method is a two-layer algorithm, in which the external subalgorithm optimizes the decision of the facility location decision while the internal subalgorithm optimizes the decision of the allocation of customer's demand under the determined location decision. The performance of the CSA is tested by 30 instances with different sizes. The computational results show that CSA works much better than the previous algorithm on DFLP and offers a new reasonable alternative solution method to it.

  5. Optimisation of electron beam characteristics by simulated annealing

    International Nuclear Information System (INIS)

    Ebert, M.A.; University of Adelaide, SA; Hoban, P.W.

    1996-01-01

    Full text: With the development of technology in the field of treatment beam delivery, the possibility of tailoring radiation beams (via manipulation of the beam's phase space) is foreseeable. This investigation involved evaluating a method for determining the characteristics of pure electron beams which provided dose distributions that best approximated desired distributions. The aim is to determine which degrees of freedom are advantageous and worth pursuing in a clinical setting. A simulated annealing routine was developed to determine optimum electron beam characteristics. A set of beam elements are defined at the surface of a homogeneous water equivalent phantom defining discrete positions and angles of incidence, and electron energies. The optimal weighting of these elements is determined by the (generally approximate) solution to the linear equation, Dw = d, where d represents the dose distribution calculated over the phantom, w the vector of (50 - 2x10 4 ) beam element relative weights, and D a normalised matrix of dose deposition kernels. In the iterative annealing procedure, beam elements are randomly selected and beam weighting distributions are sampled and used to perturb the selected elements. Perturbations are accepted or rejected according to standard simulated annealing criteria. The result (after the algorithm has terminated due to meeting an iteration or optimisation specification) is an approximate solution for the beam weight vector (w) specified by the above equation. This technique has been applied for several sample dose distributions and phase space restrictions. An example is given of the phase space obtained when endeavouring to conform to a rectangular 100% dose region with polyenergetic though normally incident electrons. For regular distributions, intuitive conclusions regarding the benefits of energy/angular manipulation may be made, whereas for complex distributions, variations in intensity over beam elements of varying energy and

  6. Effect of thermal annealing on properties of polycrystalline ZnO thin films

    Science.gov (United States)

    Gritsenko, L. V.; Abdullin, Kh. A.; Gabdullin, M. T.; Kalkozova, Zh. K.; Kumekov, S. E.; Mukash, Zh. O.; Sazonov, A. Yu.; Terukov, E. I.

    2017-01-01

    Electrical properties (density, carriers mobility, resistivity), optical absorption and photoluminescence spectra of ZnO, grown by MOCVD and hydrothermal methods, have been investigated depending on the annealing and treatment modes in a hydrogen plasma. It has been shown that the electrical and photoluminescent (PL) properties of ZnO are strongly dependent on gas atmosphere during annealing. The annealing in oxygen atmosphere causes a sharp drop of carrier mobility and films conductivity due to the absorption of oxygen on grain boundaries. The process of ZnO electrical properties recovery by the thermal annealing in inert atmosphere (nitrogen), in oil (2×10-2 mbar) and oil-free (1×10-5 mbar) vacuum has been investigated. The hydrogen plasma treatment influence on the intensity of near-band-gap emission (NBE) has been studied. The effect of annealing and subsequent plasma treatment on PL intensity depends on the gas atmosphere of preliminary thermal annealing.

  7. Effects of surface polishing and annealing on the optical conductivity of intermetallic compounds

    CERN Document Server

    Rhee, J Y

    1999-01-01

    The optical conductivity spectra of several intermetallic compounds were measured by spectroscopic ellipsometry. Three spectra were measured for each compound; just after the sample was mechanically polished, at high temperature, and after the sample was annealed at 110 .deg. C for at least one day and cooled to room temperature. An equiatomic FeTi alloy showed the typical effects of annealing after mechanical polishing of surface. The spectrum after annealing had a larger magnitude and sharper structures than the spectrum before annealing. We also observed shifts of peaks in the spectrum. A relatively low-temperature annealing gave rise to unexpectedly substantial effects, and the effects were explained by recrystallization and/or a disorder -> order transition of the surface of the sample which was damaged and, hence, became highly disordered by mechanical polishing. Similar effects were also observed when the sample temperature was lowered. The observed changes upon annealing could partly be explained by p...

  8. Effects of Annealing on TiN Thin Film Growth by DC Magnetron Sputtering

    Directory of Open Access Journals (Sweden)

    Azadeh Jafari

    2014-07-01

    Full Text Available We have reviewed the deposition of titanium nitride (TiN thin films on stainless steel substrates by a DC magnetron sputtering method and annealing at different annealing temperatures of 500, 600, and 700°C for 120 min in nitrogen/argon atmospheres. Effects of annealing temperatures on the structural and the optical properties of TiN films were investigated using X-ray diffraction (XRD, atomic force microscope (AFM, field emission scanning electron microscopy (FESEM, and UV-VIS spectrophotometer. Our experimental studies reveal that the annealing temperature appreciably affected the structures, crystallite sizes, and reflection of the films. By increasing the annealing temperature to 700°C crystallinity and reflection of the film increase. These results suggest that annealed TiN films can be good candidate for tokamak first wall due to their structural and optical properties.

  9. Strain relaxation near high-k/Si interface by post-deposition annealing

    International Nuclear Information System (INIS)

    Emoto, T.; Akimoto, K.; Yoshida, Y.; Ichimiya, A.; Nabatame, T.; Toriumi, A.

    2005-01-01

    We studied the effect of post-deposition annealing on a HfO 2 /Si interface of by extremely asymmetric X-ray diffraction. Comparing the rocking curves before annealing the sample with those of the annealed sample, it is found that an interfacial layer with a density of 3 g/cm 3 grows at the interface between the HfO 2 layer and the substrate during post-deposition annealing. The wavelength dependency of the integrated intensities of the rocking curve for the as-deposited sample fluctuated with the observation position. This fluctuation was suppressed by annealing. From these results we concluded that the strain introduced into the substrate becomes homogeneous by annealing. Moreover, a quantitative estimation of the strain by curve fitting reveals the existence of compressive strain under the HfO 2 layer

  10. Residual charges effect on the annealing behavior of Co-60 irradiated MOS capacitors

    International Nuclear Information System (INIS)

    Hwu, J.G.; Lee, G.S.; Lee, S.C.; Wang, W.S.

    1988-01-01

    It was experimentally observed that the residual charges of a MOS capacitor after C-V testing can exist for a long time. These residual charges induce a nonzero field at the SiO/sub 2//Si interface, and subsequently affect the annealing behavior due to a charge-temperature effect if the MOS capacitor is left floating during annealing. This problem is solved by a flat-band condition annealing method based on a charge-temperature technique. The annealing kinetics of a Co-60 irradiated MOS capacitor are then studied. A power law behavior of the annealing kinetics has been obtained for oxide charges annealed at 300 0 C. Possible explanations are given for this observation

  11. FTIR and Raman spectra of ion irradiated and annealed 4H-SiC

    International Nuclear Information System (INIS)

    Zhou Lihong; Yang Titao; Yao Cunfeng; Chinese Academy of Sciences, Beijing

    2007-01-01

    The 4H-SiC specimens were implanted with 110keV C-ions and then irradiated with 230MeV Pb-ions and subsequently annealed at different temperatures in vacuum. The samples were investigated after each annealing stage by using FTIR and Raman spectroscopy. The obtained FTIR spectra showed several interference fringes in the range from 960 cm -1 to 1450 cm -1 . The intensity of fringes decreases with the increase of annealing temperature, and an abrupt decrease of the fringe intensity was found for annealing above 900 degree C, indicating that there was a significant recovery of the irradiation-induced damage in the crystal for annealing at high temperatures. The Raman spectroscopy showed that after annealing at 1200 degree C for 30 min the amorphous layer was recovered and the precipitation of carbon atoms in graphite occurred. (authors)

  12. Unusual hardening behaviour in heavily cryo-rolled Cu-Al-Zn alloys during annealing treatment

    Energy Technology Data Exchange (ETDEWEB)

    Gong, Y.L. [Faculty of Science, Kunming University of Science and Technology, Kunming 650500 (China); Ren, S.Y. [Ningbo Powerway Alloy Material Co., Ltd, Ningbo 315135 (China); Zeng, S.D. [Yunnan Institute of Measuring and Testing Technology, Kunming 650228 (China); Zhu, X.K., E-mail: xk_zhu@hotmail.com [Faculty of Materials Science and Engineering, Kunming University of Science and Technology, Kunming 650500 (China)

    2016-04-06

    Three nanostructured Cu-Al-Zn alloys were produced via rolling at the liquid nitrogen temperature. The deformed Cu alloys were then annealed at 150–300 °C for 1 h. The two alloys with high solute content and thus with low stacking fault energy exhibit unusual annealing hardening, namely, an increase in hardness and strength and a decrease in tensile elongation after annealing at 150 and 200 °C. From X-ray diffraction (XRD) analysis and microstructural observations by transmission electron microscopy (TEM), it is found that microstrain and dislocation density decrease after annealing at 200 °C because of the recovery of dislocations and the lattice parameter decreases due to solute segregation. Meanwhile, the twin density of the two Cu alloys increases and grain size remains basically unchanged. It is shown that the formation of annealing twins and stacking faults and the segregation of solute atoms may be the main causes of unusual annealing hardening.

  13. Strain relaxation near high-k/Si interface by post-deposition annealing

    Energy Technology Data Exchange (ETDEWEB)

    Emoto, T. [Toyota National College of Technology, 2-1 Eisei-cho, Toyota, Aichi 471-8525 (Japan)]. E-mail: emoto@toyota-ct.ac.jp; Akimoto, K. [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Yoshida, Y. [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Ichimiya, A. [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Nabatame, T. [MIRAI-ASET, AIST Tsukuba West, Tsukuba, Ibaraki 305-8569 (Japan); Toriumi, A. [MIRAI-ASRC, AIST Tsukuba Central 4, Tsukuba, Ibaraki 305-8562 (Japan); University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan)

    2005-05-15

    We studied the effect of post-deposition annealing on a HfO{sub 2}/Si interface of by extremely asymmetric X-ray diffraction. Comparing the rocking curves before annealing the sample with those of the annealed sample, it is found that an interfacial layer with a density of 3 g/cm{sup 3} grows at the interface between the HfO{sub 2} layer and the substrate during post-deposition annealing. The wavelength dependency of the integrated intensities of the rocking curve for the as-deposited sample fluctuated with the observation position. This fluctuation was suppressed by annealing. From these results we concluded that the strain introduced into the substrate becomes homogeneous by annealing. Moreover, a quantitative estimation of the strain by curve fitting reveals the existence of compressive strain under the HfO{sub 2} layer.

  14. Defect annealing and thermal desorption of deuterium in low dose HFIR neutron-irradiated tungsten

    Science.gov (United States)

    Shimada, Masashi; Hara, Masanori; Otsuka, Teppei; Oya, Yasuhisa; Hatano, Yuji

    2015-08-01

    Three tungsten samples irradiated at High Flux Isotope Reactor at Oak Ridge National Laboratory were exposed to deuterium plasma (ion fluence of 1 × 1026 m-2) at three different temperatures (100, 200, and 500 °C) in Tritium Plasma Experiment at Idaho National Laboratory. Subsequently, thermal desorption spectroscopy was performed with a ramp rate of 10 °C min-1 up to 900 °C, and the samples were annealed at 900 °C for 0.5 h. These procedures were repeated three times to uncover defect-annealing effects on deuterium retention. The results show that deuterium retention decreases approximately 70% for at 500 °C after each annealing, and radiation damages were not annealed out completely even after the 3rd annealing. TMAP modeling revealed the trap concentration decreases approximately 80% after each annealing at 900 °C for 0.5 h.

  15. PROTOCOL FOR GAS SAMPLING AND ANALYSIS IN STRANDED MARINE MAMMALS

    OpenAIRE

    sprotocols

    2015-01-01

    Authors: Yara Bernaldo de Quirós, Óscar González-Díaz, Manuel Arbelo, Marisa Andrada & Antonio Fernández ### Abstract Gas sampling in stranded marine mammals can now be performed in situ using the appropriate vacuum tubes, insulin syringes and an aspirometer. Glass vacuum tubes are used for extraction of gas from cavities such as the intestine, pterigoyd air sacs, pneumothorax or subcapsular emphysema as well as for storage of the gas sample at room temperature and pressure. Insulin s...

  16. Turbulent Flow Validation in the Helios Strand Solver

    Science.gov (United States)

    2014-01-07

    of streamwise velocity and turbulent viscosity profiles for flow over a flat plate atM = 0.2 and Re = 5×106. Figure 20. 137×97 NACA 0012 strand grid 22...6. AUTHORS 7. PERFORMING ORGANIZATION NAMES AND ADDRESSES 15. SUBJECT TERMS b. ABSTRACT 2. REPORT TYPE 17. LIMITATION OF ABSTRACT 15. NUMBER OF...facilitates data exchange between the two mesh types as well as enables relative motion between the mesh systems - i.e. the near-body unstructured rotor

  17. Herpetic keratoconjunctivitis: Therapy with synthetic double-stranded RNA

    Science.gov (United States)

    Friedman, I.; Evans, C.; Meighan, C.W.; Foote, L.J.; Aiello, P.V.; Park, J.H.; Baron, S.

    1968-01-01

    A study was undertaken in rabbits to determine how late in the course of keratoconjunctivitis caused by herpes simplex recovery could be effected by an inducer of interferon. Interferon was induced by means of synthetic double-stranded RNA copolymer formed with polynosinic acid : polycytidilic acid RNA. Therapy promotes recovery from severe and fully established keratoconjunctivitis for which treatment was begun as late as 3 days after virus inoculation. No drug toxicity was observed in the therapeutic dose range. These findings further support the proposed role of the interferon mechanism in the natural recovery of already established viral infection. They also suggest the usefulness of interferon inducers in viral infections of man.

  18. Tailoring the magnetic properties and magnetorheological behavior of spinel nanocrystalline cobalt ferrite by varying annealing temperature

    OpenAIRE

    Sedlačík, Michal; Pavlínek, Vladimír; Peer, Petra; Filip, Petr

    2014-01-01

    Magnetic nanoparticles of spinel nanocrystalline cobalt ferrite were synthesized via the sol-gel method and subsequent annealing. The influence of the annealing temperature on the structure, magnetic properties, and magnetorheological effect was investigated. The finite crystallite size of the particles, determined by X-ray diffraction and the particle size observed via transmission electron microscopy, increased with the annealing temperature. The magnetic properties observed via a vibrating...

  19. Laser-annealed GaP OHMIC contacts for high-temperature devices

    International Nuclear Information System (INIS)

    Eknoyan, O.; Van der Hoeven, W.; Richardson, T.; Porter, W.A.; Coquat, J.A.

    1980-01-01

    The results of successful Nd:YAG laser annealed ohmic contacts on n-type GaP are reported. Comparisons on identical laser and thermal annealed contacts on the same substrates are performed. Aging investigations are also studied. The results indicate that laser annealed contacts have far superior electrical characteristics, much better surface morphology and are substantially more stable with aging than the same but thermally alloyed ones

  20. Low-temperature annealing of radiation defects in electron-irradiated gallium phosphide

    International Nuclear Information System (INIS)

    Kolb, A.A.; Megela, I.G.; Buturlakin, A.P.; Goyer, D.B.

    1990-01-01

    The isochronal annealing of radiation defects in high-energy electron irradiated n-GaP monocrystals within the 77 to 300 K range has been investigated by optical and electrical techniques. The changes in conductance and charge carrier mobility as functions of annealing temperature as well as the variation of optical absorption spectra of GaP under irradiation and annealing provide evidence that most of radiation defects are likely secondary complexes of defects

  1. Language Variation and Change in the Australian Curriculum English: Integrating Sub-Strands through a Pedagogy of Metalogue

    Science.gov (United States)

    Willis, Linda-Dianne; Exley, Beryl

    2016-01-01

    The Language Strand of the Australian Curriculum: English (Australian Curriculum, Assessment & Reporting Authority (ACARA), 2016b) includes the sub-strand of "Language Variation and Change". This sub-strand is a marked space for discovery and discussion of the history and politics of language use. As such, this sub-strand points to…

  2. 75 FR 38977 - Pre-Stressed Concrete Steel Wire Strand from the People's Republic of China: Notice of Amended...

    Science.gov (United States)

    2010-07-07

    ... International Trade Administration Pre-Stressed Concrete Steel Wire Strand from the People's Republic of China... concrete steel wire strand (PC strand) from the People's Republic of China (PRC). On June 22, 2010, the ITC...-Stressed Concrete Steel Wire Strand from the People's Republic of China, USITC Pub. 4162, Inv. Nos. 701-TA...

  3. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.

    1982-01-01

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  4. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts

    Science.gov (United States)

    Grant, Rachel A.; Savirina, Anna

    2018-01-01

    Simple Summary Marine mammals stranding on coastal beaches is not unusual. However, there appears to be no single cause for this, with several causes being probable, such as starvation, contact with humans (for example boat strike or entanglement with fishing gear), disease, and parasitism. We evaluated marine mammal stranding off the Washington and Oregon coasts and looked at offshore earthquakes as a possible contributing factor. Our analysis showed that offshore earthquakes did not make marine mammals more likely to strand. We also analysed a subset of data from the north of Washington State and found that non-adult animals made up a large proportion of stranded animals, and for dead animals the commonest cause of death was disease, traumatic injury, or starvation. Abstract The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals) stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or

  5. Molecular investigation of evaporation of biodroplets containing single-strand DNA on graphene surface.

    Science.gov (United States)

    Akbari, Fahimeh; Foroutan, Masumeh

    2018-02-14

    In this study, the water droplet behaviour of four different types of single-strand DNA with homogeneous base sequence on a graphene substrate during evaporation of the droplet was investigated using molecular dynamics (MD) simulation. The simulation results indicated that the evaporation depended on the DNA sequence. The observed changes can be divided into four parts: (i) vaporization mode, (ii) evaporation flux, (iii) mechanism of single-strand placement on the surface, and (iv) consideration of remaining single strands after evaporation. Our simulation observations indicated different evaporation modes for thymine biodroplets as compared to those for other biodroplets. The evaporation of the thymine biodroplets occurred with an increase in the contact angle, while that of the other biodroplets occur in a constant contact angle mode. Moreover, thymine biodroplets generate the lowest contact line compared to other single strands, and it is always placed far away from the centre of the droplets during evaporation. Investigating variations in the evaporation flux shows that thymine has the highest evaporation flux and guanine has the lowest. Moreover, during initial evaporation, the flux of evaporation increases at the triple point of the biodroplets containing thymine single strands, while it decreases in the other biodroplets. The following observation was obtained from the study of the placement of single strands on the substrate: guanine and thymine interacted slower than other single strands during evaporation with graphene, adenine single strand had a higher folding during evaporation, and guanine single strand showed the lowest end-to-end distance. The investigation of single-strand DNA after evaporation shows that adenine produces the most stable structure at the end of evaporation. In addition, cytosine is the most stretched single-strand DNA due to its lack of internal π-π stacking and hydrogen bonding. Therefore, cytosine single strand is more

  6. Exponential Speedup of Quantum Annealing by Inhomogeneous Driving of the Transverse Field

    Science.gov (United States)

    Susa, Yuki; Yamashiro, Yu; Yamamoto, Masayuki; Nishimori, Hidetoshi

    2018-02-01

    We show, for quantum annealing, that a certain type of inhomogeneous driving of the transverse field erases first-order quantum phase transitions in the p-body interacting mean-field-type model with and without longitudinal random field. Since a first-order phase transition poses a serious difficulty for quantum annealing (adiabatic quantum computing) due to the exponentially small energy gap, the removal of first-order transitions means an exponential speedup of the annealing process. The present method may serve as a simple protocol for the performance enhancement of quantum annealing, complementary to non-stoquastic Hamiltonians.

  7. Annealing hardening in detwinning deformation of Mg–3Al–1Zn alloy

    International Nuclear Information System (INIS)

    Xin, Yunchang; Zhou, Xiaojun; Chen, Houwen; Nie, Jian-Feng; Zhang, Hong; Zhang, Yuanyuan; Liu, Qing

    2014-01-01

    The present work reports the effect of annealing treatment on detwinning deformation in Mg alloy AZ31 and pure Mg that have pre-strained twins. It shows that appropriate annealing enhances, rather than reduces, the yield strength of the pre-strained AZ31, but it does not cause any strengthening of the pre-strained pure Mg. STEM–EDS mapping shows that both Al and Zn segregate to twin boundaries in the pre-strained AZ31 after the annealing process. It is proposed that it is the pinning of twin boundary by segregated solute atoms that results in an increased activation stress for detwinning deformation and, hence, annealing hardening

  8. Behavior of oxygen in zinc oxide films through thermal annealing and its effect on sheet resistance

    International Nuclear Information System (INIS)

    Hiramatsu, Takahiro; Furuta, Mamoru; Matsuda, Tokiyoshi; Li, Chaoyang; Hirao, Takashi

    2011-01-01

    Behavior of oxygen in sputtering deposited ZnO films through thermal annealing and its effect on sheet resistance of the films were investigated. The crystallinities of the ZnO film were improved by post-deposition annealing in vacuum. However, the sheet resistance of ZnO film was dramatically decreased after post-deposition annealing in vacuum at more than 300 deg. C, while O 2 desorbed from the film. The oxygen vacancies which acted as donors were formed by the thermal annealing in vacuum. The sheet resistance of the films was recovered by annealing in oxygen ambient. In this paper, 18 O 2 gas as an oxygen isotope was used as the annealing ambient in order to distinguish from 16 O, which was constituent atom of the ZnO films. SIMS analysis revealed that 18 O diffused into the ZnO film from the top surface by 18 O 2 annealing. Therefore oxygen vacancies formed by the post-deposition annealing in vacuum could be compensated by the annealing in oxygen ambient.

  9. One accelerated method for predicting thermal annealing effects in post-irradiation CMOS devices

    International Nuclear Information System (INIS)

    He Baoping; Zhou Heqin; Guo Hongxia; Luo Yinhong; Zhang Fengqi; Yao Zhibin

    2005-01-01

    A method for accelerated predictions of the long-term anneal effects was presented. In order to find the correspondence between two anneals time, our estimating conditions were that each isochronal step was equal to the duration of the isothermal anneal leading to the same level of charge detrapping. The long term isothermal behavior at 100 degree C and 24 degree C of the type CC4007 CMOS devices were predicted by using isochronal anneal data of 25-250 degree C and compared with an experimental isothermal. The authors note a good agreement between simulation and experiment. (authors)

  10. Annealing and etching effects on strain and stress sensitivity of polymer optical fibre Bragg grating sensors

    DEFF Research Database (Denmark)

    Pospori, A.; Marques, C. A.F.; Sáez-Rodríguez, D.

    2017-01-01

    Thermal annealing and chemical etching effects on the strain and stress sensitivity of polymer optical fibre based sensors are investigated. Bragg grating sensors have been photo-inscribed in PMMA optical fibre and their strain and stress sensitivity has been characterised before and after any...... annealing or etching process. The annealing and etching processes have been tried in different sequence in order to investigate their impact on the sensor's performance. Results show with high confidence that fibre annealing can improve both strain and stress sensitivities. The fibre etching can also...

  11. Modeling of irradiation embrittlement and annealing/recovery in pressure vessel steels

    International Nuclear Information System (INIS)

    Lott, R.G.; Freyer, P.D.

    1996-01-01

    The results of reactor pressure vessel (RPV) annealing studies are interpreted in light of the current understanding of radiation embrittlement phenomena in RPV steels. An extensive RPV irradiation embrittlement and annealing database has been compiled and the data reveal that the majority of annealing studies completed to date have employed test reactor irradiated weldments. Although test reactor and power reactor irradiations result in similar embrittlement trends, subtle differences between these two damage states can become important in the interpretation of annealing results. Microstructural studies of irradiated steels suggest that there are several different irradiation-induced microstructural features that contribute to embrittlement. The amount of annealing recovery and the post-anneal re-embrittlement behavior of a steel are determined by the annealing response of these microstructural defects. The active embrittlement mechanisms are determined largely by the irradiation temperature and the material composition. Interpretation and thorough understanding of annealing results require a model that considers the underlying physical mechanisms of embrittlement. This paper presents a framework for the construction of a physically based mechanistic model of irradiation embrittlement and annealing behavior

  12. Evaluation of trapping parameters of annealed natural quartz

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Rui [College of Resources, Environment & Tourism, Capital Normal University, 100048 Beijing (China); Shisanling Seismic Station, Institute of Earthquake Science, CEA, 102200 Beijing (China); Wei, Ming-Jian, E-mail: weimj@cnu.edu.cn [College of Resources, Environment & Tourism, Capital Normal University, 100048 Beijing (China); Song, Bo [College of Resources, Environment & Tourism, Capital Normal University, 100048 Beijing (China); Beijing Jing Yuan School, 100040 Beijing (China); Zhang, Yan [College of Resources, Environment & Tourism, Capital Normal University, 100048 Beijing (China); School of TaiPingqiao, Nan Lu of West Railway Station, 100073 Beijing (China); Zhao, Qiu-Yue [Key Laboratory of Tourism and Resources Environment in Universities of Shandong, Taishan University, 271000 Tai’an (China); Pan, Bao-Lin; Li, Teng-Fei [College of Resources, Environment & Tourism, Capital Normal University, 100048 Beijing (China)

    2016-05-15

    The thermoluminescence (TL) trapping parameters of annealed quartz have been investigated. The apparent TL peaks observed at temperatures of 133 °C, 211 °C, 266 °C and 405 °C, respectively, were named Peak I, Peak II, Peak III and Peak IV. The T{sub m} − T{sub stop} method is applied to investigate the number of peaks and their positions, and to obtain the trap distributions in the quartz. Peak shape (PS), Hoogenstraaten method (Various Heating Rates Method, VHR), and Computerized Glow Curve Deconvolution (CGCD) are used to evaluate the trapping parameters of the annealed quartz. The glow curve can be considered as a superposition of at least nine overlapping peaks. These peaks show up at 133 °C, 211 °C, 266 °C, 308 °C, 333 °C, 384 °C, 441 °C, 466 °C and 484 °C. The PS method can be only used in evaluating the parameters for Peaks I. The VHR method can be used in evaluating the trapping parameters for the first three peaks. CGCD method is complementary to obtaining parameters for the sub-peaks, and the thermal quenching correction with the Urbach’s method is necessary. The Urbach’s coefficient for the quartz is 30.03 kT{sub m}.

  13. List-Based Simulated Annealing Algorithm for Traveling Salesman Problem

    Directory of Open Access Journals (Sweden)

    Shi-hua Zhan

    2016-01-01

    Full Text Available Simulated annealing (SA algorithm is a popular intelligent optimization algorithm which has been successfully applied in many fields. Parameters’ setting is a key factor for its performance, but it is also a tedious work. To simplify parameters setting, we present a list-based simulated annealing (LBSA algorithm to solve traveling salesman problem (TSP. LBSA algorithm uses a novel list-based cooling schedule to control the decrease of temperature. Specifically, a list of temperatures is created first, and then the maximum temperature in list is used by Metropolis acceptance criterion to decide whether to accept a candidate solution. The temperature list is adapted iteratively according to the topology of the solution space of the problem. The effectiveness and the parameter sensitivity of the list-based cooling schedule are illustrated through benchmark TSP problems. The LBSA algorithm, whose performance is robust on a wide range of parameter values, shows competitive performance compared with some other state-of-the-art algorithms.

  14. Annealing of GaN under high pressure of nitrogen

    CERN Document Server

    Porowski, S; Kolesnikov, D; Lojkowski, W; Jager, V; Jäger, W; Bogdanov, V; Suski, T; Krukowski, S

    2002-01-01

    Gallium nitride, aluminum nitride and indium nitride are basic materials for blue optoelectronic devices. The essential part of the technology of these devices is annealing at high temperatures. Thermodynamic properties of the Ga-N system and their consequences to application of high nitrogen pressure for the annealing of GaN based materials are summarized. The diffusion of Zn, Mg and Au in high dislocation density heteroepitaxial GaN/Al sub 2 O sub 3 layers will be compared with the diffusion in dislocation-free GaN single crystals and homoepitaxial layers. It will be shown that high dislocation density can drastically change the diffusion rates, which strongly affects the performance of nitride devices. Inter-diffusion of Al, Ga and In in AlGaN/GaN and InGaN/GaN quantum well (QW) structures will be also considered. It will be shown that in contrast to stability of metal contacts, which is strongly influenced by dislocations, the inter-diffusion of group III atoms in QW structures is not affected strongly by...

  15. Evaluation of trapping parameters of annealed natural quartz

    International Nuclear Information System (INIS)

    Zhou, Rui; Wei, Ming-Jian; Song, Bo; Zhang, Yan; Zhao, Qiu-Yue; Pan, Bao-Lin; Li, Teng-Fei

    2016-01-01

    The thermoluminescence (TL) trapping parameters of annealed quartz have been investigated. The apparent TL peaks observed at temperatures of 133 °C, 211 °C, 266 °C and 405 °C, respectively, were named Peak I, Peak II, Peak III and Peak IV. The T m  − T stop method is applied to investigate the number of peaks and their positions, and to obtain the trap distributions in the quartz. Peak shape (PS), Hoogenstraaten method (Various Heating Rates Method, VHR), and Computerized Glow Curve Deconvolution (CGCD) are used to evaluate the trapping parameters of the annealed quartz. The glow curve can be considered as a superposition of at least nine overlapping peaks. These peaks show up at 133 °C, 211 °C, 266 °C, 308 °C, 333 °C, 384 °C, 441 °C, 466 °C and 484 °C. The PS method can be only used in evaluating the parameters for Peaks I. The VHR method can be used in evaluating the trapping parameters for the first three peaks. CGCD method is complementary to obtaining parameters for the sub-peaks, and the thermal quenching correction with the Urbach’s method is necessary. The Urbach’s coefficient for the quartz is 30.03 kT m .

  16. Coupled Qubits for Next Generation Quantum Annealing: Novel Interactions

    Science.gov (United States)

    Samach, Gabriel; Weber, Steven; Hover, David; Rosenberg, Danna; Yoder, Jonilyn; Kim, David; Oliver, William D.; Kerman, Andrew J.

    While the first generation of quantum annealers based on Josephson junction technology have been successfully engineered to represent arrays of spins in the quantum transverse-field Ising model, no circuit architecture to date has succeeded in emulating the more complicated non-stoquastic Hamiltonians of interest for next generation quantum annealing. Here, we present our recent results for tunable ZZ- and XX-coupling between high coherence superconducting flux qubits. We discuss the larger architectures these coupled two-qubit building blocks will enable, as well as comment on the limitations of such architectures. This research was funded by the Office of the Director of National Intelligence (ODNI), Intelligence Advanced Research Projects Activity (IARPA) and by the Assistant Secretary of Defense for Research & Engineering under Air Force Contract No. FA8721-05-C-0002. The views and conclusions contained herein are those of the authors and should not be interpreted as necessarily representing the official policies or endorsements, either expressed or implied, of ODNI, IARPA, or the US Government.

  17. Isothermal and isochronal annealing experiments on irradiated commercial power VDMOSFETs

    International Nuclear Information System (INIS)

    Jaksic, A.B.; Pejovic, M.M.; Ristic, G.S.

    1999-01-01

    The paper presents results of isothermal and isochronal annealing experiments on several types of gamma-ray irradiated commercial N- and P-channel power VDMOSFETs. Transistors were characterized for their threshold voltage shift and densities of radiation-induced oxide-trap charge and interface traps. The results show that the temperature enhances interface trap formation and oxide-trap charge decay rates, but also contributes to the passivation of interface traps. The study demonstrates that formation and passivation of interface traps are simultaneous processes. At certain conditions (lower temperature and/or positive bias) interface-trap formation dominates. Oppositely, at other conditions (higher temperature and/or negative bias) passivation is predominant. However at some conditions there is a complex interplay between formation and passivation of interface traps, resulting in interface traps increase followed by decrease at later annealing times. No model for interface trap post-irradiation behavior can explain this effect better than the recently proposed H-W model

  18. Microplastic processes developed in pure Ag with mesoscale annealing twins

    Energy Technology Data Exchange (ETDEWEB)

    Al-Fadhalah, Khaled Jabr Hasan [Mechanical Engineering Department, College of Engineering and Petroleum, Kuwait University, P.O. Box 5969, Safat 13060 (Kuwait)], E-mail: fadhalah@kuc01.kuniv.edu.kw; Li, Chun-Ming [Alcan Rolled Products-Ravenswood, LLC. P.O. Box 68, Century Road, Ravenswood, WV 26164 (United States)], E-mail: chun-ming.li@alcan.com; Beaudoin, A.J. [Department of Mechanical Science and Engineering, University of Illinois, 1206 West Green Street, Urbana, IL 61801 (United States)], E-mail: abeaudoi@uiuc.edu; Korzekwa, D.A. [Los Alamos National Laboratory, P.O. Box 1663, Los Alamos, NM 87545 (United States); Robertson, I.M. [Department of Materials Science and Engineering, University of Illinois, 1304 W. Green Street, Urbana, IL 61801 (United States)], E-mail: ianr@uiuc.edu

    2008-11-15

    The impact of annealing twin boundaries with a high residual defect content on the mechanical response of polycrystalline fine- and coarse-grained (2 and 20 {mu}m) silver was investigated through transmission electron microscopy and modeling. Besides an increase in the yield strength, the fine-grained material exhibited an inflection in the stress-strain curve after initial yield. Static and dynamic TEM studies revealed that the annealing twin boundaries acted as sources of perfect dislocations, partial dislocations and deformation twins; as barriers to the propagation of these dislocations; and as annihilation sites for dislocations. With increasing strain and as the twin boundaries were penetrated by dislocations, they contributed less to the overall mechanical properties. Based on these observations, equations for the evolution of mobile and forest dislocation densities are posed, depicting boundary sources and dislocation-dislocation interactions, respectively. The deformation response is modeled by computing the aggregate response of matrix-twin composite grains in the viscoplastic self-consistent scheme, which permits consideration of compatibility and equilibrium requirements across the twin boundaries. This work highlights the significant role boundaries play in generating the dislocations that control the macroscopic mechanical response.

  19. Sparse approximation problem: how rapid simulated annealing succeeds and fails

    Science.gov (United States)

    Obuchi, Tomoyuki; Kabashima, Yoshiyuki

    2016-03-01

    Information processing techniques based on sparseness have been actively studied in several disciplines. Among them, a mathematical framework to approximately express a given dataset by a combination of a small number of basis vectors of an overcomplete basis is termed the sparse approximation. In this paper, we apply simulated annealing, a metaheuristic algorithm for general optimization problems, to sparse approximation in the situation where the given data have a planted sparse representation and noise is present. The result in the noiseless case shows that our simulated annealing works well in a reasonable parameter region: the planted solution is found fairly rapidly. This is true even in the case where a common relaxation of the sparse approximation problem, the G-relaxation, is ineffective. On the other hand, when the dimensionality of the data is close to the number of non-zero components, another metastable state emerges, and our algorithm fails to find the planted solution. This phenomenon is associated with a first-order phase transition. In the case of very strong noise, it is no longer meaningful to search for the planted solution. In this situation, our algorithm determines a solution with close-to-minimum distortion fairly quickly.

  20. Simulated Annealing-Based Krill Herd Algorithm for Global Optimization

    Directory of Open Access Journals (Sweden)

    Gai-Ge Wang

    2013-01-01

    Full Text Available Recently, Gandomi and Alavi proposed a novel swarm intelligent method, called krill herd (KH, for global optimization. To enhance the performance of the KH method, in this paper, a new improved meta-heuristic simulated annealing-based krill herd (SKH method is proposed for optimization tasks. A new krill selecting (KS operator is used to refine krill behavior when updating krill’s position so as to enhance its reliability and robustness dealing with optimization problems. The introduced KS operator involves greedy strategy and accepting few not-so-good solutions with a low probability originally used in simulated annealing (SA. In addition, a kind of elitism scheme is used to save the best individuals in the population in the process of the krill updating. The merits of these improvements are verified by fourteen standard benchmarking functions and experimental results show that, in most cases, the performance of this improved meta-heuristic SKH method is superior to, or at least highly competitive with, the standard KH and other optimization methods.

  1. Microplastic processes developed in pure Ag with mesoscale annealing twins

    International Nuclear Information System (INIS)

    Al-Fadhalah, Khaled Jabr Hasan; Li, Chun-Ming; Beaudoin, A.J.; Korzekwa, D.A.; Robertson, I.M.

    2008-01-01

    The impact of annealing twin boundaries with a high residual defect content on the mechanical response of polycrystalline fine- and coarse-grained (2 and 20 μm) silver was investigated through transmission electron microscopy and modeling. Besides an increase in the yield strength, the fine-grained material exhibited an inflection in the stress-strain curve after initial yield. Static and dynamic TEM studies revealed that the annealing twin boundaries acted as sources of perfect dislocations, partial dislocations and deformation twins; as barriers to the propagation of these dislocations; and as annihilation sites for dislocations. With increasing strain and as the twin boundaries were penetrated by dislocations, they contributed less to the overall mechanical properties. Based on these observations, equations for the evolution of mobile and forest dislocation densities are posed, depicting boundary sources and dislocation-dislocation interactions, respectively. The deformation response is modeled by computing the aggregate response of matrix-twin composite grains in the viscoplastic self-consistent scheme, which permits consideration of compatibility and equilibrium requirements across the twin boundaries. This work highlights the significant role boundaries play in generating the dislocations that control the macroscopic mechanical response

  2. Annealing of defects in indium antimonide after ion bombardment

    International Nuclear Information System (INIS)

    Bogatyrev, V.A.; Kachurin, G.A.

    1977-01-01

    Indium antimonide electric properties are investigated after ion bombardment of different mass (with energy of 60 and 300 keV) and isochrone annealing in the 20-450 deg C temperature range. It is shown that 100-150 deg C n- type stable layers are formed after proton irradiation at room temperature only. Indium antimonide exposure by average mass ions under the same conditions and also by helium ions of 300 keV energy brings to p-type layer formation with high hole concentration. Subsequent heating at the temperature over 150 deg C results in electron conductivity of irradiated layers. Electron volume density and mobility efficiency reaches 10 18 cm -3 and 10 4 cm 2 /Vs respectively. N-type formed layers are stable up to 350 deg C allowing its usage for n-p transition formation admitting thermal treatment. Analysis is given of defect behaviour peculiarities depending upon the irradiation and annealing conditions. Hole conductivity in irradiated indium antimonide is supposed to be stipulated by regions of disorder, while electron conductivity - by relatively simpler disorders

  3. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  4. Complexities due to single-stranded RNA during antibody detection of genomic rna:dna hybrids.

    Science.gov (United States)

    Zhang, Zheng Z; Pannunzio, Nicholas R; Hsieh, Chih-Lin; Yu, Kefei; Lieber, Michael R

    2015-04-08

    Long genomic R-loops in eukaryotes were first described at the immunoglobulin heavy chain locus switch regions using bisulfite sequencing and functional studies. A mouse monoclonal antibody called S9.6 has been used for immunoprecipitation (IP) to identify R-loops, based on the assumption that it is specific for RNA:DNA over other nucleic acid duplexes. However, recent work has demonstrated that a variable domain of S9.6 binds AU-rich RNA:RNA duplexes with a KD that is only 5.6-fold weaker than for RNA:DNA duplexes. Most IP protocols do not pre-clear the genomic nucleic acid with RNase A to remove free RNA. Fold back of ssRNA can readily generate RNA:RNA duplexes that may bind the S9.6 antibody, and adventitious binding of RNA may also create short RNA:DNA regions. Here we investigate whether RNase A is needed to obtain reliable IP with S9.6. As our test locus, we chose the most well-documented site for kilobase-long mammalian genomic R-loops, the immunoglobulin heavy chain locus (IgH) class switch regions. The R-loops at this locus can be induced by using cytokines to stimulate transcription from germline transcript promoters. We tested IP using S9.6 with and without various RNase treatments. The RNase treatments included RNase H to destroy the RNA in an RNA:DNA duplex and RNase A to destroy single-stranded (ss) RNA to prevent it from binding S9.6 directly (as duplex RNA) and to prevent the ssRNA from annealing to the genome, resulting in adventitious RNA:DNA hybrids. We find that optimal detection of RNA:DNA duplexes requires removal of ssRNA using RNase A. Without RNase A treatment, known regions of R-loop formation containing RNA:DNA duplexes can not be reliably detected. With RNase A treatment, a signal can be detected over background, but only within a limited 2 or 3-fold range, even with a stable kilobase-long genomic R-loop. Any use of the S9.6 antibody must be preceded by RNase A treatment to remove free ssRNA that may compete for the S9.6 binding by

  5. Analysis of Double-Stranded RNA from Microbial Communities Identifies Double-Stranded RNA Virus-like Elements

    OpenAIRE

    Decker, Carolyn J.; Parker, Roy

    2014-01-01

    Double-stranded RNA (dsRNA) can function as genetic information and may have served as genomic material before the existence of DNA-based life. By developing a method to purify dsRNA, we have investigated the diversity of dsRNA in microbial populations. We detect large dsRNAs in multiple microbial populations. Analysis of an aquatic microbial population reveals that some dsRNA sequences match metagenomic DNA, suggesting that microbes contain pools of sense-antisense transcripts. In addition, ...

  6. Euler buckling and nonlinear kinking of double-stranded DNA

    Science.gov (United States)

    Fields, Alexander; Axelrod, Kevin; Cohen, Adam

    2012-02-01

    Bare double-stranded DNA is a stiff biopolymer with a persistence length of roughly 53 nm under physiological conditions. Cells and viruses employ extensive protein machinery to overcome this stiffness and bend, twist, and loop DNA to accomplish tasks such as packaging, recombination, gene regulation, and repair. The mechanical properties of DNA are of fundamental importance to the mechanism and thermodynamics of these processes, but physiologically relevant curvature has been difficult to access experimentally. We designed and synthesized a DNA hairpin construct in which base-pairing interactions generated a compressive force on a short segment of duplex DNA, inducing Euler buckling followed by bending to thermally inaccessible radii of curvature. The efficiency of F"orster resonance energy transfer (FRET) between two fluorophores covalently linked to the hairpin indicated the degree of buckling. Bulk and single-molecule measurements yielded distinctly different force-compression curves for intact DNA and for strands with single nicks, base pair mismatches, and damage sites. These results suggest that changes in local mechanical properties may play a significant role in the recognition of these features by DNA-binding proteins.

  7. Amphipathic beta-strand mimics as potential membrane disruptive antibiotics.

    Science.gov (United States)

    Watson, Jessica L; Gillies, Elizabeth R

    2009-08-21

    In recent years, there have been increasing numbers of bacterial strains emerging that are resistant to the currently available antibiotics. In the search for new antibiotics, attention has been focused on natural antimicrobial peptides that act by selectively disrupting the membranes of bacterial cells, a mechanism that is thought to be nonconducive to the development of resistance. It is desirable to mimic the structures and activities of these peptides while introducing properties such as resistance to proteolytic degradation, which make molecules more ideal for development as drugs. Described here is the design and synthesis of beta-strand mimetic oligomers based on alternating alpha-amino acids and azacyclohexenone units that segregate cationic lysine and hydrophobic valine side chains on opposite faces of the beta-strand. (1)H NMR dilution studies demonstrated that despite the incorporation of alternating d- and l-amino acids in order to obtain facial amphiphilicity, these oligomers are capable of dimerizing to beta-sheet mimics in a manner similar to the oligomers containing all l-amino acids. The ability of the molecules to disrupt phospholipid vesicles mimicking the membranes of both bacterial and mammalian cells was investigated using a fluorescent dye leakage assay. Several of the oligomers were found to exhibit activity and selectivity for the bacterial over mammalian membranes. Overall, these studies demonstrate the promise of this class of molecules for the development of new potential antibiotics and provide information on the structural features that are important for activity.

  8. Protection of DNA strand breakage by radiation exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Ho; Kim, In Gyu; Lee, Kang Suk; Kim, Kug Chan; Shim, Hae Won

    1997-12-01

    Human ceruloplasmin, the plasma copper containing protein, is thought to play an essential role in iron metabolism, but it also has antioxidant properties. Ceruloplasmin directly scavenged hydroxyl radicals (.OH) generated in dithiothreitol/FeCl{sub 3} system besides inhibitory function of hydroxyl radical formation and lipid peroxidation. Polyamines, spermidine and spermine, significantly protected the supercoiled DNA strand breakage by hydroxyl radicals and DNA strand breakage by UV was highly protected by all four polyamines used in this study. In polyamine deficient mutant KL527. It was shown that cell survivability following UV irradiation was slightly increased by exogenous polyamines putrescine and spermidine supplement. However the cell survivability of wild type (MG 1655) was not influenced by polyamine supplement. In {gamma}-irradiated cells, cell survivability of polyamine-deficient mutant strain KL527 was significantly increased by exogenous putrescine supplement and that of wild type strain MG1655 was similar irrespective of polyamine supplement. These results implicate the possibility that polyamines play a potent role in radioprotection of cell and DNA level. (author). 32 refs., 8 figs

  9. Triplex-forming oligonucleotides: a third strand for DNA nanotechnology.

    Science.gov (United States)

    Chandrasekaran, Arun Richard; Rusling, David A

    2018-02-16

    DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical ('triplex') structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone.

  10. Monomer dynamics in single- and double-stranded DNA coils

    Science.gov (United States)

    Tothova, J.; Brutovsky, B.; Lisy, V.

    2007-09-01

    In our paper (Tothova et al., Czech. J. Phys. 55, 221 (2005)), the first observation of the kinetics of individual polymer monomers using the fluorescence correlation technique (R. Shusterman et al., Phys. Rev. Lett. 92, 048303 (2004)) has been interpreted within the bead-spring theory. Optimizing the joint Rouse-Zimm model to the experimental data, the phenomenological parameters for the statistical-mechanical description of the universal behavior of double- and single-stranded DNA and the dominant types of their dynamics have been determined. Recently, these data have been corrected (R. Shusterman et al., Phys. Rev. Lett. 98, 029901 (2007)). In the present work, the fits of the theory to the new data are given. The main conclusions of our preceding paper remain unchanged but some of the polymer parameters have changed. The new data allow a significantly better agreement with the theory than the previous ones. Our calculations confirm that dsDNA follows mainly the classical Zimm-type kinetics rather than the Rouse one as it was proposed by Shusterman et al. Single-stranded DNA also behaves predominantly as the Zimm polymer. To support these conclusions, we analyze the draining effects on the monomer dynamics and the applicability of simple “universal” laws, according to which the monomer mean square displacement scales with the time as t1/2 and t2/3 for the Rouse and Zimm polymers, respectively.

  11. Genome-wide mapping of DNA strand breaks.

    Directory of Open Access Journals (Sweden)

    Frédéric Leduc

    Full Text Available Determination of cellular DNA damage has so far been limited to global assessment of genome integrity whereas nucleotide-level mapping has been restricted to specific loci by the use of specific primers. Therefore, only limited DNA sequences can be studied and novel regions of genomic instability can hardly be discovered. Using a well-characterized yeast model, we describe a straightforward strategy to map genome-wide DNA strand breaks without compromising nucleotide-level resolution. This technique, termed "damaged DNA immunoprecipitation" (dDIP, uses immunoprecipitation and the terminal deoxynucleotidyl transferase-mediated dUTP-biotin end-labeling (TUNEL to capture DNA at break sites. When used in combination with microarray or next-generation sequencing technologies, dDIP will allow researchers to map genome-wide DNA strand breaks as well as other types of DNA damage and to establish a clear profiling of altered genes and/or intergenic sequences in various experimental conditions. This mapping technique could find several applications for instance in the study of aging, genotoxic drug screening, cancer, meiosis, radiation and oxidative DNA damage.

  12. Protection of DNA strand breakage by radiation exposure

    International Nuclear Information System (INIS)

    Lee, Jeong Ho; Kim, In Gyu; Lee, Kang Suk; Kim, Kug Chan; Shim, Hae Won

    1997-12-01

    Human ceruloplasmin, the plasma copper containing protein, is thought to play an essential role in iron metabolism, but it also has antioxidant properties. Ceruloplasmin directly scavenged hydroxyl radicals (.OH) generated in dithiothreitol/FeCl 3 system besides inhibitory function of hydroxyl radical formation and lipid peroxidation. Polyamines, spermidine and spermine, significantly protected the supercoiled DNA strand breakage by hydroxyl radicals and DNA strand breakage by UV was highly protected by all four polyamines used in this study. In polyamine deficient mutant KL527. It was shown that cell survivability following UV irradiation was slightly increased by exogenous polyamines putrescine and spermidine supplement. However the cell survivability of wild type (MG 1655) was not influenced by polyamine supplement. In γ-irradiated cells, cell survivability of polyamine-deficient mutant strain KL527 was significantly increased by exogenous putrescine supplement and that of wild type strain MG1655 was similar irrespective of polyamine supplement. These results implicate the possibility that polyamines play a potent role in radioprotection of cell and DNA level. (author). 32 refs., 8 figs

  13. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  14. The RNA synthesis machinery of negative-stranded RNA viruses

    Energy Technology Data Exchange (ETDEWEB)

    Ortín, Juan, E-mail: jortin@cnb.csic.es [Department of Molecular and Cellular Biology, Centro Nacional de Biotecnología (CSIC) and CIBER de Enfermedades Respiratorias (ISCIII), Madrid (Spain); Martín-Benito, Jaime, E-mail: jmartinb@cnb.csic.es [Department of Macromolecular Structures, Centro Nacional de Biotecnología (CSIC), Madrid (Spain)

    2015-05-15

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes.

  15. The RNA synthesis machinery of negative-stranded RNA viruses

    International Nuclear Information System (INIS)

    Ortín, Juan; Martín-Benito, Jaime

    2015-01-01

    The group of Negative-Stranded RNA Viruses (NSVs) includes many human pathogens, like the influenza, measles, mumps, respiratory syncytial or Ebola viruses, which produce frequent epidemics of disease and occasional, high mortality outbreaks by transmission from animal reservoirs. The genome of NSVs consists of one to several single-stranded, negative-polarity RNA molecules that are always assembled into mega Dalton-sized complexes by association to many nucleoprotein monomers. These RNA-protein complexes or ribonucleoproteins function as templates for transcription and replication by action of the viral RNA polymerase and accessory proteins. Here we review our knowledge on these large RNA-synthesis machines, including the structure of their components, the interactions among them and their enzymatic activities, and we discuss models showing how they perform the virus transcription and replication programmes. - Highlights: • Overall organisation of NSV RNA synthesis machines. • Structure and function of the ribonucleoprotein components: Atomic structure of the RNA polymerase complex. • Commonalities and differences between segmented- and non-segmented NSVs. • Transcription versus replication programmes

  16. Cadmium/zinc-metallothionein induces DNA strand breaks in vitro.

    Science.gov (United States)

    Müller, T; Schuckelt, R; Jaenicke, L

    1991-01-01

    The in vitro DNA strand breaking activity of metallothionein (MT) containing Cd2+ and Zn2+ in a molar ratio of 5:2 is described. Studies with radical scavengers and electron paramagnetic resonance spectroscopy indicate that the DNA damage might be caused by a radical species formed by the native protein (i.e., MT) charged with the heavy metal ions. No DNA strand breaks are detectable with the heat-denatured MT or with Cd2+ or Zn2+ alone. Inhibition studies using EDTA as a metal ion chelator or N-ethylmaleimide to alkylate sulfhydryl groups suggest that both the bound heavy metal ions as well as the SH groups of the various cysteine residues of MT may be involved in the MT-dependent DNA cleavage. Further characterization showed that the DNA cleavage is more likely random than sequence- or base-specific. These observations may provide a clue in the search for initial events in Cd-related carcinogenicity.

  17. Photochemical Acceleration of DNA Strand Displacement by Using Ultrafast DNA Photo-crosslinking.

    Science.gov (United States)

    Nakamura, Shigetaka; Hashimoto, Hirokazu; Kobayashi, Satoshi; Fujimoto, Kenzo

    2017-10-18

    DNA strand displacement is an essential reaction in genetic recombination, biological processes, and DNA nanotechnology. In particular, various DNA nanodevices enable complicated calculations. However, it takes time before the output is obtained, so acceleration of DNA strand displacement is required for a rapid-response DNA nanodevice. Herein, DNA strand displacement by using DNA photo-crosslinking to accelerate this displacement is evaluated. The DNA photo-crosslinking of 3-cyanovinylcarbazole ( CNV K) was accelerated at least 20 times, showing a faster DNA strand displacement. The rate of photo-crosslinking is a key factor and the rate of DNA strand displacement is accelerated through ultrafast photo-crosslinking. The rate of DNA strand displacement was regulated by photoirradiation energy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Estimation of Prestress Force Distribution in the Multi-Strand System of Prestressed Concrete Structures.

    Science.gov (United States)

    Cho, Keunhee; Park, Sung Yong; Cho, Jeong-Rae; Kim, Sung Tae; Park, Young-Hwan

    2015-06-15

    Prestressed concrete (PSC) is one of the most reliable, durable and widely used construction materials, which overcomes the weakness of concrete in tension by the introduction of a prestress force. Smart strands enabling measurement of the prestress force have recently been developed to maintain PSC structures throughout their lifetime. However, the smart strand cannot give a representative indication of the whole prestress force when used in multi-strand systems since each strand sustains a different prestress force. In this paper, the actual distribution of the prestress force in a multi-strand system is examined using elastomagnetic (EM) sensors to develop a method for tracking representative indicators of the prestress force using smart strands.

  19. Estimation of Prestress Force Distribution in the Multi-Strand System of Prestressed Concrete Structures

    Directory of Open Access Journals (Sweden)

    Keunhee Cho

    2015-06-01

    Full Text Available Prestressed concrete (PSC is one of the most reliable, durable and widely used construction materials, which overcomes the weakness of concrete in tension by the introduction of a prestress force. Smart strands enabling measurement of the prestress force have recently been developed to maintain PSC structures throughout their lifetime. However, the smart strand cannot give a representative indication of the whole prestress force when used in multi-strand systems since each strand sustains a different prestress force. In this paper, the actual distribution of the prestress force in a multi-strand system is examined using elastomagnetic (EM sensors to develop a method for tracking representative indicators of the prestress force using smart strands.

  20. Investigations of radiation-induced strand breaks of poly(U) in aqueous solutions

    International Nuclear Information System (INIS)

    Lemaire, D.G.E.

    1984-01-01

    DNA strand breaks induced by γ irradiation were studied in polyuridylic acid (Poly(U)), a single-strand model substance with a single base. Poly(U) in diluted, aqueous solution was irradiated in a Co-γ source, and the 100 eV yields of strand breaks (Cr values) were determined on the basis of the loss of molecular weight. The molecular weight was determined by small-angle laser light scattering. (orig./PW) [de

  1. Effects of different annealing atmospheres on the properties of cadmium sulfide thin films

    Energy Technology Data Exchange (ETDEWEB)

    Yücel, E., E-mail: dr.ersinyucel@gmail.com [Department of Physics, Faculty of Arts and Sciences, Mustafa Kemal University, 31034 Hatay (Turkey); Kahraman, S. [Department of Metallurgy and Material Engineering, Faculty of Technology, Mustafa Kemal University, 31034 Hatay (Turkey); Güder, H.S. [Department of Physics, Faculty of Arts and Sciences, Mustafa Kemal University, 31034 Hatay (Turkey)

    2015-08-15

    Graphical abstract: The effects of different annealing atmospheres (air and sulfur) on the structural, morphological and optical properties of CdS thin films were studied at three different pH values. - Highlights: • Compactness and smoothness of the films were enhanced after sulfur annealing. • Micro-strain values of some films were improved after sulfur annealing. • Dislocation density values of some films were improved after sulfur annealing. • Band gap values of the films were improved after sulfur annealing. - Abstract: Cadmium sulfide (CdS) thin films were prepared on glass substrates by using chemical bath deposition (CBD) technique. The effects of different annealing atmospheres (air and sulfur) on the structural, morphological and optical properties of CdS thin films were studied at three different pH values. Compactness and smoothness of the films (especially for pH 10.5 and 11) enhanced after sulfur annealing. pH value of the precursor solution remarkably affected the roughness, uniformity and particle sizes of the films. Based on the analysis of X-ray diffraction (XRD) patterns of the films, micro-strain and dislocation density values of the sulfur-annealed films (pH 10.5 and 11) were found to be lower than those of air-annealed films. Air-annealed films (pH 10.5, 11 and 11.5) exhibited higher transmittance than sulfur-annealed films in the wavelength region of 550–800 nm. Optical band gap values of the films were found between 2.31 eV and 2.36 eV.

  2. Fracture behaviors of isotactic polypropylene/poly(ethylene oxide) blends: Effect of annealing

    Energy Technology Data Exchange (ETDEWEB)

    Wu Haiyan; Li Xiaoxi; Wang Yonghong; Wu Jun; Huang Ting [Key Laboratory of Advanced Technologies of Materials (Ministry of Education), School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China); Wang Yong, E-mail: yongwang1976@163.com [Key Laboratory of Advanced Technologies of Materials (Ministry of Education), School of Materials Science and Engineering, Southwest Jiaotong University, Chengdu 610031 (China)

    2011-10-15

    Highlights: {yields} Immiscible polypropylene/poly(ethylene oxide) was annealed at different temperatures (50-160 deg. C) for 12 h and at 100 deg. C for different durations (12-96 h). {yields} Fracture behaviors of the annealed samples were systematically investigated by means of various measurements. {yields} In a range of annealing temperature (100-140 deg. C), largely improved fracture resistance was observed. {yields} Annealing treatment is favorable for the improvement of the storage modulus of the immiscible polymer blend. - Abstract: As a part of serial work about the toughening of isotactic polypropylene (iPP) during annealing treatment, this work reports the effect of annealing on fracture behaviors of iPP blend with a little of poly(ethylene oxide) (PEO). Injection-molded bars of an iPP/PEO blend were annealed at different temperatures (50-160 deg. C) for 12 h and at 100 deg. C for different durations (12-96 h). The fracture behaviors of the annealed samples, including notched Izod impact fracture, universal tensile fracture, and single-edge notched tensile (SENT) fracture, were comparatively investigated to establish the role of annealing in improving the fracture resistance of the sample. The results showed that the annealing treatment greatly influences the fracture resistance of the blend. The impact-fractured surface morphologies were characterized by scanning electron microscope (SEM) to clarify the possible mechanisms for the improvement of the fracture resistance. It was proposed that, the excellent fracture resistance of iPP with a minor phase of which exhibits relatively low melting temperature can be easily achieved through the simple annealing treatment, even if the minor phase is immiscible with iPP.

  3. Post-annealing effects on pulsed laser deposition-grown GaN thin films

    International Nuclear Information System (INIS)

    Cheng, Yu-Wen; Wu, Hao-Yu; Lin, Yu-Zhong; Lee, Cheng-Che; Lin, Ching-Fuh

    2015-01-01

    In this work, the post-annealing effects on gallium nitride (GaN) thin films grown from pulsed laser deposition (PLD) are investigated. The as-deposited GaN thin films grown from PLD are annealed at different temperatures in nitrogen ambient. Significant changes of the GaN crystal properties are observed. Raman spectroscopy is used to observe the crystallinity, the change of residual stress, and the thermal decomposition of the annealed GaN thin films. X-ray diffraction is also applied to identify the crystal phase of GaN thin films, and the surface morphology of GaN thin films annealed at different temperatures is observed by scanning electron microscopy. Through the above analyses, the GaN thin films grown by PLD undergo three stages: phase transition, stress alteration, and thermal decomposition. At a low annealing temperature, the rock salt GaN in GaN films is transformed into wurtzite. The rock salt GaN diminishes with increasing annealing temperature. At a medium annealing temperature, the residual stress of the film changes significantly from compressive strain to tensile strain. As the annealing temperature further increases, the GaN undergoes thermal decomposition and the surface becomes granular. By investigating the annealing temperature effects and controlling the optimized annealing temperature of the GaN thin films, we are able to obtain highly crystalline and strain-free GaN thin films by PLD. - Highlights: • The GaN thin film is grown on sapphire by pulsed laser deposition. • The GaN film undergoes three stages with increasing annealing temperature. • In the first stage, the film transfers from rock salt to wurtzite phase. • In the second stage, the stress in film changes from compressive to tensile. • In the final stage, the film thermally decomposes and becomes granular

  4. Radioresistance of GGG sequences to prompt strand break formation from direct-type radiation damage.

    Science.gov (United States)

    Black, Paul J; Miller, Adam S; Hayes, Jeffrey J

    2016-11-01

    As humans, we are constantly exposed to ionizing radiation from natural, man-made and cosmic sources which can damage DNA, leading to deleterious effects including cancer incidence. In this work, we introduce a method to monitor strand breaks resulting from damage due to the direct effect of ionizing radiation and provide evidence for sequence-dependent effects leading to strand breaks. To analyze only DNA strand breaks caused by radiation damage due to the direct effect of ionizing radiation, we combined an established technique to generate dehydrated DNA samples with a technique to analyze single-strand breaks on short oligonucleotide sequences via denaturing gel electrophoresis. We find that direct damage primarily results in a reduced number of strand breaks in guanine triplet regions (GGG) when compared to isolated guanine (G) bases with identical flanking base context. In addition, we observe strand break behavior possibly indicative of protection of guanine bases when flanked by pyrimidines and sensitization of guanine to strand break when flanked by adenine (A) bases in both isolated G and GGG cases. These observations provide insight into the strand break behavior in GGG regions damaged via the direct effect of ionizing radiation. In addition, this could be indicative of DNA sequences that are naturally more susceptible to strand break due to the direct effect of ionizing radiation.

  5. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts.

    Science.gov (United States)

    Grant, Rachel A; Savirina, Anna; Hoppitt, Will

    2018-01-26

    The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals) stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or juveniles, and in the case of dead stranded mammals, the commonest cause of death was trauma, disease, and emaciation.

  6. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  7. Workshop on effects of chromium coating on Nb3Sn superconductor strand: Proceedings

    International Nuclear Information System (INIS)

    1994-01-01

    This report discusses the following topics: Chromium coating on superconductor strand -- an overview; technology of chromium plating; comparison of wires plated by different platers; search for chromium in copper; strand manufactures' presentations; chromium plating at the Lawrence Livermore National Laboratory; a first look at a chromium plating process development project tailored for T.P.X. and I.T.E.R. strand; and influence of chromium diffusion and related phenomena on the reference ratios of bare and chromium plated Nb 3 Sn strand

  8. Development of a 10 m quasi-isotropic strand assembled from 2G wires

    Science.gov (United States)

    Kan, Changtao; Wang, Yinshun; Hou, Yanbing; Li, Yan; Zhang, Han; Fu, Yu; Jiang, Zhe

    2018-03-01

    Quasi-isotropic strands made of second generation (2G) high temperature superconducting (HTS) wires are attractive to applications of high-field magnets at low temperatures and power transmission cables at liquid nitrogen temperature in virtue of their high current carrying capability and well mechanical property. In this contribution, a 10 m length quasi-isotropic strand is manufactured and successfully tested in liquid nitrogen to verify the feasibility of an industrial scale production of the strand by the existing cabling technologies. The strand with copper sheath consists of 72 symmetrically assembled 2G wires. The uniformity of critical properties of long quasi-isotropic strands, including critical current and n-value, is very important for their using. Critical currents as well as n-values of the strand are measured every 1 m respectively and compared with the simulation results. Critical current and n-value of the strand are calculated basing on the self-consistent model solved by the finite element method (FEM). Effects of self-field on the critical current and n-value distributions in wires of the strand are analyzed in detail. The simulation results show good agreement with the experimental data and the 10 m quasi-isotropic strand has good critical properties uniformity.

  9. Interactions between Cytochrome c and DNA Strands Self-Assembled at Gold Electrode

    Science.gov (United States)

    Lao, Ruojun; Wang, Lihua; Wan, Ying; Zhang, Jiong; Song, Shiping; Zhang, Zhizhou; Fan, Chunhai; He, Lin

    2007-01-01

    In this work, we reported the investigation on the interaction between DNA strands self-assembled at gold electrodes and an electron transfer protein, cytochrome c. We observed that cytochrome c exhibited well-defined electrochemistry in both double-stranded and single-stranded DNA films. This suggested that the electron transfer reaction of cytochrome c arose possibly due to the electron hopping along DNA strands rather than wiring along the double helix. We also compared the heterogeneous electron transfer rate of cytochrome c with that of a ruthenium complex, which further confirmed this mechanism.

  10. Offshore Earthquakes Do Not Influence Marine Mammal Stranding Risk on the Washington and Oregon Coasts

    Directory of Open Access Journals (Sweden)

    Rachel A. Grant

    2018-01-01

    Full Text Available The causes of marine mammals stranding on coastal beaches are not well understood, but may relate to topography, currents, wind, water temperature, disease, toxic algal blooms, and anthropogenic activity. Offshore earthquakes are a source of intense sound and disturbance and could be a contributing factor to stranding probability. We tested the hypothesis that the probability of marine mammal stranding events on the coasts of Washington and Oregon, USA is increased by the occurrence of offshore earthquakes in the nearby Cascadia subduction zone. The analysis carried out here indicated that earthquakes are at most, a very minor predictor of either single, or large (six or more animals stranding events, at least for the study period and location. We also tested whether earthquakes inhibit stranding and again, there was no link. Although we did not find a substantial association of earthquakes with strandings in this study, it is likely that there are many factors influencing stranding of marine mammals and a single cause is unlikely to be responsible. Analysis of a subset of data for which detailed descriptions were available showed that most live stranded animals were pups, calves, or juveniles, and in the case of dead stranded mammals, the commonest cause of death was trauma, disease, and emaciation.

  11. Flexural behavior of bonded post-tensioned concrete beams under strand corrosion

    International Nuclear Information System (INIS)

    Zhang, Xuhui; Wang, Lei; Zhang, Jianren; Ma, Yafei; Liu, Yongming

    2017-01-01

    Highlights: • Flexural behavior of bonded PT beams with strand corrosion is experimental tested. • Cracking, stiffness, ultimate strength, failure & ductility of beams are clarified. • A coefficient is proposed to measure incompatible strain between strand & concrete. - Abstract: An experimental test is performed to investigate the flexural behavior of bonded post-tensioned concrete beams under strand corrosion. Eight beams are designed and subjected to accelerated method to different corrosion levels. The initial stiffness of beams is observed by cyclic loading-unloading test during the corrosion procedure. Corrosion effects on concrete cracking, post-cracking stiffness, ultimate strength, failure mode and ductility are then clarified by the flexural test. And, a coefficient is introduced to quantify the incompatible strain between corroded strand and concrete. Results show that the prestress force loss of strand has almost the linear relation with corrosion loss. Strand corrosion affects slightly the initial stiffness of beam before flexural cracking, but degrades significantly the post-cracking stiffness of beam as the corrosion loss exceeds 27.0%. Slight corrosion of strand has little effects on beams flexural behavior. The severe corrosion, however, decreases the number of crack, changes the failure mode form the concrete crushing to strand rupture, degrades the ductility and the ultimate strength of beams, and leads to the incompatible strain between strand and concrete. In the present test, the incompatible strain decreases about 20% of the flexural strength as the corrosion loss exceeds 27.0%.

  12. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  13. spsann - optimization of sample patterns using spatial simulated annealing

    Science.gov (United States)

    Samuel-Rosa, Alessandro; Heuvelink, Gerard; Vasques, Gustavo; Anjos, Lúcia

    2015-04-01

    There are many algorithms and computer programs to optimize sample patterns, some private and others publicly available. A few have only been presented in scientific articles and text books. This dispersion and somewhat poor availability is holds back to their wider adoption and further development. We introduce spsann, a new R-package for the optimization of sample patterns using spatial simulated annealing. R is the most popular environment for data processing and analysis. Spatial simulated annealing is a well known method with widespread use to solve optimization problems in the soil and geo-sciences. This is mainly due to its robustness against local optima and easiness of implementation. spsann offers many optimizing criteria for sampling for variogram estimation (number of points or point-pairs per lag distance class - PPL), trend estimation (association/correlation and marginal distribution of the covariates - ACDC), and spatial interpolation (mean squared shortest distance - MSSD). spsann also includes the mean or maximum universal kriging variance (MUKV) as an optimizing criterion, which is used when the model of spatial variation is known. PPL, ACDC and MSSD were combined (PAN) for sampling when we are ignorant about the model of spatial variation. spsann solves this multi-objective optimization problem scaling the objective function values using their maximum absolute value or the mean value computed over 1000 random samples. Scaled values are aggregated using the weighted sum method. A graphical display allows to follow how the sample pattern is being perturbed during the optimization, as well as the evolution of its energy state. It is possible to start perturbing many points and exponentially reduce the number of perturbed points. The maximum perturbation distance reduces linearly with the number of iterations. The acceptance probability also reduces exponentially with the number of iterations. R is memory hungry and spatial simulated annealing is a

  14. Influence of Annealing Temperature on the Characteristics of Ti-Codoped GZO Thin Solid Film

    Directory of Open Access Journals (Sweden)

    Tao-Hsing Chen

    2013-01-01

    Full Text Available This study utilizes radio frequency magnetron sputtering (RF sputtering to deposit GZO transparent conductive film and Ti thin film on the same corning glass substrate and then treats GZO/Ti thin film with rapid thermal annealing. The annealing temperatures are 300°C , 500°C, and 550°C, respectively. Ti:GZO transparent conductive oxide (TCO thin films are deposited on glass substrates using a radio frequency magnetron sputtering technique. The thin films are then annealed at temperatures of 300°C, 500°C, and 550°C, respectively, for rapid thermal annealing. The effects of the annealing temperature on the optical properties, resistivity, and nanomechanical properties of the Ti:GZO thin films are then systematically explored. The results show that all of the annealed films have excellent transparency (~90% in the visible light range. Moreover, the resistivity of the Ti:GZO films reduces with an increasing annealing temperature, while the carrier concentration and Hall mobility both increase. Finally, the hardness and Young’s modulus of the Ti:GZO thin films are both found to increase as the annealing temperature is increased.

  15. Influence of annealing temperature on ZnO thin films grown by dual ...

    Indian Academy of Sciences (India)

    In electrical characterization as well, when annealing temperature was increased from 400 to 600 °C, room temperature electron mobility enhanced from 6.534 to 13.326 cm2/V s, and then reduced with subsequent increase in temperature. Therefore, 600 °C annealing temperature produced good-quality ZnO film, suitable ...

  16. Microstructural evolution modelling of low carbon steel sheets during continuous annealing. Prediction of the mechanical properties

    International Nuclear Information System (INIS)

    Petite, M.M.; Monsalve, A.; Gutierrez, I.; Zaitegui, J.; Larburu, J.I.

    1998-01-01

    A model has been developed which allows the prediction of both, the evolution of the microstructure during continuous annealing and the final mechanical properties as a function of the steel composition, the variables defining the annealing cycle and those during hot and cold rolling. (Author) 10 refs

  17. Threefold atmospheric-pressure annealing for suppressing graphene nucleation on copper in chemical vapor deposition

    Science.gov (United States)

    Suzuki, Seiya; Nagamori, Takashi; Matsuoka, Yuki; Yoshimura, Masamichi

    2014-09-01

    Chemical vapor deposition (CVD) is a promising method of producing a large single-crystal graphene on a catalyst, especially on copper (Cu), and a further increase in domain size is desirable for electro/optic applications. Here, we report on threefold atmospheric-pressure (ATM) annealing for suppressing graphene nucleation in atmospheric CVD. Threefold ATM annealing formed a step and terrace surface of the underlying Cu, in contrast to ATM annealing. Atomic force microscopy and Auger electron mapping revealed that Si-containing particles existed on threefold-ATM- and ATM-annealed surfaces; particles on Cu had a lower density after threefold ATM annealing than after ATM annealing. The formation of a step and terrace surface and the lower density of particles following the threefold ATM annealing would play a role in reducing graphene nucleation. By combining threefold ATM annealing and electropolishing of Cu, the nucleation of graphene was effectively suppressed, and a submillimeter-sized hexagonal single-crystal graphene was successfully obtained.

  18. Effect of annealing temperature on the mechanical properties of Zircaloy-4 cladding

    International Nuclear Information System (INIS)

    Beauregard, R.J.; Clevinger, G.S.; Murty, K.L.

    1977-01-01

    The mechanical properties of Zircaloy cladding materials are sensitive to those fabrication variables which have an effect on the preferred crystallographic orientation or texture of the finished tube. The effect of one such variable, the final annealing temperature, on various mechanical properties is examined using tube reduced Zircaloy-4 fuel rod cladding annealed at temperatures from 905F to 1060F. This temperature range provides cladding with varying degrees of recrystallization including full recrystallization. The burst strength of the cladding at 650F decreased with the annealing temperature reaching a saturation value at approximately 1000F. The total circumferential elongation increased with the annealing temperature reaching a maximum at approximately 1000F and decreasing at higher temperatures. Hoop creep characteristics of Zircaloy cladding were studied as a function of the annealing temperature using closed-end internal pressurization tests at 750F and hoop stresses of 10, 15, 20 and 25 ksi. The effect of annealing temperature on the room temperature mechanical anisotropy parameters, R and P, was studied. The R-parameter was essentially independent of the annealing temperature while the P-parameter increased with annealing temperature. The mechanical anisotropy parameters were also studied as a function of the test temperature from ambient to approximately 800F using continuously monitored high precision extensometry. (Auth.)

  19. Physical model of evolution of oxygen subsystem of PLZT-ceramics at neutron irradiation and annealing

    CERN Document Server

    Kulikov, D V; Trushin, Y V; Veber, K V; Khumer, K; Bitner, R; Shternberg, A R

    2001-01-01

    The physical model of evolution of the oxygen subsystem defects of the ferroelectric PLZT-ceramics by the neutron irradiation and isochrone annealing is proposed. The model accounts for the effect the lanthanum content on the material properties. The changes in the oxygen vacancies concentration, calculated by the proposed model, agree well with the polarization experimental behavior by the irradiated material annealing

  20. Surface Impedance of Copper MOB Depending on the Annealing Temperature and Deformation Degree

    International Nuclear Information System (INIS)

    Kutovoj, V.A.; Nikolaenko, A.A.; Stoev, P.I.; Vinogradov, D.V.

    2006-01-01

    Results of researches of influence of annealing temperature and deformation degree on mechanical features of copper MOB are presented. It is shown that minimal surface resistance is observed in copper samples that were subject to pre-deformation and were annealed in the range of temperatures 873...923 K

  1. Annealing effects on strain and stress sensitivity of polymer optical fibre based sensors

    DEFF Research Database (Denmark)

    Pospori, A.; Marques, C. A. F.; Zubel, M. G.

    2016-01-01

    The annealing effects on strain and stress sensitivity of polymer optical fibre Bragg grating sensors after their photoinscription are investigated. PMMA optical fibre based Bragg grating sensors are first photo-inscribed and then they were placed into hot water for annealing. Strain, stress...... fibre tends to increase the strain, stress and force sensitivity of the photo-inscribed sensor....

  2. Study of annealing effects in Al–Sb bilayer thin films

    Indian Academy of Sciences (India)

    Abstract. In this paper, we present preparation and characterization of Al–Sb bilayer thin films. Thin films of thicknesses, 3000/1000 Ц and 3000/1500 Е, were obtained by the thermal evaporation (resistive heating) method. Vacuum annealing and rapid thermal annealing methods were used to mix bilayer thin film structure.

  3. Synthesis and characterization of nanocrystalline vanadium oxide thin films: electrochemical behavior by annealing in different atmosphere

    Science.gov (United States)

    Asiabar, M. Amiri; Mohaghegh, Z.; Ghodsi, F. E.

    2018-01-01

    Nanocrystalline vanadium oxide thin films were prepared using sol-gel dip-coating technique. The effect of heat treatment in different environment including air, N2, Ar, and O2 gas on the structural, optical, electrical, and electrochemical properties of nanocrystalline vanadium oxide thin films were investigated. The results indicated that the calculated average crystallite size was reduced by annealing in Ar environment. Scanning electron microscopy (SEM) images showed layered morphology on the surface of the film annealed in air atmosphere, whereas the film annealed under Ar and N2 ambient revealed granular and wrinkle morphology, respectively. This morphology altered to rather smooth surface by annealing in O2 environment. The optical bandgap of the films were found to be 1.75, 1.84, 2.08, and 2.10 eV annealed in air, O2, N2, and Ar environment, respectively. It was observed that the films annealed under Ar and N2 ambient had low resistivity ( 0.2 Ω cm) and high carrier concentration, while the film annealed in nitrogen environment showed higher mobility of charge carrier. The electrochemical measurements showed that annealing under N2 ambient improved the intercalation of Li ions, leading a higher interfacial capacitance of 19.18 mF Cm-2, and decreased the charge transfer resistance due to surface defects created by heat treatment in nitrogen environment.

  4. Effect of annealing on properties of Mg doped Zn-ferrite nanoparticles

    Directory of Open Access Journals (Sweden)

    K. Nadeem

    2015-04-01

    Full Text Available A comparison of structural and magnetic properties of as-prepared and annealed (900 °C Mg doped Zn ferrite nanoparticles (Zn1−xMgxFe2O4, with x=0, 0.1, 0.2, 0.3, 0.4 and 0.5 is presented. X-ray diffraction (XRD studies confirmed the cubic spinel structure for both the as-prepared and annealed nanoparticles. The average crystallite size and lattice parameter were increased by annealing. Scanning electron microscopy (SEM images also showed that the average particle size increased after annealing. Fourier transform infrared spectroscopy (FTIR also confirmed the spinel structure for both series of nanoparticles. For both annealed and as-prepared nanoparticles, the O–Mtet.–O vibrational band shifts towards higher wave numbers with increased Mg concentration due to cationic rearrangement on the lattice sites. Magnetization studies revealed an anomalous decreasing magnetization for the annealed nanoparticles which is also ascribed to cationic rearrangement on the lattice sites after annealing. The measurement of coercivity showed a decreasing trend by annealing due to the increased nanoparticle size and better crystallinity.

  5. Annealing of UV-Induced Birefringence in Hydrogen Loaded Germanosilicate Fibres

    DEFF Research Database (Denmark)

    Canning, John; Deyerl, Hans-Jürgen; Sørensen, Henrik Rokkjær

    2005-01-01

    UV-reduced birefringence in germanosilicate optical fibres loaded with hydrogen is annealed out at low temperatures (125o C). Annealing for induced birefringence in gratings written by either s or p polarised UV light are identical. The results are incosistent with previous models for the origin ...

  6. Effect of vacuum annealing on evaporated pentacene thin films for memory device applications

    International Nuclear Information System (INIS)

    Gayathri, A.G.; Joseph, C.M.

    2016-01-01

    Graphical abstract: Switching of ITO/pentacene/Al thin films for different annealing temperatures. - Highlights: • Memory device performance in pentacene improved considerably with annealing. • ON/OFF ratio of the pentacene device increases due to annealing. • Threshold voltage reduces from 2.55 V to 1.35 V due to annealing. • Structure of pentacene thin films is also dependent on annealing temperature. - Abstract: Thin films of pentacene were deposited thermally onto glass substrates and annealed at 323 K, 373 K, 423 K, 473 K and 523 K in high vacuum. Effect of annealing on the morphological and structural properties of these films was studied. X-ray diffraction patterns confirmed the crystalline nature of the films. Electrical studies for the use as write once read many (WORM) memory devices were done for the vacuum deposited pentacene thin films on indium tin oxide coated glass. Due to annealing, a sharp increase in the ON/OFF ratio of current and a decrease in threshold voltage were observed at around 373 K. This device showed a stable switching with an ON/OFF current ratio as high as 10 9 and a switching threshold voltage of 1.35 V. The performance of the device degraded above 423 K due to the changes in the crystallinity of the film.

  7. Formation of oxygen related donors in step-annealed CZ–silicon

    Indian Academy of Sciences (India)

    Unknown

    anneal of 10 h followed by annealing of 10 h ... But it leaves some problems with a mark of interrogation, such as the exact kinetics of thermal ... desired heat treatment and the concentrations of oxygen. (Oi) and carbon (Cs) are again measured with ...

  8. Enhanced bulk heterojunction devices prepared by thermal and solvent vapor annealing processes

    Science.gov (United States)

    Forrest, Stephen R.; Thompson, Mark E.; Wei, Guodan; Wang, Siyi

    2017-09-19

    A method of preparing a bulk heterojunction organic photovoltaic cell through combinations of thermal and solvent vapor annealing are described. Bulk heterojunction films may prepared by known methods such as spin coating, and then exposed to one or more vaporized solvents and thermally annealed in an effort to enhance the crystalline nature of the photoactive materials.

  9. Electrical behavior of amide functionalized graphene oxide and graphene oxide films annealed at different temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Rani, Sumita; Kumar, Mukesh, E-mail: kumarmukesh@gmail.com; Kumar, Dinesh; Sharma, Sumit

    2015-06-30

    Films of graphene oxide (GO) and amide functionalized graphene oxides (AGOs) were deposited on SiO{sub 2}/Si(100) by spin coating and were thermally annealed at different temperatures. Sheet resistance of GO and AGOs films was measured using four probe resistivity method. GO an insulator at room temperature, exhibits decrease in sheet resistance with increase in annealing temperature. However, AGOs' low sheet resistance (250.43 Ω) at room temperature further decreases to 39.26 Ω after annealing at 800 °C. It was observed that the sheet resistance of GO was more than AGOs up to 700 °C, but effect was reversed after annealing at higher temperature. At higher annealing temperatures the oxygen functionality reduces in GO and sheet resistance decreases. Sheet resistance was found to be annealing time dependent. Longer duration of annealing at a particular temperature results in decrease of sheet resistance. - Highlights: • Amide functionalized graphene oxides (AGOs) were synthesized at room temperature (RT). • AGO films have low sheet resistance at RT as compared to graphene oxide (GO). • Fast decrease in the sheet resistance of GO with annealing as compared to AGOs • AGOs were found to be highly dispersible in polar solvents.

  10. Large Deviations for the Annealed Ising Model on Inhomogeneous Random Graphs: Spins and Degrees

    Science.gov (United States)

    Dommers, Sander; Giardinà, Cristian; Giberti, Claudio; Hofstad, Remco van der

    2018-04-01

    We prove a large deviations principle for the total spin and the number of edges under the annealed Ising measure on generalized random graphs. We also give detailed results on how the annealing over the Ising model changes the degrees of the vertices in the graph and show how it gives rise to interesting correlated random graphs.

  11. Study of annealing effects in Al–Sb bilayer thin films

    Indian Academy of Sciences (India)

    Keywords. AlSb; thin film; RBS; optical band gap. Abstract. In this paper, we present preparation and characterization of Al–Sb bilayer thin films. Thin films of thicknesses, 3000/1000 Å and 3000/1500 Å, were obtained by the thermal evaporation (resistive heating) method. Vacuum annealing and rapid thermal annealing ...

  12. Effect of annealing on phase transition in poly(vinylidene fluoride)

    Indian Academy of Sciences (India)

    Here we report the crystallization of both and -phase PVDF films by varying preparation temperature using DMSO solvent. The -phase PVDF films were annealed at 70, 90, 110, 130 and 160°C for five hours. The changes in the phase contents in the PVDF at different annealing conditions have been described.

  13. Evolution of Residual Stress and Distortion of Cold-Rolled Bearing Ring from Annealing to Quenched-Tempered Heat Treatment

    Science.gov (United States)

    Lu, Bohan; Lu, Xiaohui

    2018-02-01

    This study investigates the correlation between the residual stress and distortion behavior of a cold-rolled ring from the annealing to quenching-tempering (QT) process. Due to the cold-rolled process, the external periphery of the bearing ring experiences a compressive residual stress. To relieve the residual stress, cold-rolled rings are annealed at 700 °C which is higher than the starting temperature of recrystallization. When cold-rolled rings are annealed at 700 °C for 15 min, the compressive residual stress is reduced to zero and the outer diameter of the annealed ring becomes larger than that of a non-annealed sample, which is unrelated to annealing time. Simultaneously, the roundness and taper deviation do not obviously change compared with those of non-annealed sample. The stress relaxation during the annealing process was attributed to the recovery and recrystallization of ferrite. Annealing has a genetic influence on the following QT heat treatment, wherein the lowest residual stress is in the non-annealed cold-rolled ring. From the annealing to QT process, the deviation of the outer diameter, roundness, and taper increased with annealing time, a large extend than that of non-annealed samples.

  14. Annealing of deep boron centers in silicon carbide

    CERN Document Server

    Ballandovich, V S

    2002-01-01

    Effect of thermal annealing on the high temperature luminescence efficiency (HTL) in 6H-SiC samples grown in different conditions and doped with boron impurity was investigated. Some of the crystals were irradiated by reactor neutrons or fast electrons. The HTL efficiency was shown to depend on the abundance of deep boron centers discovered by capacitive spectroscopy as D-centers. High temperature treatment of samples results in decomposition of D-centers which is identified as B sub S sub i -V sub C complexes. The deep boron centers are shown to be stable at temperature as low as 1500 deg C. Conservation of these centers in SiC crystals at higher temperatures (up to 2600 deg C) is caused by presence of clusters which are the sources of nonequilibrium carbon vacancies

  15. Hardness evolution on annealing in AISI 304 stainless steel

    International Nuclear Information System (INIS)

    Lopez, A.; Alvarez de Sotomayor, A.; Herrera, E. J.

    2001-01-01

    The evolution of the microstructure and hardness of commercial AISI 304 stainless-steel samples with the heat treatment has been studied. Steel specimens in the as-received condition, and after 50% cold rolling, were soaked for 1 hour at various temperatures between 650 and 1200 degree centigree Samples maintain their grain size and hardness until about 900 degree centigree, thereafter, size increases with temperature, while hardness lightly diminishes. Recrystallization of cold-rolled specimens begins at 650 degree centigree, and finishes around 850 degree centigree. Recrystallized grain-size reaches the value found in the as received materials after the treatment at 900 degree centigree. For high her annealing temperatures both grain growth and hardness decrease following the same trend in cold-worked and non-deformed materials. (Author) 10 refs

  16. Geometric Optimization of Thermo-electric Coolers Using Simulated Annealing

    Science.gov (United States)

    Khanh, D. V. K.; Vasant, P. M.; Elamvazuthi, I.; Dieu, V. N.

    2015-09-01

    The field of thermo-electric coolers (TECs) has grown drastically in recent years. In an extreme environment as thermal energy and gas drilling operations, TEC is an effective cooling mechanism for instrument. However, limitations such as the relatively low energy conversion efficiency and ability to dissipate only a limited amount of heat flux may seriously damage the lifetime and performance of the instrument. Until now, many researches were conducted to expand the efficiency of TECs. The material parameters are the most significant, but they are restricted by currently available materials and module fabricating technologies. Therefore, the main objective of finding the optimal TECs design is to define a set of design parameters. In this paper, a new method of optimizing the dimension of TECs using simulated annealing (SA), to maximize the rate of refrigeration (ROR) was proposed. Equality constraint and inequality constraint were taken into consideration. This work reveals that SA shows better performance than Cheng's work.

  17. Implantation and annealing effects in molecular organic films

    CERN Document Server

    Pakhomov, G L; Shashkin, V I; Tura, J M; Ribo, J M; Ottaviano, L

    2002-01-01

    Ion implantation and annealing effects on the surface of phthalocyanine thin films have been studied by means of atomic force microscopy and electron spectroscopy for chemical analysis. Both the topology and the chemical composition of the surface are affected by irradiation. The influence of the irradiation dose is shown. The chemical degradation of the layer results mainly in the decrease of atomic concentration of nitrogen and chlorine, and in the increase of atomic concentration of oxygen. At highest dose, carbonization becomes important. Furthermore, N 1s, C 1s and Cl 2p core levels testify that the formation of new chemical species occurs in implanted pthalocyanine films. All these processes are modified by subsequent heat treatment in different ways, depending on the applied implantation fluence.

  18. Structural relaxation dynamics and annealing effects of sodium silicate glass.

    Science.gov (United States)

    Naji, Mohamed; Piazza, Francesco; Guimbretière, Guillaume; Canizarès, Aurélien; Vaills, Yann

    2013-05-09

    Here we report high-precision measurements of structural relaxation dynamics in the glass transition range at the intermediate and short length scale for a strong sodium silicate glass during long annealing times. We evidence for the first time the heterogeneous dynamics at the intermediate range order by probing the acoustic longitudinal frequency in the GHz region by Brillouin light scattering spectroscopy. Or, from in-situ Raman measurements, we show that relaxation is indeed homogeneous at the interatomic length scale. Our results show that the dynamics at the intermediate range order contains two distinct relaxation time scales, a fast and a slow component, differing by about a 10-fold factor below Tg and approaching to one another past the glass transition. The slow relaxation time agrees with the shear relaxation time, proving that Si-O bond breaking constitutes the primary control of structural relaxation at the intermediate range order.

  19. Lasing of Some Red Laser Dyes in Annealed Silica Xerogel

    Science.gov (United States)

    Bezkrovnaya, O. N.; Maslov, V. V.; Pritula, I. M.; Yurkevich, A. G.

    2018-01-01

    The spectral and energy characteristics of generation in the red spectral region 650-720 nm were measured and analyzed for three laser dyes in preliminarily annealed SiO2 xerogel matrices under laser excitation λp = 588 nm in a nonselective cavity. The specific laser-energy output for two of them (LK678 and Ox170) in the matrices was 10-13% higher than in MeOH. NBA dye in the matrix generated two laser radiation bands in the 700-720 nm region with pumping E p ≥ 80 mJ whereas its generation threshold in MeOH exceeded the maximum pumping energy of 140 mJ so that NBA generation was not observed. Laser emission spectra of the studied matrices in a nonselective cavity were red-shifted by 1000 cm-1 from the fluorescence maximum. Such a shift could improve the characteristics of biosensors based on these matrices.

  20. Positron annihilation studies on reactor irradiated and thermal annealed ferrocene

    International Nuclear Information System (INIS)

    Marques Netto, A.; Carvalho, R.S.; Magalhaes, W.F.; Sinisterra, R.D.

    1996-01-01

    Retention and thermal annealing following (n, γ) reaction in solid ferrocene, Fe(C 5 H 5 ) 2 , were studied by positron annihilation lifetime spectroscopy (PAL). Positronium (Ps) formation was observed in the non-irradiated compound with a probability or intensity (I 3 ) of 30%. Upon irradiation of the compound with thermal neutrons in a nuclear reactor, I 3 decreases with increasing irradiation time. Thermal treatment again increases I 3 values from 16% to 25%, revealing an important proportion of molecular reformation without variation of the ortho-positronium lifetime (τ 3 ). These results point out the major influence of the electronic structure as determining the Ps yields in the pure complex. In the irradiated and non irradiated complexes the results are satisfactorily explained on the basis of the spur model. (orig.)

  1. Experimental study of swelling of irradiated solid methane during annealing

    International Nuclear Information System (INIS)

    Shabalin, E.; Fedorov, A.; Kulagin, E.; Kulikov, S.; Melikhov, V.; Shabalin, D.

    2008-01-01

    Solid methane is still widely in use at pulsed neutron sources due to its excellent neutronic performance (IPNS, KENS, Second Target Station at ISIS), notwithstanding poor radiation properties. One of the specific problems is radiolytic hydrogen gas pressure on the walls of a methane chamber during annealing of methane. In this paper results of an experimental study of this phenomenon under fast neutron irradiation with the help of a specially made low temperature irradiation rig at the IBR-2 pulsed reactor are presented. The peak pressure on the wall of the experimental capsule during heating of a sample irradiated at 23-35 K appears to have a maximum of 2.7 MPa at an absorbed dose 20 MGy and then falls down with higher doses. The pressure always reached its peak value at the temperature range 72-79 K. Generally, three phases of methane swelling during heating can be distinguished, each characterized by a proper rate and intensity.

  2. Annealing in sulfur of CZTS nanoparticles deposited through doctor blading

    DEFF Research Database (Denmark)

    Engberg, Sara Lena Josefin; Crovetto, Andrea

    Solar cells made from nanoparticles of copper zinc tin sulfide (CZTS) from solution-processing are expected to be comparatively inexpensive, but their efficiency is still low compared with cells produced by vacuum processing. However, (1) the high carbon content in nanoparticle thin films is one...... microscopy (AFM) and scanning electron microscopy (SEM) images. Raman spectroscopy is used to examine the sulfur distribution between the surface and the bottom of the film. Compositional changes are monitored by energy dispersive X-ray spectroscopy (EDX) and the crystallinity by X-ray diffraction (XRD......). A photovoltaic device of the structure soda lime glass (SLG)/Mo/CZTSSe/CdS/ZnO:Al/Ag has been built, and our preliminary results show a power conversion efficiency of 1.41% for the nanoparticles annealed in selenium. This work has been supported by a grant from the Danish Council for Strategic Research...

  3. Optimization of multiple-layer microperforated panels by simulated annealing

    DEFF Research Database (Denmark)

    Ruiz Villamil, Heidi; Cobo, Pedro; Jacobsen, Finn

    2011-01-01

    Sound absorption by microperforated panels (MPP) has received increasing attention the past years as an alternative to conventional porous absorbers in applications with special cleanliness and health requirements. The absorption curve of an MPP depends on four parameters: the holes diameter...... applications. However, when a wider absorption frequency band is required, it is necessary to design multiple-layer MPP (ML-MPP). The design of an N-layers MPP depends on 4N parameters. Consequently, the tuning of an optimal ML-MPP by exhaustive search within a prescribed frequency band becomes impractical....... Therefore, simulated annealing is proposed in this paper as a tool to solve the optimization problem of finding the best combination of the constitutive parameters of an ML-MPP providing the maximum average absorption within a prescribed frequency band....

  4. Thermal annealing of natural, radiation-damaged pyrochlore

    Energy Technology Data Exchange (ETDEWEB)

    Zietlow, Peter; Mihailova, Boriana [Hamburg Univ. (Germany). Dept. of Earth Sciences; Beirau, Tobias [Hamburg Univ. (Germany). Dept. of Earth Sciences; Stanford Univ., CA (United States). Dept. of Geological Sciences; and others

    2017-03-01

    Radiation damage in minerals is caused by the α-decay of incorporated radionuclides, such as U and Th and their decay products. The effect of thermal annealing (400-1000 K) on radiation-damaged pyrochlores has been investigated by Raman scattering, X-ray powder diffraction (XRD), and combined differential scanning calorimetry/thermogravimetry (DSC/TG). The analysis of three natural radiation-damaged pyrochlore samples from Miass/Russia [6.4 wt% Th, 23.1.10{sup 18} α-decay events per gram (dpg)], Panda Hill/Tanzania (1.6 wt% Th, 1.6.10{sup 18} dpg), and Blue River/Canada (10.5 wt% U, 115.4.10{sup 18} dpg), are compared with a crystalline reference pyrochlore from Schelingen (Germany). The type of structural recovery depends on the initial degree of radiation damage (Panda Hill 28%, Blue River 85% and Miass 100% according to XRD), as the recrystallization temperature increases with increasing degree of amorphization. Raman spectra indicate reordering on the local scale during annealing-induced recrystallization. As Raman modes around 800 cm{sup -1} are sensitive to radiation damage (M. T. Vandenborre, E. Husson, Comparison of the force field in various pyrochlore families. I. The A{sub 2}B{sub 2}O{sub 7} oxides. J. Solid State Chem. 1983, 50, 362, S. Moll, G. Sattonnay, L. Thome, J. Jagielski, C. Decorse, P. Simon, I. Monnet, W. J. Weber, Irradiation damage in Gd{sub 2}Ti{sub 2}O{sub 7} single crystals: Ballistic versus ionization processes. Phys. Rev. 2011, 84, 64115.), the degree of local order was deduced from the ratio of the integrated intensities of the sum of the Raman bands between 605 and 680 cm{sup -1} divided by the sum of the integrated intensities of the bands between 810 and 860 cm{sup -1}. The most radiation damaged pyrochlore (Miass) shows an abrupt recovery of both, its short- (Raman) and long-range order (X-ray) between 800 and 850 K, while the weakly damaged pyrochlore (Panda Hill) begins to recover at considerably lower temperatures (near 500 K

  5. A simulated annealing approach for redesigning a warehouse network problem

    Science.gov (United States)

    Khairuddin, Rozieana; Marlizawati Zainuddin, Zaitul; Jiun, Gan Jia

    2017-09-01

    Now a day, several companies consider downsizing their distribution networks in ways that involve consolidation or phase-out of some of their current warehousing facilities due to the increasing competition, mounting cost pressure and taking advantage on the economies of scale. Consequently, the changes on economic situation after a certain period of time require an adjustment on the network model in order to get the optimal cost under the current economic conditions. This paper aimed to develop a mixed-integer linear programming model for a two-echelon warehouse network redesign problem with capacitated plant and uncapacitated warehouses. The main contribution of this study is considering capacity constraint for existing warehouses. A Simulated Annealing algorithm is proposed to tackle with the proposed model. The numerical solution showed the model and method of solution proposed was practical.

  6. Large-area field emission diode for semiconductor annealing

    Science.gov (United States)

    Luches, A.; Nassisi, V.; Perrone, A.; Perrone, M. R.

    1981-03-01

    We report the characteristics of a low energy electron beam generator used for annealing of materials of interest as electron devices and photovoltaic cells. The high voltage pulser is a two-stage Marx circuit which supplies 10-50 kV pulses. A Blumlein line gives the pulses an almost square shape and a length of 50 ns. This short pulse is applied to a field emission diode. Various kinds of cathodes are used. They deliver electron pulses of up to 20 kA. Tungsten needles are used for small-area beams and blade arrays or graphite cathodes for large-area beams. Consequently, the beam diameter can vary from 2 to 120 mm with a good beam homogeneity. The anode is movable to vary the vacuum diode impedance and consequently the current-voltage characteristic of the electron beam. Energy densities varying from 0.1 to 100 J/cm 2 are obtained on the anode. The anode can be formed by a semiconductor monocrystalline wafer. We used crystalline silicon wafers covered by a thin (≈100 nm) layer of vacuum deposited near-noble and refractory metals. Under electron beam bombardment with discharge energy densities ranging from 0.4 to 10 J/cm 2, silicide formation is evident over all the annealed anodes. Metastable compounds are formed because of the fast heating and cooling rates. Silicon monocrystalline wafers, doped with 10 14-10 15 ions/cm 2 of B or P ions exhibit a complete recovery of their crystalline structure after a single discharge.

  7. Primary resistance to integrase strand-transfer inhibitors in Europe

    DEFF Research Database (Denmark)

    Casadellà, M; van Ham, P M; Noguera-Julian, M

    2015-01-01

    OBJECTIVES: The objective of this study was to define the natural genotypic variation of the HIV-1 integrase gene across Europe for epidemiological surveillance of integrase strand-transfer inhibitor (InSTI) resistance. METHODS: This was a multicentre, cross-sectional study within the European...... SPREAD HIV resistance surveillance programme. A representative set of 300 samples was selected from 1950 naive HIV-positive subjects newly diagnosed in 2006-07. The prevalence of InSTI resistance was evaluated using quality-controlled baseline population sequencing of integrase. Signature raltegravir......, elvitegravir and dolutegravir resistance mutations were defined according to the IAS-USA 2014 list. In addition, all integrase substitutions relative to HXB2 were identified, including those with a Stanford HIVdb score ≥10 to at least one InSTI. To rule out circulation of minority InSTI-resistant HIV, 65...

  8. Phosphorylation: The Molecular Switch of Double-Strand Break Repair

    Directory of Open Access Journals (Sweden)

    K. C. Summers

    2011-01-01

    Full Text Available Repair of double-stranded breaks (DSBs is vital to maintaining genomic stability. In mammalian cells, DSBs are resolved in one of the following complex repair pathways: nonhomologous end-joining (NHEJ, homologous recombination (HR, or the inclusive DNA damage response (DDR. These repair pathways rely on factors that utilize reversible phosphorylation of proteins as molecular switches to regulate DNA repair. Many of these molecular switches overlap and play key roles in multiple pathways. For example, the NHEJ pathway and the DDR both utilize DNA-PK phosphorylation, whereas the HR pathway mediates repair with phosphorylation of RPA2, BRCA1, and BRCA2. Also, the DDR pathway utilizes the kinases ATM and ATR, as well as the phosphorylation of H2AX and MDC1. Together, these molecular switches regulate repair of DSBs by aiding in DSB recognition, pathway initiation, recruitment of repair factors, and the maintenance of repair mechanisms.

  9. DNA double-strand break repair in Caenorhabditis elegans.

    Science.gov (United States)

    Lemmens, Bennie B L G; Tijsterman, Marcel

    2011-02-01

    Faithful repair of DNA double-strand breaks (DSBs) is vital for animal development, as inappropriate repair can cause gross chromosomal alterations that result in cellular dysfunction, ultimately leading to cancer, or cell death. Correct processing of DSBs is not only essential for maintaining genomic integrity, but is also required in developmental programs, such as gametogenesis, in which DSBs are deliberately generated. Accordingly, DSB repair deficiencies are associated with various developmental disorders including cancer predisposition and infertility. To avoid this threat, cells are equipped with an elaborate and evolutionarily well-conserved network of DSB repair pathways. In recent years, Caenorhabditis elegans has become a successful model system in which to study DSB repair, leading to important insights in this process during animal development. This review will discuss the major contributions and recent progress in the C. elegans field to elucidate the complex networks involved in DSB repair, the impact of which extends well beyond the nematode phylum.

  10. RNA-directed repair of DNA double-strand breaks.

    Science.gov (United States)

    Yang, Yun-Gui; Qi, Yijun

    2015-08-01

    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Assembly of large icosahedral double-stranded RNA viruses.

    Science.gov (United States)

    Poranen, Minna M; Bamford, Dennis H

    2012-01-01

    Double-stranded RNA (dsRNA) viruses are a diverse group of viruses infecting hosts from bacteria to higher eukaryotes. Among the hosts are humans, domestic animals, and economically important plant species. Fine details of high-resolution virion structures have revealed common structural characteristics unique to these viruses including an internal icosahedral capsid built from 60 asymmetric dimers (120 monomers!) of the major coat protein. Here we focus mainly on the structures and assembly principles of large icosahedral dsRNA viruses belonging to the families of Cystoviridae and Reoviridae. It is obvious that there are a variety of assembly pathways utilized by different viruses starting from similar building blocks and reaching in all cases a similar capsid architecture. This is true even with closely related viruses indicating that the assembly pathway per se is not an indicator of relatedness and is achieved with minor changes in the interacting components.

  12. Manipulation of magnetic properties of glass-coated microwires by annealing

    Energy Technology Data Exchange (ETDEWEB)

    Zhukov, A., E-mail: arkadi.joukov@ehu.es [Dpto. Fisica de Materiales, Fac. Quimicas, UPV/EHU, 20009 San Sebastian (Spain); IKERBASQUE, Basque Foundation for Science, 48011 Bilbao (Spain); Chichay, K. [Immanuel Kant Baltic Federal University, 236041 Kaliningrad (Russian Federation); Talaat, A. [Dpto. Fisica de Materiales, Fac. Quimicas, UPV/EHU, 20009 San Sebastian (Spain); Rodionova, V. [Immanuel Kant Baltic Federal University, 236041 Kaliningrad (Russian Federation); National University of Science and Technology (MISIS), 119049 Moscow (Russian Federation); Blanco, J.M. [Dpto. Física Aplicada, EUPDS Basque Country University UPV/EHU (Spain); Ipatov, M.; Zhukova, V. [Dpto. Fisica de Materiales, Fac. Quimicas, UPV/EHU, 20009 San Sebastian (Spain)

    2015-06-01

    We demonstrated that magnetic properties (hysteresis loops, domain wall propagation and giant magnetoimpedance effect) of Fe and Co-rich amorphous microwires can be tailored by stress and conventional annealing. Observed dependences discussed considering stress relaxation, back stresses and change of the magnetostriction after samples annealing. These considerations have been proved by experimental observation of the change of the magnetostriction coefficient sign induced by annealing. - Highlights: • Manipulation of hysteresis loop of amorphous Co–Fe- rich microwires by annealing. • Coexistence of Giant magnetoimpedance effect and fast domain wall propagation in the same sample. • Evidence of annealing dependence of the magnetostriction coefficient. • Effect of stress induced anisotropy on magnetic properties and GMI effect.

  13. High-temperature laser annealing for thin film polycrystalline silicon solar cell on glass substrate

    Science.gov (United States)

    Chowdhury, A.; Schneider, J.; Dore, J.; Mermet, F.; Slaoui, A.

    2012-06-01

    Thin film polycrystalline silicon films grown on glass substrate were irradiated with an infrared continuous wave laser for defects annealing and/or dopants activation. The samples were uniformly scanned using an attachment with the laser system. Substrate temperature, scan speed and laser power were varied to find suitable laser annealing conditions. The Raman spectroscopy and Suns- V oc analysis were carried out to qualify the films quality after laser annealing. A maximum enhancement of the open circuit voltage V oc of about 100 mV is obtained after laser annealing of as-grown polysilicon structures. A strong correlation was found between the full width half maximum of the Si crystalline peak and V oc. It is interpreted as due to defects annealing as well as to dopants activation in the absorbing silicon layer. The maximum V oc reached is 485 mV after laser treatment and plasma hydrogenation, thanks to defects passivation.

  14. Effect of thermal annealing on the surface properties of electrospun polymer fibers.

    Science.gov (United States)

    Chen, Jiun-Tai; Chen, Wan-Ling; Fan, Ping-Wen; Yao, I-Chun

    2014-02-01

    Electrospun polymer fibers are gaining importance because of their unique properties and applications in areas such as drug delivery, catalysis, or tissue engineering. Most studies to control the morphology and properties of electrospun polymer fibers focus on changing the electrospinning conditions. The effects of post-treatment processes on the morphology and properties of electrospun polymer fibers, however, are little studied. Here, the effect of thermal annealing on the surface properties of electrospun polymer fibers is investigated. Poly(methyl methacrylate) and polystyrene fibers are fist prepared by electrospinning, followed by thermal annealing processes. Upon thermal annealing, the surface roughness of the electrospun polymer fibers decreases. The driving force of the smoothing process is the minimization of the interfacial energy between polymer fibers and air. The water contact angles of the annealed polymer fibers also decrease with the annealing time. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Novel thermal annealing methodology for permanent tuning polymer optical fiber Bragg gratings to longer wavelengths.

    Science.gov (United States)

    Pospori, A; Marques, C A F; Sagias, G; Lamela-Rivera, H; Webb, D J

    2018-01-22

    The Bragg wavelength of a polymer optical fiber Bragg grating can be permanently shifted by utilizing the thermal annealing method. In all the reported fiber annealing cases, the authors were able to tune the Bragg wavelength only to shorter wavelengths, since the polymer fiber shrinks in length during the annealing process. This article demonstrates a novel thermal annealing methodology for permanently tuning polymer optical fiber Bragg gratings to any desirable spectral position, including longer wavelengths. Stretching the polymer optical fiber during the annealing process, the period of Bragg grating, which is directly related with the Bragg wavelength, can become permanently longer. The methodology presented in this article can be used to multiplex polymer optical fiber Bragg gratings at any desirable spectral position utilizing only one phase-mask for their photo-inscription, reducing thus their fabrication cost in an industrial setting.

  16. The post-annealing environment effect on the photoluminescence recovery of ion-irradiated Si nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Sias, U.S. [Instituto de Fisica - Universidade Federal do Rio Grande do Sul (UFRGS), C.P. 15051, 91501-970 Porto Alegre, RS (Brazil) and Centro Federal de Educacao Tecnologica de Pelotas (CEFET-RS), 96015-370 Pelotas, RS (Brazil)]. E-mail: uilson@cefetrs.tche.br; Behar, M. [Instituto de Fisica - Universidade Federal do Rio Grande do Sul (UFRGS), C.P. 15051, 91501-970 Porto Alegre, RS (Brazil); Boudinov, H. [Instituto de Fisica - Universidade Federal do Rio Grande do Sul (UFRGS), C.P. 15051, 91501-970 Porto Alegre, RS (Brazil); Moreira, E.C. [UFPel - UNIPAMPA, Campus Bage, 96400-970 Bage, RS (Brazil)

    2007-04-15

    In the present work we have investigated the influence of the post-annealing environment on the photoluminescence (PL) recovery of Si nanocrystals after ion irradiation. Samples originally produced by Si implantation into SiO{sub 2} matrix at 600 deg. C post-annealed at 1100 deg. C were further bombarded with 2 MeV Si{sup +}, at a fluence of {phi} = 2 x 10{sup 13} Si/cm{sup 2}. After irradiation the original emission, composed by two PL bands, was completely quenched. We shown that the environment of a post-annealing performed at 900 deg. C has a strong effect on the PL emission recovery. The intensity and shape of the PL spectra have revealed to be dependent of the annealing gas (N{sub 2} or Ar), annealing time, as well as the original Si excess. The results are explained on the basis of current theories.

  17. Quantum annealing versus classical machine learning applied to a simplified computational biology problem

    Science.gov (United States)

    Li, Richard Y.; Di Felice, Rosa; Rohs, Remo; Lidar, Daniel A.

    2018-01-01

    Transcription factors regulate gene expression, but how these proteins recognize and specifically bind to their DNA targets is still debated. Machine learning models are effective means to reveal interaction mechanisms. Here we studied the ability of a quantum machine learning approach to predict binding specificity. Using simplified datasets of a small number of DNA sequences derived from actual binding affinity experiments, we trained a commercially available quantum annealer to classify and rank transcription factor binding. The results were compared to state-of-the-art classical approaches for the same simplified datasets, including simulated annealing, simulated quantum annealing, multiple linear regression, LASSO, and extreme gradient boosting. Despite technological limitations, we find a slight advantage in classification performance and nearly equal ranking performance using the quantum annealer for these fairly small training data sets. Thus, we propose that quantum annealing might be an effective method to implement machine learning for certain computational biology problems. PMID:29652405

  18. Manipulation of magnetic properties of glass-coated microwires by annealing

    International Nuclear Information System (INIS)

    Zhukov, A.; Chichay, K.; Talaat, A.; Rodionova, V.; Blanco, J.M.; Ipatov, M.; Zhukova, V.

    2015-01-01

    We demonstrated that magnetic properties (hysteresis loops, domain wall propagation and giant magnetoimpedance effect) of Fe and Co-rich amorphous microwires can be tailored by stress and conventional annealing. Observed dependences discussed considering stress relaxation, back stresses and change of the magnetostriction after samples annealing. These considerations have been proved by experimental observation of the change of the magnetostriction coefficient sign induced by annealing. - Highlights: • Manipulation of hysteresis loop of amorphous Co–Fe- rich microwires by annealing. • Coexistence of Giant magnetoimpedance effect and fast domain wall propagation in the same sample. • Evidence of annealing dependence of the magnetostriction coefficient. • Effect of stress induced anisotropy on magnetic properties and GMI effect

  19. Effect of Intermediate Annealing on Microstructure and Property of 5182 Aluminum Alloy Sheet for Automobile

    Directory of Open Access Journals (Sweden)

    WANG Yu

    2016-09-01

    Full Text Available Effect of intermediate annealing on the microstructure and properties of 5182 aluminum alloy sheet with full annealed state (5182-O was investigated by means of optical microscope, scanning electron microscope and universal testing machine. The results indicate that compared with 5182-O sheet without intermediate annealing, 5182-O sheet with intermediate annealing possesses too fine grain size, intermetallic compounds not broken enough, larger size intermetallic particles, less dispersed phase. Yield strength and ultimate tensile strength, work hardening exponent and normal anisotropy of plastic strain ratio decrease but planner anisotropy of plastic strain ratio increases. The mechanical properties and forming ability of 5182-O aluminum alloy sheet and its microstructure are not improved significantly after intermediate annealing.

  20. Sensitivity enhancement using annealed polymer optical fibre based sensors for pressure sensing applications

    DEFF Research Database (Denmark)

    Pospori, A.; Marques, C. A. F.; Saez-Rodriguez, D.

    2016-01-01

    Thermal annealing can be used to induce a permanent negative Bragg wavelength shift for polymer fibre grating sensors and it was originally used for multiplexing purposes. Recently, researchers showed that annealing can also provide additional benefits, such as strain and humidity sensitivity...... enhancement and augmented temperature operational range. The annealing process can change both the optical and mechanical properties of the fibre. In this paper, the annealing effects on the stress and force sensitivities of PMMA fibre Bragg grating sensors are investigated. The incentive...... for that investigation was an unexpected behaviour observed in an array of sensors which were used for liquid level monitoring. One sensor exhibited much lower pressure sensitivity and that was the only one that was not annealed. To further investigate the phenomenon, additional sensors were photo...

  1. An automated ion implant/pulse anneal machine for low cost silicon cell production

    International Nuclear Information System (INIS)

    Armini, A.J.; Bunker, S.N.; Spitzer, M.B.

    1982-01-01

    The continuing development of a high throughput ion implanter and a pulsed electron beam annealer designed for dedicated silicon solar cell manufacture is reviewed. This equipment is intended for production of junctions in 10 cm wide wafers at a throughput up to 10 MWsub(p) per year. The principal features of the implanter are the lack of mass analysis and defocusing utilizing electrostatic deflection. The implanted surface is annealed by liquid phase epitaxy resulting from a single burst of a large area electron beam. Cells with non-mass analyzed ion implantation have yielded AM1 cell efficiencies in excess of 15%. Pulse annealed Czochralski cells have been made with AM1 efficiencies of 13% vs. 15% for a furnace annealed group. Results of pulse annealing of polycrystalline materials indicate that cell performance comparable to diffusion can be obtained. (Auth.)

  2. Effect of annealing time on morphological characteristics of Ba(Zr,Ti)O3 thin films

    International Nuclear Information System (INIS)

    Cavalcante, L.S.; Anicete-Santos, M.; Pontes, F.M.; Souza, I.A.; Santos, L.P.S.; Rosa, I.L.V.; Santos, M.R.M.C.; Santos-Junior, L.S.; Leite, E.R.; Longo, E.

    2007-01-01

    Ba(Zr 0.50 Ti 0.50 )O 3 thin films were prepared by the polymeric precursor method using the annealing low temperature of 300 o C for 8, 16, 24, 48, 96 and 192h in a furnace tube with oxygen atmosphere. The X-ray diffraction patterns revealed that the film annealed for 192 h presented some crystallographic planes (1bar 0bar 0) (1bar 1bar 0) and (2bar 0bar 0) in its crystalline lattice. Fourier transformed infrared presented the formation of metal-oxygen stretching at around 756cm -1 . The atomic force microscopy analysis presented the growth of granules in the Ba(Zr 0.50 Ti 0.50 )O 3 films annealed from 8 to 96h. The crystalline film annealed for 192h already presents grains in its perovskite structure. It evidenced a reduction in the thickness of the thin films with the increase of the annealing time

  3. Annealing bounds to prevent further Charge Transfer Inefficiency increase of the Chandra X-ray CCDs

    Energy Technology Data Exchange (ETDEWEB)

    Monmeyran, Corentin, E-mail: comonmey@mit.edu [Department of Materials Science and Engineering, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Patel, Neil S., E-mail: neilp@mit.edu [Department of Materials Science and Engineering, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Bautz, Mark W., E-mail: mwb@space.mit.edu [Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Grant, Catherine E., E-mail: cgrant@space.mit.edu [Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Prigozhin, Gregory Y., E-mail: gyp@space.mit.edu [Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Agarwal, Anuradha, E-mail: anu@mit.edu [Microphotonics Center, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Kimerling, Lionel C., E-mail: lckim@mit.edu [Department of Materials Science and Engineering, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States); Microphotonics Center, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139 (United States)

    2016-12-15

    After the front-illuminated CCDs on board the X-ray telescope Chandra were damaged by radiation after launch, it was decided to anneal them in an effort to remove the defects introduced by the irradiation. The annealing led to an unexpected increase of the Charge Transfer Inefficiency (CTI). The performance degradation is attributed to point defect interactions in the devices. Specifically, the annealing at 30 °C activated the diffusion of the main interstitial defect in the device, the carbon interstitial, which led to its association with a substitutional impurity, ultimately resulting in a stable and electrically active defect state. Because the formation reaction of this carbon interstitial and substitutional impurity associate is diffusion limited, we recommend a higher upper bound for the annealing temperature and duration of any future CCD anneals, that of −50 °C for one day or −60 °C for a week, to prevent further CTI increase.

  4. Effect of Different Post Deposition Annealing Treatments on Properties of Zinc Oxide Thin Films

    Directory of Open Access Journals (Sweden)

    Arti Arora

    2010-06-01

    Full Text Available Two different post deposition annealing atmospheres of oxygen and forming gas have been investigated for the improvement of rf sputtered zinc oxide thin films. The results show that type of atmosphere (oxidant o reduction plays an important role in the changes observed in structural, electrical and optical properties. It has been found that the structural properties of rf sputtered zinc oxide films improve in all the annealing environments. The intensity and grain size increases as the annealing temperature increases. It has been found that films become stress free at lowest temperature in oxygen as compare to forming gas annealing. The zinc oxide films annealed in oxygen shows sufficient resistivity associated to high transmittance (83 % characteristics required for MEMS based acoustic devices.

  5. Propagating self-sustained annealing of radiation-induced interstitial complexes

    International Nuclear Information System (INIS)

    Bokov, P M; Selyshchev, P A

    2016-01-01

    A propagating self-sustained annealing of radiation induced defects as a result of thermal-concentration instability is studied. The defects that are considered in the model are complexes. Each of them consists of one atom of impunity and of one interstitial atom. Crystal with defects has extra energy which is transformed into heat during defect annealing. Simulation of the auto-wave of annealing has been performed. The front and the speed of the auto-wave have been obtained. It is shown that annealing occurs in a narrow region of time and space. There are two kinds of such annealing behaviour. In the first case the speed of the auto-wave oscillates near its constant mean value and the front of temperature oscillates in a complex way. In the second case the speed of propagation is constant and fronts of temperature and concentration look like sigmoid functions. (paper)

  6. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  7. Elastic properties of alternative versus single-stranded leveling archwires.

    Science.gov (United States)

    Rucker, Brian K; Kusy, Robert P

    2002-11-01

    The strength, stiffness, and range of single-stranded stainless steel (SS) and superelastic nickel-titanium (NiTi) archwires were compared with those of alternative leveling products, including nylon-coated and multistranded wires. Wire cross-sections were photographed after being potted in polymer, ground, and polished. Because the rectangular wires had rounded or beveled corners, gravimetric measurements and specific gravity calculations quantified the actual polygonal cross-sectional areas versus the ideal rectangular cross-sectional areas. Beveling reduced the cross-sectional areas by 7% to 8%; this decreased the wire stiffnesses by 15% to 19%. Using a testing machine, we measured the yield strengths, the elastic limits, and the ultimate tensile strengths in tension, and wire stiffnesses in 3-point bending. From cyclic loading tests, the elastic limits of the superelastic NiTi wires were approximately 90% and 45% of their ultimate tensile strengths for the round and rectangular wires, respectively. Using the measurements of the mechanical properties and geometric parameters of each wire, we computed the elastic property ratios (EPRs) versus a 16-mil (0.41 mm) NiTi wire. The single-stranded NiTi wires outperformed the alternative wires, whose EPRs varied from 0.05 to 0.32 for strength, from 0.11 to 1.55 for stiffness, and from 0.10 to 0.80 for range. Based on the current study and a review of the orthodontic literature, few superelastic wires are activated sufficiently in vivo to exhibit superelastic behavior. Therefore, the EPR data reported here for superelastic wires truly represent their performance in most clinical situations.

  8. Sulforaphane induces DNA single strand breaks in cultured human cells

    International Nuclear Information System (INIS)

    Sestili, Piero; Paolillo, Marco; Lenzi, Monia; Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara; Fimognari, Carmela

    2010-01-01

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 μM SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value of

  9. In vivo quantification of DNA double strand breaks

    International Nuclear Information System (INIS)

    Simonsson, M.; Qvarnstroem, F.; Turesson, I.; Johansson, K.-A.; Nyman, J.; Hermansson, I.; Oden, A.; Book, M.

    2003-01-01

    DNA double strand breaks (DSBs) can be introduced in the genome by exposure to exogenous agents such as ionising radiation and radio-mimetic chemicals. The biological importance of these breaks is significant even at low numbers. Inaccurate repair or lack of repair of a single DSB has the potential to kill a cell or lead to tumourigenesis. Thus the induction and repair of DSBs are crucial events in the onset of malignancies. Following the induction of DSBs, the core histone H2AX is rapidly phosphorylated at residue serine 139. This phosphorylated form of H2AX is referred to as gH2AX. Histones wrapped in megabase regions flanking these breaks are involved in this process, which results in the formation of discrete nuclear foci. It has previously been shown that a single DSB is sufficient to produce a detectable focus. So far there has been a lack of methods capable of measuring the amount of DSBs at clinically relevant quantities. Such a method would embrace a wide field of applications. It could be applied as a biological dosimeter when studying carcinogenic effects and provide the basis for an assay predicting individual radiosensitivity. We describe a measurement procedure that detects and quantifies small amounts of DSBs in vivo. This is accomplished using immunofluorescence detection of the molecular marker gH2AX. The gH2AX foci are quantified in histological sections using basic digital image analysis methods as the main component. In a primary assessment of the procedure we analysed the in vivo dose response of prostate cancer patients in clinical practice undergoing radiotherapy. Epidermal nucleated cells in skin biopsies taken 30 minutes following the first single dose delivered show linear dose response for low doses ranging from 0 - 1.2 Gy. The described procedure for double strand break quantification can detect dose changes as low as 0.18 Gy

  10. Annealing effects on the migration of ion-implanted cadmium in glassy carbon

    Energy Technology Data Exchange (ETDEWEB)

    Hlatshwayo, T.T., E-mail: thulani.hlatshwayo@up.ac.za [Physics Department, University of Pretoria, Pretoria (South Africa); Sebitla, L.D. [Physics Department, University of Pretoria, Pretoria (South Africa); Physics Department, University of Botswana, Gaborone (Botswana); Njoroge, E.G.; Mlambo, M.; Malherbe, J.B. [Physics Department, University of Pretoria, Pretoria (South Africa)

    2017-03-15

    The migration behaviour of cadmium (Cd) implanted into glassy carbon and the effects of annealing on radiation damage introduced by ion implantation were investigated. The glassy carbon substrates were implanted with Cd at a dose of 2 × 10{sup 16} ions/cm{sup 2} and energy of 360 keV. The implantation was performed at room temperature (RT), 430 °C and 600 °C. The RT implanted samples were isochronally annealed in vacuum at 350, 500 and 600 °C for 1 h and isothermally annealed at 350 °C up to 4 h. The as-implanted and annealed samples were characterized by Raman spectroscopy and Rutherford backscattering spectrometry (RBS). Raman results revealed that implantation at room temperature amorphized the glassy carbon structure while high temperature implantations resulted in slightly less radiation damage. Isochronal annealing of the RT implanted samples resulted in some recrystallization as a function of increasing temperature. The original glassy carbon structure was not achieved at the highest annealing temperature of 600 °C. Diffusion of Cd in glassy carbon was already taking place during implantation at 430 °C. This diffusion of Cd was accompanied by significant loss from the surface during implantation at 600 °C. Isochronal annealing of the room temperature implanted samples at 350 °C for 1 h caused Cd to diffuse towards the bulk while isothermal annealing at 500 and 600 °C resulted in the migration of implanted Cd toward the surface accompanied by a loss of Cd from the surface. Isothermal annealing at 350 °C for 1 h caused Cd to diffuse towards the bulk while for annealing time >1 h Cd diffused towards the surface. These results were interpreted in terms of trapping and de-trapping of implanted Cd by radiation damage.

  11. Radiation induced strand breaks and time scale for repair of broken strands in superinfecting phage lambda DNA in Escherichia coli lysogenic for lambda

    International Nuclear Information System (INIS)

    Johansen, I.; Boye, E.; Brustad, T.

    1975-01-01

    The production of the first radiation induced break in covalent lambda DNA molecules in pol + and pol A 1 lysogenic host cells was measured after exposure to electrons from a linear accelerator and transfer to alkaline detergent within 100 ms from the onset of irradiation. The results revealed the presence of an oxygen effect in DNA strand breakage. In both pol + and pol A 1 host cells the rate of production in nitrogen was 1.2x10 -12 DNA single strand breaks per rad per dalton as compared to 5x10 -12 in oxygen. The yields of strand breaks in lambda DNA in pol + host cells under oxygenated or anoxic conditions are independent of whether the cells are irradiated in buffer at room temperature, in buffer at ice temperature, or in growth medium at 37 0 C. These results indicate that enzymic repair of DNA strand breaks before analysis is insignificant in these experiments. The presence of an oxygen effect in DNA strand breakage under these conditions suggest that an actual difference exists between initial number of breaks produced in nitrogen and in oxygen. The kinetics of rejoining of broken molecules under optimal growth conditions was measured by incubating the irradiated host cells prior to lysis. In pol + host cells 50% of the lambda DNA molecules broken in presence of oxygen are rejoined within 10 to 20 seconds of incubation. A significantly lower recovery is seen in pol + host cells after irradiation in nitrogen. The rejoining of broken lambda DNA strands in pol A 1 host cells is impaired after irradiation in presence of oxygen as well as under anoxia. These results show that DNA polymerase I is needed for the rapid rejoining of radiation induced strand breaks in the DNA, and that oxygen promoted strand breaks are more easily rejoined than are those produced in nitrogen. (author)

  12. Unusual Mortality Events of Harbor Porpoise Strandings in North Carolina, 1997–2009

    Directory of Open Access Journals (Sweden)

    Aleta A. Hohn

    2013-01-01

    Full Text Available A marked increase in the frequency of harbor porpoises (Phocoena phocoena stranded in North Carolina in 2005 was declared as an Unusual Mortality Event (UME. Strandings occurred in January through May when harbor porpoises are seasonally present. Increased stranding rates were measured relative to a threshold to determine that the UME was occurring. The threshold analysis also revealed elevated strandings during 1999, an undeclared UME year. Recovered carcasses during 1999 and 2005 accounted for 39% of 261 strandings during 1997–2009. During 2005, of 43 strandings, primary or secondary causes of mortality included fishery interactions, emaciation, and interspecific aggression. Apart from small but significant differences in timing and condition of strandings, composition of strandings during UME and non-UME years was similar, with most being young-of-the-year and occurring during March and April, north of Cape Hatteras. Porpoises had high levels of parasitic infestation typical for this species. However, no indication of infectious disease and no cause of the 2005 event were found from gross and histologic findings. Response to UMEs is challenging, particularly along the expanses of North Carolina beaches, requiring additional effort to obtain carcasses in sufficiently fresh condition to determine the cause of these events.

  13. Targeting the MicroRNA Passenger Strand for Regulating Therapeutic Transgenes.

    Science.gov (United States)

    Kim, Sung Jin; Lee, Chang Ho; Lee, Seong-Wook

    2015-08-01

    Gene therapy strategies have been developed, which can tissue or disease specifically regulate expression of exogenous transgenes by means of endogenous microRNA (miRNA) activity. However, the use of an endogenous guide strand to regulate an exogenous transgene could affect expression of endogenous miRNA target genes. In this study, we developed a new regulatory system of exogenous transgene expression by targeting the passenger strand. We constructed reporter constructs harboring miRNA-122 guide or passenger target sites with perfect or imperfect complementarity. We observed downregulation of an exogenous transgene harboring the miRNA-122 target sites against either the guide or passenger strand in cells expressing the cognate miRNA or cells stably expressing the miRNA target site. Moreover, the transgene activity as well as the gene expression level increased specifically by intracellular introduction of the antisense RNA against the corresponding strand. Endogenous target gene expression was induced by the transgene construct harboring the miRNA guide strand target sites, but not the passenger strand target sites. Importantly, the therapeutic transgene activity was efficiently regulated by targeting the passenger strand. These results suggested that an approach to passenger strand-regulated expression of therapeutic transgenes could be applied more safely as a therapeutic tool.

  14. Distinct voltage-current characteristics of Nb3Sn strands with dispersed and collective crack distributions

    NARCIS (Netherlands)

    Miyoshi, Y.; van Lanen, E.P.A.; Dhalle, Marc M.J.; Nijhuis, Arend

    2009-01-01

    Two ITER-type Nb3Sn superconductor strands, one prepared with the bronze route and the other with the internal-tin route, were used to investigate the impact of filament cracking on the strand's transport properties. Careful mechanical polishing allowed unambiguous identification of the microscopic

  15. Persistent-current magnetizations of Nb3Sn Rutherford cables and extracted strands

    NARCIS (Netherlands)

    Collings, E.W.; Sumption, M.D.; Myers, C.S.; Wang, Xiao; Dietderich, D.R.; Yagotyntsev, K.; Nijhuis, Arend

    2017-01-01

    The magnetizations of eight high-gradient quadrupole cables designated HQ and QXF and a pair of strands, identical in architecture but with different effective strand diameters extracted from an HQ and a related QXF cable, were measured. In the service of field quality assessment, the cable

  16. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in ...

  17. DNA template strand sequencing of single-cells maps genomic rearrangements at high resolution

    NARCIS (Netherlands)

    Falconer, Ester; Hills, Mark; Naumann, Ulrike; Poon, Steven S. S.; Chavez, Elizabeth A.; Sanders, Ashley D.; Zhao, Yongjun; Hirst, Martin; Lansdorp, Peter M.

    2012-01-01

    DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, but they are typically masked by single-cell sequencing techniques. We developed Strand-seq to independently sequence parental DNA template strands from single cells, making it

  18. Nick-initiated homologous recombination: Protecting the genome, one strand at a time

    NARCIS (Netherlands)

    Vriend, Lianne E. M.; Krawczyk, Przemek M.

    2017-01-01

    Homologous recombination (HR) is an essential, widely conserved mechanism that utilizes a template for accurate repair of DNA breaks. Some early HR models, developed over five decades ago, anticipated single-strand breaks (nicks) as initiating lesions. Subsequent studies favored a more double-strand

  19. A Stress Measurement Method for Steel Strands Based on LC Oscillation

    Directory of Open Access Journals (Sweden)

    Dongjun Chen

    2018-01-01

    Full Text Available The prestress loss is one of the main factors affecting the safety of prestressed concrete structure. While the detecting signals like sound and light are difficult to spread in steel strands, there is no effective method for prestress detection of the bonded prestressed steel strands in existing structures yet. In this paper, taking into consideration that the electromagnetic oscillation characteristic can make the signal propagate effectively on the bonded prestressed steel strands, a nondestructive prestress detection method based on the electromagnetic effect to detect oscillation frequency is proposed. In a detection circuit, the steel strands are simulated as an inductance component, in which an induced electromagnetic signal passes through the steel strands to form resonance. And then, a frequency meter is used to detect the oscillation frequency of the resonant circuit. The oscillation frequency is supposed to have relationship with the prestress loading on the steel strands. A section of steel strands with a length of 1.2 m is adopted to test the correlation of stress and oscillation frequency. Both the theoretical and experimental results show that the resonant frequency of the circuit decreases with the increase of the stress of the strand and is linear in a certain range.

  20. When proteome meets genome: the alpha helix and the beta strand ...

    Indian Academy of Sciences (India)

    The avoidance of the -helix and the -strand by splice junctions suggests the existence of a selection pressure against their disruption, perhaps underscoring the investment made by nature in building these intricate secondary structures. A corollary is that the helix and the strand are the smallest integral architectural units ...