WorldWideScience

Sample records for synthesis x-ray crystal

  1. Synthesis, characterization, X-ray crystal structure, electrochemical ...

    Indian Academy of Sciences (India)

    DOI 10.1007/s12039-015-0978-8. Synthesis, characterization, X-ray crystal structure, electrochemical evaluation and anti-cancer studies of a mixed ligand Cu(II) complex of (E)-N -((2-hydroxynaphthalen-1-yl)methylene)acetohydrazide. IRAN SHEIKHSHOAIEa, S YOUSEF EBRAHIMIPOURa,∗, MAHDIEH SHEIKHSHOAIEa,.

  2. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity ...

    Indian Academy of Sciences (India)

    s12039-016-1125-x. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity of lanthanide(III) complexes of 2-benzoylpyridine acetylhydrazone. KARREDDULA RAJA, AKKILI SUSEELAMMA and KATREDDI HUSSAIN REDDY. ∗.

  3. Synthesis and single crystal X-ray analysis of two griseofulvin metabolites

    DEFF Research Database (Denmark)

    Rønnest, Mads Holger; Harris, Pernille; Gotfredsen, Charlotte Held

    2010-01-01

    The two phenols, 6-O-desmethyl griseofulvin and 4-O-desmethyl griseofulvin are metabolites of the antifungal drug griseofulvin. Herein, we present an improved synthesis of the 6-phenol derivative, and an unequivocal proof of both structures by single-crystal X-ray analysis.......The two phenols, 6-O-desmethyl griseofulvin and 4-O-desmethyl griseofulvin are metabolites of the antifungal drug griseofulvin. Herein, we present an improved synthesis of the 6-phenol derivative, and an unequivocal proof of both structures by single-crystal X-ray analysis....

  4. Synthesis, X-ray crystal structure, DNA binding and Nuclease activity ...

    Indian Academy of Sciences (India)

    BPAH)₂(NO₃)(H₂O)₂] 2NO₃.H₂O (where, BPAH = 2-benzoylpyridine acetyl hydrazone), were synthesized and characterized by elemental analysis, molar conductance, IR spectroscopy and single crystal X-ray diffraction and Hirschfeld ...

  5. Synthesis and Single Crystal X-Ray Crystallographic Analysis of 2 ...

    African Journals Online (AJOL)

    dihydropyrimidin-1-ium) tetrachlorocobaltate(II) [H2pymo]2[CoCl4]. The compound was re-crystallized in diethyl ether to obtain a suitable single crystal for X-ray diffraction analysis which revealed a molecule crystallizes in the orthorhombic ...

  6. Heteroaryl Chalcones: Design, Synthesis, X-ray Crystal Structures and Biological Evaluation

    Directory of Open Access Journals (Sweden)

    Hoong-Kun Fun

    2013-10-01

    Full Text Available Chalcone derivatives have attracted increasing attention due to their numerous pharmacological activities. Changes in their structures have displayed high degree of diversity that has proven to result in a broad spectrum of biological activities. The present study highlights the synthesis of some halogen substituted chalcones 3(a–i containing the 5-chlorothiophene moiety, their X-ray crystal structures and the evaluation of possible biological activities such as antibacterial, antifungal and reducing power abilities. The results indicate the tested compounds show a varied range of inhibition values against all the tested microbial strains. Compound 3c with a p-fluoro substituent on the phenyl ring exhibits elevated antimicrobial activity, whereas the compounds 3e and 3f displayed the least antimicrobial activities. The compounds 3d, 3e, 3f and 3i showed good ferric and cupric reducing abilities, and the compounds 3b and 3c showed the weakest reducing power in the series.

  7. Synthesis, X-ray crystal structure and theoretical calculations of antileishmanial neolignan analogues

    International Nuclear Information System (INIS)

    Nascimento, Josenaide P. do; Santos, Lourivaldo S.; Carmo, Maria Carolina L. do; Brasil, Davi S.B.; Alves, Claudio N.; Santos, Regina Helena A.; Tozzo, Erica; Ferreira, Janaina G.

    2010-01-01

    The synthesis and X-ray crystal diffraction structure of two analogues of neolignans, 2-(4-chlorophenyl)-1-phenylethanone (20) and 2-[(4-chlorophenyl)thio]-1-(3,4-dimethoxyphenyl) propan-1-one (12) is described. The compound 12 presents activity against intracellular Leishmania donovani and Leishmania amazonensis amastigotes that cause cutaneous and visceral leishmaniasis. In addition, the density functional theory (DFT) with the B3LYP hybrid functional was employed to calculate a set of molecular descriptors for nineteen synthetic analogues of neolignans with antileishmanial activities. Afterwards, the stepwise discriminant analysis was performed to investigate possible relationship between the molecular descriptors and biological activities. Through this analysis the compounds were classified into two groups active and inactive according to their degree of biological activities, and the more important properties were charges on some key atoms, electronic affinity and ClogP. (author)

  8. Synthesis, X-ray crystal structure and theoretical calculations of antileishmanial neolignan analogues

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Josenaide P. do; Santos, Lourivaldo S.; Carmo, Maria Carolina L. do; Brasil, Davi S.B.; Alves, Claudio N., E-mail: nahum@ufpa.b [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Inst. de Ciencias Exatas e Naturais; Santos, Regina Helena A.; Tozzo, Erica; Ferreira, Janaina G. [Universidade de Sao Paulo (IQSC/USP), Sao Carlos, SP (Brazil). Inst. de Quimica

    2010-07-01

    The synthesis and X-ray crystal diffraction structure of two analogues of neolignans, 2-(4-chlorophenyl)-1-phenylethanone (20) and 2-[(4-chlorophenyl)thio]-1-(3,4-dimethoxyphenyl) propan-1-one (12) is described. The compound 12 presents activity against intracellular Leishmania donovani and Leishmania amazonensis amastigotes that cause cutaneous and visceral leishmaniasis. In addition, the density functional theory (DFT) with the B3LYP hybrid functional was employed to calculate a set of molecular descriptors for nineteen synthetic analogues of neolignans with antileishmanial activities. Afterwards, the stepwise discriminant analysis was performed to investigate possible relationship between the molecular descriptors and biological activities. Through this analysis the compounds were classified into two groups active and inactive according to their degree of biological activities, and the more important properties were charges on some key atoms, electronic affinity and ClogP. (author)

  9. A pyrrolo-tetrathiafulvalene cage: Synthesis and X-ray crystal structure

    DEFF Research Database (Denmark)

    Nielsen, Kent A.; Jeppesen, Jan O.; Levillain, Eric

    2002-01-01

    A novel type of tetrathiafulvalene-cage 4 containing three monopyrrolo-tetrathiafulvalene units has been prepared employing a general and efficient synthetic approach. X-ray crystal structure analysis revealed that the cage is able to accommodate solvent molecules within a cavity in the solid state....

  10. Synthesis, characterization, single crystal X-ray and DFT analysis of disubstituted phosphorodithioates

    Science.gov (United States)

    Kour, Mandeep; Kumar, Sandeep; Feddag, Ahmed; Andotra, Savit; Chouaih, Abdelkader; Gupta, Vivek K.; Kant, Rajni; Pandey, Sushil K.

    2018-04-01

    Disubstituted phosphorodithioates of the type [{(2,5-CH3)2C6H3O}2PS2HNEt3] (1) and [{(3,5-CH3)2C6H3O)2(PS2)}2] (2) were synthesized and characterized by IR and NMR (1H,13C and 31P) spectroscopic studies and as single crystal X-ray analysis. The compound 1 crystallizes in monoclinic space group P21/c whereas compound 2 crystallizes in triclinic space group Pbar1. The X-ray analysis reveals that in compound 1 phosphorus atom is coordinated to the two S and two O atoms to form tetrahedral geometry. The structure is stabilized by cation-anion Nsbnd H⋯S hydrogen bonded interactions. In compound 2, the two phosphorus atoms have a distorted tetrahedral geometry coordinated to two (3,5-CH3)2C6H3O groups. The molecule possesses a crystallographic center of symmetry and consists of zig-zag array of Sdbnd Psbnd Ssbnd Ssbnd Pdbnd S linkages with two diphenyldithiophosphate moieties in the trans configuration. Molecular geometries, HOMO-LUMO analysis and molecular electrostatic potential of compounds 1 and 2 are investigated by theoretical calculations using B3LYP functional with the 6-311G basis combination set in the ground state and compared with the experimental values.

  11. Synthesis and Single Crystal X-Ray Structure Determination of 3,3',5 ...

    African Journals Online (AJOL)

    Single crystal structure determination at 100 K revealed needle-like crystals in an orthorhombic crystal system. The asymmetric unit of the cell consists of an isolated chloride ion, one half of a tetrahedral [MnCl4]2- anion, a [H2Me4bpz]2+ dication and one half of a molecule of water. Keywords: Crystal Engineering, Hydrogen ...

  12. Crystal structure resolution by X-rays

    International Nuclear Information System (INIS)

    Jeannin, Y.

    1998-01-01

    This paper deals with the crystal structure analysis by X-rays. It details the different steps of the crystal structure resolution, the measured parameters and the possible errors with appropriate corrections. The presentation includes the x-rays intensity measurement, the structure factor calculus, the Patterson method, the direct methods, the structure analysis, the parameters refinement by least square fit, the temperature factors, disorder and twinning, the primary and secondary extinctions and a absolute configuration determination. (A.L.B.)

  13. Synthesis, Single Crystal X-ray Analysis, and Antifungal Profiling of Certain New Oximino Ethers Bearing Imidazole Nuclei

    Directory of Open Access Journals (Sweden)

    Reem I. Al-Wabli

    2017-11-01

    Full Text Available Fungal infections threaten human health, particularly in immune-compromised patients worldwide. Although there are a large number of antifungal agents available, the desired clinical attributes for the treatment of fungal infections have not yet been achieved. Azoles are the mainstay class of the clinically used antifungal agents. In the current study, the synthesis, spectroscopic characterization, and antifungal activity of certain new oximino ethers Va–n bearing imidazole nuclei are reported. The (E-configuration of the imine double bond of the synthesized compounds Va–n has been confirmed via single crystal X-ray analysis of compound Vi as a representative example of this class of compounds. The molecular structure of compound Vi was crystallized in the monoclinic, P21/c, a = 18.7879(14 Å, b = 5.8944(4 Å, c = 16.7621(12 Å, β = 93.063(3°, V = 1855.5(2 Å3, Z = 4. The in vitro antifungal activity of the synthesized compounds Va–n were evaluated using diameter of the inhibition zone (DIZ and minimum inhibitory concentration (MIC assays against different fungal strains. Compound Ve manifested anti-Candida albicans activity with an MIC value of 0.050 µmol/mL, being almost equipotent with the reference antifungal drug fluconazole (FLC,while compounds Vi and Vn are the most active congeners against Candida parapsilosis, being equipotent and about twenty-three times more potent than FLC with an MIC value of 0.002 µmol/mL. The results of the current report might support the development of new potent and safer antifungal azoles.

  14. Synthesis and X-Ray Crystal Structures of Mononuclear Complexes of 1,3-Bis(8-quinolyloxy)propane

    International Nuclear Information System (INIS)

    Al-Mandhary, M.R.; Steel, P.

    2002-01-01

    The preparations and X-ray crystal structures of the first transition metal complexes of 1,3-bis(8-quinolyloxy)propane are described. The ligand acts as a trans-chelating N,N'-bidentate ligand in the three-coordinate silver nitrate complex and four-coordinate copper chloride complex, but as an N,O,O',N'-tetradentate ligand in the octahedral nickel chloride complex. Copyright (2002) CSIRO Australia

  15. Synthesis and single crystal x-ray diffraction study of a Schiff base derived from 4-acylpyrazolone and 2-aminophenol

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Naresh; Kant, Rajni, E-mail: vivek-gupta2k2@hotmail.com; Gupta, Vivek K., E-mail: vivek-gupta2k2@hotmail.com [Department of Physics and Electronics, University of Jammu, Jammu Tawi - 180006 (India); Jadeja, R. N. [Department of Chemistry, Faculty of Science, The M. S. University of Baroda, Vadodara-390002 (India)

    2014-04-24

    The title compound, (Z)-1-(3-chlorophenyl)-4[1((2hydroxyphenyl)amino)propylidene] -3-methyl-1H-pyrazol-5(4H)-one was synthesized by refluxing compound 1-(m-chlorophenyl)-3-methyl-4-propionyl-5-pyrazolone, with 2-aminophenol in ethanol. The compound crystallizes in the orthorhombic crystal system with space group Pca2{sub 1} having unit cell parameters: a = 26.2993(8), b = 7.0724(2) and c = 18.7170(5)Å. The structure contains two crystallographically independent molecules, A, and, B, in the asymmetric unit cell. The crystal structure was solved by direct method using single crystal X-ray diffraction data collected at room temperature and refined by full-matrix least-squares procedures to a final R- value of 0.049 for 5207 observed reflections.

  16. Organobase catalyzed 1,4-conjugate addition of 4-hydroxycoumarin on chalcones: Synthesis, NMR and single-crystal X-ray diffraction studies of novel warfarin analogues

    Science.gov (United States)

    Talhi, Oualid; Fernandes, José A.; Pinto, Diana C. G. A.; Almeida Paz, Filipe A.; Silva, Artur M. S.

    2015-08-01

    The synthesis of a new series of warfarin analogues by convenient organobase catalyzed 1,4-conjugate addition of 4-hydroxycoumarin to chalcone derivatives is described. 1H NMR spectroscopy evidenced the presence of a predominant acyclic open-form together with the cyclic hemiketal tautomers of the resulting Michael adducts. The acyclic open-form has been unequivocally proved by single-crystal X-ray diffraction analysis. The use of the B ring ortho-hydroxychalcone synthons in this reaction has led to a diastereoselective synthesis of warfarin bicyclo[3.3.1]nonane ketal derivatives.

  17. Synthesis, characterization and single crystal X-ray analysis of chlorobis(N,N-dimethyldithiocarbamato-S,S′antimony(III

    Directory of Open Access Journals (Sweden)

    H.P.S. Chauhan

    2015-07-01

    Full Text Available The title compound chlorobis(N,N-dimethyldithiocarbamato-S,S′antimony(III has been prepared in distilled acetonitrile and characterized by physicochemical [melting point and molecular weight determination, elemental analysis (C, H, N, S & Sb], spectral [FT–IR, far IR, NMR (1H & 13C] studies. The crystal and molecular structure was further confirmed using single crystal X-ray diffraction analysis which features a five-coordinate geometry for antimony(III within a ClS4 donor set. The distortion in the co-planarity of ClSbS3 evidences the stereochemical influence exerts by the lone pair of electrons on antimony(III. Two centrosymmetrically related molecule held together via C–H···Cl secondary interaction result in molecular aggregation of the compound.

  18. Synthesis, structural, X-ray photoelectron spectroscopy (XPS) studies and IR induced anisotropy of Tl{sub 4}HgI{sub 6} single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V. [Department of Inorganic and Physical Chemistry, Lesya Ukrainka Eastern European National University, Voli Ave. 13, Lutsk, 43025 (Ukraine); Khyzhun, O.Y. [Frantsevych Institute for Problems of Materials Science, National Academy of Sciences of Ukraine, 3 Krzhyzhanivsky St., 03142, Kyiv (Ukraine); Piasecki, M. [Institute of Physics, J. Dlugosz University Częstochowa, Armii Krajowej 13/15, Częstochowa (Poland); Kityk, I.V., E-mail: iwank74@gmail.com [Electrical Engineering Department, Czestochowa University Technology, Armii Krajowej 17, PL-42-217, Czestochowa (Poland); Lakshminarayana, G. [Wireless and Photonic Networks Research Centre, Faculty of Engineering, Universiti Putra Malaysia, 43400, Serdang, Selangor (Malaysia); Luzhnyi, I. [Frantsevych Institute for Problems of Materials Science, National Academy of Sciences of Ukraine, 3 Krzhyzhanivsky St., 03142, Kyiv (Ukraine); Fochuk, P.M. [Yuriy Fed’kovych Chernivtsi National University, 2 Kotziubynskoho Str., 58012, Chernivtsi (Ukraine); Fedorchuk, A.O. [Department of Inorganic and Organic Chemistry, Lviv National University of Veterinary Medicine and Biotechnologies, Pekarska Street 50, 79010, Lviv (Ukraine); Levkovets, S.I.; Yurchenko, O.M.; Piskach, L.V. [Department of Inorganic and Physical Chemistry, Lesya Ukrainka Eastern European National University, Voli Ave. 13, Lutsk, 43025 (Ukraine)

    2017-02-01

    In the present work, we report on the synthesis and structural properties including X-ray protoelectron spectroscopy (XPS) analysis of Tl{sub 4}HgI{sub 6} crystals that were grown by Bridgman-Stockbarger method up to 80 mm in length and 18 mm in diameter. The existence of the ternary compound Tl{sub 4}HgI{sub 6} that melts incongruently at 641 K was confirmed. Phase equilibria and structural properties for the TlI–HgI{sub 2} system were investigated by differential thermal analysis (DTA) and X-ray diffraction (XRD) methods. X-ray photoelectron spectra were measured for both pristine and Ar{sup +} ion-bombarded Tl{sub 4}HgI{sub 6} single crystal surfaces. The data reveal that the Tl{sub 4}HgI{sub 6} single crystal is sensitive with respect to Ar{sup +} ion-bombardment as 3.0 keV Ar{sup +} irradiation over 5 min at an ion current density 14 μA/cm{sup 2} induces changes to the elemental stoichiometry of the Tl{sub 4}HgI{sub 6} surface, leading to a decrease of the mercury content in the topmost surface layers. X-ray photoelectron spectroscopy (XPS) measurements indicate very low hygroscopic nature of the Tl{sub 4}HgI{sub 6} single crystal surface. The IR coherent bicolor laser treatment at wavelengths 10.6/5.3 μm has shown an occurrence of anisotropy at wavelengths 1540 nm of Er:glass laser. This may open the applications of Tl{sub 4}HgI{sub 6} as a material for IR laser triggering. - Highlights: • Phase diagram of the HgI{sub 2}–TlI system was built. • Tl{sub 4}HgI{sub 6} single crystals were grown by Bridgman Stockbarger method. • XRD, XPS analysis was done. • Ir induced anisotropy was established. • The compounds may be proposed as Ir laser operated polarizers.

  19. Synthesis, characterization, X-ray crystal structures of heterocyclic Schiff base compounds and in vitro cholinesterase inhibition and anticancer activity

    Science.gov (United States)

    Arafath, Md. Azharul; Adam, Farook; Al-Suede, Fouad Saleih R.; Razali, Mohd R.; Ahamed, Mohamed B. Khadeer; Abdul Majid, Amin Malik Shah; Hassan, Mohd Zaheen; Osman, Hasnah; Abubakar, Saifullah

    2017-12-01

    Four heterocyclic embedded Schiff base derivatives (1-4) were synthesized and characterized by melting point, elemental analysis, FTIR, 1H, 13C NMR, UV-Visible spectral data. The structures of compounds 1, 2 and 4 were successfully established through single crystal X-ray diffraction analysis. In vitro cholinesterase inhibition assays showed that the cyclized derivative 1 displayed higher BuChE enzyme inhibitory activity with IC50 value of 1.45 ± 0.09 μM. The anti-proliferative efficacies of the compounds were also evaluated using human colorectal HCT 116 and breast MCF-7 adenocarcinoma cell lines. In addition, a human normal endothelial cell line (Ea.hy926) was also tested to assess the safety and selectivity of the compounds towards normal and cancer cells, respectively. Among the compounds tested, compound 2 displayed potent cytotoxic effect (IC50 = 34 μM) against HCT 116 cells with highest selectivity index of 3.1 with respect to the normal endothelial cells. Whereas, compound 4 exhibited significant anti-proliferative effect (IC50 = 21.1 μM) against MCF-7 cells with highest selectivity index of 3.3 with respect to the normal endothelial cells. The docking result of these compounds against hAChE showed potent activities with different binding modes. These compounds could be a promising pharmacological agent to treat cancer and Alzheimer's disease.

  20. Synthesis, X-Ray Crystal Structures, Biological Evaluation, and Molecular Docking Studies of a Series of Barbiturate Derivatives

    Directory of Open Access Journals (Sweden)

    Assem Barakat

    2016-01-01

    Full Text Available A series of barbiturates derivatives synthesized and screened for different set of bioassays are described. The molecular structures of compounds 5a, 5d, and 5f were solved by single-crystal X-ray diffraction techniques. The results of bioassay show that compounds 4a, 4b, 4c, 4d, 4e, 4f, and 4g are potent antioxidants in comparison to the tested standards, butylated hydroxytoluene (BHT, and N-acetylcysteine. Compounds 4a–4e (IC50=101.8±0.8–124.4±4.4 μM and 4g (IC50=104.1±1.9 μM were more potent antioxidants than the standard (BHT, IC50=128.8±2.1 μM. The enzyme inhibition potential of these compounds was also evaluated, in vitro, against thymidine phosphorylase, α-glucosidase, and β-glucuronidase enzymes. Compounds 4c, 4h, 4o, 4p, 4q, 5f, and 5m were found to be potent α-glucosidase inhibitors and showed more activity than the standard drug acarbose, whereas compounds 4v, and 5h were found to be potent thymidine phosphorylase inhibitors, more active than the standard drug, 7-deazaxanthine. All barbiturates derivatives (4a–4x, 4z, and 5a–5m were found to be noncytotoxic against human prostate (PC-3, Henrietta Lacks cervical (HeLa and Michigan Cancer Foundation-7 breast (MCF-7 cancer cell lines, and 3T3 normal fibroblast cell line, except 4y which was cytotoxic against all the cell lines.

  1. A versatile three/four crystal X-ray diffractometer for X-ray optical elements: Performance and applications

    DEFF Research Database (Denmark)

    Christensen, Finn Erland; Hornstrup, Allan; Jacobsen, E.

    1987-01-01

    A versatile X-ray diffractometer for the study of X-ray optical elements such as grazing incidence mirrors, crystals and X-ray gratings has been built and put into operation at the Danish Space Research Institute. The diffractrometer is built on a 1.5 m long granite bench with the X-ray source...

  2. Crystals x-rays and proteins comprehensive protein crystallography

    CERN Document Server

    Sherwood, Dennis

    2011-01-01

    Information derived from X-ray crystal structures of biological molecules allows us to explain their functions in living organisms and to develop drugs to treat disease. This book describes the principles and practice of X-ray diffraction as a key technique at the forefront of new discoveries in biology and medicine.

  3. Synthesis, X-ray crystal structure and optical properties research of novel diphenyl sulfone-based bis-pyrazoline derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Gong Zhongliang; Zheng Liangwen [Institute of Organic Chemistry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Zhao Baoxiang, E-mail: bxzhao@sdu.edu.cn [Institute of Organic Chemistry, School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

    2012-02-15

    A series of novel bis-pyrazoline derivatives were synthesized by the reaction of chalcone and (sulfonylbis(3,1-phenylene))bis(hydrazine) in 20-34% yields. The structures of the compounds were determined by IR, {sup 1}H NMR, HRMS spectra, and a representative compound 3b was confirmed based on the X-ray crystallographic analysis. Absorption and fluorescence spectra of these compounds in dichloromethane solution were investigated. The results showed that the emission maxima varied from 415 to 444 nm mainly depending on C3 substituents of pyrazoline moiety. The compounds had higher quantum yields, when C3 substituent was an electron-withdrawing p-chlorophenyl group. Moreover, absorption spectra and emission spectra exhibited a blue-shift and a red-shift with increasing the polarity of solvents, respectively. Fluorescent molecules happened to collide with each other and resulted in quench of the fluorescence when the concentration increased over to 10{sup -5} M. - Highlights: Black-Right-Pointing-Pointer A series of novel diphenyl sulfone-based bis-pyrazoline derivatives were designed and synthesized. Black-Right-Pointing-Pointer Their UV-vis absorption and fluorescence emission spectra were investigated. Black-Right-Pointing-Pointer The relationship of substituents and the optical properties were discussed. Black-Right-Pointing-Pointer With increasing the solvent polarity, fluorescence emission displayed a red-shift and fluorescence quantum yields decreased. Black-Right-Pointing-Pointer Fluorescence was quenched when the concentration increased over to 10{sup -5} M.

  4. Synthesis, X-ray crystal structure and optical properties research of novel diphenyl sulfone-based bis-pyrazoline derivatives

    International Nuclear Information System (INIS)

    Gong Zhongliang; Zheng Liangwen; Zhao Baoxiang

    2012-01-01

    A series of novel bis-pyrazoline derivatives were synthesized by the reaction of chalcone and (sulfonylbis(3,1-phenylene))bis(hydrazine) in 20–34% yields. The structures of the compounds were determined by IR, 1 H NMR, HRMS spectra, and a representative compound 3b was confirmed based on the X-ray crystallographic analysis. Absorption and fluorescence spectra of these compounds in dichloromethane solution were investigated. The results showed that the emission maxima varied from 415 to 444 nm mainly depending on C3 substituents of pyrazoline moiety. The compounds had higher quantum yields, when C3 substituent was an electron-withdrawing p-chlorophenyl group. Moreover, absorption spectra and emission spectra exhibited a blue-shift and a red-shift with increasing the polarity of solvents, respectively. Fluorescent molecules happened to collide with each other and resulted in quench of the fluorescence when the concentration increased over to 10 −5 M. - Highlights: ► A series of novel diphenyl sulfone-based bis-pyrazoline derivatives were designed and synthesized. ► Their UV–vis absorption and fluorescence emission spectra were investigated. ► The relationship of substituents and the optical properties were discussed. ► With increasing the solvent polarity, fluorescence emission displayed a red-shift and fluorescence quantum yields decreased. ► Fluorescence was quenched when the concentration increased over to 10 −5 M.

  5. Synthesis, characterization and x-ray crystal structure of a dimethyltin (IV) dichloride complex of 2-acetylpyridine benzophenone azine

    International Nuclear Information System (INIS)

    Mustaffa Shamsuddin; Md Abu Affan; Ramli Atan

    1998-01-01

    Dimethyltin dichloride react with 2-ac ethylpyridine benzophenone azine (apba) in refluxing dry hexane to give (SnMe 2 Cl 2 (apba)) where the azine ligand acts as a bidentate N-N chelating ligand. The complex has been characterized by IR spectroscopy, 1 H and 13 C NMR spectroscopic data and elemental analyses. The crystal structure of the dimethyltin(IV) derivative has also been determined. Crystals are monoclinic with space group P2(1)/n with cell dimensions: a = 10.1819(3) Armstrong, b = 18.3113(5) Armstrong, c = 12.6451(4) Armstrong

  6. A = Rb, K: Single crystal X-ray diffraction studies

    Indian Academy of Sciences (India)

    Unknown

    X-ray diffraction on structural phase transition. 475. Figure 2. Powder X-ray diffraction pattern of KLHS at 298 and 100 K. 3. Structure determination and refinement. 3.1 Structure of RLHS at 293 K. A crystal of size 0⋅7 × 0⋅3 × 0⋅4 mm was mounted on a BRUKER AXS SMART APEX. CCD9 diffractometer with a crystal to ...

  7. Synthesis and X-ray crystal structure of the first tetrathiafulvalene-based acceptor-donor-acceptor sandwich

    DEFF Research Database (Denmark)

    Simonsen, Klaus B.; Thorup, Niels; Cava, Michael P.

    1998-01-01

    The synthesis and characterization of a bis-macrocyclic A-D-A sandwich produced in a simple one-pot reaction is reported. Only one acceptor unit participates in charge-transfer interactions with the TTF unit in the solid state....

  8. X-ray conductivity of ZnSe single crystals

    Energy Technology Data Exchange (ETDEWEB)

    Degoda, V. Ya., E-mail: degoda@univ.kiev.ua; Podust, G. P. [Taras Shevchenko Kyiv National University, Physics Department (Ukraine)

    2016-05-15

    The experimental I–V and current–illuminance characteristics of the X-ray conductivity and X-ray luminescence of zinc-selenide single crystals feature a nonlinear shape. The performed theoretical analysis of the kinetics of the X-ray conductivity shows that even with the presence of shallow and deep traps for free charge carriers in a semiconductor sample, the integral characteristics of the X-ray conductivity (the current–illuminance and I–V dependences) should be linear. It is possible to assume that the nonlinearity experimentally obtained in the I–V and current–illuminance characteristics can be caused by features of the generation of free charge carriers upon X-ray irradiation, i.e., the generation of hundreds of thousands of free charge carriers of opposite sign in a local region with a diameter of <1 μm and Coulomb interaction between the free charge carriers of opposite signs.

  9. Locating and Visualizing Crystals for X-Ray Diffraction Experiments.

    Science.gov (United States)

    Becker, Michael; Kissick, David J; Ogata, Craig M

    2017-01-01

    Macromolecular crystallography has advanced from using macroscopic crystals, which might be >1 mm on a side, to crystals that are essentially invisible to the naked eye, or even under a standard laboratory microscope. As crystallography requires recognizing crystals when they are produced, and then placing them in an X-ray, electron, or neutron beam, this provides challenges, particularly in the case of advanced X-ray sources, where beams have very small cross sections and crystals may be vanishingly small. Methods for visualizing crystals are reviewed here, and examples of different types of cases are presented, including: standard crystals, crystals grown in mesophase, in situ crystallography, and crystals grown for X-ray Free Electron Laser or Micro Electron Diffraction experiments. As most techniques have limitations, it is desirable to have a range of complementary techniques available to identify and locate crystals. Ideally, a given technique should not cause sample damage, but sometimes it is necessary to use techniques where damage can only be minimized. For extreme circumstances, the act of probing location may be coincident with collecting X-ray diffraction data. Future challenges and directions are also discussed.

  10. X-ray scattering from surfaces of organic crystals

    DEFF Research Database (Denmark)

    Gidalevitz, D.; Feidenhans'l, R.; Smilgies, D.-M.

    1997-01-01

    X-ray scattering experiments have been performed on the surfaces of organic crystals. The (010) cleavage planes of beta-alanine and alpha-glycine were investigated, and both specular and off-specular crystal truncation rods were measured. This allowed a determination of the molecular layering...

  11. X-ray Diffraction Crystal Calibration and Characterization

    International Nuclear Information System (INIS)

    Haugh, Michael J.; Stewart, Richard; Kugland, Nathan

    2009-01-01

    National Security Technologies X-ray Laboratory is comprised of a multi-anode Manson type source and a Henke type source that incorporates a dual goniometer and XYZ translation stage. The first goniometer is used to isolate a particular spectral band. The Manson operates up to 10 kV and the Henke up to 20 kV. The Henke rotation stages and translation stages are automated. Procedures have been developed to characterize and calibrate various NIF diagnostics and their components. The diagnostics include X-ray cameras, gated imagers, streak cameras, and other X-ray imaging systems. Components that have been analyzed include filters, filter arrays, grazing incidence mirrors, and various crystals, both flat and curved. Recent efforts on the Henke system are aimed at characterizing and calibrating imaging crystals and curved crystals used as the major component of an X-ray spectrometer. The presentation will concentrate on these results. The work has been done at energies ranging from 3 keV to 16 keV. The major goal was to evaluate the performance quality of the crystal for its intended application. For the imaging crystals we measured the laser beam reflection offset from the X-ray beam and the reflectivity curves. For the curved spectrometer crystal, which was a natural crystal, resolving power was critical. It was first necessary to find sources of crystals that had sufficiently narrow reflectivity curves. It was then necessary to determine which crystals retained their resolving power after being thinned and glued to a curved substrate

  12. New Cu (II), Co(II) and Ni(II) complexes of chalcone derivatives: Synthesis, X-ray crystal structure, electrochemical properties and DFT computational studies

    Science.gov (United States)

    Tabti, Salima; Djedouani, Amel; Aggoun, Djouhra; Warad, Ismail; Rahmouni, Samra; Romdhane, Samir; Fouzi, Hosni

    2018-03-01

    The reaction of nickel(II), copper(II) and cobalt(II) with 4-hydroxy-3-[(2E)-3-(1H-indol-3-yl)prop-2-enoyl]-6-methyl-2H-pyran-2-one (HL) leads to a series of new complexes: Ni(L)2(NH3), Cu(L)2(DMF)2 and Co(L)2(H2O). The crystal structure of the Cu(L)2(DMF)2 complex have been determined by X-ray diffraction methods. The Cu(II) lying on an inversion centre is coordinated to six oxygen atoms forming an octahedral elongated. Additionally, the electrochemical behavior of the metal complexes were investigated by cyclic voltammetry at a glassy carbon electrode (GC) in CH3CN solutions, showing the quasi-reversible redox process ascribed to the reduction of the MII/MI couples. The X-ray single crystal structure data of the complex was matched excellently with the optimized monomer structure of the desired compound; Hirschfeld surface analysis supported the packed crystal lattice 3D network intermolecular forces. HOMO/LUMO energy level and the global reactivity descriptors quantum parameters are also calculated. The electrophilic and nucleophilic potions in the complex surface are theoretically evaluated by molecular electrostatic potential and Mulliken atomic charges analysis.

  13. Synthesis, characterization and single crystal x-ray analysis of a complex of iron(II) bis(2,4-dimethylphenyl)dithiophosphate with 4-ethylpyridine

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, Sandeep; Andotra, Savit; Kaur, Mandeep [University of Jammu, Department of Chemistry (India); Gupta, Vivek K.; Kant, Rajni [Department of Physics and Electronics, University of Jammu, X-ray Crystallographic Laboratory (India); Pandey, Sushil K., E-mail: kpsushil@rediffmail.com [University of Jammu, Department of Chemistry (India)

    2016-09-15

    Complex of iron(II) bis(2,4-dimethylphenyl)dithiophosphate with 4-ethylpyridine [((2,4- (CH{sub 3}){sub 2}C{sub 6}H{sub 3}O)2PS2)2Fe(NC{sub 5}H{sub 4}(C{sub 2}H{sub 5})-4){sub 2}] is synthesized and characterized by elemental analysis, magnetic moment, IR spectroscopy and single crystal X-ray analysis. Complex crystallizes in the monoclinic sp. gr. P2{sub 1}/n, Z = 2. Crystal structure consists of mononuclear units with Fe(II) ion chelated by four S atoms of the two diphenyldithiophosphate ligands in bidentate manner. N atoms from two 4-ethylpyridine ligands are axially coordinated to the Fe(II) atom leading to an octahedral geometry.

  14. Design, Synthesis, and X-ray Crystal Structures of 2,4-Diaminofuro[2,3-d]pyrimidines as Multireceptor Tyrosine Kinase and Dihydrofolate Reductase Inhibitors

    Science.gov (United States)

    Gangjee, Aleem; Li, Wei; Lin, Lu; Zeng, Yibin; Ihnat, Michael; Warnke, Linda A.; Green, Dixy W.; Cody, Vivian; Pace, Jim; Queener, Sherry F.

    2009-01-01

    To optimize dual receptor tyrosine kinase (RTK) and dihydrofolate reductase (DHFR) inhibition, the E- and Z-isomers of 5-[2-(2-methoxyphenyl)prop-1-en-1-yl]furo[2,3-d]pyrimidine-2,4-diamines (1a and 1b) were separated by HPLC and the X-ray crystal structures (2.0 Å and 1.4 Å respectively) with mouse DHFR and NADPH as well as 1b with human DHFR (1.5 Å) were determined. The E- and Z-isomers adopt different binding modes when bound to mouse DHFR. A series of 2,4-diaminofuro[2,3-d]pyrimidines 2–13 were designed and synthesized using the X-ray crystal structures of 1a and 1b with DHFR to increase their DHFR inhibitory activity. Wittig reactions of appropriate 2-methoxyphenyl ketones with 2,4-diamino-6-chloromethyl furo[2,3-d]pyrimidine afforded the C8–C9 unsaturated compounds 2–7 and catalytic reduction gave the saturated 8–13. Homologation of the C9-methyl analog maintains DHFR inhibitory activity. In addition, inhibition of EGFR and PDGFR-β were discovered for saturated C9-homologated analogs 9 and 10 that were absent in the saturated C9-methyl analogs. PMID:19748785

  15. Synthesis, X-ray structure and N–H…O interactions in 1,3-diphenyl ...

    Indian Academy of Sciences (India)

    The synthesis, X-ray structure and role of intermolecular interactions have been studied in case of 1,3-diphenyl-urea, owing to its medicinal importance. The compound crystallizes in orthorhombic crystal system (space group, 21) with unit cell parameters, = 9.118(3), = 10.558(2), = 11.780(3) Å and = 4.

  16. Self-filtering extremely inclined x-ray crystal monochromator

    Czech Academy of Sciences Publication Activity Database

    Hrdá, Jaromíra; Hrdý, Jaromír

    2011-01-01

    Roč. 44, č. 6 (2011), 1169-1172 ISSN 0021-8898 R&D Projects: GA MPO FR-TI1/412 Institutional research plan: CEZ:AV0Z10100522 Keywords : synchrotron radiation monochromator * x-ray crystal monochromator * inclined monochromator * inclined diffraction Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 5.152, year: 2011

  17. A 1:1 pharmaceutical cocrystal of myricetin in combination with uncommon piracetam conformer: X-ray single crystal analysis and mechanochemical synthesis

    Science.gov (United States)

    Sowa, Michał; Ślepokura, Katarzyna; Matczak-Jon, Ewa

    2014-01-01

    Combination of two Active Pharmaceutical Ingredients, myricetin and piracetam, yields a 1:1 cocrystal characterized by X-ray single-crystal and powder diffraction, Raman spectroscopy, 1H NMR, thermal analysis (DSC and TG-DTA) methods. Constituents of the cocrystalline phase were also investigated in terms of Hirshfeld surfaces. Compounds in their neutral forms cocrystallize in the Pna21 space group of orthorhombic system. Notably, piracetam adopts an uncommon conformation, not encountered in its cocrystals previously described. In the crystal lattice, a three-dimensional hydrogen-bonded network is observed, including formation of a 2D molecular scaffolding motif. A scale-up procedure is readily available with use of solvent-drop grinding method, in which application of a variety of common solvents leads to formation of the cocrystal, as confirmed by XRPD and Raman spectroscopy.

  18. Fourier Analysis and Structure Determination--Part III: X-ray Crystal Structure Analysis.

    Science.gov (United States)

    Chesick, John P.

    1989-01-01

    Discussed is single crystal X-ray crystal structure analysis. A common link between the NMR imaging and the traditional X-ray crystal structure analysis is reported. Claims that comparisons aid in the understanding of both techniques. (MVL)

  19. Crystallization and preliminary X-ray analysis of argininosuccinate lyase from Streptococcus mutans

    International Nuclear Information System (INIS)

    Cao, Yan-Li; Li, Gui-Lan; Wang, Kai-Tuo; Zhang, Hong-Yin; Li, Lan-Fen

    2011-01-01

    Crystals of argininosuccinate lyase from S. mutans were obtained and X-ray data were collected to 2.5 Å resolution in space group R3. Argininosuccinate lyase (ASL) is an important enzyme in arginine synthesis and the urea cycle, which are highly conserved from bacteria to eukaryotes. The gene encoding Streptococcus mutans ASL (smASL) was amplified and cloned into expression vector pET28a. The recombinant smASL protein was expressed in a soluble form in Escherichia coli strain BL21 (DE3) and purified to homogeneity by two-step column chromatography. Crystals suitable for X-ray analysis were obtained and X-ray diffraction data were collected to a resolution of 2.5 Å. The crystals belonged to space group R3, with unit-cell parameters a = b = 254.5, c = 78.3 Å

  20. Determination of organic crystal structures by X ray powder diffraction

    CERN Document Server

    McBride, L

    2000-01-01

    The crystal structure of Ibuprofen has been solved from synchrotron X-ray powder diffraction data using a genetic algorithm (GA). The performance of the GA is improved by incorporating prior chemical information in the form of hard limits on the values that can be taken by the flexible torsion angles within the molecule. Powder X-ray diffraction data were collected for the anti-convulsant compounds remacemide, remacemide nitrate and remacemide acetate at 130 K on BM 16 at the X-ray European Synchrotron Radiation Facility (ESRF) at Grenoble. High quality crystal structures were obtained using data collected to a resolution of typically 1.5 A. The structure determinations were performed using a simulated annealing (SA) method and constrained Rietveld refinements for the structures converged to chi sup 2 values of 1.64, 1.84 and 1.76 for the free base, nitrate and acetate respectively. The previously unknown crystal structure of the drug famotidine Form B has been solved using X-ray powder diffraction data colle...

  1. Scattering of x-ray from crystal surfaces

    International Nuclear Information System (INIS)

    Andrews, S.R.; Cowley, R.A.

    1985-01-01

    X-ray measurements performed on a variety of materials demonstrate that it is possible to observe diffuse scattering that originates in the abrupt change of density at a crystal surface. Such a discontinuity gives rise, in general, to rods of scattering in reciprocal space which are most intense close to the Bragg peaks tau and are well defined for sufficiently smooth surfaces. For wave-vector transfer Q=tau+q the q-dependence of the intensity of scattering gives information on the topographic structure of the crystal surface. Experimental results on crystals of GaAs and KTaO 3 , with surfaces prepared in various ways, were obtained using conventional x-ray techniques with a rotating anode source and can be described by a continuum model of the surface. There are discrepancies between the predictions of the models and the experimental results and the suggest that further experiments are needed to achieve a more complete understanding. (author)

  2. Second-sphere coordination complex via hydrogen bonding: Synthesis, characterization, X-ray crystal structure determination and packing of hexaamminecobalt(III) chloride di( para-nitrobenzoate)

    Science.gov (United States)

    Sharma, Raj Pal; Bala, Ritu; Sharma, Rajni; Perez, Julio; Miguel, Daniel

    2006-09-01

    A reddish orange coloured crystalline solid of hexaamminecobalt(III) chloride di( para-nitrobenzoate) was obtained when hexaamminecobalt(III) chloride was reacted with the sodium salt of para-nitrobenzoic acid (1:3 molar ratio) in hot aqueous medium. This cobalt(III) complex salt has been characterized by elemental analyses and spectroscopic techniques (e.g. UV/visible, IR and NMR). Single-crystal X-ray structure determination of the title complex salt revealed that it contains the cationic cobaltammine ([Co(NH 3) 6] 3+) and mixed anions (Cl -, NO 2C 6H 4COO -), which are held together by electrostatic forces attractions through second-sphere coordination, i.e. N-H⋯O (carboxylate and nitro) and N-H⋯Cl hydrogen bonds, resulting in a three-dimensional network.

  3. Ptychographic X-Ray Imaging of Colloidal Crystals.

    Science.gov (United States)

    Lazarev, Sergey; Besedin, Ilya; Zozulya, Alexey V; Meijer, Janne-Mieke; Dzhigaev, Dmitry; Gorobtsov, Oleg Yu; Kurta, Ruslan P; Rose, Max; Shabalin, Anatoly G; Sulyanova, Elena A; Zaluzhnyy, IvanA; Menushenkov, Alexey P; Sprung, Michael; Petukhov, Andrei V; Vartanyants, Ivan A

    2018-01-01

    Ptychographic coherent X-ray imaging is applied to obtain a projection of the electron density of colloidal crystals, which are promising nanoscale materials for optoelectronic applications and important model systems. Using the incident X-ray wavefield reconstructed by mixed states approach, a high resolution and high contrast image of the colloidal crystal structure is obtained by ptychography. The reconstructed colloidal crystal reveals domain structure with an average domain size of about 2 µm. Comparison of the domains formed by the basic close-packed structures, allows us to conclude on the absence of pure hexagonal close-packed domains and confirms the presence of random hexagonal close-packed layers with predominantly face-centered cubic structure within the analyzed part of the colloidal crystal film. The ptychography reconstruction shows that the final structure is complicated and may contain partial dislocations leading to a variation of the stacking sequence in the lateral direction. As such in this work, X-ray ptychography is extended to high resolution imaging of crystalline samples. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.

    1992-01-01

    The term open-quote Variable-Metricclose quotes (V-M) when applied to diffraction crystals refers to a crystal in which the spacing between crystalline planes varies with the position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes. The variation in the crystalline spacing of a V-M crystal can be produced by introducing a thermal gradient in the crystal. This approach works well when the over-all percentage change in the lattice spacing is small (less than 0.1 %). For V-M crystals where the over-all change in spacing is the order of 0.1 percent or larger, it is more practical to produce the change in crystal spacing by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. One of the simplest applications of this type of crystal diffraction optics is to use V-M crystals to increase the number of photon per unit bandwidth in a diffracted x-ray beam. Typical enhancement factors of 3 to 20 are possible with wiggler sources. For near perfect silicon crystals the rocking curve for (111) planes is typically 8.5 arc seconds at 8 keV and 2.6 arc seconds at 20 keV. If one changes the crystalline spacing to match the change in the incident angle of the beam on the crystalline planes, then the full surface of the diffraction crystal will diffract the same wavelength x-ray. The increase in flux per unit bandwidth in the diffracted beam is 6 to 1 and 20 to 1 for the 8 keV and 20 keV x-rays, respectively, for the NSLS example. In most of the experiments the changes in crystalline spacings were generated with thermal gradients. One set of experiments used a V-M crystal grown with a variable percentage of germanium and silicon. This crystal had a 0.1 percent change in crystal spacing in 1 mm of distance in the crystal

  5. Crystal defect studies using x-ray diffuse scattering

    Energy Technology Data Exchange (ETDEWEB)

    Larson, B.C.

    1980-01-01

    Microscopic lattice defects such as point (single atom) defects, dislocation loops, and solute precipitates are characterized by local electronic density changes at the defect sites and by distortions of the lattice structure surrounding the defects. The effect of these interruptions of the crystal lattice on the scattering of x-rays is considered in this paper, and examples are presented of the use of the diffuse scattering to study the defects. X-ray studies of self-interstitials in electron irradiated aluminum and copper are discussed in terms of the identification of the interstitial configuration. Methods for detecting the onset of point defect aggregation into dislocation loops are considered and new techniques for the determination of separate size distributions for vacancy loops and interstitial loops are presented. Direct comparisons of dislocation loop measurements by x-rays with existing electron microscopy studies of dislocation loops indicate agreement for larger size loops, but x-ray measurements report higher concentrations in the smaller loop range. Methods for distinguishing between loops and three-dimensional precipitates are discussed and possibilities for detailed studies considered. A comparison of dislocation loop size distributions obtained from integral diffuse scattering measurements with those from TEM show a discrepancy in the smaller sizes similar to that described above.

  6. Synthesis, Characterization, and X-Ray Crystal Structure of Bis(O-amyl dithiocarbonato-κ2S,S′bis(4-cyanopyridine-κNnickel(II

    Directory of Open Access Journals (Sweden)

    Kuldeep Singh

    2014-01-01

    Full Text Available The [Ni(S2CO-n-C5H112(C6H4N22] adduct of 4-cyanopyridine with [Ni(S2CO-n-C5H112] was synthesized and characterized by elemental analysis, magnetic susceptibility measurement, IR, electronic spectral data, and X-ray diffraction analysis. The Ni atom in the title complex is octahedrally coordinated within a trans-N2S4 donor set, with the Ni atom located on a centre of inversion. The title compound exhibits magnetic moment value (3.20 B.M which is in agreement with magnetic moment values observed for paramagnetic octahedral complexes of nickel(II. The title complex crystallizes in the orthorhombic space group Pbca with unit cell parameters a = 11.455(5, b = 9.602(4, and c = 26.374(1 Å. Crystal structure was solved by direct methods and refined by full matrix least-squares procedures to a final R value of 0.0499 for 2004 observed reflections. The amyl chain is disordered over two sets of sites, with occupancy ratios of 0.595 : 0.405. Infinite long chains of molecules are formed with the help of C–H⋯N hydrogen bond.

  7. Synthesis, characterization, single crystal X-ray determination, fluorescence and electrochemical studies of new dinuclear nickel(II) and oxovanadium(IV) complexes containing double Schiff base ligands.

    Science.gov (United States)

    Shafaatian, Bita; Ozbakzaei, Zahra; Notash, Behrouz; Rezvani, S Ahmad

    2015-04-05

    A series of new bimetallic complexes of nickel(II) and vanadium(IV) have been synthesized by the reaction of the new double bidentate Schiff base ligands with nickel acetate and vanadyl acetylacetonate in 1:1 M ratio. In nickel and also vanadyl complexes the ligands were coordinated to the metals via the imine N and enolic O atoms. The complexes have been found to possess 1:1 metals to ligands stoichiometry and the molar conductance data revealed that the metal complexes were non-electrolytes. The nickel and vanadyl complexes exhibited distorted square planar and square pyramidal coordination geometries, respectively. The emission spectra of the ligands and their complexes were studied in methanol. Electrochemical properties of the ligands and their metal complexes were also investigated in DMSO solvent at 150 mV s(-1) scan rate. The ligands and metal complexes showed both quasi-reversible and irreversible processes at this scan rate. The Schiff bases and their complexes have been characterized by FT-IR, 1H NMR, UV/Vis spectroscopies, elemental analysis and conductometry. The crystal structure of the nickel complex has been determined by single crystal X-ray diffraction. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Variable-metric diffraction crystals for x-ray optics

    International Nuclear Information System (INIS)

    Smither, R.K.; Fernandez, P.B.

    1992-01-01

    A variable-metric (VM) crystal is one in which the spacing between the crystalline planes changes with position in the crystal. This variation can be either parallel to the crystalline planes or perpendicular to the crystalline planes of interest and can be produced by either introducing a thermal gradient in the crystal or by growing a crystal made of two or more elements and changing the relative percentages of the two elements as the crystal is grown. A series of experiments were performed in the laboratory to demonstrate the principle of the variable-metric crystal and its potential use in synchrotron beam lines. One of the most useful applications of the VM crystal is to increase the number of photons per unit bandwidth in a diffracted beam without losing any of the overall intensity. In a normal synchrotron beam line that uses a two-crystal monochromator, the bandwidth of the diffracted photon beam is determined by the vertical opening angle of the beam which is typically 0.10--0.30 mrad or 20--60 arcsec. When the VM crystal approach is applied, the bandwidth of the beam can be made as narrow as the rocking curve of the diffracting crystal, which is typically 0.005--0.050 mrad or 1--10 arcsec. Thus a very large increase of photons per unit bandwidth (or per unit energy) can be achieved through the use of VM crystals. When the VM principle is used with bent crystals, new kinds of x-ray optical elements can be generated that can focus and defocus x-ray beams much like simple lenses where the focal length of the lens can be changed to match its application. Thus both large magnifications and large demagnifications can be achieved as well as parallel beams with narrow bandwidths

  9. Diamond drumhead crystals for X-ray optics applications

    Energy Technology Data Exchange (ETDEWEB)

    Kolodziej, Tomasz; Vodnala, Preeti; Terentyev, Sergey; Blank, Vladimir; Shvyd' ko, Yuri

    2016-07-14

    Thin (<50 µm) and flawless diamond single crystals are essential for the realization of numerous advanced X-ray optical devices at synchrotron radiation and free-electron laser facilities. The fabrication and handling of such ultra-thin components without introducing crystal damage and strain is a challenge. Drumhead crystals, monolithic crystal structures composed of a thin membrane furnished with a surrounding solid collar, are a solution ensuring mechanically stable strain-free mounting of the membranes with efficient thermal transport. Diamond, being one of the hardest and most chemically inert materials, poses significant difficulties in fabrication. Reported here is the successful manufacture of diamond drumhead crystals in the [100] orientation using picosecond laser milling. Subsequent high-temperature treatment appears to be crucial for the membranes to become defect free and unstrained, as revealed by X-ray topography on examples of drumhead crystals with a 26 µm thick (1 mm in diameter) and a 47 µm thick (1.5 × 2.5 mm) membrane.

  10. An efficient synthesis, X-ray and spectral characterization of ...

    Indian Academy of Sciences (India)

    -thiazolidin-2,4-dione derivatives containing biphenyl ring system derivatised with the tetrazole (9), 1,2,4-triazoles (16), and 1,3,4- oxadiazole 17, 18. The single crystal X-ray analysis of one of the compounds 9 is also described as part of the.

  11. An efficient synthesis, X-ray and spectral characterization of ...

    Indian Academy of Sciences (India)

    An efficient synthesis, X-ray and spectral characterization of biphenyl derivatives. Ravindra R Kamble Dharesh B Biradar Gangadhar Y Meti Tasneem Taj Tegginamath Gireesh Imthiyaz Ahmed M Khazi Sundar T Vaidyanathan Raju Mohandoss Balasubramanian Sridhar Viraraghav Parthasarathi. Volume 123 Issue 4 July ...

  12. Synthesis, quantum chemical computations and x-ray ...

    African Journals Online (AJOL)

    Benyza N

    2017-05-01

    May 1, 2017 ... Journal of Fundamental and Applied Sciences is licensed under a Creative Commons Attribution-NonCommercial 4.0. International License. Libraries Resource Directory. We are listed under Research Associations category. SYNTHESIS, QUANTUM CHEMICAL COMPUTATIONS AND X-RAY.

  13. X-ray Resonance in Crystal Cavities--Realization of Fabry-Perot Resonator for Hard X-rays

    OpenAIRE

    Chang, S. -L.; Stetsko, Yu. P.; Tang, M. -T.; Lee, Y. -R.; Sun, W. -H.; Yabashi, M.; Ishikawa, T.

    2004-01-01

    X-ray back diffraction from monolithic two silicon crystal plates of 25--150 um thick and a 40--150 um gap using synchrotron radiation of energy resolution deltaE=0.36 meV at 14.4388 keV shows clearly resonance fringes inside the energy gap and the total-reflection range for the (12 4 0) reflection. This cavity resonance results from the coherent interaction between the X-ray wavefields generated by the two plates with a gap smaller than the X-ray coherence length. This finding opens up new o...

  14. Synthesis, NMR characterization, X-ray crystal structure of Co(II) Ni(II) and Cu(II) complexes of a pyridine containing self-assembling

    International Nuclear Information System (INIS)

    Ranjbar, M.; Taghavipour, M.; Moghimi, A.; Aghabozorg, H.

    2002-01-01

    In the recent years, the self-assembling systems have been attracted chemists. The intermolecular bond in such systems mainly consists of ion pairing and hydrogen bonding [1,2]. The reaction between self-assembling system liquid LH 2 (py dc=2,6-pyridinedicarboxylic acid and py da=2,6- pyridine diamin) with cobalt (II) nitrate, nickel (II) chloride, and copper (II) acetate in water leads to the formation of self- assemble coordination complexes, [py da.H] 2 [M(py dc) 2 ]. H 2 O, M=Co(II),Ni(II), and Cu(II). The characterization was performed using elemental analysis, ESI mass spectroscopy, 1 H and 13 C NMR and X-ray crystallography. The crystal systems are monoclinic with space group P2 1 /n and four molecules per unit cell. These complexes shows 13 C NMR resonances of cationic counter ion [(py dc,H)] + in DMSO- d 6 but no signal corresponding to the two coordinated ligands [py dc] 2- The metal atoms are six-coordinated with a distorted octahedral geometry. The two [py de] 2- units are almost perpendicular to each other

  15. Synthesis, spectroscopic and single crystal X-ray studies on three new mononuclear Ni(II) pincer type complexes: DFT calculations and their antimicrobial activities

    Science.gov (United States)

    Layek, Samaresh; Agrahari, Bhumika; Tarafdar, Abhrajyoti; Kumari, Chanda; Anuradha; Ganguly, Rakesh; Pathak, Devendra D.

    2017-08-01

    Three new mononuclear square planar Ni(II) complexes, containing pincer type tridentate Schiff base ligands, having general formula [(NiL1(4-MePy)] (1), [(NiL1(2-AzNp)] (2), and [(NiL2(4-MePy)] (3) [where L1 = anion of N-(2-hydroxy-3-methoxybenzylidene) benzoylhydrazide (HL1), L2 = anion of N-(2-hydroxy-3-methoxybenzylidene) thiosemicarbazide (HL2), 4-MePy = 4-Methylpyridine and 2-AzNp = 2-Azanapthalene] have been synthesized and fully characterized by FT-IR, UV-visible, NMR, single crystal X-ray diffraction studies and elemental analysis. All the three complexes show square planar geometry around the nickel atom. The pincer type ligand occupies three coordination sites, while the fourth site is occupied by the monodentate nitrogen containing ligand. The Quantum chemical DFT calculations have also been carried out using DFT/B3LYP method and 6-311++G(d,p) basis set. The synthesized nickel complexes were screened for antimicrobial activities by agar well diffusion method against E. coli bacteria. Out of three complexes, [(NiL2(4-MePy)] (3) only showed the antimicrobial activity against E. coli bacteria.

  16. X-ray crystal structure and small-angle X-ray scattering of sheep liver sorbitol dehydrogenase

    DEFF Research Database (Denmark)

    Yennawar, Hemant; Møller, Magda; Gillilan, Richard

    2011-01-01

    The X-ray crystal structure of sheep liver sorbitol dehydrogenase (slSDH) has been determined using the crystal structure of human sorbitol dehydrogenase (hSDH) as a molecular-replacement model. slSDH crystallized in space group I222 with one monomer in the asymmetric unit. A conserved tetramer...... the substrate-binding pocket together with the acetate designed by nature to fit large polyol substrates. The substrate-binding pocket is seen to be in close proximity to the tetramer interface, which explains the need for the structural integrity of the tetramer for enzyme activity. Small-angle X-ray...

  17. X-ray diffraction studies of NbTe 2 single crystal

    Indian Academy of Sciences (India)

    The composition of the grown crystals was confirmed on the basis of energy dispersive analysis by X-ray (EDAX) and remaining structural characterization was also accomplished by X-ray diffraction (XRD) studies. Lattice parameters, volume and X-ray density have been carried out for the grown crystals. The particle size ...

  18. X-ray crystal spectroscopy of JET - a design study

    International Nuclear Information System (INIS)

    Bateman, J.E.; Hobby, M.G.; Peacock, N.J.

    1980-02-01

    This study describes the design and specification of a diagnostic system to measure the space- and time-resolved x-ray spectrum from JET discharges with high-resolution crystal spectrometers operating in the wavelength region 1 - 15A. The specification is given in terms of sensitivity, resolving power, detector, and data handling requirements, special attention being given to the problems encountered in interfacing the spectrometer arrays to the torus vacuum system and in their disposition to the machine. Shielding requirements during the active mode are evaluated and a staged diagnostic is proposed to accommodate D - T operation. (U.K.)

  19. Synthesis and X-Ray Crystal Structure of the First Pure and Air-Stable Salt of Peroxymonosulphuric Acid: (Ph4PHSO5

    Directory of Open Access Journals (Sweden)

    Marco Crisma

    2000-06-01

    Full Text Available In this paper we describe the synthesis of tetraphenylphosphonium peroxymonosulphate, its crystal structure and packing mode. The asymmetric unit accomodates two independent molecules of the monopersulphate anion, which are held together by hydrogen bonds. In the packing mode, rows of such dimers are surrounded by four rows of tetraphenyl cations. The consequence is that the highly water sensitive HSO5¯ anions are segregated inside hydrophobic channels composed by the lipophilic cations. This circumstance presumably accounts for the exceptional stability of the title compound.

  20. Structural Characterization of Doped GaSb Single Crystals by X-ray Topography

    Energy Technology Data Exchange (ETDEWEB)

    Honnicke, M.G.; Mazzaro, I.; Manica, J.; Benine, E.; M da Costa, E.; Dedavid, B. A.; Cusatis, C.; Huang, X. R.

    2009-09-13

    We characterized GaSb single crystals containing different dopants (Al, Cd and Te), grown by the Czochralski method, by x-ray topography and high angular resolution x-ray diffraction. Lang topography revealed dislocations parallel and perpendicular to the crystal's surface. Double-crystal GaSb 333 x-ray topography shows dislocations and vertical stripes than can be associated with circular growth bands. We compared our high-angular resolution x-ray diffraction measurements (rocking curves) with the findings predicted by the dynamical theory of x-ray diffraction. These measurements show that our GaSb single crystals have a relative variation in the lattice parameter ({Delta}d/d) on the order of 10{sup -5}. This means that they can be used as electronic devices (detectors, for example) and as x-ray monochromators.

  1. Synthesis, characterization, X-ray crystal structure, DFT calculation, DNA binding, and antimicrobial assays of two new mixed-ligand copper(II) complexes

    Science.gov (United States)

    Ebrahimipour, S. Yousef; Sheikhshoaie, Iran; Mohamadi, Maryam; Suarez, Sebastian; Baggio, Ricardo; Khaleghi, Moj; Torkzadeh-Mahani, Masoud; Mostafavi, Ali

    2015-05-01

    Two new Cu(II) complexes, [Cu(L)(phen)] (1), [Cu(L)(bipy)] (2), where L2- = (3-methoxy-2oxidobenzylidene)benzohydrazidato, phen = 1,10 phenanthroline, and bipy = 2,2‧ bipyridine, were prepared and fully characterized using elemental analyses, FT-IR, molar conductivity, and electronic spectra. The structures of both complexes were also determined by X-ray diffraction. It was found that, both complexes possessed square pyramidal coordination environment in which, Cu(II) ions were coordinated by donor atoms of HL and two nitrogens of heterocyclic bases. Computational studies were performed using DFT calculations at B3LYP/6-311+G(d,p) level of theory. DNA binding activities of these complexes were also investigated using electronic absorption, competitive fluorescence titration and cyclic voltammetry studies. The obtained results indicated that binding of the complexes to DNA was of intercalative mode. Furthermore, antimicrobial activities of these compounds were screened against microorganisms.

  2. Understanding Nickel Thin Film crystallization using X-Ray ...

    African Journals Online (AJOL)

    The microstructures of these Ni films were studied using X-ray diffractometry technique. The X-ray diffraction (XRD) patterns depicted 100% and 42% relative intensity (RI) peaks identified for normal and helical deposited Ni films but none for the zigzag deposited Ni film. Higher degree of crystallinity of Ni was demonstrated ...

  3. The X-ray crystal bichromator possible modifications and applications

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír

    2017-01-01

    Roč. 854, May (2017), s. 1-2 ISSN 0168-9002 Institutional support: RVO:68378271 Keywords : X-ray bichromator * X-ray optics * synchrotron radiation optics Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.362, year: 2016

  4. Synthesis and X-ray Crystal Structure of a Stable cis-1,2-bis(diphenylphosphinoethene Monodentate Thiolate Platinum Complex and TGA Studies of its Precursors

    Directory of Open Access Journals (Sweden)

    Vaz Rodrigo H.

    2002-01-01

    Full Text Available The stable Pt(II complex [Pt(SPh2(dppen (4, (dppen, Ph2PCH=CHPPh2 was obtained from [PtCl(SPh2(SnPh3cod] (1 (cod = 1,5-cyclooctadiene by reductive elimination reaction of SnClPh3 and substitution of the cod ligand by the diphosphine, albeit in low yields. Yields of 80% were obtained when [Pt(SPh2cod] (3 was used as the starting material instead. The viability of these reactions was suggested by a TG study, performed on the starting materials. Complex 4 was characterized by multinuclear NMR (195Pt, 31P, ¹H and 13C and IR spectroscopies and elemental analysis. The molecular structure, solved by an X-ray diffraction study, exhibted a slightly distorted square-planar geometry and short C=C and Pt-P bond distances which were interpreted in terms of a p interaction between the double bond and the metal-ligand bond, as observed for other diphosphine compounds described previously.

  5. X-ray dosimetry of TlGaSe2 single crystals

    International Nuclear Information System (INIS)

    Kerimova, E.M.; Mustafaeva, S.N.; Mamedbeili, S.D.; Jabarov, J.N.; Iskenderova, P.M.; Kazimov, S.B.

    2002-01-01

    TlGaSe 2 compound belongs to group of layered semiconductors of A 3 B 3 C 2 6 -type. Photoelectric and optical properties of TlGaSe 2 single crystals were investigated in detail. Influence of gamma-, electron and neutron radiation on photoelectric properties of TlGaSe 2 single crystals is investigated too. The present work deals with experimental results relative to X-ray dosimetric characteristics of TlGaSe 2 crystals at 300 K. X-ray conductivity and X-ray dosimetric characteristic measurements are carried out in low load resistance regime. The source of X-ray radiation is the installation of X-ray diffraction analysis (URS-55a) with the BCV-2(Cu). Intensity of X-ray radiation (E) is regulated by measurement with current variation in tube at each given value of X-ray radiation dose E (R/min) are measured by crystal dosimeter DRGZ-02. X-ray conductivity coefficients K σ characterising X-ray sensitivity of investigated crystals are determined as the relative change of conductivity under X-ray radiation a per dose. There have been determined values of characteristic coefficients of TlGaSe 2 single crystal X-ray conductivity at different values of accelerating voltage (V a ) on the tube and corresponding doses of X-ray radiation. Analysis of obtained data showed that X-ray conductivity coefficients K σ in studied crystals are regularly decreased (from 0.276 to 0.033) as with the rise of dose (E=0.75-78.0 R/min) as with the increase of values of V a on X-ray tube (V a =254-50 keV). One of the possible reasons of observed regularities is that X-ray conductivity in investigated crystals, especially at comparatively low V a is due predominantly to radiation of thin layer of crystal. In this case with the rise of radiation intensity there have been started to prevail the mechanism of surface quadratic recombination which leads to observed decrease of X-ray conductivity. With the rise of accelerating potential 'effective hardness' is increased, as a result of which there

  6. One pot synthesis, X-ray crystal structure of 2-(2‧-hydroxyphenyl)oxazolo[4,5-b]pyridine derivatives and studies of their optical properties

    Science.gov (United States)

    Briseño-Ortega, Horacio; Juárez-Guerra, Lizbeth; Rojas-Lima, Susana; Mendoza-Huizar, Luis Humberto; Vázquez-García, Rosa A.; Farfán, Norberto; Arcos-Ramos, Rafael; Santillan, Rosa; López-Ruiz, Heralio

    2018-04-01

    A series of five 2-(2-hydroxyphenyl)oxazolo [4,5-b]pyridines (HPOP) (3a-e), where four are novel, were synthesized by a mild, one pot, phenylboronic acid-NaCN catalyzed reaction. Spectroscopic characterization and photophysical properties of these compounds are reported. Absorption and excitation spectra of the compounds were dependent on the substituents in the phenyl ring. Fluorescence quantum yields (0.009-0.538) were associated with the donor strength and the position of the substituents. Also, DFT analysis allowed us to determine the contribution of diethylamino and methoxy moieties to the π-system, which is in agreement with the experimental data analyzed in solution and by cyclic voltammetry. The results obtained in the solid state by single-crystal X-ray diffraction experiments indicate that, the quasi-planarity envisioned for the explored compounds is present, supporting the hypothesis that both the H-bonding of a hydroxyl group to the Cdbnd N moiety and a donor groups such as diethylamino and methoxy moieties favor an electronic communication. Due to the facile synthesis and their photophysical properties, the novel HPOP 3a-e have potential application as organic semiconductors.

  7. Synthesis and X-ray crystal structure of cationic polynuclear hydroxide acetylacetonate lanthanide(III) clusters with homodinuclear or heterodinuclear decacarbonyl hydrides: [HMo2(CO)1]- and [HCrW(CO)1]-

    International Nuclear Information System (INIS)

    Volpe, M.; Bombieri, G.; Marchini, N.

    2006-01-01

    The synthesis and characterization of new polynuclear lanthanide(III) ionic clusters of general formula [Ln 9 (acac) 16 (OH) 1 ] + [Mo 2 (CO) 1 (μ-H)] - (Ln = Sm, Eu, Gd, Dy, Yb) and [Sm 9 (acac) 16 (OH) 1 ] + [CrW(CO) 1 (μ-H)] - is reported. The polynuclear complexes, prepared under pure nitrogen atmosphere by interaction of the hydridic metal carbonyls with the β-dichetonate Ln(acac) 3 .3H 2 O (Ln = Sm, Eu, Gd, Dy, Yb). The new clusters were characterized by elemental analysis, complexometric titration for Ln, atomic absorption for Cr, W and Mo, gas-volumetric analysis for CO, FTIR spectroscopy and single crystal X-ray structure determination of [Sm 9 (acac) 16 (OH) 1 ][Mo 2 (CO) 1 (μ-H)]. The Eu and Yb complexes are isostructural to the Sm one for which, similarly to their homonuclear chromium and tungsten derivative analogues, a square antiprismatic arrangement of eight Sm ions with the ninth at the center of the antiprism has been found

  8. Synthesis and X-ray crystal structure of a novel organometallic (µ(3)-oxido)(µ(3)-imido) trinuclear iridium complex

    DEFF Research Database (Denmark)

    Schau-Magnussen, Magnus; Malcho, Phillip; Herbst, Konrad

    2011-01-01

    Reaction of the organometallic aqua ion [Cp*Ir(H(2)O)(3)](2+) with tert-butyl(trimethylsilyl)amine in acetone yielded a novel trinuclear (µ(3)-oxido)(µ(3)-imido)pentamethylcyclopentadienyliridium(iii) complex, [(Cp*Ir)(3)(O)(N(t)Bu)](2+). Single crystal structure analyses show the complex can be ...

  9. Crystallization and preliminary X-ray diffraction study of phosphoribosyl pyrophosphate synthetase from E. Coli

    Energy Technology Data Exchange (ETDEWEB)

    Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Abramchik, Yu. A., E-mail: tostars@mail.ru; Zhukhlistova, N. E., E-mail: ugama@yandex.ru; Kuranova, I. P. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2015-09-15

    Enzymes of the phosphoribosyl pyrophosphate synthetase family (PRPPS, EC 2.7.6.1) catalyze the formation of 5-phosphoribosyl pyrophosphate (5-PRPP) from adenosine triphosphate and ribose 5-phosphate. 5-Phosphoribosyl pyrophosphate is an important intermediate in the synthesis of purine, pyrimidine, and pyridine nucleotides, as well as of the amino acids histidine and tryptophan. The crystallization conditions for E. coli PRPPS were found by the vapor-diffusion technique and were optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals grown by the counter-diffusion technique using a synchrotron radiation source to 3.1-Å resolution. The crystals of PRPPS belong to sp. gr. P6{sub 3}22 and have the following unit-cell parameters: a = b = 104.44 Å, c = 124.98 Å, α = β = 90°, γ = 120°. The collected X-ray diffraction data set is suitable for the solution of the three-dimensional structure of PRPPS at 3.1-Å resolution.

  10. Antiferroelectric surface layers in a liquid crystal as observed by synchrotron x-ray scattering

    DEFF Research Database (Denmark)

    Gramsbergen, E. F.; de Jeu, W. H.; Als-Nielsen, Jens Aage

    1986-01-01

    The X-ray reflectivity form the surface of a liquid crystal with terminally polar (cyano substituted) molecules has been studied using a high-resolution triple-axis X-ray spectrometer in combination with a synchrotron source. It is demonstrated that at the surface of the smectic Al phase a few...

  11. A high resolution X-ray crystal spectrometer to study electron and ...

    Indian Academy of Sciences (India)

    We have studied fast ion–atom and electron–atom collision processes using a reconditioned high resolution X-ray spectrometer. The X-rays, generated by the collisions, are dispersed by a curved ADP crystal (Johansson geometry) and detected by a gas proportional counter. A self-written LabVIEW based program has ...

  12. A conical-type X-ray guide tube for diffraction experiments with small crystals

    International Nuclear Information System (INIS)

    Nozaki, Hiroshi; Nakazawa, Hiromoto

    1986-01-01

    The divergence and intensity distribution of X-rays transported through a conical-type X-ray guide tube (XGT) were measured. Diverging X-rays from a point source were condensed by use of the conical-type XGT. The parallelism of X-rays through the XGT was better than that encountered for a cylindrical-type XGT proposed previously. The intensity of the X-ray beam around the central axis of the conical-type XGT was exceedingly high in comparison with that measured without the tube and almost uniform over a cross-sectional area 60 μm in diameter. The high intensity provides the possibility of performing diffraction experiments with crystals as small as 20 μm in diameter with a conventional X-ray diffraction system. (orig.)

  13. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    Energy Technology Data Exchange (ETDEWEB)

    Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation); Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S., E-mail: esipov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation)

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  14. Nuclear fusion induced by X-rays in a crystal

    OpenAIRE

    Belyaev, V. B.; Miller, M. B.; Otto, J.; Rakityansky, S. A.

    2016-01-01

    The nuclei that constitute a crystalline lattice, oscillate relative to each other with a very low energy that is not sufficient to penetrate through the Coulomb barriers separating them. An additional energy, which is needed to tunnel through the barrier and fuse, can be supplied by external electromagnetic waves (X-rays or the synchrotron radiation). Exposing to the X-rays the solid compound LiD (lithium-deuteride) for the duration of 111 hours, we have detected 88 events of the nuclear fus...

  15. Synthesis of a 2,2'-bipyridyl functionalized oligovinylene-phenylene using Heck and Horner-Wadsworth-Emmons reactions and X-ray crystal structure of E-(4-(4-bromostyryl)phenyl)(methyl)sulfane.

    Science.gov (United States)

    Karácsony, Orsolya; Deschamps, Jeffrey R; Trammell, Scott A; Nita, Rafaela; Knight, D Andrew

    2012-05-14

    The synthesis of a new 2,2'-bipyridyl functionalized oligovinylenephenylene (OVP-5) containing a methyl protected thiol using Heck coupling and the Horner-Wadsworth-Emmons reaction and is described. A key step involving a diisopropylcarbodiimide promoted dehydration of a stable β-hydroxyphosphonate intermediate was identified. The structure of precursor E-(4-(4-bromostyryl)phenyl)(methyl)sulfane was determined using X-ray crystallography.

  16. Synthesis of a 2,2'-Bipyridyl Functionalized Oligovinylene-Phenylene Using Heck and Horner-Wadsworth-Emmons Reactions and X-ray Crystal Structure of E-(4-(4-Bromostyrylphenyl(methylsulfane

    Directory of Open Access Journals (Sweden)

    Orsolya Karácsony

    2012-05-01

    Full Text Available The synthesis of a new 2,2'-bipyridyl functionalized oligovinylenephenylene (OVP-5 containing a methyl protected thiol using Heck coupling and the Horner-Wadsworth-Emmons reaction and is described. A key step involving a diisopropylcarbodiimide promoted dehydration of a stable b-hydroxyphosphonate intermediate was identified. The structure of precursor E-(4-(4-bromostyrylphenyl(methylsulfane (1 was determined using X-ray crystallography.

  17. Ruthenium(II) bipyridine complexes bearing quinoline-azoimine (NN'N″) tridentate ligands: synthesis, spectral characterization, electrochemical properties and single-crystal X-ray structure analysis.

    Science.gov (United States)

    Al-Noaimi, Mousa; Abdel-Rahman, Obadah S; Fasfous, Ismail I; El-khateeb, Mohammad; Awwadi, Firas F; Warad, Ismail

    2014-05-05

    Four octahedral ruthenium(II) azoimine-quinoline complexes having the general molecular formula [Ru(II)(L-Y)(bpy)Cl](PF6) {L-Y=YC6H4N=NC(COCH3)=NC9H6N, Y=H (1), CH3 (2), Br (3), NO2 (4) and bpy=2,2'-bipyrdine} were synthesized. The azoimine-quinoline based ligands behave as NN'N″ tridentate donors and coordinated to ruthenium via azo-N', imine-N' and quinolone-N″ nitrogen atoms. The composition of the complexes has been established by elemental analysis, spectral methods (FT-IR, electronic, (1)H NMR, UV/Vis and electrochemical (cyclic voltammetry) techniques. The crystal structure of complex 1 is reported. The Ru(II) oxidation state is greatly stabilized by the novel tridentate ligands, showing Ru(III/II) couples ranging from 0.93-1.27 V vs. Cp2Fe/Cp2Fe(+). The absorption spectrum of 1 in dichloromethane was modeled by time-dependent density functional theory (TD-DFT). Copyright © 2014 Elsevier B.V. All rights reserved.

  18. X-ray diffraction analysis of some single crystals with special properties

    Energy Technology Data Exchange (ETDEWEB)

    Antipin, M.Yu. [Russian Academy of Sciences, Moscow (Russian Federation). Inst. of Organoelement Compounds

    1996-12-31

    New possibilities of the X-ray diffraction method for studies of some single crystals with special physical properties are analyzed. It is demonstrated that wide range temperature diffraction data, special single crystals experiments under strong electric fields, and charge density analysis in crystals might enrich the knowledge on the nature of the crystal properties.

  19. Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

    International Nuclear Information System (INIS)

    Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi; Kita, Akiko; Fukami, Takaaki A.; Mio, Toshiyuki; Yamada-Okabe, Hisafumi; Yamada-Okabe, Toshiko; Miki, Kunio

    2006-01-01

    UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the product complex belong to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å

  20. Laboratory-based micro-X-ray fluorescence setup using a von Hamos crystal spectrometer and a focused beam X-ray tube

    International Nuclear Information System (INIS)

    Kayser, Y.; Błachucki, W.; Dousse, J.-Cl.; Hoszowska, J.; Neff, M.; Romano, V.

    2014-01-01

    The high-resolution von Hamos bent crystal spectrometer of the University of Fribourg was upgraded with a focused X-ray beam source with the aim of performing micro-sized X-ray fluorescence (XRF) measurements in the laboratory. The focused X-ray beam source integrates a collimating optics mounted on a low-power micro-spot X-ray tube and a focusing polycapillary half-lens placed in front of the sample. The performances of the setup were probed in terms of spatial and energy resolution. In particular, the fluorescence intensity and energy resolution of the von Hamos spectrometer equipped with the novel micro-focused X-ray source and a standard high-power water-cooled X-ray tube were compared. The XRF analysis capability of the new setup was assessed by measuring the dopant distribution within the core of Er-doped SiO 2 optical fibers

  1. Laboratory-based micro-X-ray fluorescence setup using a von Hamos crystal spectrometer and a focused beam X-ray tube.

    Science.gov (United States)

    Kayser, Y; Błachucki, W; Dousse, J-Cl; Hoszowska, J; Neff, M; Romano, V

    2014-04-01

    The high-resolution von Hamos bent crystal spectrometer of the University of Fribourg was upgraded with a focused X-ray beam source with the aim of performing micro-sized X-ray fluorescence (XRF) measurements in the laboratory. The focused X-ray beam source integrates a collimating optics mounted on a low-power micro-spot X-ray tube and a focusing polycapillary half-lens placed in front of the sample. The performances of the setup were probed in terms of spatial and energy resolution. In particular, the fluorescence intensity and energy resolution of the von Hamos spectrometer equipped with the novel micro-focused X-ray source and a standard high-power water-cooled X-ray tube were compared. The XRF analysis capability of the new setup was assessed by measuring the dopant distribution within the core of Er-doped SiO2 optical fibers.

  2. [μ-1,1'-Bis(diphenylphosphine)ferrocene]bis(chlorogold): Synthesis, iron-57 and gold-197 Moessbauer spectroscopy, x-ray crystal structure, and antitumor activity

    International Nuclear Information System (INIS)

    Hill, D.T.; Girard, G.R.; McCabe, F.L.; Johnson, R.K.; Eggleston, D.S.; Stupik, P.D.; Zhang, J.H.; Reiff, W.M.

    1989-01-01

    The title compound 2, Fdpp(AuCl) 2 , synthesized via the addition of Fdpp (1) to an aqueous solution of [(HOCH 2 CH 2 ) 2 S]AuCl generated in situ by the thiodiglycol reduction of HAuCl 4 showed a 31 P[ 1 H] NMR chemical shift at δ 27.39, which was downfield from that of 1 at δ -17.34 relative to (CH 3 O)PO. The 57 Fe Moessbauer spectrum of 2 is a doublet with parameters (IS = 0.50 mm/s relative to Fe, QS = 2.33 mm/s) similar to those of ferrocene. The 197 Au Moessbauer spectrum of 2 is an asymmetric doublet (QS = 6.93 mm/s) with an IS of 3.81 mm/s relative to Au metal. Fdpp(AuCl) 2 crystallized in space group P bar 1 with lattice constants a = 16.192 (4) angstrom, b = 16.921 (4) angstrom, and c = 10.878 (5) angstrom with Z = 3. Two crystallographically independent molecules, A and B, were observed in the structure of 2 with a chloroform solvate molecule per 1.5 formula units of the gold complex. For A, the P atoms are 180 degree opposed and the rings exactly staggered, while in B the P atoms are 150 degree apart and the rings are partially staggered. The P-Au-Cl linkage is nearly linear, and the bond distances fall within normal ranges. Evaluation in an ip P388 leukemia mouse model showed 1 and 2 to have only marginal activity with an increased life span (ILS) relative to untreated controls of 30% at a maximally tolerated dose (MTD) of 231 μmol/kg and 40% ILS at 4 μmol/kg, respectively. 27 refs., 4 figs., 3 tabs

  3. Application of spherically bent crystals spectrometer to X-ray diagnosis

    International Nuclear Information System (INIS)

    Liu Lifeng; Xiao Shali; Wang Hongjian; Shi Jun; Qian Jiayu; Liu Shenye; Wei Minxi; Chen Bolun

    2010-01-01

    In order to diagnose X-ray emitted from the plasma, a spherically bent crystals spectrometer was developed based on the X-ray Bragg diffraction theory. In the experiment, the dispersive element of crystal analyzer was quartz, the bent radius was 250 mm and the range of Bragg angle of the crystal was 30 degree to 67.5 degree. The X-ray film, as its principal detector, obtained spectra information which had an effective area of 10 mm x 50 mm. The experiment was carried out at the anode accelerator. The detector obtained the X-ray spectra information of the K-shell Ti spectra. By the analysis of spectra information, the spectral resolution of spherically bent quartz crystals can be achieved for more than 1000, and the spectral passband is 0.43 eV. (authors)

  4. Instrumentations in x-ray plasma polarization spectroscopy. Crystal spectrometer, polarimeter and detectors for astronomical observations

    Energy Technology Data Exchange (ETDEWEB)

    Baronova, Elena O.; Stepanenko, Mikhail M. [RRC Kurchatov Institute, Nuclear Fusion Institute, Moscow (Russian Federation); Jakubowski, Lech [Soltan Institute for Nuclear Studies, Swierk-Otwock (Poland); Tsunemi, Hiroshi [Osaka Univ., Graduate School of Science, Osaka (Japan)

    2002-08-01

    This report discusses the various problems which are encountered when a crystal spectrometer is used for the purpose of observing polarized x-ray lines. A polarimeter is proposed based on the novel idea of using two series of equivalent atomic planes in a single crystal. The present status of the astronomical x-ray detection techniques are described with emphasis on two dimensional detectors which are polarization sensitive. (author)

  5. Crystal distortion of monoclinic hen egg-white lysozyme crystals using X-ray digital topography

    Science.gov (United States)

    Wako, Kei; Fujii, Daiki; Tsukashima, Shiro; Kishi, Takeharu; Tachibana, Masaru; Kojima, Kenichi

    2014-09-01

    The crystal distortion of monoclinic hen egg-white lysozyme (HEWL) crystals was observed by the X-ray digital topography. The local rocking curves were obtained by the series of the topographic images. The single, double, triple, and multiple peaks of the local rocking curves were observed. The mapping of the full width of the one tenth maximum (FW10M) of the local rocking curves was obtained. It was found that the magnitude of FW10M depended on the distance of the peak splitting. The distribution of the distortion in the monoclinic HEWL crystals was investigated by the analysis of the local rocking curves.

  6. Preliminary results of absolute wavelength calibration of imaging X-ray crystal spectrometer on EAST

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Xiayun [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); University of Science and Technology of China, Hefei 230026 (China); Wang, Fudi [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Chen, Jun [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); University of Science and Technology of China, Hefei 230026 (China); Lyu, Bo, E-mail: blu@ipp.ac.cn [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Li, Yingying; Fu, Jia; Xu, Liqing [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Shi, Yuejiang [University of Science and Technology of China, Hefei 230026 (China); Department of Nuclear Engineering, Seoul National University, Seoul 151-742 (Korea, Republic of); Ye, Minyou [University of Science and Technology of China, Hefei 230026 (China); Wan, Baonian [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China)

    2015-10-15

    Highlights: • The absolute wavelength calibration method for X-ray crystal spectrometer using X-ray fluorescence of the appropriate materials was first tested on EAST, and the preliminary experimental results were obtained. • The experimental results were thoroughly discussed and suggestion for further improvements of the experimental arrangement was proposed. • Rotation calibration of X-ray crystal spectrometer on EAST using MHD frequency was presented when the absolute wavelength calibration method is unavailable currently. - Abstract: Imaging X-ray crystal spectrometers (XCS) are currently operating on several major tokamaks to provide profiles of ion temperature and rotation velocity. In order to acquire absolute rotation velocity, several indirect methods were pursued previously, however the direct and effective method is to use known X-ray lines for wavelength calibration. One way to produce standard spectral lines is X-ray fluorescence, which could be excited by X-rays from tokamak plasmas. As part of the upgrade of XCS system on EAST, wavelength calibration was studied using cadmium's L-shell lines, namely Lα{sub 1} line (3.9564 Å) and Lα{sub 2} line (3.9650 Å) as the reference wavelength. The Geant 4 code was used to optimize foil thickness to achieve a reasonable X-ray fluorescence intensity. The Cd foil was placed between the beryllium window and crystal and could be retracted to provide in situ wavelength calibration. The detailed arrangement and preliminary wavelength calibration results of imaging X-ray crystal spectrometer on EAST are presented, plus the calibration using MHD frequency.

  7. Nuclear fusion induced by x rays in a crystal

    Science.gov (United States)

    Belyaev, V. B.; Miller, M. B.; Otto, J.; Rakityansky, S. A.

    2016-03-01

    The nuclei that constitute a crystalline lattice oscillate relative to each other with a very low energy that is not sufficient to penetrate through the Coulomb barriers separating them. An additional energy, which is needed to tunnel through the barrier and fuse, can be supplied by external electromagnetic waves (x rays or synchrotron radiation). Exposing the solid compound LiD (lithium deuteride) to x rays for the duration of 111 h, we detect 88 events of nuclear fusion d +6Li→8Be* . Our theoretical estimate agrees with what we observed. One possible application of the phenomenon we found is in measurements of the rates of various nuclear reactions (not necessarily fusion) at extremely low energies inaccessible in accelerator experiments.

  8. Modification of the x-ray diffraction efficiency of lithium fluoride crystals by surface treatment

    International Nuclear Information System (INIS)

    Sellick, B.O.

    1976-01-01

    Convex-curved crystals of lithium fluoride demonstrate good dispersion and efficiency when used in reflection for x-ray spectral analysis. The crystals are stable and reasonably unaffected by harsh environments. In addition, they are mechanically strong, easily cleavable or machinable, and plastically deformable with heat. In the present study, flat crystal wafers were left either clear as cleaved or were subjected to surface treatment by sandblasting or lapping. Some wafers were then bent in a press mold to obtain convex-curved crystals of differing radii. The diffraction efficiency data presented show how surface treatment affects the efficiency of these various crystals when used as x-ray diffracting agents

  9. In situ X-ray powder diffraction, synthesis, and magnetic properties of InVO3

    International Nuclear Information System (INIS)

    Lundgren, Rylan J.; Cranswick, Lachlan M.D.; Bieringer, Mario

    2006-01-01

    We report the first synthesis and high-temperature in situ X-ray diffraction study of InVO 3 . Polycrystalline InVO 3 has been prepared via reduction of InVO 4 using a carbon monoxide/carbon dioxide buffer gas. InVO 3 crystallizes in the bixbyite structure in space group Ia-3 (206) with a=9.80636(31) A with In 3+ /V 3+ disorder on the (8b) and (24d) cation sites. In situ powder X-ray diffraction experiments and thermal gravimetric analysis in a CO/CO 2 buffer gas revealed the existence of the metastable phase InVO 3 . Bulk samples with 98.5(2)% purity were prepared using low-temperature reduction methods. The preparative methods limited the crystallinity of this new phase to approximately 225(50) A. Magnetic susceptibility and neutron diffraction experiments suggest a spin-glass ground state for InVO 3 . - Graphical abstract: In situ powder X-ray diffractograms for the reduction of InVO 4 in CO/CO 2 . The three temperature regions show the conversion of InVO 4 to InVO 3 and final decomposition into In 2 O 3 and V 2 O 3

  10. Characterization of single-crystal sapphire substrates by X-ray methods and atomic force microscopy

    International Nuclear Information System (INIS)

    Prokhorov, I. A.; Zakharov, B. G.; Asadchikov, V. E.; Butashin, A. V.; Roshchin, B. S.; Tolstikhina, A. L.; Zanaveskin, M. L.; Grishchenko, Yu. V.; Muslimov, A. E.; Yakimchuk, I. V.; Volkov, Yu. O.; Kanevskii, V. M.; Tikhonov, E. O.

    2011-01-01

    The possibility of characterizing a number of practically important parameters of sapphire substrates by X-ray methods is substantiated. These parameters include wafer bending, traces of an incompletely removed damaged layer that formed as a result of mechanical treatment (scratches and marks), surface roughness, damaged layer thickness, and the specific features of the substrate real structure. The features of the real structure of single-crystal sapphire substrates were investigated by nondestructive methods of double-crystal X-ray diffraction and plane-wave X-ray topography. The surface relief of the substrates was investigated by atomic force microscopy and X-ray scattering. The use of supplementing analytical methods yields the most complete information about the structural inhomogeneities and state of crystal surface, which is extremely important for optimizing the technology of substrate preparation for epitaxy.

  11. Crystallization and preliminary X-ray analysis of immunophilin-like FKBP42 from Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Eckhoff, Andreas; Granzin, Joachim [Institut für Biologische Informationsverarbeitung (IBI-2, Biologische Strukturforschung), Forschungszentrum Jülich GmbH, D-52425 Jülich (Germany); Kamphausen, Thilo [Max-Planck-Forschungsstelle für Enzymologie der Proteinfaltung, D-06120 Halle (Germany); Büldt, Georg [Institut für Biologische Informationsverarbeitung (IBI-2, Biologische Strukturforschung), Forschungszentrum Jülich GmbH, D-52425 Jülich (Germany); Schulz, Burkhard [Universität Tübingen, ZMBP, D-72076 Tübingen (Germany); Purdue University, Department of Horticulture and Landscape Architecture, West Lafayette, IN 47907 (United States); Weiergräber, Oliver H., E-mail: o.h.weiergraeber@fz-juelich.de [Institut für Biologische Informationsverarbeitung (IBI-2, Biologische Strukturforschung), Forschungszentrum Jülich GmbH, D-52425 Jülich (Germany)

    2005-04-01

    The crystallization of FKBP42, a multi-domain member of the FK506-binding protein family, from the plant A. thaliana is reported. Two fragments of FKBP42 from Arabidopsis thaliana covering differing lengths of the molecule have been expressed, purified and crystallized. For each construct, crystals belonging to two different space groups were obtained and subjected to preliminary X-ray analysis.

  12. Crystallization and preliminary X-ray analysis of immunophilin-like FKBP42 from Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Eckhoff, Andreas; Granzin, Joachim; Kamphausen, Thilo; Büldt, Georg; Schulz, Burkhard; Weiergräber, Oliver H.

    2005-01-01

    The crystallization of FKBP42, a multi-domain member of the FK506-binding protein family, from the plant A. thaliana is reported. Two fragments of FKBP42 from Arabidopsis thaliana covering differing lengths of the molecule have been expressed, purified and crystallized. For each construct, crystals belonging to two different space groups were obtained and subjected to preliminary X-ray analysis

  13. A community resource of experimental data for NMR / X-ray crystal structure pairs.

    Science.gov (United States)

    Everett, John K; Tejero, Roberto; Murthy, Sarath B K; Acton, Thomas B; Aramini, James M; Baran, Michael C; Benach, Jordi; Cort, John R; Eletsky, Alexander; Forouhar, Farhad; Guan, Rongjin; Kuzin, Alexandre P; Lee, Hsiau-Wei; Liu, Gaohua; Mani, Rajeswari; Mao, Binchen; Mills, Jeffrey L; Montelione, Alexander F; Pederson, Kari; Powers, Robert; Ramelot, Theresa; Rossi, Paolo; Seetharaman, Jayaraman; Snyder, David; Swapna, G V T; Vorobiev, Sergey M; Wu, Yibing; Xiao, Rong; Yang, Yunhuang; Arrowsmith, Cheryl H; Hunt, John F; Kennedy, Michael A; Prestegard, James H; Szyperski, Thomas; Tong, Liang; Montelione, Gaetano T

    2016-01-01

    We have developed an online NMR / X-ray Structure Pair Data Repository. The NIGMS Protein Structure Initiative (PSI) has provided many valuable reagents, 3D structures, and technologies for structural biology. The Northeast Structural Genomics Consortium was one of several PSI centers. NESG used both X-ray crystallography and NMR spectroscopy for protein structure determination. A key goal of the PSI was to provide experimental structures for at least one representative of each of hundreds of targeted protein domain families. In some cases, structures for identical (or nearly identical) constructs were determined by both NMR and X-ray crystallography. NMR spectroscopy and X-ray diffraction data for 41 of these "NMR / X-ray" structure pairs determined using conventional triple-resonance NMR methods with extensive sidechain resonance assignments have been organized in an online NMR / X-ray Structure Pair Data Repository. In addition, several NMR data sets for perdeuterated, methyl-protonated protein samples are included in this repository. As an example of the utility of this repository, these data were used to revisit questions about the precision and accuracy of protein NMR structures first outlined by Levy and coworkers several years ago (Andrec et al., Proteins 2007;69:449-465). These results demonstrate that the agreement between NMR and X-ray crystal structures is improved using modern methods of protein NMR spectroscopy. The NMR / X-ray Structure Pair Data Repository will provide a valuable resource for new computational NMR methods development. © 2015 The Protein Society.

  14. Study of lead iodide crystals for X-Ray detection

    Czech Academy of Sciences Publication Activity Database

    Matuchová, Marie; Žďánský, Karel; Zavadil, Jiří

    2006-01-01

    Roč. 100, č. 8 (2006), s. 635 ISSN 0009-2770. [Sjezd chemických společností /58./. Ústí nad Labem, 04.09.2006-08.09.2006] R&D Projects: GA ČR(CZ) GA102/04/0959; GA ČR(CZ) GA102/03/0379 Institutional research plan: CEZ:AV0Z20670512 Keywords : zone melting * X-Ray diffraction * semiconductor technology Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.431, year: 2006

  15. X-ray microscopy of plant cells by using LiF crystal as a detector.

    Science.gov (United States)

    Reale, Lucia; Bonfigli, Francesca; Lai, Antonia; Flora, Francesco; Poma, Anna; Albertano, Patrizia; Bellezza, Simona; Montereali, Rosa Maria; Faenov, Anatoly; Pikuz, Tania; Almaviva, Salvatore; Vincenti, Maria Aurora; Francucci, Massimo; Gaudio, Pasqualino; Martellucci, Sergio; Richetta, Maria

    2008-12-01

    A lithium fluoride (LiF) crystal has been utilized as a new soft X-ray detector to image different biological samples at a high spatial resolution. This new type of image detector for X-ray microscopy has many interesting properties: high resolution (nanometer scale), permanent storage of images, the ability to clear the image and reuse the LiF crystal, and high contrast with greater dynamic range. Cells of the unicellular green algae Chlamydomonas dysosmos and Chlorella sorokiniana, and pollen grains of Olea europea have been used as biological materials for imaging. The biological samples were imaged on LiF crystals by using the soft X-ray contact microscopy and contact micro-radiography techniques. The laser plasma soft X-ray source was generated using a Nd:YAG/Glass laser focused on a solid target. The X-ray energy range for image acquisition was in the water-window spectral range for single shot contact microscopy of very thin biological samples (single cells) and around 1 keV for multishots microradiography. The main aim of this article is to highlight the possibility of using a LiF crystal as a detector for the biological imaging using soft X-ray radiation and to demonstrate its ability to visualize the microstructure within living cells. 2008 Wiley-Liss, Inc.

  16. Visualization of X-ray Beam Using CdWO4 Crystal for Macromolecular Crystallography

    Directory of Open Access Journals (Sweden)

    Kazimierz J. Gofron

    2011-12-01

    Full Text Available In synchrotron diffraction experiments, it is typically assumed that the X-ray beam at the sample position is uniform, stable and has dimensions that are controlled by the focus and slits settings. As might be expected, this process is much more complex. We present here an investigation of the properties of a synchrotron X-ray beam at the sample position. The X-ray beam is visualized with a single crystal scintillator that converts X-ray photons into visible light photons, which can be imaged using Structure Biology Center (SBC on-axis and off-axis microscope optics. The X-ray penetration is dependent on the composition of the scintillator (especially the effective Z, and X-ray energy. Several scintillators have been used to visualize X-ray beams. Here we compare CdWO4, PbWO4, Bi4Ge3O12, Y3Al5O12:Ce (YAG:Ce, and Gd2O2S:Tb (phosphor. We determined that scintillator crystals made of CdWO4 and similar high-Z materials are best suited for the energy range (7–20 keV and are most suitable for beam visualization for macromolecular crystallography applications. These scintillators show excellent absorption, optical, and mechanical properties.

  17. Cylindrical Crystal Imaging Spectrometer (CCIS) for cosmic X-ray spectroscopy

    Science.gov (United States)

    Schnopper, H. W.; Taylor, P. O.

    1981-01-01

    A "stigmatic" focusing, Bragg crystal spectrometer was developed and used for high spectral resolution X-ray emission line diagnostics on hot laboratory plasmas. The concept be applied at the focal plane of an orbiting X-ray telescope where it offers several advantages over conventional spectrometers, i.e., mechanical simplicity, high resolving power and sensitivity, simultaneous measurement of an extended segment of spectrum, and good imaging properties. The instrument features a simple, unambiguous, non-scanning spectrum readout that is not adversely affected by either spacecraft pointing error or source extent. The performance of the instrument is estimated in the context of the Advanced X-Ray Astrophysical Facility mission.

  18. Radiation-shielded double crystal X-ray monochromator for JET

    International Nuclear Information System (INIS)

    Barnsley, R.; Morsi, H.W.; Rupprecht, G.; Kaellne, E.

    1989-01-01

    A double crystal X-ray monochromator for absolute wavelength and intensity measurements with very effective shielding of its detector against neutrons and hard X-rays was brought into operation at JET. Fast wavelength scans were taken of impurity line radiation in the wavelength region from about 0.1 nm to 2.3 nm, and monochromatic as well as spectral line scans, for different operational modes of JET. (author) 5 refs., 4 figs

  19. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation

    Czech Academy of Sciences Publication Activity Database

    Hrdý, Jaromír; Mikulík, P.; Oberta, Peter

    2011-01-01

    Roč. 18, č. 2 (2011), s. 299-301 ISSN 0909-0495 R&D Projects: GA MPO FR-TI1/412 Institutional research plan: CEZ:AV0Z10100522 Keywords : diffractive-refractive optics * x-ray synchrotron radiation monochromator * x-ray crystal monochromator * harmonics separation Subject RIV: BH - Optics, Masers, Lasers Impact factor: 2.726, year: 2011

  20. Expression, purification, crystallization and X-ray analysis of 3-quinuclidinone reductase from Agrobacterium tumefaciens

    International Nuclear Information System (INIS)

    Hou, Feng; Miyakawa, Takuya; Takeshita, Daijiro; Kataoka, Michihiko; Uzura, Atsuko; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru

    2012-01-01

    The purification and crystallization of 3-quinuclidinone reductase from A. tumefaciens allowed the collection of a diffraction data set to 1.72 Å resolution. (R)-3-Quinuclidinol is a useful chiral building block for the synthesis of various pharmaceuticals and can be produced from 3-quinuclidinone by asymmetric reduction. A novel 3-quinuclidinone reductase from Agrobacterium tumefaciens (AtQR) catalyzes the stereospecific reduction of 3-quinuclidinone to (R)-3-quinuclidinol with NADH as a cofactor. Recombinant AtQR was overexpressed in Escherichia coli, purified and crystallized with NADH using the sitting-drop vapour-diffusion method at 293 K. Crystals were obtained using a reservoir solution containing PEG 3350 as a precipitant. X-ray diffraction data were collected to 1.72 Å resolution on beamline BL-5A at the Photon Factory. The crystal belonged to space group P2 1 , with unit-cell parameters a = 62.0, b = 126.4, c = 62.0 Å, β = 110.5°, and was suggested to contain four molecules in the asymmetric unit (V M = 2.08 Å 3 Da −1 )

  1. Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

    Energy Technology Data Exchange (ETDEWEB)

    Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br [Laboratório de Cristalografia de Proteínas, Departamento de Física e Química, Faculdade de Ciências Farmacêuticas de Ribeirão Preto-USP, Ribeirão Preto, SP 14040-903 (Brazil)

    2006-10-01

    Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, c = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.

  2. A new type of crystal spectrometer for cosmic X-ray studies

    International Nuclear Information System (INIS)

    Berthelsdorf, R.F.; Mitchell, R.J.; Culhane, J.L.

    1976-01-01

    A crystal spectrometer using a crystal panel curved in two dimensions and a position sensitive proportional counter is described. The instrument uses conical focussing to minimize detector size, and the crystal panel is bent to simultaneously present a range of Bragg angles to incoming X-rays, resulting in a one-to-one correspondence between the energy of a reflected X-ray and its point of incidence on the proportional counter. The advantages of such an instrument are high sensitivity, mechanical simplicity, and the capability of measuring spectra of rapidly varying sources. (Auth.)

  3. Crystallization and preliminary X-ray diffraction study of porcine carboxypeptidase B

    Energy Technology Data Exchange (ETDEWEB)

    Akparov, V. Kh., E-mail: valery@akparov.ru [Scientific Center of Russian Federation Research Institute for Genetics and Selection of Industrial Microorganisms (Russian Federation); Timofeev, V. I., E-mail: inna@ns.crys.ras.ru; Kuranova, I. P., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2015-05-15

    Crystals of porcine pancreatic carboxypeptidase B have been grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction study showed that the crystals belong to sp. gr. P4{sub 1}2{sub 1}2 and have the following unit-cell parameters: a = b = 79.58 Å, c = 100.51 Å; α = β = γ = 90.00°. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one of the grown crystals at the SPring 8 synchrotron facility to 0.98 Å resolution.

  4. Visualization of membrane protein crystals in lipid cubic phase using X-ray imaging

    International Nuclear Information System (INIS)

    Warren, Anna J.; Armour, Wes; Axford, Danny; Basham, Mark; Connolley, Thomas; Hall, David R.; Horrell, Sam; McAuley, Katherine E.; Mykhaylyk, Vitaliy; Wagner, Armin; Evans, Gwyndaf

    2013-01-01

    A comparison of X-ray diffraction and radiographic techniques for the location and characterization of protein crystals is demonstrated on membrane protein crystals mounted within lipid cubic phase material. The focus in macromolecular crystallography is moving towards even more challenging target proteins that often crystallize on much smaller scales and are frequently mounted in opaque or highly refractive materials. It is therefore essential that X-ray beamline technology develops in parallel to accommodate such difficult samples. In this paper, the use of X-ray microradiography and microtomography is reported as a tool for crystal visualization, location and characterization on the macromolecular crystallography beamlines at the Diamond Light Source. The technique is particularly useful for microcrystals and for crystals mounted in opaque materials such as lipid cubic phase. X-ray diffraction raster scanning can be used in combination with radiography to allow informed decision-making at the beamline prior to diffraction data collection. It is demonstrated that the X-ray dose required for a full tomography measurement is similar to that for a diffraction grid-scan, but for sample location and shape estimation alone just a few radiographic projections may be required

  5. Visualization of membrane protein crystals in lipid cubic phase using X-ray imaging

    Energy Technology Data Exchange (ETDEWEB)

    Warren, Anna J. [Diamond Light Source, Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom); Armour, Wes [Diamond Light Source, Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom); Oxford e-Research Centre, 7 Keble Road, Oxford OX1 3QG (United Kingdom); Axford, Danny; Basham, Mark; Connolley, Thomas; Hall, David R. [Diamond Light Source, Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom); Horrell, Sam [Diamond Light Source, Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom); University of Liverpool, Liverpool L69 3BX (United Kingdom); McAuley, Katherine E.; Mykhaylyk, Vitaliy; Wagner, Armin; Evans, Gwyndaf, E-mail: gwyndaf.evans@diamond.ac.uk [Diamond Light Source, Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom)

    2013-07-01

    A comparison of X-ray diffraction and radiographic techniques for the location and characterization of protein crystals is demonstrated on membrane protein crystals mounted within lipid cubic phase material. The focus in macromolecular crystallography is moving towards even more challenging target proteins that often crystallize on much smaller scales and are frequently mounted in opaque or highly refractive materials. It is therefore essential that X-ray beamline technology develops in parallel to accommodate such difficult samples. In this paper, the use of X-ray microradiography and microtomography is reported as a tool for crystal visualization, location and characterization on the macromolecular crystallography beamlines at the Diamond Light Source. The technique is particularly useful for microcrystals and for crystals mounted in opaque materials such as lipid cubic phase. X-ray diffraction raster scanning can be used in combination with radiography to allow informed decision-making at the beamline prior to diffraction data collection. It is demonstrated that the X-ray dose required for a full tomography measurement is similar to that for a diffraction grid-scan, but for sample location and shape estimation alone just a few radiographic projections may be required.

  6. New structural studies of liquid crystal by reflectivity and resonant X-ray diffraction

    International Nuclear Information System (INIS)

    Fernandes, P.

    2007-04-01

    This memory presents three structural studies of smectic Liquid Crystals by reflectivity and resonant diffraction of X-rays. It is divided in five chapters. In the first a short introduction to Liquid Crystals is given. In particular, the smectic phases that are the object of this study are presented. The second chapter is consecrated to the X-ray experimental techniques that were used in this work. The three last chapters present the works on which this thesis can be divided. Chapter three demonstrates on free-standing films of MHPOBC (historic liquid crystal that possesses the antiferroelectric sub-phases) the possibility to extend the technique of resonant X-ray diffraction to liquid crystals without resonant element. In the fourth chapter the structure of the B 2 liquid crystal phase of bent-core molecules (or banana molecules) is elucidated by using resonant X-ray diffraction combined with polarization analysis of the diffracted beam. A model of the polarization of the resonant beam diffracted by four different structures proposed for the B 2 phase is developed in this chapter. In the fifth chapter a smectic binary mixture presenting a very original critical point of phase separation is studied by X-ray reflectivity and optical microscopy. A concentration gradient in the direction perpendicular to the plane of the film seems to be induced by the free-standing film geometry. The results of a simplified model of the system are compatible with this interpretation

  7. Protein crystal structure from non-oriented, single-axis sparse X-ray data

    Directory of Open Access Journals (Sweden)

    Jennifer L. Wierman

    2016-01-01

    Full Text Available X-ray free-electron lasers (XFELs have inspired the development of serial femtosecond crystallography (SFX as a method to solve the structure of proteins. SFX datasets are collected from a sequence of protein microcrystals injected across ultrashort X-ray pulses. The idea behind SFX is that diffraction from the intense, ultrashort X-ray pulses leaves the crystal before the crystal is obliterated by the effects of the X-ray pulse. The success of SFX at XFELs has catalyzed interest in analogous experiments at synchrotron-radiation (SR sources, where data are collected from many small crystals and the ultrashort pulses are replaced by exposure times that are kept short enough to avoid significant crystal damage. The diffraction signal from each short exposure is so `sparse' in recorded photons that the process of recording the crystal intensity is itself a reconstruction problem. Using the EMC algorithm, a successful reconstruction is demonstrated here in a sparsity regime where there are no Bragg peaks that conventionally would serve to determine the orientation of the crystal in each exposure. In this proof-of-principle experiment, a hen egg-white lysozyme (HEWL crystal rotating about a single axis was illuminated by an X-ray beam from an X-ray generator to simulate the diffraction patterns of microcrystals from synchrotron radiation. Millions of these sparse frames, typically containing only ∼200 photons per frame, were recorded using a fast-framing detector. It is shown that reconstruction of three-dimensional diffraction intensity is possible using the EMC algorithm, even with these extremely sparse frames and without knowledge of the rotation angle. Further, the reconstructed intensity can be phased and refined to solve the protein structure using traditional crystallographic software. This suggests that synchrotron-based serial crystallography of micrometre-sized crystals can be practical with the aid of the EMC algorithm even in cases

  8. Expression, purification, crystallization and preliminary X-ray analysis of Aeromonas hydrophilia metallo-β-lactamase

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Nandini, E-mail: nandini-sharma@merck.com; Toney, Jeffrey H.; Fitzgerald, Paula M. D.

    2005-02-01

    Crystallization and preliminary X-ray analysis of the CphA metallo-β-lactamase from A. hydrophilia are described. The crystals belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 40.75, b = 42.05, c = 128.88 Å, and diffract to 1.8 Å.

  9. Simultaneous X-ray diffraction from multiple single crystals of macromolecules

    DEFF Research Database (Denmark)

    Paithankar, Karthik S.; Sørensen, Henning Osholm; Wright, Jonathan P.

    2011-01-01

    The potential in macromolecular crystallography for using multiple crystals to collect X-ray diffraction data simultaneously from assemblies of up to seven crystals is explored. The basic features of the algorithms used to extract data and their practical implementation are described. The procedure...

  10. Cyclic olefin homopolymer-based microfluidics for protein crystallization and in situ X-ray diffraction

    International Nuclear Information System (INIS)

    Emamzadah, Soheila; Petty, Tom J.; De Almeida, Victor; Nishimura, Taisuke; Joly, Jacques; Ferrer, Jean-Luc; Halazonetis, Thanos D.

    2009-01-01

    A cyclic olefin homopolymer-based microfluidics system has been established for protein crystallization and in situ X-ray diffraction. Microfluidics is a promising technology for the rapid identification of protein crystallization conditions. However, most of the existing systems utilize silicone elastomers as the chip material which, despite its many benefits, is highly permeable to water vapour. This limits the time available for protein crystallization to less than a week. Here, the use of a cyclic olefin homopolymer-based microfluidics system for protein crystallization and in situ X-ray diffraction is described. Liquid handling in this system is performed in 2 mm thin transparent cards which contain 500 chambers, each with a volume of 320 nl. Microbatch, vapour-diffusion and free-interface diffusion protocols for protein crystallization were implemented and crystals were obtained of a number of proteins, including chicken lysozyme, bovine trypsin, a human p53 protein containing both the DNA-binding and oligomerization domains bound to DNA and a functionally important domain of Arabidopsis Morpheus’ molecule 1 (MOM1). The latter two polypeptides have not been crystallized previously. For X-ray diffraction analysis, either the cards were opened to allow mounting of the crystals on loops or the crystals were exposed to X-rays in situ. For lysozyme, an entire X-ray diffraction data set at 1.5 Å resolution was collected without removing the crystal from the card. Thus, cyclic olefin homopolymer-based microfluidics systems have the potential to further automate protein crystallization and structural genomics efforts

  11. Cyclic olefin homopolymer-based microfluidics for protein crystallization and in situ X-ray diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Emamzadah, Soheila [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland); Petty, Tom J. [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Biomedical Graduate Studies Genomics and Computational Biology Group, University of Pennsylvania, Philadelphia, PA 19104 (United States); De Almeida, Victor [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland); Nishimura, Taisuke [Department of Plant Biology, University of Geneva, CH-1205 Geneva (Switzerland); Joly, Jacques; Ferrer, Jean-Luc [Institut de Biologie Structurale J.-P. Ebel, CEA-CNRS-University J. Fourier, 38027 Grenoble CEDEX 1 (France); Halazonetis, Thanos D., E-mail: thanos.halazonetis@unige.ch [Department of Molecular Biology, University of Geneva, CH-1205 Geneva (Switzerland); Department of Biochemistry, University of Geneva, CH-1205 Geneva (Switzerland)

    2009-09-01

    A cyclic olefin homopolymer-based microfluidics system has been established for protein crystallization and in situ X-ray diffraction. Microfluidics is a promising technology for the rapid identification of protein crystallization conditions. However, most of the existing systems utilize silicone elastomers as the chip material which, despite its many benefits, is highly permeable to water vapour. This limits the time available for protein crystallization to less than a week. Here, the use of a cyclic olefin homopolymer-based microfluidics system for protein crystallization and in situ X-ray diffraction is described. Liquid handling in this system is performed in 2 mm thin transparent cards which contain 500 chambers, each with a volume of 320 nl. Microbatch, vapour-diffusion and free-interface diffusion protocols for protein crystallization were implemented and crystals were obtained of a number of proteins, including chicken lysozyme, bovine trypsin, a human p53 protein containing both the DNA-binding and oligomerization domains bound to DNA and a functionally important domain of Arabidopsis Morpheus’ molecule 1 (MOM1). The latter two polypeptides have not been crystallized previously. For X-ray diffraction analysis, either the cards were opened to allow mounting of the crystals on loops or the crystals were exposed to X-rays in situ. For lysozyme, an entire X-ray diffraction data set at 1.5 Å resolution was collected without removing the crystal from the card. Thus, cyclic olefin homopolymer-based microfluidics systems have the potential to further automate protein crystallization and structural genomics efforts.

  12. Synthesis and single crystal X-ray structure of the tetragonal tungsten bronze Pb{sub 0.91}K{sub 1.72}Li{sub 1.46}Nb{sub 5}O{sub 15}

    Energy Technology Data Exchange (ETDEWEB)

    Capitelli, F. [Institute of Crystallography - CNR, Via Salaria Km 29.300, 00016 Monterotondo Rome (Italy); Rossi, M. [Earth Sciences Department, Federico II University, Via Mezzocannone 8, 80134 Naples (Italy); Elaatmani, M.; Zegzouti, A. [Laboratoire de Chimie du Solide Mineral, Faculte des Sciences Semlalia, Universite Cadi Ayyad, Marrakech (Morocco)

    2010-11-15

    Crystals of Pb{sub 0.91}K{sub 1.72}Li{sub 1.46}Nb{sub 5}O{sub 15}, belonging to tetragonal tungsten bronze materials, were grown by the slow cooling technique, and characterized by means of single crystal X-ray diffraction: the structure was solved in the P4bm tetragonal space group, with the following unit cell parameters: a = 12.548(5), c = 4.042(5)A, V = 636.4(9)A{sup 3}. The three-dimensional framework can be described as a layered structure down crystallographic axis c, with arrays of NbO{sub 6} octahedra, whose corner sharing makes up the formation of tunnels filled up by Li, Pb and K displaying complex cation-oxygen coordinations. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  13. Diffraction crystals for sagittally focusing x-rays

    Science.gov (United States)

    Ice, G.E.; Sparks, C.J. Jr.

    1982-06-07

    The invention is a new type of diffraction crystal designed for sagittally focusing photons of various energies. The invention is based on the discovery that such focusing is not obtainable with conventional crystals because of distortion resulting from anticlastic curvature. The new crystal comprises a monocrystalline base having a front face contoured for sagittally focusing photons and a back face provided with rigid, upstanding, stiffening ribs restricting anticlastic curvature. When mounted in a suitable bending device, the reflecting face of the crystal can be adjusted to focus photons having any one of a range of energies.

  14. Synthesis, characterization, X-ray structure, optical properties and ...

    Indian Academy of Sciences (India)

    ESMA LAMERA

    Also, the values of dipole moment μ, the average polarizability ¯α, and the first static hyperpolarizability (β0) were computed. The theoretical and experimental results confirm the NLO behavior of both compounds. Keywords. Condensed phthalazine; DFT calculations; spectroscopic analysis; X-ray structure; NLO. 1.

  15. Development of an X-ray fluorescence holographic measurement system for protein crystals

    International Nuclear Information System (INIS)

    Sato-Tomita, Ayana; Shibayama, Naoya; Okabe, Takahiro; Happo, Naohisa; Kimura, Koji; Matsushita, Tomohiro; Park, Sam-Yong; Sasaki, Yuji C.; Hayashi, Kouichi

    2016-01-01

    Experimental procedure and setup for obtaining X-ray fluorescence hologram of crystalline metalloprotein samples are described. Human hemoglobin, an α 2 β 2 tetrameric metalloprotein containing the Fe(II) heme active-site in each chain, was chosen for this study because of its wealth of crystallographic data. A cold gas flow system was introduced to reduce X-ray radiation damage of protein crystals that are usually fragile and susceptible to damage. A χ-stage was installed to rotate the sample while avoiding intersection between the X-ray beam and the sample loop or holder, which is needed for supporting fragile protein crystals. Huge hemoglobin crystals (with a maximum size of 8 × 6 × 3 mm 3 ) were prepared and used to keep the footprint of the incident X-ray beam smaller than the sample size during the entire course of the measurement with the incident angle of 0°-70°. Under these experimental and data acquisition conditions, we achieved the first observation of the X-ray fluorescence hologram pattern from the protein crystals with minimal radiation damage, opening up a new and potential method for investigating the stereochemistry of the metal active-sites in biomacromolecules.

  16. Development of an X-ray fluorescence holographic measurement system for protein crystals

    Energy Technology Data Exchange (ETDEWEB)

    Sato-Tomita, Ayana, E-mail: ayana.sato@jichi.ac.jp, E-mail: shibayam@jichi.ac.jp, E-mail: hayashi.koichi@nitech.ac.jp; Shibayama, Naoya, E-mail: ayana.sato@jichi.ac.jp, E-mail: shibayam@jichi.ac.jp, E-mail: hayashi.koichi@nitech.ac.jp; Okabe, Takahiro [Division of Biophysics, Department of Physiology, Jichi Medical University, Yakushiji, Shimotsuke 329-0498 (Japan); Happo, Naohisa [Department of Computer and Network Engineering, Graduate School of Information Sciences, Hiroshima City University, Asa-Minami-Ku, Hiroshima 731-3194 (Japan); Kimura, Koji [Department of Physical Science and Engineering, Nagoya Institute of Technology, Gokiso, Showa, Nagoya 466-8555 (Japan); Matsushita, Tomohiro [Japan Synchrotron Radiation Research Institute (JASRI), SPring-8, Sayo, Hyogo 679-5198 (Japan); Park, Sam-Yong [Drug Design Laboratory, Department of Medical Life Science, Yokohama City University, Suehiro, Tsurumi, Yokohama 230-0045 (Japan); Sasaki, Yuji C. [Department of Advanced Material Science, Graduate School of Frontier Science, The University of Tokyo, Kashiwanoha, Kashiwa 277-8561 (Japan); Hayashi, Kouichi, E-mail: ayana.sato@jichi.ac.jp, E-mail: shibayam@jichi.ac.jp, E-mail: hayashi.koichi@nitech.ac.jp [Department of Physical Science and Engineering, Nagoya Institute of Technology, Gokiso, Showa, Nagoya 466-8555 (Japan); Frontier Research Institute for Materials Science, Nagoya Institute of Technology, Gokiso, Showa, Nagoya 466-8555 (Japan)

    2016-06-15

    Experimental procedure and setup for obtaining X-ray fluorescence hologram of crystalline metalloprotein samples are described. Human hemoglobin, an α{sub 2}β{sub 2} tetrameric metalloprotein containing the Fe(II) heme active-site in each chain, was chosen for this study because of its wealth of crystallographic data. A cold gas flow system was introduced to reduce X-ray radiation damage of protein crystals that are usually fragile and susceptible to damage. A χ-stage was installed to rotate the sample while avoiding intersection between the X-ray beam and the sample loop or holder, which is needed for supporting fragile protein crystals. Huge hemoglobin crystals (with a maximum size of 8 × 6 × 3 mm{sup 3}) were prepared and used to keep the footprint of the incident X-ray beam smaller than the sample size during the entire course of the measurement with the incident angle of 0°-70°. Under these experimental and data acquisition conditions, we achieved the first observation of the X-ray fluorescence hologram pattern from the protein crystals with minimal radiation damage, opening up a new and potential method for investigating the stereochemistry of the metal active-sites in biomacromolecules.

  17. Batch crystallization of rhodopsin for structural dynamics using an X-ray free-electron laser

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Wenting; Nogly, Przemyslaw; Rheinberger, Jan; Kick, Leonhard M.; Gati, Cornelius; Nelson, Garrett; Deupi, Xavier; Standfuss, Jörg; Schertler, Gebhard; Panneels, Valérie, E-mail: valerie.panneels@psi.ch [Paul Scherrer Institute, OFLC/103, 5232 Villigen-PSI (Switzerland)

    2015-06-27

    A new batch preparation method is presented for high-density micrometre-sized crystals of the G protein-coupled receptor rhodopsin for use in time-resolved serial femtosecond crystallography at an X-ray free-electron laser using a liquid jet. Rhodopsin is a membrane protein from the G protein-coupled receptor family. Together with its ligand retinal, it forms the visual pigment responsible for night vision. In order to perform ultrafast dynamics studies, a time-resolved serial femtosecond crystallography method is required owing to the nonreversible activation of rhodopsin. In such an approach, microcrystals in suspension are delivered into the X-ray pulses of an X-ray free-electron laser (XFEL) after a precise photoactivation delay. Here, a millilitre batch production of high-density microcrystals was developed by four methodical conversion steps starting from known vapour-diffusion crystallization protocols: (i) screening the low-salt crystallization conditions preferred for serial crystallography by vapour diffusion, (ii) optimization of batch crystallization, (iii) testing the crystal size and quality using second-harmonic generation (SHG) imaging and X-ray powder diffraction and (iv) production of millilitres of rhodopsin crystal suspension in batches for serial crystallography tests; these crystals diffracted at an XFEL at the Linac Coherent Light Source using a liquid-jet setup.

  18. Understanding Nickel Thin Film crystallization using X-Ray ...

    African Journals Online (AJOL)

    MICHAEL

    Being a novel technique of thin film deposition, demonstrated applications are increasingly developed. Some already feasible usages include magnetic media high density information storage. (Hsieh et al., 1997), liquid crystal display technology. (Robbie et al., 1999), photonic crystal (Kennedy et al., 2003), optical rotators, ...

  19. Investigation of a novel x-ray tube for the calibration of the x-ray crystal spectrometer in the KSTAR machine

    International Nuclear Information System (INIS)

    Bak, J.G.; Lee, S.G.

    2007-01-01

    A novel x-ray tube with a line filament has been developed for the in-situ calibration of the x-ray crystal spectrometer (XCS) in the KSTAR machine. The characteristics of the x-ray tube are investigated from the x-ray images obtained by using a pinhole and a CCD detector. It is found that the image has the width of about 0.1 mm, which is much improved as compared with the previous experimental results. In addition, there is a uniform region around the center of the image within its full length of 13.5 mm. This work may lead to the development of a novel x-ray tube with a line focus, which is required for the calibration of the XCS. Experimental results from the investigation of the x-ray tube are presented and the technical issues in a design of the in-situ calibration system using the x-ray tube for the KSTAR XCS are discussed. (author)

  20. Purification, crystallization and preliminary X-ray structure analysis of the laccase from Ganoderma lucidum

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Belova, Oksana; Gabdulkhakov, Azat G.; Lashkov, Alexander A.; Lisov, Alexandr V.; Leontievsky, Alexey A.; Mikhailov, Al’bert M.

    2011-01-01

    The purification, crystallization and preliminary X-ray structure analysis of the laccase from G. lucidum are reported. The ligninolytic enzymes of the basidiomycetes play a key role in the global carbon cycle. A characteristic property of these enzymes is their broad substrate specificity, which has led to their use in various biotechnologies, thus stimulating research into the three-dimensional structures of ligninolytic enzymes. This paper presents the purification, crystallization and preliminary X-ray analysis of the laccase from the ligninolytic basidiomycete Ganoderma lucidum

  1. X-ray diffraction in laser-irradiated epsomite crystals grown in presence of borax

    International Nuclear Information System (INIS)

    Zaitseva, E.V.; Portnov, V.N.; Faddeev, M.A.; Chuprunov, E.V.

    1997-01-01

    Relative changes in the intensities ΔI/I of the (220) and (440) X-ray diffraction reflection during laser irradiation of epsomite (MgSO 2 ·7H 2 O) crystals grown from an aqueous solution in the presence of borax (Na 2 B 4 O 7 ·10H 2 O) were measured using the CoK α , CuK α , MoK α radiations. The intensities measured depend on the real crystal structure dependent on the borax content in the solution. The dependence of ΔI/I is studied as a function of borax in the solution and X-ray-radiation wavelength

  2. Crystallization and preliminary X-ray analysis of Atg3

    International Nuclear Information System (INIS)

    Yamada, Yuya; Suzuki, Nobuo N.; Fujioka, Yuko; Ichimura, Yoshinobu; Ohsumi, Yoshinori; Inagaki, Fuyuhiko

    2006-01-01

    S. cerevisiae Atg3, an E2-like enzyme that mediates the lipidation of Atg8, was crystallized and diffracted to 2.5 Å resolution. Atg3 is an E2-like enzyme that catalyzes the conjugation reaction between Atg8 and phosphatidylethanolamine (PE). The Atg8–PE conjugate is essential for autophagy, the bulk degradation process of cytoplasmic components by the vacuolar/lysosomal system. Crystals of Saccharomyces cerevisiae Atg3 have been obtained by the sitting-drop vapour-diffusion method using ammonium sulfate and lithium sulfate as precipitants. A native data set was collected from a single crystal to 2.5 Å resolution. The crystals belong to space group P4 1 or P4 3 , with unit-cell parameters a = 59.33, c = 115.22 Å, and are expected to contain one protein molecule per asymmetric unit

  3. X-ray diffraction and imaging with a coherent beam: application to X-ray optical elements and to crystals exhibiting phase inhomogeneities

    International Nuclear Information System (INIS)

    Masiello, F.

    2011-05-01

    The exceptional properties of synchrotron light sources have been exploited in very different disciplines, from archaeology to chemistry, from material science to biology, from medicine to physics. Among these properties it is important to mention the high brilliance, continuum spectrum, high degree of polarization, time structure, small source size and divergence of the beam, the last resulting in a high transversal coherence of the produced radiation. This high transversal coherence of the synchrotron sources has permitted the development of new techniques, e.g. phase contrast imaging, X-ray photon correlation spectroscopy and coherent X-ray diffraction imaging (CXDI). This thesis work will consist essentially of three parts. In the first part it will be presented the work done as a member of the X-ray Optics Group of ESRF in the characterization of high quality diamond crystals foreseen as X-ray optical elements. The characterization has been done using different complementary X-ray techniques, such as high resolution diffraction, topography, grazing incidence diffraction, reflectivity and measurements of the coherence preservation using the Talbot effect. In the second part, I will show the result obtained in the study of the temperature behaviours of the domain in periodically poled ferroelectrics crystals. This type of measurements, based on Bragg-Fresnel diffraction, are possible only thanks to the high degree of coherence of the beam. In the third part, I will present the results obtained in the characterization of diamonds foreseen for applications other than X-ray optical elements. (author)

  4. Synchrotron X-Ray Reciprocal Space Mapping, Topography and Diffraction Resolution Studies of Macromolecular Crystal Quality

    Science.gov (United States)

    Boggon, T. J.; Helliwell, J. R.; Judge, Russell A.; Siddons, D. P.; Snell, Edward H.; Stojanoff, V.

    2000-01-01

    A comprehensive study of microgravity and ground grown chicken egg white lysozyme crystals is presented using synchrotron X-ray reciprocal space mapping, topography techniques and diffraction resolution. Microgravity crystals displayed, on average, reduced intrinsic mosaicities but no differences in terms of stress over their earth grown counterparts. Topographic analysis revealed that in the microgravity case the majority of the crystal was contributing to the peak of the reflection at the appropriate Bragg angle. In the earth case at the diffraction peak only a small volume of the crystal contributed to the intensity. The techniques prove to be highly complementary with the reciprocal space mapping providing a quantitative measure of the crystal mosaicity and stress (or variation in lattice spacing) and topography providing a qualitative overall assessment of the crystal in terms of its X-ray diffraction properties. Structural data collection was also carried out both at the synchrotron and in the laboratory.

  5. Crystallization kinetics of amorphous griseofulvin by pattern fitting procedure using X-ray diffraction data.

    Science.gov (United States)

    Yamamura, Shigeo; Takahira, Rieko; Momose, Yasunori

    2007-05-01

    A pattern fitting procedure using X-ray powder diffraction patterns was applied to study the crystallization kinetics of amorphous griseofulvin. From the optimized parameters obtained by pattern fitting, a change in the quantity and quality of griseofulvin crystals with crystallization was also investigated. Amorphous griseofulvin was prepared by cooling the melts followed by pulverization. X-ray diffraction patterns of amorphous griseofulvin were repeatedly measured every 20 h. The observed pattern was separated into crystalline diffraction intensity and amorphous scattering intensity by the nonlinear least-squares procedure. The fitting between the observed and simulated diffraction patterns was satisfactorily independent of the degree of crystallinity. Since a good linear relationship was found in a plot of amorphous scattering intensity against crystalline diffraction intensity, the degree of crystallinity can be determined according to Hermans' method. The diffraction peak width increased with higher diffraction angles with crystallization. The crystallization was biphasic: fast and slow crystallization with the growth of low disordered crystals and disordered crystals, respectively. The pattern fitting procedure is a powerful tool to analyze the X-ray diffraction patterns of semicrystalline materials. This procedure can simultaneously analyze the degree of crystallinity and crystal disorder in semicrystalline samples during crystallization.

  6. Microdefects revealed by X-ray diffusion scattering in Czochralski-growth dislocation-free silicon single crystals

    International Nuclear Information System (INIS)

    Bublik, B.T.; Zotov, N.M.

    1997-01-01

    Microdefects in the regions of Si crystals having different thermal history defined by growth conditions was studied by the X-ray diffuse scattering method on a triple crystal X-ray diffractometer. It was shown that in such crystals the microdefects with positive strength are prevalent. However, between the above indicated regions the defects with the strength of opposite sign prevail

  7. First indirect x-ray imaging tests with an 88-mm diameter single crystal

    Energy Technology Data Exchange (ETDEWEB)

    Lumpkin, A. H. [Fermilab; Macrander, A. T. [Argonne

    2017-02-01

    Using the 1-BM-C beamline at the Advanced Photon Source (APS), we have performed the initial indirect x - ray imaging point-spread-function (PSF) test of a unique 88-mm diameter YAG:Ce single crystal of only 100 - micron thickness. The crystal was bonded to a fiber optic plat e (FOP) for mechanical support and to allow the option for FO coupling to a large format camera. This configuration resolution was compared to that of self - supported 25-mm diameter crystals, with and without an Al reflective coating. An upstream monochromator was used to select 17-keV x-rays from the broadband APS bending magnet source of synchrotron radiation. The upstream , adjustable Mo collimators were then used to provide a series of x-ray source transverse sizes from 200 microns down to about 15-20 microns (FWHM) at the crystal surface. The emitted scintillator radiation was in this case lens coupled to the ANDOR Neo sCMOS camera, and the indirect x-ray images were processed offline by a MATLAB - based image processing program. Based on single Gaussian peak fits to the x-ray image projected profiles, we observed a 10.5 micron PSF. This sample thus exhibited superior spatial resolution to standard P43 polycrystalline phosphors of the same thickness which would have about a 100-micron PSF. Lastly, this single crystal resolution combined with the 88-mm diameter makes it a candidate to support future x-ray diffraction or wafer topography experiments.

  8. Novel organophosphorus compounds; synthesis, spectroscopy and X-ray crystallography

    Czech Academy of Sciences Publication Activity Database

    Shariatinia, Z.; Sohrabi, M.; Yousefi, M.; Kovaľ, Tomáš; Dušek, Michal

    2012-01-01

    Roč. 11, č. 2 (2012), s. 125-133 ISSN 1024-1221 Grant - others:AV ČR(CZ) AP0701 Program:Akademická prémie - Praemium Academiae Institutional research plan: CEZ:AV0Z10100521 Keywords : organophosphorus compounds * NMR * X-ray crystallography * hydrogen bond Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.686, year: 2012

  9. Synthesis of hydroxyapatite and structural refinement by X-ray diffraction

    International Nuclear Information System (INIS)

    Araujo, Jorge Correa de

    2007-01-01

    A sample of hydroxyapatite was synthesized and its crystalline structure was analyzed by X-ray diffraction by means of the Rietveld method. Two functions were used to fit the peak profiles, modified Voigt (TCHZ) and Pearson VII. The occupational factors and lattice parameters obtained by both models show that the sample does not contain relevant cationic substitutions. The interatomic distances from Ca1 to oxygens O1, O2 and O3 were adequate for a pure hydroxyapatite without defect at site Ca1. Besides, the use of multiple lines in planes (300) and (002) associated with the model Pearson VII resulted in good agreement with the TCHZ model with respect to the size-strain effects with an ellipsoidal shape of crystallites. In conclusion, the procedures adopted in the synthesis of hydroxyapatite produced a pure and crystalline material. The experimental results of transmission electron microscopy confirmed the predicted shape of crystals. (author)

  10. Controllable reflection of X-rays on crystals of saccharose

    CERN Document Server

    Navasardyan, M A; Hayrapetyan, K T; Gabrielyan, R T

    2003-01-01

    Multiple (ten times and more) increase in intensities of separate reflections and of lauegram reflections from organic single crystals of saccharose (C sub 1 2H sub 2 2O sub 1 1) was observed under influence of certain temperature gradient. On the base of the present experiment and the data of our previous woks we show that the controllable reflection process has a common nature and the intensity of the diffracted beam under external influences does not depend on the total number of electrons per unit volume of the unit cell of the single crystal.

  11. Measuring the X-ray Resolving Power of Bent Potassium Acid Phthalate Diffraction Crystals

    Energy Technology Data Exchange (ETDEWEB)

    Haugh, M. J. [NSTec; Wu, M. [SNL; Jacoby, K. D. [NSTec; Loisel, G. P. [SNL

    2014-11-01

    This report presents the results from measuring the X-ray resolving power of a curved potassium acid phthalate (KAP(001)) spectrometer crystal using two independent methods. It is part of a continuing effort to measure the fundamental diffraction properties of bent crystals that are used to study various characteristics of high temperature plasmas. Bent crystals like KAP(001) do not usually have the same diffraction properties as corresponding flat crystals. Models that do exist to calculate the effect of bending the crystal on the diffraction properties have simplifying assumptions and their accuracy limits have not been adequately determined. The type of crystals that we measured is being used in a spectrometer on the Z machine at Sandia National Laboratories (SNL) in Albuquerque, NM. The first technique for measuring the crystal resolving power measures the X-ray spectral line width of the characteristic lines from several metal anodes. The second method uses a diode X-ray source and a dual goniometer arrangement to measure the reflectivity curve of the KAP(001) crystal. The width of that curve is inversely proportional to the crystal resolving power. The measurement results are analyzed and discussed.

  12. High Miller-index germanium crystals for high-energy x-ray imaging applications.

    Science.gov (United States)

    Koch, J A; Lee, J J; Haugh, M J

    2015-12-01

    Near-normal-incidence bent crystals are widely used for x-ray imaging applications. Advantages include high collection solid angle and potentially high efficiency for narrow-band sources, while disadvantages include relatively large (several Å) interatomic spacings and a limited number of suitable matches between a crystal 2d value and an integral multiple of useful emission line wavelengths. The disadvantages become more significant at x-ray energies >10  keV. The former disadvantage can be mitigated by using high-order reflections from crystal planes having low Miller indices, but both disadvantages can be mitigated by using low-order reflections from crystal planes having high Miller indices. We report here on integrated reflectivity measurements we performed of Ge (15,7,7) (2d=0.6296  Å), a candidate for imaging Ru He-α (θ(B)=87°). We find good agreement with calculations, and the data show a multitude of closely spaced reflections with slightly different Bragg angles including a fifth-order reflection of Ge (3,1,1) that has comparable reflectivity. This demonstrates that arbitrary choices of Miller indices in Ge crystals can be used to fine-tune Bragg angles for near-normal-incidence x-ray imaging at tens of kiloelectron volt x-ray energies with minimal lower-energy contamination from lower-order reflections, and that existing calculational tools can be used to reliably estimate integrated reflectivity.

  13. Femtosecond X-ray diffraction from two-dimensional protein crystals

    Directory of Open Access Journals (Sweden)

    Matthias Frank

    2014-03-01

    Full Text Available X-ray diffraction patterns from two-dimensional (2-D protein crystals obtained using femtosecond X-ray pulses from an X-ray free-electron laser (XFEL are presented. To date, it has not been possible to acquire transmission X-ray diffraction patterns from individual 2-D protein crystals due to radiation damage. However, the intense and ultrafast pulses generated by an XFEL permit a new method of collecting diffraction data before the sample is destroyed. Utilizing a diffract-before-destroy approach at the Linac Coherent Light Source, Bragg diffraction was acquired to better than 8.5 Å resolution for two different 2-D protein crystal samples each less than 10 nm thick and maintained at room temperature. These proof-of-principle results show promise for structural analysis of both soluble and membrane proteins arranged as 2-D crystals without requiring cryogenic conditions or the formation of three-dimensional crystals.

  14. Lysozyme crystal growth, as observed by small angle X-ray scattering, proceeds without crystallization intermediates

    International Nuclear Information System (INIS)

    Finet, S.; Bonnete, F.; Frouin, J.; Provost, K.; Tardieu, A.

    1998-01-01

    A combination of small angle X-ray scattering and gel techniques was used to follow the kinetics of protein crystal growth as a function of time. Hen egg white lysozyme, at different protein concentrations, was used as a model system. A new sample holder was designed, in which supersaturation is induced in the presence of salt by decreasing the temperature. It had been shown previously that a decrease in temperature and/or an increase in crystallizing agent induces an increase in the attractive interactions present in the lysozyme solutions, the lysozyme remaining monomeric. In the present paper we show that similar behaviour is observed in NaCl when agarose gels are used. During crystal growth, special attention was paid to determine whether oligomers were formed as the protein in solution was incorporated in the newly formed crystals. From these first series of experiments, we did not find any indication of oligomer formation between monomer in solution and crystal. The results obtained are in agreement with the hypothesis that lysozyme crystals in NaCl grow by addition of monomeric particles. (orig.)

  15. Crystallization and X-ray diffraction studies of cellobiose phosphorylase from Cellulomonas uda.

    Science.gov (United States)

    Van Hoorebeke, Annelies; Stout, Jan; Kyndt, John; De Groeve, Manu; Dix, Ina; Desmet, Tom; Soetaert, Wim; Van Beeumen, Jozef; Savvides, Savvas N

    2010-03-01

    Disaccharide phosphorylases are able to catalyze both the synthesis and the breakdown of disaccharides and have thus emerged as attractive platforms for tailor-made sugar synthesis. Cellobiose phosphorylase from Cellulomonas uda (CPCuda) is an enzyme that belongs to glycoside hydrolase family 94 and catalyzes the reversible breakdown of cellobiose [beta-D-glucopyranosyl-(1,4)-D-glucopyranose] to alpha-D-glucose-1-phosphate and D-glucose. Crystals of ligand-free recombinant CPCuda and of its complexes with substrates and reaction products yielded complete X-ray diffraction data sets to high resolution using synchrotron radiation but suffered from significant variability in diffraction quality. In at least one case an intriguing space-group transition from a primitive monoclinic to a primitive orthorhombic lattice was observed during data collection. The structure of CPCuda was determined by maximum-likelihood molecular replacement, thus establishing a starting point for an investigation of the structural and mechanistic determinants of disaccharide phosphorylase activity.

  16. Crystallization and X-ray diffraction studies of cellobiose phosphorylase from Cellulomonas uda

    International Nuclear Information System (INIS)

    Van Hoorebeke, Annelies; Stout, Jan; Kyndt, John; De Groeve, Manu; Dix, Ina; Desmet, Tom; Soetaert, Wim; Van Beeumen, Jozef; Savvides, Savvas N.

    2010-01-01

    Preliminary crystallographic studies of recombinant cellobiose phosphorylase from Cellulomonas uda in complex with reaction substrates and products have led to high-quality diffraction data at high resolution, thus enabling structural studies to dissect the structural and mechanistic determinants of disaccharide phosphorylase activity. Disaccharide phosphorylases are able to catalyze both the synthesis and the breakdown of disaccharides and have thus emerged as attractive platforms for tailor-made sugar synthesis. Cellobiose phosphorylase from Cellulomonas uda (CPCuda) is an enzyme that belongs to glycoside hydrolase family 94 and catalyzes the reversible breakdown of cellobiose [β-d-glucopyranosyl-(1,4)-d-glucopyranose] to α-d-glucose-1-phosphate and d-glucose. Crystals of ligand-free recombinant CPCuda and of its complexes with substrates and reaction products yielded complete X-ray diffraction data sets to high resolution using synchrotron radiation but suffered from significant variability in diffraction quality. In at least one case an intriguing space-group transition from a primitive monoclinic to a primitive orthorhombic lattice was observed during data collection. The structure of CPCuda was determined by maximum-likelihood molecular replacement, thus establishing a starting point for an investigation of the structural and mechanistic determinants of disaccharide phosphorylase activity

  17. Correct interpretation of diffraction properties of quartz crystals for X-ray optics applications

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Xian-Rong; Gog, Thomas; Kim, Jungho; Kasman, Elina; Said, Ayman H.; Casa, Diego M.; Wieczorek, Michael; Hönnicke, Marcelo G.; Assoufid, Lahsen

    2018-02-01

    Quartz has hundreds of strong Bragg reflections that may offer a great number of choices for making fixed-angle X-ray analyzers and polarizers at virtually any hard X-ray energies with selectable resolution. However, quartz crystals, unlike silicon and germanium, are chiral and may thus appear in two different forms of handedness that are mirror images. Furthermore, because of the threefold rotational symmetry along thecaxis, the {h1h2h3L} and {h2h1h3L} Bragg reflections may have quite different Darwin bandwidth, reflectivity and angular acceptance, although they have the same Bragg angle. The design of X-ray optics from quartz crystals therefore requires unambiguous determination of the orientation, handedness and polarity of the crystals. The Laue method and single-axis diffraction technique can provide such information, but the variety of conventions used in the literature to describe quartz structures has caused widespread confusion. The current studies give detailed guidelines for design and fabrication of quartz X-ray optics, with special emphasis on the correct interpretation of Laue patterns in terms of the crystallography and diffraction properties of quartz. Meanwhile, the quartz crystals examined were confirmed by X-ray topography to have acceptably low densities of dislocations and other defects, which is the foundation for developing high-resolution quartz-based X-ray optics.

  18. Design parameters of transmission curved crystal spectrometer for hard X-ray diagnoses

    International Nuclear Information System (INIS)

    Qian Feng; Cao Leifeng; Zhou Weimin; Zhao Zongqing; Gu Yuqiu; Yan Yonghong; Wei Lai; Xiao Shali

    2013-01-01

    The high resolving measurement of hard X-ray spectra generated in laser-produced plasma is usually performed using a cylindrically curved crystal spectrometer. In this paper, theoretical analysis and numerical simulation are performed to investigate the dependence of the energy range and resolving power on various design parameters, including crystal bending radius, source to crystal standoff distance, source size, location of the detector, etc. The investigation provides a means to design and develop cylindrically transmission curved crystal spectrometer which is used in hard X-ray diagnostics. The results show that crystal bending radius has a great influence on energy range of spectra and resolving power, and the separation between the spectral lines increases with the distance behind the focal circle faster than the line width, resulting in increased resolving power with distance. (authors)

  19. Bent crystal X-ray optics for the diagnosis and applications of laser-produced plasmas

    International Nuclear Information System (INIS)

    Loetzsch, Robert

    2012-01-01

    The present thesis discussed several aspects of X-ray optics based on bent crystals and a number of applications of these optics. First, a deeper insight into the reflection properties of elastically bent perfect crystal optics was gained by the consideration of all deformation effects. It was shown that the reflection properties depend on the lateral position on the crystal, an effect that was not addressed before, neither experimentally nor theoretically. To investigate this effect, an apparatus for the measurement of Bragg angles of bent crystals with high angular resolution was built. It was measured that the lattice plane distances of two-dimensionally bent crystals vary laterally by up to 10 -4 . This effect has to be considered in high resolution X-ray spectroscopy and imaging with these bent crystals. It can explain discrepancies in theoretical and experimental spectrometer resolution with spherically bent crystals. Besides these principal investigations, in this thesis a number of X-ray optics were presented that demonstrate the application potential of bent crystal optics. This includes two optics that are used in the field of applications of laser-produced plasmas as high repeating hard X-ray sources. It was shown that an X-ray spectrometer based on full cylinder rings of highly oriented pyrolytic graphite is capable to record the rather weak single shot pulses from a high repeating 1 er-plasma X-ray source. This is possible due to the high collection efficiency of the instrument of up to 5.10 -4 . Furthermore, X-ray optics based on toroidally bent crystals that make it possible to spectrally select a bandwidth of ∝1 eV and focus the ultrashort X-ray pulses from such a laser-plasma source, were designed, prepared and characterized. It was shown that these bent crystals provide the calculated integrated reflectivity, the predicted bandwidth and focus to spot sizes smaller than 60 μm. A novel application of toroidally bent crystals was pointed out: a

  20. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals

    Directory of Open Access Journals (Sweden)

    E. Han Dao

    2015-07-01

    Full Text Available In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  1. Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals.

    Science.gov (United States)

    Dao, E Han; Sierra, Raymond G; Laksmono, Hartawan; Lemke, Henrik T; Alonso-Mori, Roberto; Coey, Aaron; Larsen, Kevin; Baxter, Elizabeth L; Cohen, Aina E; Soltis, S Michael; DeMirci, Hasan

    2015-07-01

    In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecond X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.

  2. Doubly curved imaging Bragg crystal spectrometer for X-ray astronomy

    DEFF Research Database (Denmark)

    Byrnak, B. P.; Christensen, Finn Erland; Westergaard, Niels Jørgen Stenfeldt

    1985-01-01

    An X-ray spectrometer which is sensitive in the 0.5-7-keV energy range and is intended for use onboard astronomical satellites has been studied. The Bragg reflected rays from a doubly bent crystal positioned downstream of the focal plane of a grazing-incidence concentrator are focused along the a...

  3. X-ray absorption spectroscopy of PbMoO 4 single crystals

    Indian Academy of Sciences (India)

    X-ray absorption spectra of PbMoO4 (LMO) crystals have been investigated for the first time in literature. The measurements have been carried out at Mo absorption edge at the dispersive EXAFS beamline (BL-8) of INDUS-2 Synchrotron facility at Indore, India. The optics of the beamline was set to obtain a band of 2000 eV ...

  4. Observation of dislocations in crystals using X-ray and electron transmission

    International Nuclear Information System (INIS)

    Morlevat, J.P.

    1965-10-01

    Two approaches of the dynamical theory of diffraction (EWALD's and AUTHIER's) are recalled briefly. In the light of these theories, one then considers what information concerning the dislocations existing in a crystal can be obtained by X-Ray as well as electron diffraction. (author) [fr

  5. A simple model for dynamic small-angle X-ray diffraction in colloidal crystals

    NARCIS (Netherlands)

    de Beer, A.G.F.; Petukhov, A.V.

    2007-01-01

    A simple model is presented that allows calculation of the small-angle X-ray diffraction patterns of perfect colloidal crystals. The model is based on the Wentzel–Kramers–Brillouin approximation and permits a straightforward evaluation of multibeam interactions. Results are illustrated by several

  6. Flexible X-ray detector based on sliced lead iodide crystal

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Hui; Gao, Xiuying [College of Optoelectronic Technology, Chengdu University of Information Technology, Chengdu (China); Department of Materials Science, Sichuan University, Chengdu (China); Zhao, Beijun [Department of Materials Science, Sichuan University, Chengdu (China); Yang, Dingyu; Wangyang, Peihua; Zhu, Xinghua [College of Optoelectronic Technology, Chengdu University of Information Technology, Chengdu (China)

    2017-02-15

    A promising flexible X-ray detector based on inorganic semiconductor PbI{sub 2} crystal is reported. The sliced crystals mechanically cleaved from an as-grown PbI{sub 2} crystal act as the absorber directly converting the impinging X-ray photons to electron hole pairs. Due to the ductile feature of the PbI{sub 2} crystal, the detector can be operated under a highly curved state with the strain on the top surface up to 1.03% and still maintaining effective detection performance. The stable photocurrent and fast response were obtained with the detector repeated bending to a strain of 1.03% for 100 cycles. This work presents an approach for developing efficient and cost-effective PbI{sub 2}-based flexible X-ray detector. Photocurrent responses of the flexible PbI{sub 2} X-ray detector with the strain on the top surface up to 1.03% proposed in this work with the cross sectional structure and curved detector photograph as insets. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. A high resolution X-ray crystal spectrometer to study electron and ...

    Indian Academy of Sciences (India)

    A high resolution X-ray crystal spectrometer to study electron and heavy-ion impact atomic collisions. AJAY KUMAR, D MISRA, A H KELKAR, U R KADHANE, K V THULASIRAM and LOKESH C TRIBEDI. Tata Institute of Fundamental Research, Colaba, Mumbai 400 005, India. E-mail: lokesh@tifr.res.in. MS received 9 March ...

  8. High spatial resolution X-ray and gamma ray imaging system using diffraction crystals

    Science.gov (United States)

    Smither, Robert K [Hinsdale, IL

    2011-05-17

    A method and a device for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation are provided. The device comprises a plurality of arrays, with each array comprising a plurality of elements comprising a first collimator, a diffracting crystal, a second collimator, and a detector.

  9. Characterization of calcium crystals in Abelia using x-ray diffraction and electron microscopes

    Science.gov (United States)

    Localization, chemical composition, and morphology of calcium crystals in leaves and stems of Abelia mosanensis and A. ×grandiflora were analyzed with a variable pressure scanning electron microscope (VP-SEM) equipped with an X-ray diffraction system, low temperature SEM (LT-SEM) and a transmission ...

  10. Raphide crystal structure in agave tequilana determined by x-ray originating from synchrotron radiation

    International Nuclear Information System (INIS)

    Tadokoro, Makoto; Ozawa, Yoshiki; Mitsumi, Minoru; Toriumi, Kohshiro; Ogura, Tetsuya

    2005-01-01

    The first single crystal structure of small natural raphides in an agave plant is completely determined using an intense X-ray originating from a synchrotron radiation. The SEM image shows that the tip of the crystal is approximately hundreds of nanometer in width sharply grow to stick to the tissue of herbivorous vermin. Furthermore, the crystal develops cracks that propagate at an inclination of approximately 45deg towards the direction of crystal growth such that the crystal easily splits into small pieces in the tissue. (author)

  11. Single crystal growth and X-ray structure analysis of non-peripheral octahexyl phthalocyanine

    Science.gov (United States)

    Ohmori, Masashi; Nakano, Chika; Higashi, Takuya; Miyano, Tetsuya; Tohnai, Norimitsu; Fujii, Akihiko; Ozaki, Masanori

    2016-07-01

    The single-crystal structure of metal-free non-peripheral octahexyl-substituted phthalocyanine (C6PcH2) has been investigated by single-crystal X-ray structure analysis. Two types of C6PcH2 single crystal, bulk and needle crystals, were separately grown by controlling the recrystallization conditions. The structures of the two types of crystal were determined, and were found to be completely different, that is, C6PcH2 exhibits structural polymorphism. It has been clarified that the C6PcH2 microcrystals in thin films used in previously reported electronic devices have the needle structure.

  12. The surface preparation of beryl crystals for X-ray spectroscopy

    International Nuclear Information System (INIS)

    Hayes, R.W.; Kent, B.J.

    1980-08-01

    One of the few crystals available for X-ray spectroscopy in the 10 to 15 A band is natural beryl. Surface preparation of beryl crystals by etching in hydrofluric acid followed by polishing in X-30 syton is shown to bring the rocking curve widths (FWHM) as measured on a two-crystal spectrometer to the near perfect values of 5 arc sec at Cu Kα (1.54 A) and 3.3 arc min at Cu Lα (13.31 A). In addition the crystals peak reflectivity can be enhanced by a factor eight times that of flat and ground but otherwise untreated crystals. (author)

  13. Antiferroelectric surface layers in a liquid crystal as observed by synchrotron x-ray scattering

    DEFF Research Database (Denmark)

    Gramsbergen, E. F.; de Jeu, W. H.; Als-Nielsen, Jens Aage

    1986-01-01

    The X-ray reflectivity form the surface of a liquid crystal with terminally polar (cyano substituted) molecules has been studied using a high-resolution triple-axis X-ray spectrometer in combination with a synchrotron source. It is demonstrated that at the surface of the smectic Al phase a few...... antiferroelectric double layers develop that can be distinguished from the bulk single layer structure. A model is developed that separates the electron density in a contribution from the molecular form factor, and from the structure factor of the mono- and the bilayers, respectively. It shows that (i) the first...

  14. [Research on increasing X-ray protection capability based on photonic crystal technology].

    Science.gov (United States)

    Li, Ping; Zhao, Peng; Zhang, Rui

    2014-06-01

    Light cannot be propagated within the range of photonic crystal band gaps. Based on this unique property, we proposed a method to improve anti-radiation capability through one-dimensional photonic crystal coating. Using transmission matrix method, we determined the appropriate dielectric materials, thickness and periodic numbers of photonic crystals through Matlab programming simulation. Then, compound one-dimensional photonic crystal coating was designed which was of high anti-radiation rate within the range of X-ray. As is shown through simulation experiments, the reflection rate against X-ray was higher than 90 percent, and the desired anti-radiation effect was achieved. Thus, this method is able to help solve the technical problems facing the inorganic lead glass such as thickness, weightiness, costliness, high lead equivalent, low transparency and high cost. This method has won China's national invention patent approval, and the patent number is 201220228549.2.

  15. Purification, crystallization and preliminary X-ray crystallographic analysis of rice bifunctional α-amylase/subtilisin inhibitor from Oryza sativa

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Yi-Hung [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Peng, Wen-Yan [Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Huang, Yen-Chieh [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Guan, Hong-Hsiang; Hsieh, Ying-Cheng [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan (China); Liu, Ming-Yih [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Chang, Tschining [Department of Hospitality Management, Nan Jeon Institute of Technology, Yen-Shui, Tainan 73746,Taiwan (China); Chen, Chun-Jung, E-mail: cjchen@nsrrc.org.tw [Life Science Group, Research Division, National Synchrotron Radiation Research Center, Hsinchu 30076,Taiwan (China); Department of Physics, National Tsing-Hua University, Hsinchu 30013,Taiwan (China)

    2006-08-01

    The crystallization of rice α-amylase/subtilisin bifunctional inhibitor is reported. Rice bifunctional α-amylase/subtilisin inhibitor (RASI) can inhibit both α-amylase from larvae of the red flour beetle (Tribolium castaneum) and subtilisin from Bacillus subtilis. The synthesis of RASI is up-regulated during the late milky stage in developing seeds. The 8.9 kDa molecular-weight RASI from rice has been crystallized using the hanging-drop vapour-diffusion method. According to 1.81 Å resolution X-ray diffraction data from rice RASI crystals, the crystal belongs to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 79.99, b = 62.95, c = 66.70 Å. Preliminary analysis indicates two RASI molecules in an asymmetric unit with a solvent content of 44%.

  16. Visualization of membrane protein crystals in lipid cubic phase using X-ray imaging.

    Science.gov (United States)

    Warren, Anna J; Armour, Wes; Axford, Danny; Basham, Mark; Connolley, Thomas; Hall, David R; Horrell, Sam; McAuley, Katherine E; Mykhaylyk, Vitaliy; Wagner, Armin; Evans, Gwyndaf

    2013-07-01

    The focus in macromolecular crystallography is moving towards even more challenging target proteins that often crystallize on much smaller scales and are frequently mounted in opaque or highly refractive materials. It is therefore essential that X-ray beamline technology develops in parallel to accommodate such difficult samples. In this paper, the use of X-ray microradiography and microtomography is reported as a tool for crystal visualization, location and characterization on the macromolecular crystallography beamlines at the Diamond Light Source. The technique is particularly useful for microcrystals and for crystals mounted in opaque materials such as lipid cubic phase. X-ray diffraction raster scanning can be used in combination with radiography to allow informed decision-making at the beamline prior to diffraction data collection. It is demonstrated that the X-ray dose required for a full tomography measurement is similar to that for a diffraction grid-scan, but for sample location and shape estimation alone just a few radiographic projections may be required.

  17. Single crystal X-ray structure of the artists’ pigment zinc yellow

    DEFF Research Database (Denmark)

    Simonsen, Kim Pilkjær; Christiansen, Marie Bitsch; Vinum, Morten Gotthold

    2017-01-01

    been unknown. In this work, zinc yellow was synthesised by precipitation from an aqueous solution of zinc nitrate and potassium chromate under both neutral and basic conditions, and the products were compared with the pigment used in industrial paints. Analyses by Raman microscopy (MRS), scanning...... electron microscopy-energy dispersive X-ray spectroscopy (SEM-EDS), attenuated total reflectance-Fourier transform infrared spectroscopy (ATR-FTIR), and powder X-ray diffraction (PXRD), showed that the synthesised products and the industrial pigment were identical. Single-crystal X-ray crystallography......The artists’ pigment zinc yellow is in general described as a complex potassium zinc chromate with the empirical formula 4ZnCrO4·K2O·3H2O. Even though the pigment has been in use since the second half of the 19th century also in large-scale industrial applications, the exact structure had hitherto...

  18. Increase in the Reflected Intensity of X-Ray Films Using Photonic Crystals

    Science.gov (United States)

    Aly, Arafa H.; Eissa, M. F.

    Photographic film is the familiar image of recording X-ray method. Examinations performed with radiographic intensifying screens reduce the patient’s exposure to radiation of X-rays compared with those without radiographic intensifying screens, where it directs less than half of the light emitted from the X-ray film with a screen interaction. A reflective layer made of magnesium oxide or titanium dioxide is located between the screen and the base of the film; this layer can help regain the control of the header light in other directions and is forwarded to the film. One-dimensional array of photonic crystals (PCs) consists of MgO with Al and TiO2 with Al used as reflectors. This array may increase the reflected intensity by an amount of 10.88% if MgO-Al PCs with periodicity N=1 are used as reflectors.

  19. The (oxo)[(2,3,7,8,12,13,17,18-octachloro-5,10,15,20-tetrakis(4-tolylporphyrinato)]vanadium(IV): Synthesis, UV-visible, Cyclic voltammetry and X-ray crystal structure

    Science.gov (United States)

    Mchiri, Chadlia; Amiri, Nesrine; Jabli, Souhir; Roisnel, Thierry; Nasri, Habib

    2018-02-01

    The present work is concerned with the oxo vanadium(IV) complex of 2,3,7,8,12,13,17,18-octachloro-5,10,15,20-tetrakis(4-tolylporphyrin) with formula [V(Cl8TTP)O] (I), which was prepared by reacting the (oxo)[5,10,15,20-tetrakis(4-tolylporphyrinato)]vanadium(IV) complex ([V(TTP)O]), under aerobic atmosphere, with a large excess of thionyl chloride (SOCl2). The title compound was characterized by UV-visible spectroscopy, cyclic voltammetry and X-ray crystal structure. The electron-withdrawing chlorine substituents at the pyrrole carbons in the vanadyl-Cl8TTP derivative produce remarkable redshifts of the Soret and Q absorption bands and an important anodic shift of the porphyrin ring oxidation and reduction potentials. This is an indication that the porphyrin core of complex (I) is severely nonplanar in solution. The molecular structure of our vanadyl derivative shows a very high saddle distortion and an important ruffled deformation of the porphyrin macrocycle. The crystal structure of (I) is made by one-dimensional chains parallel to the c axis where channels are located between these chains.

  20. Crystallization and preliminary X-ray analysis of Escherichia coli RNase G

    International Nuclear Information System (INIS)

    Fang, Pengfei; Wang, Jing; Li, Xu; Guo, Min; Xing, Li; Cao, Xu; Zhu, Yi; Gao, Yan; Niu, Liwen; Teng, Maikun

    2009-01-01

    Full-length E. coli RNase G was overexpressed, purified and crystallized. Diffraction data were collected to a resolution of 3.4 Å. The homologous RNases RNase E and RNase G are widely distributed in bacteria and function in many important physiological processes, including mRNA degradation, rRNA maturation and so on. In this study, the crystallization and preliminary X-ray analysis of RNase G from Escherichia coli is described. Purified recombinant E. coli RNase G, which has 497 amino acids, was crystallized in the cubic space group F432, with unit-cell parameters a = b = c = 219.84 Å. X-ray diffraction data were collected to a resolution of 3.4 Å

  1. Study by X ray topography of dislocation rise and sliding in zinc and cadmium single crystals

    International Nuclear Information System (INIS)

    G'Sell, Christian

    1977-01-01

    After having recalled that dislocation rise with a Burgers vector component located off the base plane has already been observed in zinc and cadmium by transmission electron microscopy and by X-ray topography on very thin crystals (5 microns), and that the Burgers vectors and characteristics of the rising configuration could not be precisely determined, this research thesis addresses the study of this phenomenon of dislocation rise by observing displacements in thicker (100 microns) zinc and cadmium crystals, by using X-ray topography. Rise is firstly observed during temperature variation, and the evolution of the initial configuration of dislocations is determined. The influences of atmosphere nature and of crystal surface condition resulting from different chemical treatments are studied. Dislocation sliding in the base plane is studied by determining different characteristics of sliding induced micro-deformation

  2. Synthesis, X-ray crystal structure, photo luminescent property, antimicrobial activities and DFT computational study of Zn(II) coordination polymer derived from multisite N,O donor Schiff base ligand (H2L1)

    Science.gov (United States)

    Majumdar, Dhrubajyoti; Surendra Babu, M. S.; Das, Sourav; Biswas, Jayanta Kumar; Mondal, Monojit; Hazra, Suman

    2017-06-01

    A unique thiocyanato linked 1D chain of Zn(II) coordination polymer [Zn2L1(μ1,3-SCN)(η1SCN)]n (1) has been synthesized using potential multisite compartmental N,O donor Schiff base blocker ligand (L1H2) in presence of Zn(OAc)2 and KSCN. The Schiff base ligand [N, N‧-bis(3-methoxysalicylidenimino)-1,3-daminopropane] (L1H2) is 2:1 M ratio condensation product of O-vaniline and 1,3-diaminopropane in methanol medium. The characterization of Complex 1 was accomplished by means of different micro analytical techniques like elemental analyses, IR, UV-Vis, 1H NMR, emission spectroscopy and Single X-ray crystallographic study. Complex 1 crystallizes in Orthorhombic system, space group Pbca, with values a = 11.579(2), b = 18.538(3), and c = 22.160(4) Å; α = β = γ = 90.00°; V = 4756.6(14) and Z = 8. The single crystal X-ray revealed that the one dimensional chain system with the repeating unit [Zn2(μ1,3-SCN)(η1SCN)(L1)]n bridge by an end to end μ1,3 thiocyanate anion. Within each repeating unit two different types of Zn(II) ions are present. One of these is five-coordinate in a square pyramidal geometry while the other is six-coordinate in an octahedral geometry. A brief but lucid comparative approach has been demonstrated in between Schiff base (L1H2) and complex 1 with respect to their photoluminescence activities. Active luminescence behavior of complex 1 in presence of ligand (L1H2) is due to quenching of PET process which is mediated by 'chelating effect'. Complex 1 exhibits strong antimicrobial efficacy against some important Gram + ve and Gram -ve bacteria. Apart from antimicrobial potential, a combined experimental and theoretical investigation has been performed via DFT on molecular structure of complex 1 with respect to Hirshfeld surface analysis.

  3. The complementary use for X-ray and neutron diffraction in the study of crystals

    International Nuclear Information System (INIS)

    Finney, J.L.

    1995-01-01

    Neutrons and X-rays interact differently with atoms in crystals. While X-rays primarily give information on electron distributions, neutrons report on nuclear positions, and, through the spin interaction, are sensitive to magnetic structure. These and other differences have been exploited for many years in, for example, X-N difference studies and in determining magnetic structure. The major differences in available X-ray and neutron incident-beam intensities have also influenced the ways in which the two probes are exploited; not only are neutron sources inherently weaker, but this disadvantage is heightened by the weaker neutron-nucleus interaction. Advances in sources of both types, coupled with developments in instrumentation, have enabled not only the relative strengths to be exploited more effectively, but also some of the respective weaknesses in both techniques to be at least partially overcome. After outlining the main relevant advantages of X-rays and neutrons, and specifically of pulsed spallation neutron sources, this paper will discuss some of the scientific areas in which these various advantages are being increasingly exploited with advanced sources and instrumentation. Although the examples focus in particular on studies of structure and disorder in powder samples, including work at high pressures, some attention is given to hydrogen location in, and diffuse scattering from, single crystals. Finally, a personal forward look towards possible future developments is offered. (orig.)

  4. Crystallization and preliminary X-ray analysis of AzoR (azoreductase) from Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Ito, Kosuke [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Nakanishi, Masayuki [Department of Biomolecular Science, Faculty of Engineering, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan); Lee, Woo-Cheol; Sasaki, Hiroshi [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Zenno, Shuhei; Saigo, Kaoru [Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Kitade, Yukio [Department of Biomolecular Science, Faculty of Engineering, Gifu University, 1-1 Yanagido, Gifu 501-1193 (Japan); Tanokura, Masaru, E-mail: amtanok@mail.ecc.u-tokyo.ac.jp [Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2005-04-01

    The crystallization and preliminary X-ray analysis of AzoR (azoreductase) have been performed. AzoR (azoreductase), an FMN-dependent NADH-azo compound oxidoreductase from Escherichia coli, has been crystallized in the presence of FMN by the sitting-drop vapour-diffusion method using 2-propanol as a precipitant. AzoR catalyzes the reductive cleavage of azo groups. The crystals were found to diffract X-rays to beyond 1.8 Å resolution using a synchrotron-radiation source. The crystals belonged to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 92.2, c = 51.9 Å. The crystals are expected to contain one subunit of the homodimer in the asymmetric unit (V{sub M} = 2.6 Å{sup 3} Da{sup −1}) and to have a solvent content of 51.6%. Data sets were also collected from heavy-atom derivatives for use in phasing. As a result, crystals soaked in a solution containing K{sub 2}PtCl{sub 4} for 23 d were found to be reasonably isomorphous to the native crystals and the presence of Pt atoms could be confirmed. The data sets from the native crystals and the K{sub 2}PtCl{sub 4}-derivatized crystals are being evaluated for use in structure determination by single isomorphous replacement with anomalous scattering.

  5. Crystallization and preliminary X-ray diffraction analysis of selenophosphate synthetases from Trypanosoma brucei and Leishmania major.

    Science.gov (United States)

    Faim, Lívia Maria; Rosa e Silva, Ivan; Bertacine Dias, Marcio Vinicius; D'Muniz Pereira, Humberto; Brandao-Neto, José; Alves da Silva, Marco Túlio; Thiemann, Otavio Henrique

    2013-08-01

    Selenophosphate synthetase (SPS) plays an indispensable role in selenium metabolism, being responsible for catalyzing the activation of selenide with adenosine 5'-triphosphate (ATP) to generate selenophosphate, the essential selenium donor for selenocysteine synthesis. Recombinant full-length Leishmania major SPS (LmSPS2) was recalcitrant to crystallization. Therefore, a limited proteolysis technique was used and a stable N-terminal truncated construct (ΔN-LmSPS2) yielded suitable crystals. The Trypanosoma brucei SPS orthologue (TbSPS2) was crystallized by the microbatch method using paraffin oil. X-ray diffraction data were collected to resolutions of 1.9 Å for ΔN-LmSPS2 and 3.4 Å for TbSPS2.

  6. Synthesis, single crystal X-ray, spectroscopic (FT-IR, UV-vis, fluorescence, 1H &13C NMR), computational (DFT/B3LYP) studies of some imidazole based picrates

    Science.gov (United States)

    Arockia doss, M.; Rajarajan, G.; Thanikachalam, V.; Selvanayagam, S.; Sridhar, B.

    2018-04-01

    2,4,5-triphenyl-1H-imidazol-3-ium picrate (1), 2-(4-fluorophenyl)-4,5-diphenyl-1H-imidazol-3-ium picrate (2), 2-(4-methylphenyl)-4,5-diphenyl-1H-imidazol-3-ium picrate (3) were synthesised. These compounds 1-3 were characterized by elemental, FT-IR, 1H NMR and 13C NMR analyses. The structure of compound 3 was further confirmed by single crystal X-ray diffraction. The studies reveal that the molecule is associated with weak Nsbnd H⋯O and Csbnd H⋯N and van der Waals interactions which are responsible for the formation and strengthening of supramolecular assembly. The nature of the interactions and their importance are explored using the Hirshfeld surface method. The physicochemical properties of the compounds 1-3 were evaluated by UV-vis spectroscopy, fluorescence spectroscopy, and thermogravimetric analysis. According to thermal data the salts possess excellent thermal stabilities with decomposition temperatures ranging from 220 to 280 °C. Second-harmonic generation (SHG) results exposed that the picrates 1-3 were about 1.13-1.50 times greater than potassium dihydrogen phosphate (KDP). Here we also used Density functional theory (DFT) calculations in order to investigate the opto-electronic properties. The obtained theoretical results validate with available experimental data.

  7. Crystallization and preliminary X-ray diffraction experiments of arylmalonate decarboxylase from Alcaligenes bronchisepticus

    International Nuclear Information System (INIS)

    Nakasako, Masayoshi; Obata, Rika; Okubo, Ryosuke; Nakayama, Shyuichi; Miyamoto, Kenji; Ohta, Hiromichi

    2008-01-01

    Crystals of arylmalonate decarboxylase from A. bronchisepticus were obtained which diffracted X-rays to a resolution of at least 3.0 Å. Arylmalonate decarboxylase catalyses the enantioselective decarboxylation of α-aryl-α-methylmalonates to produce optically pure α-arylpropionates. The enzyme was crystallized with ammonium sulfate under alkaline pH conditions with the aim of understanding the mechanism of the enantioselective reaction. X-ray diffraction data collected to a resolution of 3.0 Å at cryogenic temperature showed that the crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 83.13, b = 99.62, c = 139.64 Å. This suggested that the asymmetric unit would contain between four and six molecules. Small-angle X-ray scattering revealed that the enzyme exists as a monomer in solution. Thus, the assembly of molecules in the asymmetric unit was likely to have been induced during the crystallization process

  8. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    International Nuclear Information System (INIS)

    Nascimento, Alessandro S.; Ferrarezi, Thiago; Catalano-Dupuy, Daniela L.; Ceccarelli, Eduardo A.; Polikarpov, Igor

    2006-01-01

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP + reductase. Ferredoxin-NADP + reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source

  9. Crystallization and preliminary X-ray diffraction studies of ferredoxin reductase from Leptospira interrogans

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Alessandro S.; Ferrarezi, Thiago [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil); Catalano-Dupuy, Daniela L.; Ceccarelli, Eduardo A. [Facultad de Ciencias Bioquímicas y Farmacéuticas, Molecular Biology Division, Instituto de Biología Molecular y Celular de Rosario (IBR), CONICET, Universidad Nacional de Rosario, Suipacha 531, S2002LRK Rosario (Argentina); Polikarpov, Igor, E-mail: ipolikarpov@if.sc.usp.br [Instituto de Física de São Carlos, Universidade de São Paulo, Av. Trabalhador Saocarlense 400, São Carlos, SP, 13560-970 (Brazil)

    2006-07-01

    Crystals adequate for X-ray diffraction analysis have been prepared from L. interrogans ferredoxin-NADP{sup +} reductase. Ferredoxin-NADP{sup +} reductase (FNR) is an FAD-containing enzyme that catalyzes electron transfer between NADP(H) and ferredoxin. Here, results are reported of the recombinant expression, purification and crystallization of FNR from Leptospira interrogans, a parasitic bacterium of animals and humans. The L. interrogans FNR crystals belong to a primitive monoclinic space group and diffract to 2.4 Å resolution at a synchrotron source.

  10. Nano-crystal growth in cordierite glass ceramics studied with X-ray scattering

    Energy Technology Data Exchange (ETDEWEB)

    Bras, Wim; Clark, Simon M.; Greaves, G. N.; Kunz, Martin; van Beek, W.; Radmilovic, V.

    2009-01-16

    The development of monodisperse crystalline particles in cordierite glass doped with Cr3+ after a two-step heat treatment is elucidated by a combination of time-resolved small and wide angle x-ray scattering (SAXS/WAXS) experiments with electron microscopy. The effects of bulk and surface crystallization can clearly be distinguished, and the crystallization kinetics of the bulk phase is characterized. The internal pressure due to structural differences between the crystalline and amorphous phase is measured but the physical cause of this pressure can not unambiguously be attributed. The combined measurements comprise a nearly full characterization of the crystallization processes and the resulting sample morphology.

  11. Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Feifei [East China University of Science and Technology, 130 Meilong Road, Shanghai 200237, People’s Republic of (China); Gao, Feng [Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, People’s Republic of (China); Li, Honglin [East China University of Science and Technology, 130 Meilong Road, Shanghai 200237, People’s Republic of (China); Gong, Weimin [Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, People’s Republic of (China); Zhou, Lin, E-mail: gdtb-bg@vip.163.com [Center for Tuberculosis Control of Guangdong Province, Guangzhou, People’s Republic of (China); Bi, Lijun, E-mail: gdtb-bg@vip.163.com [East China University of Science and Technology, 130 Meilong Road, Shanghai 200237, People’s Republic of (China)

    2014-07-23

    The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

  12. Expression, crystallization and preliminary X-ray analysis of the phosphoribosylglycinamide formyltransferase from Streptococcus mutans

    International Nuclear Information System (INIS)

    Zhai, Fangli; Liu, Xiaojuan; Ruan, Jing; Li, Jing; Liu, Zhenlong; Hu, Yulin; Li, Shentao

    2011-01-01

    Phosphoribosylglycinamide formyltransferase (PurN) from Streptococcus mutans was expressed in E. coli, purified and studied crystallographically. Phosphoribosylglycinamide formyltransferase (PurN) from Streptococcus mutans was recombinantly expressed in Escherichia coli. An effective purification protocol was established. The purified protein, which had a purity of >95%, was identified by SDS–PAGE and MALDI–TOF MS. The protein was crystallized using the vapour-diffusion method in hanging-drop mode with PEG 3350 as the primary precipitant. X-ray diffraction data were collected to 2.1 Å resolution. Preliminary X-ray analysis indicated that the crystal belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 52.25, b = 63.29, c = 131.81 Å

  13. Evaluation of undoped ZnS single crystal materials for x-ray imaging applications

    Science.gov (United States)

    Saleh, Muad; Lynn, Kelvin G.; McCloy, John S.

    2017-05-01

    ZnS-based materials have a long history of use as x-ray luminescent materials. ZnS was one of the first discovered scintillators and is reported to have one of the highest scintillator efficiencies. The use of ZnS for high energy luminescence has been thus far limited to thin powder screens, such as ZnS:Ag which is used for detecting alpha radiation, due to opacity to its scintillation light, primarily due to scattering. ZnS in bulk form (chemical vapor deposited, powder processed, and single crystal) has high transmission and low scattering compared to powder screens. In this paper, the performance of single crystalline ZnS is evaluated for low energy x-ray (PLE) of several undoped ZnS single crystals is compared to their Radioluminescence (RL) spectra. It was found that the ZnS emission wavelength varies on the excitation source energy.

  14. Instrument and method for X-ray diffraction, fluorescence, and crystal texture analysis without sample preparation

    Science.gov (United States)

    Gendreau, Keith (Inventor); Martins, Jose Vanderlei (Inventor); Arzoumanian, Zaven (Inventor)

    2010-01-01

    An X-ray diffraction and X-ray fluorescence instrument for analyzing samples having no sample preparation includes a X-ray source configured to output a collimated X-ray beam comprising a continuum spectrum of X-rays to a predetermined coordinate and a photon-counting X-ray imaging spectrometer disposed to receive X-rays output from an unprepared sample disposed at the predetermined coordinate upon exposure of the unprepared sample to the collimated X-ray beam. The X-ray source and the photon-counting X-ray imaging spectrometer are arranged in a reflection geometry relative to the predetermined coordinate.

  15. X-Ray Reflectivity from the Surface of a Liquid Crystal:

    DEFF Research Database (Denmark)

    Pershan, P.S.; Als-Nielsen, Jens Aage

    1984-01-01

    X-ray reflectivity from the surface of a nematic liquid crystal is interpreted as the coherent superposition of Fresnel reflection from the surface and Bragg reflection from smectic order induced by the surface. Angular dependence of the Fresnel effect yields information on surface structure....... Measurement of the intensity of diffuse critical scattering relative to the Fresnel reflection yields the absolute value of the critical part of the density-density correlation function....

  16. Time and space domain separation of pulsed X-ray beams diffracted from vibrating crystals

    Energy Technology Data Exchange (ETDEWEB)

    Nosik, V. L., E-mail: v-nosik@yandex.ru, E-mail: nosik@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography, Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation)

    2016-11-15

    It is known that a set of additional reflections (satellites) may arise on rocking curves in the case of X-ray diffraction in the Bragg geometry from crystals where high-frequency ultrasonic vibrations are excited. It is shown that, under certain conditions, the pulse wave fields of the satellites and main reflection may be intersected in space (playing the role of pump and probe beams) and in time (forming interference superlattices).

  17. Optimization of dynamically bent crystals for X-ray focusing monochromators

    Czech Academy of Sciences Publication Activity Database

    Artemiev, A.; Artemiev, Nikolai; Busetto, E.; Hrdý, Jaromír; Mrázek, D.; Savoia, A.

    467-468, - (2001), s. 373-376 ISSN 0168-9002 R&D Projects: GA MŠk OK 305; GA MPO PZ-CH/22 Grant - others:COPERNICUS N ERBIC 15(XE) CT96 Institutional research plan: CEZ:AV0Z1010914 Keywords : bent crystal * focusing x-ray monochromator * synchrotron radiation Subject RIV: BH - Optics, Masers, Lasers Impact factor: 1.026, year: 2001

  18. Diffractive-refractive optics: (+,-,-,+) X-ray crystal monochromator with harmonics separation.

    Science.gov (United States)

    Hrdý, Jaromír; Mikulík, Petr; Oberta, Peter

    2011-03-01

    A new kind of two channel-cut crystals X-ray monochromator in dispersive (+,-,-,+) position which spatially separates harmonics is proposed. The diffracting surfaces are oriented so that the diffraction is inclined. Owing to refraction the diffracted beam is sagittally deviated. The deviation depends on wavelength and is much higher for the first harmonics than for higher harmonics. This leads to spatial harmonics separation. The idea is supported by ray-tracing simulation.

  19. single crystal growth, x-ray structure analysis, optical band gap

    African Journals Online (AJOL)

    2015-09-01

    Sep 1, 2015 ... Hg...Hgand Cl...Cl interactions are stabilizing the structures in 3D pattern. UV-vis absorption spectra illustrate the change in opticalband gap from 3.01eVto 3.42eV on replacing the metal halide group.Raman and Hyper-Raman tensors calculations were performed based on single crystal X-ray data and the ...

  20. Formation and evaluation of convex-curved crystals of lithium fluoride for use in analyzing x-ray spectra

    International Nuclear Information System (INIS)

    Sellick, B.O.

    1976-01-01

    Lithium fluoride as received from the vendor in boule form is 38 x 38 x 13 mm thick. This block is cleaved to wafers of the desired thickness, x-ray-evaluated for ''d'' spacing and greatest intensity, bent to the required radius, and then acid-etched to remove foreign material. The diffraction and dispersion characteristics of a wafer are analyzed using well-collimated tungsten x rays that strike the crystal and are diffracted onto no-screen x-ray film. If the crystal is satisfactory, it is mounted in a spectrogoniometer and rotated through an x-ray beam while a detector is set at the optimized angle for the diffracted x rays. The average intensity across the length of the crystal is recorded by multichannel scaling. Any imperfections appear as peaks or dips compared to the average intensity. The crystal next goes to a 10-channel, filter-fluorescer x-ray unit that compares zero-order intensity to diffracted Kα and Kβ intensity. Counts for 100-s intervals are taken in groups of three and averaged. Correction factors for instrument geometry, air, pinhole diameter at zero order, Kα-Kβ, barometric pressure, temperature, etc., are added to the efficiency calculations to obtain the crystal efficiency (epsilon) vs keV data. The crystal is mounted in the spectrograph or spectrometer and calibrated to either the detector or film plane by using direct radiation with proper x-ray filters or absorbers. The crystal is then ready for use

  1. In vacuo X-ray data collection from graphene-wrapped protein crystals

    International Nuclear Information System (INIS)

    Warren, Anna J.; Crawshaw, Adam D.; Trincao, Jose; Aller, Pierre; Alcock, Simon; Nistea, Ioana; Salgado, Paula S.; Evans, Gwyndaf

    2015-01-01

    A method is reported for collecting room-temperature data from protein crystals under vacuum by protecting them with a thin graphene layer. The measurement of diffraction data from macromolecular crystal samples held in vacuo holds the promise of a very low X-ray background and zero absorption of incident and scattered beams, leading to better data and the potential for accessing very long X-ray wavelengths (>3 Å) for native sulfur phasing. Maintaining the hydration of protein crystals under vacuum is achieved by the use of liquid jets, as with serial data collection at free-electron lasers, or is side-stepped by cryocooling the samples, as implemented at new synchrotron beamlines. Graphene has been shown to protect crystals from dehydration by creating an extremely thin layer that is impermeable to any exchanges with the environment. Furthermore, owing to its hydrophobicity, most of the aqueous solution surrounding the crystal is excluded during sample preparation, thus eliminating most of the background caused by liquid. Here, it is shown that high-quality data can be recorded at room temperature from graphene-wrapped protein crystals in a rough vacuum. Furthermore, it was observed that graphene protects crystals exposed to different relative humidities and a chemically harsh environment

  2. In vacuo X-ray data collection from graphene-wrapped protein crystals

    Energy Technology Data Exchange (ETDEWEB)

    Warren, Anna J. [Diamond Light Source, Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom); Crawshaw, Adam D. [Newcastle University, Newcastle upon Tyne NE2 4HH (United Kingdom); Trincao, Jose; Aller, Pierre; Alcock, Simon; Nistea, Ioana [Diamond Light Source, Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom); Salgado, Paula S. [Newcastle University, Newcastle upon Tyne NE2 4HH (United Kingdom); Evans, Gwyndaf, E-mail: gwyndaf.evans@diamond.ac.uk [Diamond Light Source, Harwell Science and Innovation Campus, Didcot OX11 0DE (United Kingdom)

    2015-09-26

    A method is reported for collecting room-temperature data from protein crystals under vacuum by protecting them with a thin graphene layer. The measurement of diffraction data from macromolecular crystal samples held in vacuo holds the promise of a very low X-ray background and zero absorption of incident and scattered beams, leading to better data and the potential for accessing very long X-ray wavelengths (>3 Å) for native sulfur phasing. Maintaining the hydration of protein crystals under vacuum is achieved by the use of liquid jets, as with serial data collection at free-electron lasers, or is side-stepped by cryocooling the samples, as implemented at new synchrotron beamlines. Graphene has been shown to protect crystals from dehydration by creating an extremely thin layer that is impermeable to any exchanges with the environment. Furthermore, owing to its hydrophobicity, most of the aqueous solution surrounding the crystal is excluded during sample preparation, thus eliminating most of the background caused by liquid. Here, it is shown that high-quality data can be recorded at room temperature from graphene-wrapped protein crystals in a rough vacuum. Furthermore, it was observed that graphene protects crystals exposed to different relative humidities and a chemically harsh environment.

  3. Mechanical design of thin-film diamond crystal mounting apparatus for coherence preservation hard x-ray optics

    Energy Technology Data Exchange (ETDEWEB)

    Shu, Deming, E-mail: shu@aps.anl.gov; Shvyd’ko, Yuri V.; Stoupin, Stanislav; Kim, Kwang-Je [Advanced Photon Source, Argonne National Laboratory, Argonne, IL 60439, U.S.A (United States)

    2016-07-27

    A new thin-film diamond crystal mounting apparatus has been designed at the Advanced Photon Source (APS) for coherence preservation hard x-ray optics with optimized thermal contact and minimized crystal strain. This novel mechanical design can be applied to new development in the field of: x-ray optics cavities for hard x-ray free-electron laser oscillators (XFELOs), self-seeding monochromators for hard x-ray free-electron laser (XFEL) with high average thermal loading, high heat load diamond crystal monochromators and beam-sharing/beam-split-and-delay devices for XFEL facilities and future upgraded high-brightness coherent x-ray source in the MBA lattice configuration at the APS.

  4. Structure of sodium above 100 GPa by single-crystal x-ray diffraction.

    Science.gov (United States)

    McMahon, M I; Gregoryanz, E; Lundegaard, L F; Loa, I; Guillaume, C; Nelmes, R J; Kleppe, A K; Amboage, M; Wilhelm, H; Jephcoat, A P

    2007-10-30

    At pressures above a megabar (100 GPa), sodium crystallizes in a number of complex crystal structures with unusually low melting temperatures, reaching as low as 300 K at 118 GPa. We have utilized this unique behavior at extreme pressures to grow a single crystal of sodium at 108 GPa, and have investigated the complex crystal structure at this pressure using high-intensity x-rays from the new Diamond synchrotron source, in combination with a pressure cell with wide angular apertures. We confirm that, at 108 GPa, sodium is isostructural with the cI16 phase of lithium, and we have refined the full crystal structure of this phase. The results demonstrate the extension of single-crystal structure refinement beyond 100 GPa and raise the prospect of successfully determining the structures of yet more complex phases reported in sodium and other elements at extreme pressures.

  5. Synthesis of new nano Schiff base complexes: X-ray crystallography ...

    African Journals Online (AJOL)

    This study presents synthesis and characterization of new nano uranyl Schiff base complexes. Electrochemistry of these complexes showed a quasireversible redox reaction without any successive reactions. Furthermore, X-ray crystallography exhibited that beside the coordination of tetradentate Schiff base, one solvent ...

  6. X-ray absorption spectroscopy investigation of structurally modified lithium niobate crystals

    Energy Technology Data Exchange (ETDEWEB)

    Vitova, Tonya

    2008-02-15

    The type and concentration of impurity centers in different valence states are crucial for tuning the photorefractive properties of doped Lithium Niobate (LN) crystals. X-ray Absorption Spectroscopy (XAS) is an appropriate tool for studying the local structure of impurity centers. XAS combined with absorption in UV/VIS/IR and High Resolution X-ray Emission Spectroscopy (HRXES) provide information about the valence state of the dopant ions in as-grown, reduced or oxidized doped LN crystals. Cu (Cu{sup 1+} and Cu{sup 2+}) and Fe (Fe{sup 2+} and Fe{sup 3+}) atoms are found in two different valence states, whereas there are indications for a third Mn valency, in addition to Mn{sup 2+} and Mn{sup 3+} in manganese-doped LN crystals. One of the charge compensation mechanisms during reduction of copper- doped LN crystals is outgassing of oxygen atoms. Cu ions in the reduced crystals have at least two different site symmetries: twofold (Cu{sup 1+}) and sixfold (Cu{sup 2+}) coordinated by O atoms. Fe and Mn atoms are coordinated by six O atoms. Cu and Fe ions are found to occupy only Li sites, whereas Mn ions are also incorporated into Li and Nb sites. The refractive index change in LN crystals irradiated with {sup 3}He{sup 2+} ions is caused by structurally disordered centers, where Nb atoms are displaced from normal crystallographic sites and Li or/and O vacancies are present. (orig.)

  7. In vacuo X-ray data collection from graphene-wrapped protein crystals

    Science.gov (United States)

    Warren, Anna J.; Crawshaw, Adam D.; Trincao, Jose; Aller, Pierre; Alcock, Simon; Nistea, Ioana; Salgado, Paula S.; Evans, Gwyndaf

    2015-01-01

    The measurement of diffraction data from macromolecular crystal samples held in vacuo holds the promise of a very low X-ray background and zero absorption of incident and scattered beams, leading to better data and the potential for accessing very long X-ray wavelengths (>3 Å) for native sulfur phasing. Maintaining the hydration of protein crystals under vacuum is achieved by the use of liquid jets, as with serial data collection at free-electron lasers, or is side-stepped by cryocooling the samples, as implemented at new synchrotron beamlines. Graphene has been shown to protect crystals from dehydration by creating an extremely thin layer that is impermeable to any exchanges with the environment. Furthermore, owing to its hydrophobicity, most of the aqueous solution surrounding the crystal is excluded during sample preparation, thus eliminating most of the background caused by liquid. Here, it is shown that high-quality data can be recorded at room temperature from graphene-wrapped protein crystals in a rough vacuum. Furthermore, it was observed that graphene protects crystals exposed to different relative humidities and a chemically harsh environment. PMID:26457431

  8. Improved X-ray diffraction from Bacillus megaterium penicillin G acylase crystals through long cryosoaking dehydration

    International Nuclear Information System (INIS)

    Rojviriya, Catleya; Pratumrat, Thunyaluck; Saper, Mark A.; Yuvaniyama, Jirundon

    2011-01-01

    Penicillin G acylase from the Gram-positive bacterium B. megaterium was crystallized and X-ray diffraction from these crystals could be substantially improved by slight dehydration through a long cryo-soak. Penicillin G acylase from Bacillus megaterium (BmPGA) is currently used in the pharmaceutical industry as an alternative to PGA from Escherichia coli (EcPGA) for the hydrolysis of penicillin G to produce 6-aminopenicillanic acid (6-APA), a penam nucleus for semisynthetic penicillins. Despite the significant differences in amino-acid sequence between PGAs from Gram-positive and Gram-negative bacteria, a representative PGA structure of Gram-positive origin has never been reported. In this study, crystallization and diffraction studies of BmPGA are described. Poor diffraction patterns with blurred spots at higher resolution were typical for BmPGA crystals cryocooled after a brief immersion in cryoprotectant solution. Overnight soaking in the same cryo-solution substantially improved both the mosaicity and resolution limit through the establishment of a new crystal-packing equilibrium. A crystal of BmPGA diffracted X-rays to 2.20 Å resolution and belonged to the monoclinic space group P2 1 with one molecule of BmPGA in the asymmetric unit

  9. Crystallization and preliminary X-ray data of the FadA adhesin from Fusobacterium nucleatum

    International Nuclear Information System (INIS)

    Nithianantham, Stanley; Xu, Minghua; Wu, Nan; Han, Yiping W.; Shoham, Menachem

    2006-01-01

    The FadA adhesin from F. nucleatum, which is involved in bacterial attachment and invasion of human oral epithelial cells, has been crystallized in space group P6 1 or P6 5 , and X-ray data have been collected to 1.9 Å resolution. Fusobacterium nucleatum is a Gram-negative anaerobe prevalent in the oral cavity that is associated with periodontal disease, preterm birth and infections in other parts of the human body. The bacteria attach to and invade epithelial and endothelial cells in the gum tissue and elsewhere via a 13.7 kDa adhesin protein FadA (Fusobacterium adhesin A). FadA exists in two forms: the intact form (pre-FadA), consisting of 129 amino acids, and the mature form (mFadA), which lacks an 18-residue signal sequence. Both forms have been expressed in Escherichia coli and purified. mFadA has been crystallized. The crystals belong to the hexagonal space group P6 1 or P6 5 , with unit-cell parameters a = b = 59.3, c = 125.7 Å and one molecule per asymmetric unit. The crystals exhibit an unusually high solvent content of 74%. Synchrotron X-ray data have been collected to 1.9 Å. The crystals are suitable for X-ray structure determination. The crystal structure of FadA may provide a basis for the development of therapeutic agents to combat periodontal disease and other infections associated with F. nucleatum

  10. Crystallization and preliminary X-ray data of the FadA adhesin from Fusobacterium nucleatum

    Energy Technology Data Exchange (ETDEWEB)

    Nithianantham, Stanley [Department of Biochemistry, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4935 (United States); Xu, Minghua [Department of Biological Sciences, School of Dentistry, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4905 (United States); Wu, Nan [Department of Biochemistry, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4935 (United States); Han, Yiping W., E-mail: ywh2@case.edu [Department of Biological Sciences, School of Dentistry, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4905 (United States); Department of Pathology, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106 (United States); Shoham, Menachem, E-mail: ywh2@case.edu [Department of Biochemistry, School of Medicine, Case Western Reserve University, Cleveland, OH 44106-4935 (United States)

    2006-12-01

    The FadA adhesin from F. nucleatum, which is involved in bacterial attachment and invasion of human oral epithelial cells, has been crystallized in space group P6{sub 1} or P6{sub 5}, and X-ray data have been collected to 1.9 Å resolution. Fusobacterium nucleatum is a Gram-negative anaerobe prevalent in the oral cavity that is associated with periodontal disease, preterm birth and infections in other parts of the human body. The bacteria attach to and invade epithelial and endothelial cells in the gum tissue and elsewhere via a 13.7 kDa adhesin protein FadA (Fusobacterium adhesin A). FadA exists in two forms: the intact form (pre-FadA), consisting of 129 amino acids, and the mature form (mFadA), which lacks an 18-residue signal sequence. Both forms have been expressed in Escherichia coli and purified. mFadA has been crystallized. The crystals belong to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 59.3, c = 125.7 Å and one molecule per asymmetric unit. The crystals exhibit an unusually high solvent content of 74%. Synchrotron X-ray data have been collected to 1.9 Å. The crystals are suitable for X-ray structure determination. The crystal structure of FadA may provide a basis for the development of therapeutic agents to combat periodontal disease and other infections associated with F. nucleatum.

  11. Effects of crystal defects on the diffuse scattering of X-rays

    International Nuclear Information System (INIS)

    Kremser, R.

    1974-01-01

    This thesis concerns with the influence of crystal defects in germanium-drifted silicium and in α=quartz on the intensity of the diffuse X-ray scattering. The experiments were performed at low and high temperatures to show the effect of the atomic thermal motion on the intensity of the diffuse maxima. The comparison of the results for pure silicium and for the germanium-drifted crystal gives information about the relation between the frequency-spectra and the defects of the drifted silicium. For α-quarts it was not possible to relate unequivocally the observed changes in the intensity to individual defects. (C.R.)

  12. X-ray plane-wave diffraction effects in a crystal with third-order nonlinearity

    Energy Technology Data Exchange (ETDEWEB)

    Balyan, M. K., E-mail: mbalyan@ysu.am [Yerevan State University, Faculty of Physics (Armenia)

    2016-12-15

    The two-wave dynamical diffraction in the Laue geometry has been theoretically considered for a plane X-ray wave in a crystal with a third-order nonlinear response to the external field. An analytical solution to the problem stated is found for certain diffraction conditions. A nonlinear pendulum effect is analyzed. The nonlinear extinction length is found to depend on the incident-wave intensity. A pendulum effect of a new type is revealed: the intensities of the transmitted and diffracted waves periodically depend on the incidentwave intensity at a fixed crystal thickness. The rocking curves and Borrmann nonlinear effect are numerically calculated.

  13. Local layer structure of smectic liquid crystals by X-ray micro-diffraction

    CERN Document Server

    Takanishi, Y

    2003-01-01

    The local layer structure of smectic liquid crystal has been measured using time-resolved synchrotron X-ray micro-diffraction. Typical layer disorders observed in surface stabilized (anti-) ferroelectric liquid crystals, i.e. a stripe texture, a needed-like defect and a zigzag defect, are directly analyzed. The detailed analysis slows that the surface anchoring force due to the interaction between the liquid crystal molecule and the alignment thin film plays an important role to realize both the static and dynamic local layer structures. The layer structure of the circular domain observed in the liquid crystal of bent-shaped molecules found to depend on the applied electric field though the optical micrograph shows little difference. The frustrated, double and single layer structures of the bent-shaped molecule liquid crystal are determined depending on the terminal alkyl chain length. (author)

  14. Crystallization and preliminary X-ray crystallographic analysis of peptide deformylase from Pseudomonas aeruginosa.

    Science.gov (United States)

    Kim, Hyung-Wook; Han, Byung Woo; Yoon, Hye-Jin; Yang, Jin Kuk; Lee, Byung Il; Lee, Hyung Ho; Ahn, Hyung Jun; Suh, Se Won

    2002-10-01

    Peptide deformylase (PDF) from the pathogenic bacterium Pseudomonas aeruginosa has been overexpressed in Escherichia coli and crystallized in the presence of its inhibitor actinonin at 297 K using polyethylene glycol (PEG) 4000 as a precipitant. The diffraction limit and the spot shape of the crystals could be slightly improved by the crystal annealing/dehydration procedure. X-ray diffraction data to 1.85 A have been collected using synchrotron radiation. The crystal belongs to the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a = 68.75, b = 74.46, c = 77.18 A. The asymmetric unit contains two subunits of peptide deformylase, with a corresponding crystal volume per protein mass (V(M)) of 2.45 A(3) Da(-1) and a solvent content of 49.8%.

  15. Multiple x-ray diffraction applied to the study of crystal impurities

    International Nuclear Information System (INIS)

    Cardoso, L.P.

    1983-06-01

    The x-ray multiple diffraction technique is used in the study of impurities concentration and localization in the crystal lattice, implemented with the fundamental observation that the impurities cannot be distributed with the same spatial group symmetry of the crystal. This fact could introduce scattered intensity in the crystal reciprocal lattice forbidden nodes. This effect was effectively observed in multiple diffraction diagrams, where a reinforcement of the scattered intensity in the pure crystal is produced, when choosing conveniently the involved reflections. The reflectivity theory was developed in the kinematic case, which take into account the scattering by the impurities atoms, and the analysis showed that, in the first approximation, the impurities can influence both in the allowed and forbidden positions for the pure crystal. (L.C.J.A.)

  16. Ultra-small-angle x-ray scattering by single-crystal Al deformed in situ

    Science.gov (United States)

    Long, Gabrielle; Levine, Lyle

    1997-03-01

    Among the earliest small-angle x-ray scattering and small-angle neutron scattering experiments were attempts to study dislocation structures. These structures have proven to be very difficult to measure because of the intrinsically low contrast of the microstructure, and the requirement that multiple Bragg diffraction be strictly avoided. Thus, many attempts to measure dislocation structures have been compromised by these difficulties. We present results from ultra-small-angle x-ray scattering measurements on single-crystal Al, deformed in situ on beam line X23A3 at the National Synchrotron Light Source. Radiographic images, which are in the O-beam position for diffraction, were taken of the scattering volume. The Al crystal was also rotated to ensure that the scattering data would be accumulated in a region sufficiently distant from accidental Bragg diffractions. Stress-strain data were obtained simultaneously with the x-ray scattering data. We report on the evolution of dislocation structures from 0% strain to 18% strain.

  17. Nd-doped Lu3Al5O12 single-crystal scintillator for X-ray imaging

    International Nuclear Information System (INIS)

    Sugiyama, Makoto; Fujimoto, Yutaka; Yanagida, Takayuki; Totsuka, Daisuke; Chani, Valery; Yokota, Yuui; Yoshikawa, Akira

    2013-01-01

    The optical and scintillation properties of Nd-doped Lu 3 Al 5 O 12 (Nd:LuAG) crystals grown by the Czochralski (Cz) method were examined under X-ray excitation. Their applicability for X-ray imaging was also inspected. The radioluminescence spectrum induced by X-rays showed a broad host emission and sharp Nd 3+ 4f–4f emission peaks in the UV to visible wavelengths. The light output current of the Nd:LuAG was 85% of that of a standard CdWO 4 X-ray scintillator. The afterglow value measured 20 ms after X-ray irradiation was 1.5%. An X-ray radiographic image was successfully obtained using the Nd:LuAG scintillator coupled with the charge coupled device (CCD) photodetector. -- Highlights: ► The Nd:LuAG single crystal was produced to perform X-ray imaging test. ► The sample exhibited the 85% light output current of the standard CdWO 4 . ► The afterglow intensity of the sample was very high compared with the CdWO 4 . ► The X-ray radiographic image was obtained from the Nd:LuAG single crystal

  18. Lightweight and High-Resolution Single Crystal Silicon Optics for X-ray Astronomy

    Science.gov (United States)

    Zhang, William W.; Biskach, Michael P.; Chan, Kai-Wing; Mazzarella, James R.; McClelland, Ryan S.; Riveros, Raul E.; Saha, Timo T.; Solly, Peter M.

    2016-01-01

    We describe an approach to building mirror assemblies for next generation X-ray telescopes. It incorporates knowledge and lessons learned from building existing telescopes, including Chandra, XMM-Newton, Suzaku, and NuSTAR, as well as from our direct experience of the last 15 years developing mirror technology for the Constellation-X and International X-ray Observatory mission concepts. This approach combines single crystal silicon and precision polishing, thus has the potential of achieving the highest possible angular resolution with the least possible mass. Moreover, it is simple, consisting of several technical elements that can be developed independently in parallel. Lastly, it is highly amenable to mass production, therefore enabling the making of telescopes of very large photon collecting areas.

  19. NXDC-neutron and x-ray diffraction code for crystal structures calculations

    International Nuclear Information System (INIS)

    Abbas, Y.; El-Sherif, A.

    1982-01-01

    A computer program NXDC for the calculations of neutron diffraction and x-ray diffraction intensities is reported. The program is very flexible and allows the intensity of a reflection with a given Miller indices to be calculated if the unit cell and its contents are specified together with the equipement used Neutrons or X-rays-and if necessary introducing temperature and absorption factors corrections. For the refinement of crystal structures provision is made for the comparison of the calculated intensities and the intergrated intensities observed from the diffraction diagrams using the least-squares analysis to obtain the reliability factor R. The program is written in FORTRAN Iv and is very suitable for minicomputers

  20. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    Energy Technology Data Exchange (ETDEWEB)

    Kiyota, Eduardo [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Sousa, Sylvia Morais de [Centro de Biologia Molecular e Engenharia Genética, Universidade Estadual de Campinas, Campinas-SP (Brazil); Santos, Marcelo Leite dos; Costa Lima, Aline da [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil); Menossi, Marcelo [Departamento de Genética e Evolução, Instituto de Biologia, Universidade Estadual de Campinas, Campinas-SP (Brazil); Yunes, José Andrés [Laboratório de Biologia Molecular, Centro Infantil Boldrini, Campinas-SP (Brazil); Aparicio, Ricardo, E-mail: aparicio@iqm.unicamp.br [Laboratório de Biologia Estrutural, Instituto de Química, Universidade Estadual de Campinas, CP 6154, 13083-970 Campinas-SP (Brazil)

    2007-11-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR.

  1. Combined neutron and X-ray diffraction studies of DNA in crystals and solutions.

    Science.gov (United States)

    Leal, Ricardo M F; Callow, Shirley; Callow, Phil; Blakeley, Matthew P; Cardin, Christine J; Denny, William A; Teixeira, Susana C M; Mitchell, Edward P; Forsyth, V Trevor

    2010-11-01

    Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

  2. Crystallization and preliminary X-ray diffraction analysis of maize aldose reductase

    International Nuclear Information System (INIS)

    Kiyota, Eduardo; Sousa, Sylvia Morais de; Santos, Marcelo Leite dos; Costa Lima, Aline da; Menossi, Marcelo; Yunes, José Andrés; Aparicio, Ricardo

    2007-01-01

    Preliminary X-ray diffraction studies of apo maize aldose reductase at 2.0 Å resolution are reported. Maize aldose reductase (AR) is a member of the aldo-keto reductase superfamily. In contrast to human AR, maize AR seems to prefer the conversion of sorbitol into glucose. The apoenzyme was crystallized in space group P2 1 2 1 2 1 , with unit-cell parameters a = 47.2, b = 54.5, c = 100.6 Å and one molecule in the asymmetric unit. Synchrotron X-ray diffraction data were collected and a final resolution limit of 2.0 Å was obtained after data reduction. Phasing was carried out by an automated molecular-replacement procedure and structural refinement is currently in progress. The refined structure is expected to shed light on the functional/enzymatic mechanism and the unusual activities of maize AR

  3. Measurement of the energy distribution of parametric X-ray radiation from a double-crystal system

    International Nuclear Information System (INIS)

    Mori, Akira; Hayakawa, Yasushi; Kidokoro, Akio; Sato, Isamu; Tanaka, Toshinari; Hayakawa, Ken; Kobayashi, Kouji; Ohshima, Hisashi

    2006-01-01

    A parametric X-ray radiation (PXR) generator system was developed at the Laboratory for Electron Beam Research and Applications (LEBRA) at Nihon University; this PXR generator system is a tunable wavelength and quasi-monochromatic X-ray source constructed as one of the advanced applications of the LEBRA 125-MeV electron linear accelerator. The PXR beam which has characteristic of energy distribution. The theoretical values of energy distribution obtained at the output port were calculated to be approximately 300 eV and 2 keV at the central X-ray energies of 7 keV and 20 keV, respectively. In order to investigate the energy distribution, several measurements of the X-ray energy were carried out. The X-ray absorption of known materials and that of thin aluminum has been evaluated based on analyses of images taken using an imaging plate. The X-ray energy was deduced base on the identification of the absorption edges, and the energy distribution was estimated based on measurements using aluminum step method. In addition, an X-ray diffraction method using a perfect silicon crystal was employed, and spectra were measured using a solid state detector (SSD). The results of these experiments agreed with the calculated results. In particular, the well-defined absorption edges in the X-ray images and the typical rocking curves obtained by the measurement of the X-ray diffraction indicated that the distribution has a high-energy resolution

  4. Solvent structure in crystals of trypsin determined by X-ray and neutron diffraction.

    Science.gov (United States)

    Finer-Moore, J S; Kossiakoff, A A; Hurley, J H; Earnest, T; Stroud, R M

    1992-03-01

    The solvent structure in orthorhombic crystals of bovine trypsin has been independently determined by X-ray diffraction to 1.35 A resolution and by neutron diffraction to 2.1 A resolution. A consensus model of the water molecule positions was obtained using oxygen positions identified in the electron density map determined by X-ray diffraction, which were verified by comparison to D2O-H2O difference neutron scattering density. Six of 184 water molecules in the X-ray structure, all with B-factors greater than 50 A2, were found to be spurious after comparison with neutron results. Roughly two-thirds of the water of hydration expected from thermodynamic data for proteins was localized by neutron diffraction; approximately one-half of the water of hydration was located by X-ray diffraction. Polar regions of the protein are well hydrated, and significant D2O-H2O difference density is seen for a small number of water molecules in a second shell of hydration. Hydrogen bond lengths and angles calculated from unconstrained refinement of water positions are distributed about values typically seen in small molecule structures. Solvent models found in seven other bovine trypsin and trypsinogen and rat trypsin structures determined by X-ray diffraction were compared. Internal water molecules are well conserved in all trypsin structures including anionic rat trypsin, which is 65% homologous to bovine trypsin. Of the 22 conserved waters in trypsin, 19 were also found in trypsinogen, suggesting that they are located in regions of the apoprotein that are structurally conserved in the transition to the mature protein. Seven waters were displaced upon activation of trypsinogen. Water structure at crystal contacts is not generally conserved in different crystal forms. Three groups of integral structural water molecules are highly conserved in all solvent structures, including a spline of water molecules inserted between two beta-strands, which may resemble an intermediate in the

  5. Radiation decay of thaumatin crystals at three X-ray energies.

    Science.gov (United States)

    Liebschner, Dorothee; Rosenbaum, Gerold; Dauter, Miroslawa; Dauter, Zbigniew

    2015-04-01

    Radiation damage is an unavoidable obstacle in X-ray crystallographic data collection for macromolecular structure determination, so it is important to know how much radiation a sample can endure before being degraded beyond an acceptable limit. In the literature, the threshold at which the average intensity of all recorded reflections decreases to a certain fraction of the initial value is called the `dose limit'. The first estimated D50 dose-limit value, at which the average diffracted intensity was reduced to 50%, was 20 MGy and was derived from observing sample decay in electron-diffraction experiments. A later X-ray study carried out at 100 K on ferritin protein crystals arrived at a D50 of 43 MGy, and recommended an intensity reduction of protein reflections to 70%, D70, corresponding to an absorbed dose of 30 MGy, as a more appropriate limit for macromolecular crystallography. In the macromolecular crystallography community, the rate of intensity decay with dose was then assumed to be similar for all protein crystals. A series of diffraction images of cryocooled (100 K) thaumatin crystals at identical small, 2° rotation intervals were recorded at X-ray energies of 6.33 , 12.66 and 19.00 keV. Five crystals were used for each wavelength. The decay in the average diffraction intensity to 70% of the initial value, for data extending to 2.45 Å resolution, was determined to be about 7.5 MGy at 6.33 keV and about 11 MGy at the two higher energies.

  6. Cloning, Expression, Purification, Crystallization and Preliminary X-ray Analysis of Mycoplasma Genitalium Protein MG289

    Energy Technology Data Exchange (ETDEWEB)

    Sippel, K.; Boehlein, S; Sakai, Y; Quirit, J; Agbandje-McKenna, M; Rosser, C; McKenna, R

    2009-01-01

    Mycoplasma genitalium is a human pathogen that is associated with nongonococcal urethritis in men and cervicitis in women. The cloning, expression, purification and crystallization of the protein MG289 from M. genitalium strain G37 are reported here. Crystals of MG289 diffracted X-rays to 2.8 {angstrom} resolution. The crystals belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.7, b = 90.9, c = 176.1 {angstrom}. The diffraction data after processing had an overall R{sub merge} of 8.7%. The crystal structure of Cypl, the ortholog of MG289 from M. hyorhinis, has recently been determined, providing a reasonable phasing model; molecular replacement is currently under way.

  7. Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Minglian; Li, Zhenguo; Zheng, Wei; Lou, Zhiyong [MOE Key Laboratory of Protein Science, Department of Biological Sciences and Biotechnology, Tsinghua University, Beijing 100084 (China); Chen, Guo-Qiang, E-mail: chengq@stu.edu.cn [MOE Key Laboratory of Protein Science, Department of Biological Sciences and Biotechnology, Tsinghua University, Beijing 100084 (China); Multidisciplinary Research Center, Shantou University, Shantou 515063, Guangdong (China)

    2006-08-01

    The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

  8. Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

    International Nuclear Information System (INIS)

    Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis

    2009-01-01

    Recombinant V. cholerae EpsG has been expressed, purified and crystallized. The crystals diffracted to 2.26 Å resolution. EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 Å and belonged to space group P2 1 , with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 Å

  9. Tunable hard X-ray spectrometer utilizing asymmetric planes of a quartz transmission crystal

    International Nuclear Information System (INIS)

    Seely, John F.; Feldman, Uri; Henins, Albert

    2016-01-01

    A Cauchois type hard x-ray spectrometer was developed that utilizes the (301) diffraction planes at an asymmetric angle of 23.51° to the normal to the surface of a cylindrically curved quartz transmission crystal. The energy coverage is tunable by rotating the crystal and the detector arm, and spectra were recorded in the 8 keV to 20 keV range with greater than 2000 resolving power. The high resolution results from low aberrations enabled by the nearly perpendicular angle of the diffracted rays with the back surface of the crystal. By using other asymmetric planes of the same crystal and rotating to selected angles, the spectrometer can operate with high resolution up to 50 keV.

  10. Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

    Energy Technology Data Exchange (ETDEWEB)

    Abramchik, Yu. A., E-mail: inna@ns.crys.ras.ru; Timofeev, V. I., E-mail: espiov@ibch.ru; Zhukhlistova, N. E., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Muravieva, T. I.; Esipov, R. S. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

    2015-07-15

    Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamer is the biological active form of E. coli. purine nucleoside phosphorylase.

  11. Characterization of barite and crystal glass as attenuators in X-ray and gamma radiation shieldings

    International Nuclear Information System (INIS)

    Almeida Junior, Airton Tavares de

    2005-03-01

    Aiming to determine the barium sulphate (BaSO 4 ) ore and crystal glass attenuation features, both utilized as shieldings against ionizing X and gamma radiations in radiographic installations, a study of attenuation using barite plaster and barite concrete was carried out, which are used, respectively, on wall coverings and in block buildings. The crystal glass is utilized in screens and in windows. To do so, ten plates of barite plaster and three of barite concrete with 900 cm 2 and with an average thickness ranging from 1 to 5 cm, and three plates of crystal glass with 323 cm 2 and with thicknesses of 1, 2 and 4 cm were analyzed. The samples were irradiated with X-rays with potentials of 60, 80, 110 and 150 kilovolts, and also with 60 Co gamma rays. Curves of attenuation were obtained for barite plaster and barite concrete (mGy/mA.min) and (mGy/h), both at 1 meter, as a function of thickness and curve of transmission through barite plaster and barite concrete as a function of the thickness. The equivalent thicknesses of half and tenth value layers for barite plaster, barite concrete and crystal glass for all X-Ray energies were also determined. (author)

  12. Crystallization and preliminary X-ray studies of azoreductases from Bacillus sp. B29

    International Nuclear Information System (INIS)

    Ogata, Daiki; Ooi, Toshihiko; Fujiwara, Takaaki; Taguchi, Seiichi; Tanaka, Isao; Yao, Min

    2010-01-01

    In order to determine the structure–function relationship of the azo-dye reduction mechanism, an X-ray crystallographic study of azoreductases was performed. Selenomethionine-labelled AzrA (SeMet-AzrA) and AzrC were crystallized by the hanging-drop vapour-diffusion method. Azoreductases from Bacillus sp. B29 are NADH-dependent flavoenzymes which contain a flavin mononucleotide (FMN) as a prosthetic group and exist as homodimers composed of 23 kDa subunits. These enzymes catalyze the reductive degradation of various azo compounds by a ping-pong mechanism. In order to determine the structure–function relationship of the azo-dye reduction mechanism, an X-ray crystallographic study of azoreductases was performed. Selenomethionine-labelled AzrA (SeMet-AzrA) and AzrC were crystallized by the hanging-drop vapour-diffusion method. A crystal of SeMet-AzrA diffracted to 2.0 Å resolution and was determined to belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 56.9, b = 69.0, c = 105.4 Å. The native crystals of AzrC belonged to space group C2, with unit-cell parameters a = 192.0, b = 56.6, c = 105.5 Å, β = 115.7°, and diffracted to 2.21 Å resolution

  13. Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, Leandra; Nascimento, Alessandro S. [Instituto de Física de São Carlos, Departamento de Física e Informática, Universidade de São Paulo, Avenida Trabalhador São Carlense 400, CEP 13566-590 São Carlos, SP (Brazil); Zamorano, Laura S. [Departamento de Química Física, Facultad de Química, Universidad de Salamanca, 37008 Salamanca (Spain); Shnyrov, Valery L. [Departamento de Bioquímica y Biología Molecular, Facultad de Biología, Universidad de Salamanca, 37007 Salamanca (Spain); Polikarpov, Igor, E-mail: ipolikarpov@if.sc.usp.br [Instituto de Física de São Carlos, Departamento de Física e Informática, Universidade de São Paulo, Avenida Trabalhador São Carlense 400, CEP 13566-590 São Carlos, SP (Brazil); Laboratório Nacional de Luz Síncrotron, Campinas, SP (Brazil)

    2007-09-01

    The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.

  14. Smectic Liquid Crystal-Nanoparticle arrangement observed with X-ray Scattering

    Science.gov (United States)

    Martinez-Miranda, Luz J.; Romero-Hasler, Patricio; Meneses-Franco, Ariel; Soto-Bustamante, Eduardo A.

    We observed the alignment of two different monomeric liquid crystals combined with TiO2in a concentration of 0.3 wt of TiO2. The liquid crystals are M6R8 and I6R8. These two monomeric compounds have a crystal-SmC-SmA-isotropic phase progression. The two monomeric compounds differ in the final group at the end of one of the carbon chains. The nanoparticle ties itself to the monomers through hydrogen bonding. The difference in the final group determines where the nanoparticle attaches to the liquid crystal molecule. This difference in the way it attaches can be observed using X-ray scattering. The way the nanoparticle attaches has consequences in the current-voltage curve obtained. Under the influence of an electric field, the M6R8 polymerizes. We observe by X-ray scattering that the nanoparticles migrate and the scan is very similar to the scan of the I6R8 monomer with the nanoparticle. In addition the nanoparticle is ordered along one direction and does not seem as ordered in the direction perpendicular to this direction. This work supported by grant NSF- OISE-1157589 in the USA and grant Fondecyt 1130187 in Chile.

  15. Some Aspects of Crystal Centering During X-ray High-throughput Protein Crystallography Experiment

    Science.gov (United States)

    Gaponov, Yu. A.; Matsugaki, N.; Sasajima, K.; Igarashi, N.; Wakatsuki, S.

    A set of algorithms and procedures of a crystal loop centering during X-ray high-throughput protein crystallography experiment has been designed and developed. A simple algorithm of the crystal loop detection and preliminary recognition has been designed and developed. The crystal loop detection algorithm is based on finding out the crystal loop ending point (opposite to the crystal loop pin) using image cross section (digital image column) profile analysis. The crystal loop preliminary recognition procedure is based on finding out the crystal loop sizes and position using image cross section profile analysis. The crystal loop fine recognition procedure based on Hooke-Jeeves pattern search method with an ellipse as a fitting pattern has been designed and developed. The procedure of restoring missing coordinate of the crystal loop is described. Based on developed algorithms and procedures the optimal auto-centering procedure has been designed and developed. A procedure of optimal manual crystal centering (Two Clicks Procedure) has been designed and developed. Developed procedures have been integrated into control software system PCCS installed at crystallography beamlines Photon Factory BL5A and PF-AR NW12, KEK.

  16. Crystallization and preliminary X-ray diffraction study of the protealysin precursor belonging to the peptidase family M4

    International Nuclear Information System (INIS)

    Gromova, T. Yu.; Demidyuk, I. V.; Kostrov, S. V.; Sosfenov, N. I.; Melik-Adamyan, V. R.; Kuranova, I. P.

    2008-01-01

    A protealysin precursor (the enzyme of the peptidase family M4) was crystallized for the first time. The crystal-growth conditions were found, and single crystals of the protein with dimensions of 0.3-0.5 mm were grown. The preliminary X-ray diffraction study of the enzyme was performed. The protealysin precursor was shown to crystallize in two crystal modifications suitable for the X-ray diffraction study of the three-dimensional structure of the protein molecule at atomic resolution.

  17. Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

    International Nuclear Information System (INIS)

    Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.; Zhukova, Yuliya N.; Voelter, Wolfang; Zaitsev, Viatcheslav N.; Bento, Isabel; Stepanova, Elena V.; Kachalova, Galina S.; Koroleva, Ol’ga V.; Cherkashyn, Evgeniy A.; Tishkov, Vladimir I.; Lamzin, Victor S.; Schirwitz, Katja; Morgunova, Ekaterina Yu.; Betzel, Christian; Lindley, Peter F.; Mikhailov, Al’bert M.

    2006-01-01

    The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccase structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R free = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO 2 substituents

  18. Purification, crystallization and preliminary X-ray study of the fungal laccase from Cerrena maxima

    Energy Technology Data Exchange (ETDEWEB)

    Lyashenko, Andrey V.; Zhukhlistova, Nadegda E.; Gabdoulkhakov, Azat G.; Zhukova, Yuliya N. [A. V. Shubnikov Institute of Crystallography, RAS, Leninskiy Prospect 59, 119333 Moscow (Russian Federation); Voelter, Wolfang [Institute of Biochemistry, University of Tuebingen, Physiologisch-Chemisches Institut, Hoppe-Seyler-Strasse 4, 72076 Tuebingen (Germany); Zaitsev, Viatcheslav N. [University of St Andrews, Centre for Biomolecular Sciences, North Haugh, St Andrews, KY16 9ST,Scotland (United Kingdom); Bento, Isabel [Instituto de Tecnologia Química e Biológica (ITQB), Universidade Nova de Lisboa, Apartado 127, Av. Republica, 2781-901 Oeiras (Portugal); Stepanova, Elena V. [A. N. Bakh Institute of Biochemistry, RAS, Leninskiy Prospect 33, 119071 Moscow (Russian Federation); Kachalova, Galina S. [Institute of Theoretical and Experimental Biophysics of RAS, Institutskaya Street 3, 142290 Puschino, Moscow Region (Russian Federation); Koroleva, Ol’ga V. [A. N. Bakh Institute of Biochemistry, RAS, Leninskiy Prospect 33, 119071 Moscow (Russian Federation); Cherkashyn, Evgeniy A.; Tishkov, Vladimir I. [Department of Chemical Enzymology, M. V. Lomonosov Moscow State University, 119992 Moscow (Russian Federation); Lamzin, Victor S.; Schirwitz, Katja [European Molecular Biology Laboratory, c/o DESY, Notkestrasse 85, 22603 Hamburg (Germany); Morgunova, Ekaterina Yu. [A. V. Shubnikov Institute of Crystallography, RAS, Leninskiy Prospect 59, 119333 Moscow (Russian Federation); Betzel, Christian [University of Hamburg, Institute fur Biochemie und Lebensmittelchemie, Department of Biochemistry and Molecular Biology, c/o DESY, Building 22a, Notkestrasse 85, 22603 Hamburg (Germany); Lindley, Peter F. [Instituto de Tecnologia Química e Biológica (ITQB), Universidade Nova de Lisboa, Apartado 127, Av. Republica, 2781-901 Oeiras (Portugal); Mikhailov, Al’bert M., E-mail: amm@ns.crys.ras.ru [A. V. Shubnikov Institute of Crystallography, RAS, Leninskiy Prospect 59, 119333 Moscow (Russian Federation)

    2006-10-01

    The crystallization and preliminary X-ray structure at 1.9 Å resolution of the fungal laccase from C. maxima are presented. Laccases are members of the blue multi-copper oxidase family that oxidize substrate molecules by accepting electrons at a mononuclear copper centre and transferring them to a trinuclear centre. Dioxygen binds to the trinuclear centre and, following the transfer of four electrons, is reduced to two molecules of water. Crystals of the laccase from Cerrena maxima have been obtained and X-ray data were collected to 1.9 Å resolution using synchrotron radiation. A preliminary analysis shows that the enzyme has the typical laccase structure and several carbohydrate sites have been identified. The carbohydrate chains appear to be involved in stabilization of the intermolecular contacts in the crystal structure, thus promoting the formation of well ordered crystals of the enzyme. Here, the results of an X-ray crystallographic study on the laccase from the fungus Cerrena maxima are reported. Crystals that diffract well to a resolution of at least 1.9 Å (R factor = 18.953%; R{sub free} = 23.835; r.m.s.d. bond lengths, 0.06 Å; r.m.s.d. bond angles, 1.07°) have been obtained despite the presence of glycan moieties. The overall spatial organization of C. maxima laccase and the structure of its copper-containing active centre have been determined by the molecular-replacement method using the laccase from Trametes versicolor (Piontek et al., 2002 ▶) as a structural template. In addition, four glycan-binding sites were identified and the 1.9 Å X-ray data were used to determine the previously unknown primary structure of this protein. The identity (calculated from sequence alignment) between the C. maxima laccase and the T. versicolor laccase is about 87%. Tyr196 and Tyr372 show significant extra density at the ortho positions and this has been interpreted in terms of NO{sub 2} substituents.

  19. Single crystal X-ray structure of the artists' pigment zinc yellow

    Science.gov (United States)

    Simonsen, Kim Pilkjær; Christiansen, Marie Bitsch; Vinum, Morten Gotthold; Sanyova, Jana; Bendix, Jesper

    2017-08-01

    The artists' pigment zinc yellow is in general described as a complex potassium zinc chromate with the empirical formula 4ZnCrO4·K2O·3H2O. Even though the pigment has been in use since the second half of the 19th century also in large-scale industrial applications, the exact structure had hitherto been unknown. In this work, zinc yellow was synthesised by precipitation from an aqueous solution of zinc nitrate and potassium chromate under both neutral and basic conditions, and the products were compared with the pigment used in industrial paints. Analyses by Raman microscopy (MRS), scanning electron microscopy-energy dispersive X-ray spectroscopy (SEM-EDS), attenuated total reflectance-Fourier transform infrared spectroscopy (ATR-FTIR), and powder X-ray diffraction (PXRD), showed that the synthesised products and the industrial pigment were identical. Single-crystal X-ray crystallography determined the structure of zinc yellow as KZn2(CrO4)2(H2O)(OH) or as KZn2(CrO4)2(H3O2) emphasizing the μ-H3O2- moiety. Notably, the zinc yellow is isostructural to the recently structurally characterized cadmium analog and both belong to the natrochalcite structure type.

  20. Determination of Ni(II) crystal structure by powder x-ray diffraction ...

    African Journals Online (AJOL)

    X-ray powder diffraction pattern was used to determine the length of the unit cell, “a”, the lattice structure type, and the number of atoms per unit cell of Ni(II) crystal. The “a” value was determined to be 23.66 ± 0.005 Å, particle size of 34.87 nm, volume 13.24 Å and Strain value ε = 9.8 x 10-3. The cell search on PXRD patterns ...

  1. Computer simulations of X-ray six-beam diffraction in a perfect silicon crystal. I

    Czech Academy of Sciences Publication Activity Database

    Kohn, V.G.; Khikhlukha, Danila

    2016-01-01

    Roč. 72, May (2016), s. 349-356 ISSN 2053-2733 R&D Projects: GA MŠk EF15_008/0000162; GA MŠk ED1.1.00/02.0061 Grant - others:ELI Beamlines(XE) CZ.02.1.01/0.0/0.0/15_008/0000162; ELI Beamlines(XE) CZ.1.05/1.1.00/02.0061 Institutional support: RVO:68378271 Keywords : X-ray diffraction * silicon crystal * six-beam diffraction * section topography * computer simulations Subject RIV: BL - Plasma and Gas Discharge Physics OBOR OECD: Fluids and plasma physics (including surface physics) Impact factor: 5.725, year: 2016

  2. High resolution x-ray and gamma ray imaging using diffraction lenses with mechanically bent crystals

    Science.gov (United States)

    Smither, Robert K [Hinsdale, IL

    2008-12-23

    A method for high spatial resolution imaging of a plurality of sources of x-ray and gamma-ray radiation is provided. High quality mechanically bent diffracting crystals of 0.1 mm radial width are used for focusing the radiation and directing the radiation to an array of detectors which is used for analyzing their addition to collect data as to the location of the source of radiation. A computer is used for converting the data to an image. The invention also provides for the use of a multi-component high resolution detector array and for narrow source and detector apertures.

  3. Crystallization and preliminary X-ray diffraction analysis of recombinant hepatitis E virus-like particle

    International Nuclear Information System (INIS)

    Wang, Che-Yen; Miyazaki, Naoyuki; Yamashita, Tetsuo; Higashiura, Akifumi; Nakagawa, Atsushi; Li, Tian-Cheng; Takeda, Naokazu; Xing, Li; Hjalmarsson, Erik; Friberg, Claes; Liou, Der-Ming; Sung, Yen-Jen; Tsukihara, Tomitake; Matsuura, Yoshiharu; Miyamura, Tatsuo; Cheng, R. Holland

    2008-01-01

    A recombinant virus-like particle that is a potential oral hepatitis E vaccine was crystallized. Diffraction data were collected to 8.3 Å resolution and the X-ray structure was phased with the aid of a low-resolution density map determined using cryo-electron microscopy data. Hepatitis E virus (HEV) accounts for the majority of enterically transmitted hepatitis infections worldwide. Currently, there is no specific treatment for or vaccine against HEV. The major structural protein is derived from open reading frame (ORF) 2 of the viral genome. A potential oral vaccine is provided by the virus-like particles formed by a protein construct of partial ORF3 protein (residue 70–123) fused to the N-terminus of the ORF2 protein (residues 112–608). Single crystals obtained by the hanging-drop vapour-diffusion method at 293 K diffract X-rays to 8.3 Å resolution. The crystals belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 337, b = 343, c = 346 Å, α = β = γ = 90°, and contain one particle per asymmetric unit

  4. Crystallization and preliminary X-ray analysis of alginate importer from Sphingomonas sp. A1

    International Nuclear Information System (INIS)

    Maruyama, Yukie; Itoh, Takafumi; Nishitani, Yu; Mikami, Bunzo; Hashimoto, Wataru; Murata, Kousaku

    2012-01-01

    Alginate importer from Sphingomonas sp. A1 is a member of the ABC transporter superfamily that directly transports alginate polysaccharide into the cytoplasm. Crystals of alginate importer in complex with the periplasmic binding protein AlgQ2 diffracted X-rays to 3.3 Å resolution. Sphingomonas sp. A1 directly incorporates alginate polysaccharides through a ‘superchannel’ comprising a pit on the cell surface, alginate-binding proteins in the periplasm and an ABC transporter (alginate importer) in the inner membrane. Alginate importer, consisting of four subunits, AlgM1, AlgM2 and two molecules of AlgS, was crystallized in the presence of the binding protein AlgQ2. Preliminary X-ray analysis showed that the crystal diffracted to 3.3 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 72.5, b = 136.8, c = 273.3 Å, suggesting the presence of one complex in the asymmetric unit

  5. Revisit of alpha-chitin crystal structure using high resolution X-ray diffraction data.

    Science.gov (United States)

    Sikorski, Pawel; Hori, Ritsuko; Wada, Masahisa

    2009-05-11

    High resolution synchrotron X-ray fiber diffraction data recorded from crab tendon chitin have been used to describe the crystal structure of alpha-chitin. Crystal structures at 100 and 300 K have been solved using restrained crystallographic refinement against diffraction intensities measured from the fiber diffraction patterns. The unit cell contains two polymer chains in a 2(1) helix conformation and in the antiparallel orientation. The best agreement between predicated and observed X-ray diffraction intensities is obtained for a model that includes two distinctive conformations of C6-O6 hydroxymethl group. Those conformations are different from what is proposed in the generally accepted alpha-chitin crystal structure (J. Mol. Biol. 1978, 120, 167-181). Based on refined positions of the O6 atoms, a network of hydrogen bonds involving O6 is proposed. This network of hydrogen bonds can explain the main features of the polarized FTIR spectra of alpha-chitin and sheds some light on the origin of splitting of the amide I band observed on alpha-chitin IR spectra.

  6. Redetermination of LaZn5 based on single crystal X-ray diffraction data

    Directory of Open Access Journals (Sweden)

    Igor Oshchapovsky

    2012-01-01

    Full Text Available The crystal structure of the already known binary title compound LaZn5 (lanthanum pentazinc (space group P6/mmm, Pearson symbol hP6, CaCu5 structure type has been redetermined from single-crystal X-ray diffraction data. In contrast to previous determinations based on X-ray powder data [Nowotny (1942. Z. Metallkd. 34, 247–253; de Negri et al. (2008. Intermetallics, 16, 168–178], where unit-cell parameters and assignment of the structure type were reported, the present study reveals anisotropic displacement parameters for all atoms. The crystal structure consists of three crytallographically distinct atoms. The La atom (Wyckoff site 1a, site symmetry 6/mmm is surrounded by 18 Zn atoms and two La atoms. The coordination polyhedron around one of the Zn atoms (Wyckoff site 2c, site symmetry -6m2 is an icosahedron made up from three La and nine Zn atoms. The other Zn atom (Wyckoff site 3g, site symmetry mmm is surrounded by four La and eight Zn atoms. Bonding between atoms is explored by means of the TB–LMTO–ASA (tight-binding linear muffin-tin orbital atomic spheres approximation program package. The positive charge density is localized around La atoms, and the negative charge density is around Zn atoms, with weak covalent bonding between the latter.

  7. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of Trypanosoma brucei gambiense glycerol kinase

    International Nuclear Information System (INIS)

    Balogun, Emmanuel Oluwadare; Inaoka, Daniel Ken; Kido, Yasutoshi; Shiba, Tomoo; Nara, Takeshi; Aoki, Takashi; Honma, Teruki; Tanaka, Akiko; Inoue, Masayuki; Matsuoka, Shigeru; Michels, Paul A. M.; Harada, Shigeharu; Kita, Kiyoshi

    2010-01-01

    Glycerol kinase from human African trypanosomes has been purified and crystallized for X-ray structure analysis. In the bloodstream forms of human trypanosomes, glycerol kinase (GK; EC 2.7.1.30) is one of the nine glycosomally compartmentalized enzymes that are essential for energy metabolism. In this study, a recombinant Trypanosoma brucei gambiense GK (rTbgGK) with an N-terminal cleavable His 6 tag was overexpressed, purified to homogeneity and crystallized by the sitting-drop vapour-diffusion method using PEG 400 as a precipitant. A complete X-ray diffraction data set to 2.75 Å resolution indicated that the crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 63.84, b = 121.50, c = 154.59 Å. The presence of two rTbgGK molecules in the asymmetric unit gives a Matthews coefficient (V M ) of 2.5 Å 3 Da −1 , corresponding to 50% solvent content

  8. Crystallization and preliminary X-ray analysis of tubulin-folding cofactor A from Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Lu, Lu; Nan, Jie; Mi, Wei; Wei, Chun-Hong; Li, Lan-Fen; Li, Yi

    2010-01-01

    Tubulin-folding cofactor A from A. thaliana has been crystallized and preliminarily analyzed using X-ray diffraction. Tubulin-folding cofactor A (TFC A) is a molecular post-chaperonin that is involved in the β-tubulin-folding pathway. It has been identified in many organisms including yeasts, humans and plants. In this work, Arabidopsis thaliana TFC A was expressed in Escherichia coli and purified to homogeneity. After thrombin cleavage, a well diffracting crystal was obtained by the sitting-drop vapour-diffusion method at 289 K. The crystal diffracted to 1.6 Å resolution using synchrotron radiation and belonged to space group I4 1 , with unit-cell parameters a = 55.0, b = 55.0, c = 67.4 Å

  9. Purification, crystallization and preliminary X-ray diffraction analysis of the glyoxalase II from Leishmania infantum

    Energy Technology Data Exchange (ETDEWEB)

    Trincão, José [REQUIMTE-CQFB, Departamento Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica (Portugal); Sousa Silva, Marta [Centro de Química e Bioquímica, Departamento Química e Bioquímica, Faculdade de Ciências da Universidade de Lisboa, Edifício C8, Lisboa (Portugal); Barata, Lídia [REQUIMTE-CQFB, Departamento Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica (Portugal); Centro de Química e Bioquímica, Departamento Química e Bioquímica, Faculdade de Ciências da Universidade de Lisboa, Edifício C8, Lisboa (Portugal); Bonifácio, Cecília [REQUIMTE-CQFB, Departamento Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica (Portugal); Carvalho, Sandra; Tomás, Ana Maria [IBMC - Instituto de Biologia Molecular e Celular, Universidade do Porto, Porto (Portugal); ICBAS - Instituto de Ciências Biomédicas Abel Salazar, Universidade do Porto, Porto (Portugal); Ferreira, António E. N.; Cordeiro, Carlos; Ponces Freire, Ana [Centro de Química e Bioquímica, Departamento Química e Bioquímica, Faculdade de Ciências da Universidade de Lisboa, Edifício C8, Lisboa (Portugal); Romão, Maria João, E-mail: mromao@dq.fct.unl.pt [REQUIMTE-CQFB, Departamento Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, Caparica (Portugal)

    2006-08-01

    A glyoxalase II from L. infantum was cloned, purified and crystallized and its structure was solved by X-ray crystallography. In trypanosomatids, trypanothione replaces glutathione in all glutathione-dependent processes. Of the two enzymes involved in the glyoxalase pathway, glyoxalase I and glyoxalase II, the latter shows absolute specificity towards trypanothione thioester, making this enzyme an excellent model to understand the molecular basis of trypanothione binding. Cloned glyoxalase II from Leishmania infantum was overexpressed in Escherichia coli, purified and crystallized. Crystals belong to space group C222{sub 1} (unit-cell parameters a = 65.6, b = 88.3, c = 85.2 Å) and diffract beyond 2.15 Å using synchrotron radiation. The structure was solved by molecular replacement using the human glyoxalase II structure as a search model. These results, together with future detailed kinetic characterization using lactoyltrypanothione, should shed light on the evolutionary selection of trypanothione instead of glutathione by trypano-somatids.

  10. Crystallization and preliminary X-ray diffraction analysis of human phosphate-binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Contreras-Martel, Carlos; Carpentier, Philippe; Morales, Renaud [Laboratoire de Cristallogenèse et Cristallographie des Protéines, Institut de Biologie Structurale J.-P. Ebel, 38027 Grenoble (France); Renault, Frédérique [Unité d’Enzymologie, Département de Toxicologie, Centre de Recherches du Service de Santé des Armées, 38702 La Tronche (France); Chesne-Seck, Marie-Laure [Laboratoire de Cristallographie Macromoléculaire, Institut de Biologie Structurale J.-P. Ebel, 38027 Grenoble (France); Rochu, Daniel; Masson, Patrick [Unité d’Enzymologie, Département de Toxicologie, Centre de Recherches du Service de Santé des Armées, 38702 La Tronche (France); Fontecilla-Camps, Juan Carlos [Laboratoire de Cristallogenèse et Cristallographie des Protéines, Institut de Biologie Structurale J.-P. Ebel, 38027 Grenoble (France); Chabrière, Eric, E-mail: eric.chabriere@lcm3b.uhp-nancy.fr [Unité d’Enzymologie, Département de Toxicologie, Centre de Recherches du Service de Santé des Armées, 38702 La Tronche (France); Laboratoire de Cristallographie et Modélisation des Matériaux Minéraux et Biologiques, CNRS-Université Henri Poincaré, 54506 Vandoeuvre-lès-Nancy (France); Laboratoire de Cristallogenèse et Cristallographie des Protéines, Institut de Biologie Structurale J.-P. Ebel, 38027 Grenoble (France)

    2006-01-01

    The purification, detergent-exchange protocol and crystallization conditions that led to the discovery of HPBP are reported. HPBP is a new human apoprotein that is absent from the genomic database and is the first phosphate transporter characterized in human plasma. Human phosphate-binding protein (HPBP) was serendipitously discovered by crystallization and X-ray crystallography. HPBP belongs to a eukaryotic protein family named DING that is systematically absent from the genomic database. This apoprotein of 38 kDa copurifies with the HDL-associated apoprotein paraoxonase (PON1) and binds inorganic phosphate. HPBP is the first identified transporter capable of binding phosphate ions in human plasma. Thus, it may be regarded as a predictor of phosphate-related diseases such as atherosclerosis. In addition, HPBP may be a potential therapeutic protein for the treatment of such diseases. Here, the purification, detergent-exchange protocol and crystallization conditions that led to the discovery of HPBP are reported.

  11. Recombinant ACHT1 from Arabidopsis thaliana: crystallization and X-ray crystallographic analysis.

    Science.gov (United States)

    Pan, Weimin; Wang, Junchao; Yang, Ye; Liu, Lin; Zhang, Min

    2017-07-01

    Thioredoxins (Trxs) play important roles in chloroplasts by linking photosynthetic light reactions to a series of plastid functions. They execute their function by regulating the oxidation and reduction of disulfide bonds. ACHT1 (atypical cysteine/histidine-rich Trx1) is a thylakoid-associated thioredoxin-type protein found in the Arabidopsis thaliana chloroplast. Recombinant ACHT1 protein was overexpressed in Escherichia coli, purified and crystallized by the vapour-diffusion method. The crystal diffracted to 1.7 Å resolution and a complete X-ray data set was collected. Preliminary crystallographic analysis suggested that the crystals belonged to space group C222 1 , with unit-cell parameters a = 102.7, b = 100.6, c = 92.8 Å.

  12. Characterization of gypsum crystals exposed to a high CO2 concentration fog using x-ray

    International Nuclear Information System (INIS)

    Carreño-Márquez, I. J. A.; Castillo-Sandoval, I.; Esparza-Ponce, H. E.; Fuentes-Cobas, L.; Montero-Cabrera, M. E.

    2015-01-01

    In Chihuahua State, a little town called Naica has the largest gypsum single crystals in the world. The growth of these structures has been described as a long and stable process developed over thousands of years. Due to the change in the environmental conditions, these crystals could suffer alterations on their surface. In this project we study the cause of possible deterioration of the giant crystals and intend to suggest measures for their preservation. For this sake, our first experiment consists on several gypsum crystals that have been subjected in a climate chamber to a fog at high CO 2 concentration and 51 °C for a period of time of six months, extracting two crystals every 15 days. Then the crystals have been characterized through Grazing Incidence X-Ray Diffraction using a diffractometer PanAlytical X’PertPro with two different detectors; Xe-filled proportional detector and a Pixel 3D detector. The results were compared to determine which technique is the most suitable to study the degradation of gypsum single crystals. In the two cases, we have identified only the gypsum phase, but with different crystal plane orientations

  13. Production, purification, crystallization and preliminary X-ray diffraction studies of the nucleoside diphosphate kinase b from Leishmania major

    International Nuclear Information System (INIS)

    Tonoli, Celisa Caldana Costa; Vieira, Plinio Salmazo; Ward, Richard John; Arni, Raghuvir Krishnaswamy; Oliveira, Arthur Henrique Cavalcante de; Murakami, Mario Tyago

    2009-01-01

    Overexpression, purification, crystallization and preliminary X-ray diffraction analysis of the nucleoside diphosphate kinase b from Leishmania major are reported. The crystals belonged to the trigonal space group P3 2 21 and diffracted to 2.18 Å resolution. Nucleoside diphosphate kinases (NDKs; EC 2.7.4.6) play an essential role in the synthesis of nucleotides from intermediates in the salvage pathway in all parasitic trypanosomatids and their structural studies will be instrumental in shedding light on the biochemical machinery involved in the parasite life cycle and host–parasite interactions. In this work, NDKb from Leishmania major was overexpressed in Escherichia coli, purified to homogeneity and crystallized using the sitting-drop vapour-diffusion method. The NDK crystal diffracted to 2.2 Å resolution and belonged to the trigonal crystal system, with unit-cell parameters a = 114.2, c = 93.9 Å. Translation-function calculations yielded an unambiguous solution in the enantiomorphic space group P3 2 21

  14. Synthesis of nanoparticles through x-ray radiolysis using synchrotron radiation

    Science.gov (United States)

    Yamaguchi, A.; Okada, I.; Fukuoka, T.; Ishihara, M.; Sakurai, I.; Utsumi, Y.

    2016-09-01

    The synthesis and deposition of nanoparticles consisting of Cu and Au in a CuSO4 solution with some kinds of alcohol and electroplating solution containing gold (I) trisodium disulphite under synchrotron X-ray radiation was investigated. The functional group of alcohol plays an important in nucleation, growth and aggregation process of copper and cupric oxide particles. We found that the laboratory X-ray source also enables us to synthesize the NPs from the metallic solution. As increasing X-ray exposure time, the full length at half width of particle size distribution is broader and higher-order nanostructure containing NPs clusters is formed. The surface-enhanced Raman scattering (SERS) of 4, 4'-bipyridine (4bpy) in aqueous solution was measured using higher-order nanostructure immobilized on silicon substrates under systematically-varied X-ray exposure. This demonstration provide a clue to develop a three-dimensional printing and sensor for environmental analyses and molecular detection through simple SERS measurements.

  15. Systematic search for spherical crystal X-ray microscopes matching 1-25 keV spectral line sources.

    Science.gov (United States)

    Schollmeier, Marius S; Loisel, Guillaume P

    2016-12-01

    Spherical-crystal microscopes are used as high-resolution imaging devices for monochromatic x-ray radiography or for imaging the source itself. Crystals and Miller indices (hkl) have to be matched such that the resulting lattice spacing d is close to half the spectral wavelength used for imaging, to fulfill the Bragg equation with a Bragg angle near 90 ∘ which reduces astigmatism. Only a few suitable crystal and spectral-line combinations have been identified for applications in the literature, suggesting that x-ray imaging using spherical crystals is constrained to a few chance matches. In this article, after performing a systematic, automated search over more than 9 × 10 6 possible combinations for x-ray energies between 1 and 25 keV, for six crystals with arbitrary Miller-index combinations hkl between 0 and 20, we show that a matching, efficient crystal and spectral-line pair can be found for almost every He α or K α x-ray source for the elements Ne to Sn. Using the data presented here it should be possible to find a suitable imaging combination using an x-ray source that is specifically selected for a particular purpose, instead of relying on the limited number of existing crystal imaging systems that have been identified to date.

  16. Rotation of X-ray polarization in the glitches of a silicon crystal monochromator.

    Science.gov (United States)

    Sutter, John P; Boada, Roberto; Bowron, Daniel T; Stepanov, Sergey A; Díaz-Moreno, Sofía

    2016-08-01

    EXAFS studies on dilute samples are usually carried out by collecting the fluorescence yield using a large-area multi-element detector. This method is susceptible to the 'glitches' produced by all single-crystal monochromators. Glitches are sharp dips or spikes in the diffracted intensity at specific crystal orientations. If incorrectly compensated, they degrade the spectroscopic data. Normalization of the fluorescence signal by the incident flux alone is sometimes insufficient to compensate for the glitches. Measurements performed at the state-of-the-art wiggler beamline I20-scanning at Diamond Light Source have shown that the glitches alter the spatial distribution of the sample's quasi-elastic X-ray scattering. Because glitches result from additional Bragg reflections, multiple-beam dynamical diffraction theory is necessary to understand their effects. Here, the glitches of the Si(111) four-bounce monochromator of I20-scanning just above the Ni  K edge are associated with their Bragg reflections. A fitting procedure that treats coherent and Compton scattering is developed and applied to a sample of an extremely dilute (100 micromolal) aqueous solution of Ni(NO 3 ) 2 . The depolarization of the wiggler X-ray beam out of the electron orbit is modeled. The fits achieve good agreement with the sample's quasi-elastic scattering with just a few parameters. The X-ray polarization is rotated up to ±4.3° within the glitches, as predicted by dynamical diffraction. These results will help users normalize EXAFS data at glitches.

  17. Rotation of X-ray polarization in the glitches of a silicon crystal monochromator

    Energy Technology Data Exchange (ETDEWEB)

    Sutter, John P.; Boada, Roberto; Bowron, Daniel T.; Stepanov, Sergey A.; Díaz-Moreno, Sofía

    2016-07-06

    EXAFS studies on dilute samples are usually carried out by collecting the fluorescence yield using a large-area multi-element detector. This method is susceptible to the `glitches' produced by all single-crystal monochromators. Glitches are sharp dips or spikes in the diffracted intensity at specific crystal orientations. If incorrectly compensated, they degrade the spectroscopic data. Normalization of the fluorescence signal by the incident flux alone is sometimes insufficient to compensate for the glitches. Measurements performed at the state-of-the-art wiggler beamline I20-scanning at Diamond Light Source have shown that the glitches alter the spatial distribution of the sample's quasi-elastic X-ray scattering. Because glitches result from additional Bragg reflections, multiple-beam dynamical diffraction theory is necessary to understand their effects. Here, the glitches of the Si(111) four-bounce monochromator of I20-scanning just above the Ni Kedge are associated with their Bragg reflections. A fitting procedure that treats coherent and Compton scattering is developed and applied to a sample of an extremely dilute (100 micromolal) aqueous solution of Ni(NO3)2. The depolarization of the wiggler X-ray beam out of the electron orbit is modeled. The fits achieve good agreement with the sample's quasi-elastic scattering with just a few parameters. The X-ray polarization is rotated up to ±4.3° within the glitches, as predicted by dynamical diffraction. These results will help users normalize EXAFS data at glitches.

  18. A triple axis double crystal multiple reflection camera for ultra small angle X-ray scattering

    Science.gov (United States)

    Lambard, Jacques; Lesieur, Pierre; Zemb, Thomas

    1992-06-01

    To extend the domain of small angle X-ray scattering requires multiple reflection crystals to collimate the beam. A double crystal, triple axis X-ray camera using multiple reflection channel cut crystals is described. Procedures for measuring the desmeared scattering cross-section on absolute scale are described as well as the measurement from several typical samples : fibrils of collagen, 0.3 μm diameter silica spheres, 0.16 μm diameter interacting latex spheres, porous lignite coal, liquid crystals in a surfactant-water system, colloidal crystal of 0.32 μm diameter silica spheres. L'extension du domaine de diffusion des rayons-X vers les petits angles demande l'emploi de cristaux à réflexions multiples pour collimater le faisceau. Nous décrivons une caméra à rayons-X à trois axes où les réflexions multiples sont réalisées dans deux cristaux à gorge. Nous donnons ensuite les procédures de déconvolution pour obtenir la section efficace de diffusion en échelle absolue, ainsi que les résultats des mesures effectuées avec plusieurs échantillons typiques : fibres de collagène, sphères de silice de 0,3 μm de diamètre, sphères de latex de 0,16 μm de diamètre en interaction, charbon lignite poreux, cristaux liquides formés dans un système eau-tensioactif, solution colloïdale de sphères de silice de 0,32 μm de diamètre.

  19. X-ray beam monitor made by thin-film CVD single-crystal diamond.

    Science.gov (United States)

    Marinelli, Marco; Milani, E; Prestopino, G; Verona, C; Verona-Rinati, G; Angelone, M; Pillon, M; Kachkanov, V; Tartoni, N; Benetti, M; Cannatà, D; Di Pietrantonio, F

    2012-11-01

    A novel beam position monitor, operated at zero bias voltage, based on high-quality chemical-vapor-deposition single-crystal Schottky diamond for use under intense synchrotron X-ray beams was fabricated and tested. The total thickness of the diamond thin-film beam monitor is about 60 µm. The diamond beam monitor was inserted in the B16 beamline of the Diamond Light Source synchrotron in Harwell (UK). The device was characterized under monochromatic high-flux X-ray beams from 6 to 20 keV and a micro-focused 10 keV beam with a spot size of approximately 2 µm × 3 µm square. Time response, linearity and position sensitivity were investigated. Device response uniformity was measured by a raster scan of the diamond surface with the micro-focused beam. Transmissivity and spectral responsivity versus beam energy were also measured, showing excellent performance of the new thin-film single-crystal diamond beam monitor.

  20. Time-Resolved Soft X-ray Diffraction Reveals Transient Structural Distortions of Ternary Liquid Crystals

    Directory of Open Access Journals (Sweden)

    Klaus Mann

    2009-11-01

    Full Text Available Home-based soft X-ray time-resolved scattering experiments with nanosecond time resolution (10 ns and nanometer spatial resolution were carried out at a table top soft X-ray plasma source (2.2–5.2 nm. The investigated system was the lyotropic liquid crystal C16E7/paraffin/glycerol/formamide/IR 5. Usually, major changes in physical, chemical, and/or optical properties of the sample occur as a result of structural changes and shrinking morphology. Here, these effects occur as a consequence of the energy absorption in the sample upon optical laser excitation in the IR regime. The liquid crystal shows changes in the structural response within few hundred nanoseconds showing a time decay of 182 ns. A decrease of the Bragg peak diffracted intensity of 30% and a coherent macroscopic movement of the Bragg reflection are found as a response to the optical pump. The Bragg reflection movement is established to be isotropic and diffusion controlled (1 μs. Structural processes are analyzed in the Patterson analysis framework of the time-varying diffraction peaks revealing that the inter-lamellar distance increases by 2.7 Å resulting in an elongation of the coherently expanding lamella crystallite. The present studies emphasize the possibility of applying TR-SXRD techniques for studying the mechanical dynamics of nanosystems.

  1. X-ray imaging crystal spectroscopy for use in plasma transport research

    Science.gov (United States)

    Reinke, M. L.; Podpaly, Y. A.; Bitter, M.; Hutchinson, I. H.; Rice, J. E.; Delgado-Aparicio, L.; Gao, C.; Greenwald, M.; Hill, K.; Howard, N. T.; Hubbard, A.; Hughes, J. W.; Pablant, N.; White, A. E.; Wolfe, S. M.

    2012-11-01

    This research describes advancements in the spectral analysis and error propagation techniques associated with x-ray imaging crystal spectroscopy (XICS) that have enabled this diagnostic to be used to accurately constrain particle, momentum, and heat transport studies in a tokamak for the first time. Doppler tomography techniques have been extended to include propagation of statistical uncertainty due to photon noise, the effect of non-uniform instrumental broadening as well as flux surface variations in impurity density. These methods have been deployed as a suite of modeling and analysis tools, written in interactive data language (IDL) and designed for general use on tokamaks. Its application to the Alcator C-Mod XICS is discussed, along with novel spectral and spatial calibration techniques. Example ion temperature and radial electric field profiles from recent I-mode plasmas are shown, and the impact of poloidally asymmetric impurity density and natural line broadening is discussed in the context of the planned ITER x-ray crystal spectrometer.

  2. Studying the energy dependence of intrinsic conversion efficiency of single crystal scintillators under X-ray excitation

    Science.gov (United States)

    Kalyvas, N.; Valais, I.; David, S.; Michail, Ch.; Fountos, G.; Liaparinos, P.; Kandarakis, I.

    2014-05-01

    Single crystal scintilators are used in various radiation detectors applications. The efficiency of the crystal can be determined by the Detector Optical Gain (DOG) defined as the ratio of the emitted optical photon flux over the incident radiation photons flux. A parameter affecting DOG is the intrinsic conversion efficiency ( n C ) giving the percentage of the X-ray photon power converted to optical photon power. n C is considered a constant value for X-ray energies in the order of keV although a non-proportional behavior has been reported. In this work an analytical model, has been utilized to single crystals scintillators GSO:Ce, LSO:Ce and LYSO:Ce to examine whether the intrinsic conversion efficiency shows non proportional behavior under X-ray excitation. DOG was theoretically calculated as a function of the incident X-ray spectrum, the X-ray absorption efficiency, the energy of the produced optical photons and the light transmission efficiency. The theoretical DOG values were compared with experimental data obtained by irradiating the crystals with X-rays at tube voltages from 50 to 140 kV and by measuring the light energy flux emitted from the irradiated screen. An initial value for n C (calculated from literature data) was assumed for the X-ray tube voltage of 50 kV. For higher X-ray tube voltages the optical photon propagation phenomena was assumed constant and any deviations between experimental and theoretical data were associated with changes in the intrinsic conversion efficiency. The experimental errors were below 7% for each experimental setup. The behavior of n C values for LSO:Ce and LYSO:Ce were found very similar, i.e., ranging with values from 0.089 at 50 kV to 0.015 at 140 kV, while for GSO:Ce, n C demonstrated a peak at 80 kV.

  3. Characteristics Measurement of CdWO4 Crystal and Photo PIN Diode for X-ray Scanner

    International Nuclear Information System (INIS)

    Kang, K. H.; Hyun, H. J.; Jeon, H. B.; Kim, B. B.; Park, H.; Uozumi, S.; Moon, M. K.

    2014-01-01

    CWO is commonly used in X-ray scanner due to its detection efficiency and low after glow. We measured a decay time, emission wavelength, and light yield of CWO. And we measure signal-to-noise ratio (SNR) and energy resolution of γ-ray with CsI(Tl) by using the PD. Measurements results determine quality of the CWO crystal and PD. After this study, we will study X-ray response by using combined CWO and PD

  4. Expression, Purification, Crystallization And Preliminary X-Ray Studies of Histamine Dehydrogenase From Nocardioides Simplex

    Energy Technology Data Exchange (ETDEWEB)

    Reed, T.M.; Hirakawa, H.; Mure, M.; Scott, E.E.; Limburg, J.

    2009-05-21

    Histamine dehydrogenase (HADH) from Nocardioides simplex catalyzes the oxidative deamination of histamine to produce imidazole acetaldehyde and an ammonium ion. HADH is functionally related to trimethylamine dehydrogenase (TMADH), but HADH has strict substrate specificity towards histamine. HADH is a homodimer, with each 76 kDa subunit containing two redox cofactors: a [4Fe-4S] cluster and an unusual covalently bound flavin mononucleotide, 6-S-cysteinyl-FMN. In order to understand the substrate specificity of HADH, it was sought to determine its structure by X-ray crystallography. This enzyme has been expressed recombinantly in Escherichia coli and successfully crystallized in two forms. Diffraction data were collected to 2.7 {angstrom} resolution at the SSRL synchrotron with 99.7% completeness. The crystals belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 101.14, b = 107.03, c = 153.35 {angstrom}.

  5. Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

    Energy Technology Data Exchange (ETDEWEB)

    Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis; (MSU)

    2010-01-12

    EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.

  6. Study of the creep of germanium bi-crystals by X ray topography and electronic microscopy

    International Nuclear Information System (INIS)

    Gay, Marie-Odile

    1981-01-01

    This research thesis addresses the study of the microscopic as well as macroscopic aspect of the role of grain boundary during deformation, by studying the creep of Germanium bi-crystals. The objective was to observe interactions of network dislocations with the boundary as well as the evolution of dislocations in each grain. During the first stages of deformation, samples have been examined by X ray topography, a technique which suits well the observation of low deformed samples, provided their initial dislocation density is very low. At higher deformation, more conventional techniques of observation of sliding systems and electronic microscopy have been used. After some general recalls, the definition of twin boundaries and of their structure in terms of dislocation, a look at germanium deformation, and an overview of works performed on bi-crystals deformation, the author presents the experimental methods and apparatuses. He reports and discusses the obtained results at the beginning of deformation as well as during next phases

  7. Performance of bent-crystal x-ray microscopes for high energy density physics research.

    Science.gov (United States)

    Schollmeier, Marius S; Geissel, Matthias; Shores, Jonathon E; Smith, Ian C; Porter, John L

    2015-06-01

    We present calculations for the field of view (FOV), image fluence, image monochromaticity, spectral acceptance, and image aberrations for spherical crystal microscopes, which are used as self-emission imaging or backlighter systems at large-scale high energy density physics facilities. Our analytic results are benchmarked with ray-tracing calculations as well as with experimental measurements from the 6.151 keV backlighter system at Sandia National Laboratories. The analytic expressions can be used for x-ray source positions anywhere between the Rowland circle and object plane. This enables quick optimization of the performance of proposed but untested, bent-crystal microscope systems to find the best compromise between FOV, image fluence, and spatial resolution for a particular application.

  8. The Crystal Structure of the Malaria Pigment Hemozoin as Elucidated by X-ray Powder Diffraction

    DEFF Research Database (Denmark)

    Straasø, Tine

    in the eradication of malaria. This thesis is a step towards that goal. When examining red blood cells from an infected person under a microscope dark pigment is observed. This dark pigment is actually small crystals called hemozoin. Hemozoin is a by-product formed by the parasite and a necessity for parasitic......Malaria is a widespread and severe disease caused by an infection by the parasite of the genus Plasmodium, the lifecycle of which is very complex. During its lifecycle the parasite resides in both a mosquito and a human host. If this cycle can be disrupted at any point, it will result...... survival. Successful inhibition of hemozoin crystallization will lead to parasitic death and thus break the cycle. The aim of this thesis is to elucidate the structure of hemozoin by means of X-ray diffraction techniques. Knowledge of the structure will help facilitate intelligent drug design in the future...

  9. Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG.

    Science.gov (United States)

    Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis

    2009-06-01

    EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 A and belonged to space group P2(1), with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 A.

  10. Expression, purification, crystallization and preliminary X-ray diffraction analysis of the aspartate transcarbamoylase domain of human CAD.

    Science.gov (United States)

    Ruiz-Ramos, Alba; Lallous, Nada; Grande-García, Araceli; Ramón-Maiques, Santiago

    2013-12-01

    Aspartate transcarbamoylase (ATCase) catalyzes the synthesis of N-carbamoyl-L-aspartate from carbamoyl phosphate and aspartate in the second step of the de novo biosynthesis of pyrimidines. In prokaryotes, the first three activities of the pathway, namely carbamoyl phosphate synthetase (CPSase), ATCase and dihydroorotase (DHOase), are encoded as distinct proteins that function independently or in noncovalent association. In animals, CPSase, ATCase and DHOase are part of a 243 kDa multifunctional polypeptide named CAD. Up-regulation of CAD is essential for normal and tumour cell proliferation. Although the structures of numerous prokaryotic ATCases have been determined, there is no structural information about any eukaryotic ATCase. In fact, the only detailed structural information about CAD is that it self-assembles into hexamers and trimers through interactions of the ATCase domains. Here, the expression, purification and crystallization of the ATCase domain of human CAD is reported. The recombinant protein, which was expressed in bacteria and purified with good yield, formed homotrimers in solution. Crystallization experiments both in the absence and in the presence of the inhibitor PALA yielded small crystals that diffracted X-rays to 2.1 Å resolution using synchrotron radiation. The crystals appeared to belong to the hexagonal space group P6(3)22, and Matthews coefficient calculation indicated the presence of one ATCase subunit per asymmetric unit, with a solvent content of 48%. However, analysis of the intensity statistics suggests a special case of the P21 lattice with pseudo-symmetry and possibly twinning.

  11. Purification, crystallization and preliminary X-ray crystallographic studies of the Mycobacterium tuberculosis DNA gyrase CTD

    International Nuclear Information System (INIS)

    Darmon, Amélie; Piton, Jérémie; Roué, Mélanie; Petrella, Stéphanie; Aubry, Alexandra; Mayer, Claudine

    2012-01-01

    The M. tuberculosis DNA gyrase A C-terminal domain (CTD) was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2 1 2 1 2 1 and diffraction data were collected to a resolution of 1.55 Å. Mycobacterium tuberculosis DNA gyrase, a nanomachine involved in regulation of DNA topology, is the only type II topoisomerase present in this organism and hence is the sole target of fluoroquinolone in the treatment of tuberculosis. The C-terminal domain (CTD) of the DNA gyrase A subunit possesses a unique feature, the ability to wrap DNA in a chiral manner, that plays an essential role during the catalytic cycle. A construct of 36 kDa corresponding to this domain has been overproduced, purified and crystallized. Diffraction data were collected to 1.55 Å resolution. Cleavage of the N-terminal His tag was crucial for obtaining crystals. The crystals belonged to space group P2 1 2 1 2 1 , with one molecule in the asymmetric unit and a low solvent content (33%). This is the first report of the crystallization and preliminary X-ray diffraction studies of a DNA gyrase CTD from a species that contains one unique type II topoisomerase

  12. Crystallization and X-ray diffraction analysis of human CLEC-2

    Energy Technology Data Exchange (ETDEWEB)

    Watson, Aleksandra A.; O’Callaghan, Christopher A., E-mail: chrisoc@ccmp.ox.ac.uk [Henry Wellcome Building of Molecular Physiology, University of Oxford, Roosevelt Drive, Oxford OX3 7BN (United Kingdom)

    2005-12-01

    Recombinant human CLEC-2 was crystallized in the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1} and X-ray diffraction data were collected to 2.0 Å. The human C-type lectin-like protein CLEC-2 has recently been shown to be expressed on the surface of platelets and to function as a receptor for the snake-venom protein rhodocytin. The C-type lectin-like domain (CTLD) of CLEC-2 was expressed in Escherichia coli, refolded and purified. Crystals of this recombinant CLEC-2 were grown by sitting-drop vapour diffusion using polyethylene glycol (PEG) 6000 as a precipitant. After optimization, crystals were grown which diffracted to 2.0 Å using in-house radiation (λ = 1.5418 Å). These crystals belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 35.407, b = 55.143, c = 56.078 Å. The presence of one molecule per asymmetric unit is consistent with a crystal volume per unit weight (V{sub M}) of 1.82 Å{sup 3} Da{sup −1} and a solvent content of 32.6%. These results suggest that crystals producing diffraction of this quality will be suitable for the structural determination of human CLEC-2.

  13. Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

    Science.gov (United States)

    Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

    1999-01-01

    Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

  14. The crystal structure of benzoic acid: a redetermination with X-rays at room temperature

    International Nuclear Information System (INIS)

    Feld, R.; Lehmann, M.S.; Muir, K.W.; Speakman, J.C.

    1981-01-01

    The crystal structure of benzoic acid, C 6 H 5 CO 2 H, has been redetermined by X-ray diffraction at room temperature. Extensive neutron-diffraction measurements have also been made; by single-crystal methods at room temperature and 130 K; and, at 130 K and 5 K, by powder-profile analysis on C 6 D 5 CO 2 H. The structure consists of centrosymmetric dimers, in which two molecules are linked by a pair of hydrogen bonds between their carboxyl groups. Better precision attaches to the X-ray results. Full-matrix refinement, on 1011 independent reflexions, converged at R = 3.7%. This refinement was indeed based on a model that was formally ordered, so far as concerns all atoms except the acidic hydrogen. However the structural results implied an averaged molecule, with the C - O distances 1.258, 1.268(2)Angstroem and the C - C - O angles 118.7, 117.8(1) 0 ; and the acidic hydrogen appeared as two half atoms on the hydrogen bond, 0.9 Angstroem from each oxygen atom. These findings are most simply interpreted as due to disorder; the two configurations, A and B (of Fig. 1), occur randomly and in nearly equal proportions. Owing to difficulties inherent in the crystal texture of benzoic acid, the neutron results were less satisfactory. Large single crystals were affected by twinning. Though the powder method avoids this difficulty, the structure, further confused by modulation, is rather too complicated for profile refinement. At 5 K however, the structure may be ordered, consisting wholly of dimers in the A-configuration. (orig.)

  15. Purification, crystallization and preliminary X-ray diffraction analysis of the effector protein PevD1 from Verticillium dahliae

    International Nuclear Information System (INIS)

    Han, Lei; Liu, Zheng; Liu, Xinqi; Qiu, Dewen

    2012-01-01

    The overexpression, purification, crystallization and preliminary X-ray diffraction analysis of protein elicitor PevD1 from Verticillium dahliae are reported. The effector protein PevD1 from the pathogenic fungus Verticillium dahliae was purified and crystallized using the hanging-drop vapour-diffusion method. Native crystals appeared in a solution consisting of 4.0 M sodium formate. A native data set was collected at 1.9 Å resolution at 100 K using an in-house X-ray source. Because of the absence of useful methinione in the protein sequence, derivative crystals that contained iodine were obtained by soaking in 1.25 M potassium iodide, and a data set that contained anomalous signal was collected using the same X-ray facility at a wavelength of 1.54 Å. The single-wavelength anomalous dispersion method was used to successfully solve the structure based on the anomalous signal generated from iodine

  16. X-ray-excited optical luminescence of protein crystals: a new tool for studying radiation damage during diffraction data collection.

    Science.gov (United States)

    Owen, Robin L; Yorke, Briony A; Pearson, Arwen R

    2012-05-01

    During X-ray irradiation protein crystals radiate energy in the form of small amounts of visible light. This is known as X-ray-excited optical luminescence (XEOL). The XEOL of several proteins and their constituent amino acids has been characterized using the microspectrophotometers at the Swiss Light Source and Diamond Light Source. XEOL arises primarily from aromatic amino acids, but the effects of local environment and quenching within a crystal mean that the XEOL spectrum of a crystal is not the simple sum of the spectra of its constituent parts. Upon repeated exposure to X-rays XEOL spectra decay non-uniformly, suggesting that XEOL is sensitive to site-specific radiation damage. However, rates of XEOL decay were found not to correlate to decays in diffracting power, making XEOL of limited use as a metric for radiation damage to protein crystals. © 2012 International Union of Crystallography

  17. Evaluation of bent-crystal x-ray backlighting and microscopy techniques for the Sandia Z machine.

    Science.gov (United States)

    Sinars, Daniel B; Bennett, Guy R; Wenger, David F; Cuneo, Michael E; Porter, John L

    2003-07-01

    X-ray backlighting and microscopy systems for the 1-10-keV range based on spherically or toroidally bent crystals are discussed. These systems are ideal for use on the Sandia Z machine, a megajoule-class x-ray facility. Near-normal-incidence crystal microscopy systems have been shown to be more efficient than pinhole cameras with the same spatial resolution and magnification [Appl. Opt. 37, 1784 (1998)]. We show that high-resolution (< or = 10 microm) x-ray backlighting systems using bent crystals can be more efficient than analogous point-projection imaging systems. Examples of bent-crystal-backlighting results that demonstrate 10-microm resolution over a 20-mm field of view are presented.

  18. Microfocus wide-angle X-ray scattering of polymers crystallized in a fast scanning chip calorimeter

    Energy Technology Data Exchange (ETDEWEB)

    Drongelen, Martin van [Eindhoven University of Technology, 5600 MB Eindhoven (Netherlands); Meijer-Vissers, Tamara [Eindhoven University of Technology, 5600 MB Eindhoven (Netherlands); Dutch Polymer Institute (DPI), P.O. Box 902, 5600 AX Eindhoven (Netherlands); Cavallo, Dario, E-mail: d.cavallo1@tue.nl [Eindhoven University of Technology, 5600 MB Eindhoven (Netherlands); Portale, Giuseppe [ESRF, Dubble CRG, Netherlands Organization of Scientific Research (NWO), 38043 Grenoble (France); Poel, Geert Vanden [DSM Resolve, Urmonderbaan 22, 6167 RD Geleen (Netherlands); Androsch, René, E-mail: rene.androsch@iw.uni-halle.de [Martin-Luther-University Halle-Wittenberg, Center of Engineering Sciences, 06099 Halle/Saale (Germany)

    2013-07-10

    Graphical abstract: - Highlights: • Micro-focused synchrotron radiation was used for WAXS analysis of FSC samples. • FSC polymer crystallization experiments were completed by in situ X-ray structure analysis. • The supercooling-controlled polymorphism of iPP and PA 6 has been confirmed. - Abstract: Microfocus wide-angle X-ray scattering (WAXS) has been applied for analysis of the polymorphism of isotactic polypropylene and polyamide 6 prepared in a fast scanning chip calorimeter (FSC). Samples with a typical mass of few hundred nanograms, and lateral dimension and thickness of about 100 μm and 20 μm, respectively, were exposed to a defined thermal history in the FSC and subsequently analyzed regarding the X-ray structure at ambient temperature using an intense synchrotron microfocused X-ray beam. The relaxed melt of isotactic polypropylene was cooled at rates of 40 K s{sup −1} and 200 K s{sup −1} which allowed formation of α-crystals or mesophase, respectively. Polyamide 6 was isothermally crystallized at 95 °C and 180 °C which led to formation of γ-mesophase and α-crystals, respectively. This study demonstrated, for the first time, that FSC polymer crystallization experiments could be completed and expanded by subsequent in situ structure analysis by X-ray scattering.

  19. Crystallization and preliminary X-ray characterization of two thermostable DNA nucleases

    International Nuclear Information System (INIS)

    Kuettner, E. Bartholomeus; Pfeifer, Sven; Keim, Antje; Greiner-Stöffele, Thomas; Sträter, Norbert

    2006-01-01

    Two thermostable DNA nucleases from archaea were crystallized in different space groups; the crystals were suitable for X-ray analysis. Temperature-tolerant organisms are an important source to enhance the stability of enzymes used in biotechnological processes. The DNA-cleaving enzyme exonuclease III from Escherichia coli is used in several applications in gene technology. A thermostable variant could expand the applicability of the enzyme in these methods. Two homologous nucleases from Archaeoglobus fulgidus (ExoAf) and Methanothermobacter thermoautrophicus (ExoMt) were studied for this purpose. Both enzymes were crystallized in different space groups using (poly)ethylene glycols, 2,4-methyl pentandiol, dioxane, ethanol or 2-propanol as precipitants. The addition of a 10-mer DNA oligonucleotide was important to obtain monoclinic crystals of ExoAf and ExoMt that diffracted to resolutions better than 2 Å using synchrotron radiation. The crystal structures of the homologous proteins can serve as templates for genetic engineering of the E. coli exonuclease III and will aid in understanding the different catalytic properties of the enzymes

  20. The purification, crystallization and preliminary X-ray diffraction analysis of dihydrodipicolinate synthase from Clostridium botulinum

    Energy Technology Data Exchange (ETDEWEB)

    Dobson, Renwick C. J., E-mail: rdobson@unimelb.edu.au; Atkinson, Sarah C. [Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville, Victoria 3010 (Australia); Bio21 Molecular Science and Biotechnology Institute, 30 Flemington Road, University of Melbourne, Parkville, Victoria 3010 (Australia); Gorman, Michael A. [St Vincents Institute, 9 Princes Street, Fitzroy, Victoria 3065 (Australia); Newman, Janet M. [CSIRO Division of Molecular and Health Technologies, 343 Royal Parade, Parkville, Victoria 3052 (Australia); Parker, Michael W. [Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville, Victoria 3010 (Australia); Bio21 Molecular Science and Biotechnology Institute, 30 Flemington Road, University of Melbourne, Parkville, Victoria 3010 (Australia); St Vincents Institute, 9 Princes Street, Fitzroy, Victoria 3065 (Australia); Perugini, Matthew A. [Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville, Victoria 3010 (Australia); Bio21 Molecular Science and Biotechnology Institute, 30 Flemington Road, University of Melbourne, Parkville, Victoria 3010 (Australia)

    2008-03-01

    Dihydrodipicolinate synthase (DHDPS), an enzyme in the lysine-biosynthetic pathway, is a promising target for antibiotic development against pathogenic bacteria. Here, the expression, purification, crystallization and preliminary diffraction analysis of DHDPS from C. botulinum are reported. In recent years, dihydrodipicolinate synthase (DHDPS; EC 4.2.1.52) has received considerable attention from both mechanistic and structural viewpoints. This enzyme, which is part of the diaminopimelate pathway leading to lysine, couples (S)-aspartate-β-semialdehyde with pyruvate via a Schiff base to a conserved active-site lysine. In this paper, the expression, purification, crystallization and preliminary X-ray diffraction analysis of DHDPS from Clostridium botulinum, an important bacterial pathogen, are presented. The enzyme was crystallized in a number of forms, predominantly using PEG precipitants, with the best crystal diffracting to beyond 1.9 Å resolution and displaying P4{sub 2}2{sub 1}2 symmetry. The unit-cell parameters were a = b = 92.9, c = 60.4 Å. The crystal volume per protein weight (V{sub M}) was 2.07 Å{sup 3} Da{sup −1}, with an estimated solvent content of 41%. The structure of the enzyme will help guide the design of novel therapeutics against the C. botulinum pathogen.

  1. Characteristics and performance of thin LaBr3(Ce) crystal for X-ray astronomy

    Science.gov (United States)

    Manchanda, R. K.

    Lanthanum Bromide crystal is the latest among the family of the scintillation counters and has an advantage over conventional room temperature detectors. It has a high atomic number, high light yield, and fast decay time compared to NaI(Tl) crystal and therefore, the energy resolution, of LaBr3 detector is superior and it has higher detection efficiency. In recent past, laboratory studies have been generally made using thick crystal geometry (1.5×1.5-inch and 2×2-inch). Similarly, simulation studies are also in progress for the use of LaBr3 detectors in the ground based high energy physics experiments. The detector background counting rate of LaBr3 crystal is affected by the internal radioactivity and is due to naturally occurring radioisotopes 138La and 227Ac, similar to the sodium Iodide detector which is affected by the iodine isotopes. We have developed a new detector using thin lanthanum bromide crystal (3×30-mm) for use in X-ray astronomy. The instrument was launched in high altitude balloon flight on Dec. 21, 2007, which reached a ceiling altitude of 4.3 mbs. A background counting rate of 1.6 ×10-2 ct cm-2 s-1 keV-1 sr-1 was observed at the ceiling altitude. This paper describes the details of the electronics hardware, energy resolution and the background characteristics of the detector at ceiling altitude

  2. Crystallization and preliminary X-ray analysis of S-ribosylhomocysteinase from Streptococcus mutans

    International Nuclear Information System (INIS)

    Li, Hui; Zhao, Hongyan; Zhu, Laikuan; Hong, Lihua; Zhang, Hong; Lin, Fanjing; Xu, Chunyan; Li, Shentao; Zhang, Zhimin

    2012-01-01

    S-Ribosylhomocysteinase (LuxS) encoded by the LuxS gene from Streptococcus mutans was solubly expressed in Escherichia coli, purified and crystallized. Diffraction by the crystal extended to 2.4 Å resolution. S-Ribosylhomocysteinase (LuxS) encoded by the luxS gene from Streptococcus mutans plays a crucial role in the quorum-sensing system. LuxS was solubly expressed in Escherichia coli with high yield. The purity of the purified target protein, which was identified by SDS–PAGE and MALDI–TOF MS analysis, was >95%. The protein was crystallized using the hanging-drop vapour-diffusion method with PEG 3350 as the primary precipitant. X-ray diffraction data were collected at Beijing Synchrotron Radiation Facility (BSRF). Diffraction by the crystal extended to 2.4 Å resolution and the crystal belonged to space group C222 1 , with unit-cell parameters a = 55.3, b = 148.7, c = 82.8 Å

  3. Crystal structure and tautomerism of Pigment Yellow 138 determined by X-ray powder diffraction and solid-state NMR

    DEFF Research Database (Denmark)

    Gumbert, Silke D.; Körbitzer, Meike; Alig, Edith

    2016-01-01

    The crystal structure of C.I. Pigment Yellow 138 was determined from X-ray powder diffraction data using real-space methods with subsequent Rietveld refinements. The tautomeric state was investigated by solid-state 1D and 2D multinuclear NMR experiments. In the crystals, the compound exhibits...... is not a packing effect, but caused by intramolecular steric hindrance....

  4. Crystallization of ornithine acetyltransferase from yeast by counter-diffusion and preliminary X-ray study

    International Nuclear Information System (INIS)

    Maes, Dominique; Crabeel, Marjolaine; Van de Weerdt, Cécile; Martial, Joseph; Peeters, Eveline; Charlier, Daniël; Decanniere, Klaas; Vanhee, Celine; Wyns, Lode; Zegers, Ingrid

    2006-01-01

    A study on the crystallization of ornithine acetyltransferase from yeast, catalysing the fifth step in microbial arginine synthesis, is presented. The use of the counter-diffusion technique removes the disorder present in one dimension in crystals grown by either batch or hanging-drop techniques. A study is presented on the crystallization of ornithine acetyltransferase from yeast, which catalyzes the fifth step in microbial arginine synthesis. The use of the counter-diffusion technique removes the disorder present in one dimension in crystals grown by either the batch or hanging-drop techniques. This makes the difference between useless crystals and crystals that allow successful determination of the structure of the protein. The crystals belong to space group P4, with unit-cell parameters a = b = 66.98, c = 427.09 Å, and a data set was collected to 2.76 Å

  5. Crystallization of ornithine acetyltransferase from yeast by counter-diffusion and preliminary X-ray study

    Energy Technology Data Exchange (ETDEWEB)

    Maes, Dominique, E-mail: dominique.maes@vub.ac.be; Crabeel, Marjolaine [Laboratorium voor Ultrastructuur, Vrije Universiteit Brussel (VUB) and Vlaams Interuniversitair Instituut voor Biotechnologie (VIB), Pleinlaan 2, B-1050 Brussels (Belgium); Van de Weerdt, Cécile; Martial, Joseph [Laboratoire de Biologie Moléculaire et de Génie Génétique, Université de Liège, Allée de la Chimie 3, B-4000 Liège (Belgium); Peeters, Eveline; Charlier, Daniël [Erfelijkheidsleer en Microbiologie, Vrije Universiteit Brussel (VUB), Pleinlaan 2, B-1050 Brussels (Belgium); Decanniere, Klaas; Vanhee, Celine; Wyns, Lode; Zegers, Ingrid [Laboratorium voor Ultrastructuur, Vrije Universiteit Brussel (VUB) and Vlaams Interuniversitair Instituut voor Biotechnologie (VIB), Pleinlaan 2, B-1050 Brussels (Belgium)

    2006-12-01

    A study on the crystallization of ornithine acetyltransferase from yeast, catalysing the fifth step in microbial arginine synthesis, is presented. The use of the counter-diffusion technique removes the disorder present in one dimension in crystals grown by either batch or hanging-drop techniques. A study is presented on the crystallization of ornithine acetyltransferase from yeast, which catalyzes the fifth step in microbial arginine synthesis. The use of the counter-diffusion technique removes the disorder present in one dimension in crystals grown by either the batch or hanging-drop techniques. This makes the difference between useless crystals and crystals that allow successful determination of the structure of the protein. The crystals belong to space group P4, with unit-cell parameters a = b = 66.98, c = 427.09 Å, and a data set was collected to 2.76 Å.

  6. On the possibility of using X-ray Compton scattering to study magnetoelectrical properties of crystals

    Energy Technology Data Exchange (ETDEWEB)

    Collins, S. P., E-mail: steve.collins@diamond.ac.uk; Laundy, D.; Connolley, T.; Laan, G. van der; Fabrizi, F. [Diamond Light Source Ltd, Harwell Science and Innovation Campus, Didcot, OX11 0DE (United Kingdom); Janssen, O. [Department of Physics, New York University, New York, NY 10003 (United States); Cooper, M. J. [Department of Physics, University of Warwick, CV4 7AL (United Kingdom); Ebert, H.; Mankovsky, S. [Universität München, Department Chemie, Haus E2.033, Butenandtstrasse 5-13, D-81377 München (Germany)

    2016-02-16

    The possibility of using X-ray Compton scattering to reveal antisymmetric components of the electron momentum density, as a fingerprint of magnetoelectric sample properties, is investigated experimentally and theoretically by studying the polar ferromagnet GaFeO{sub 3}. This paper discusses the possibility of using Compton scattering – an inelastic X-ray scattering process that yields a projection of the electron momentum density – to probe magnetoelectrical properties. It is shown that an antisymmetric component of the momentum density is a unique fingerprint of such time- and parity-odd physics. It is argued that polar ferromagnets are ideal candidates to demonstrate this phenomenon and the first experimental results are shown, on a single-domain crystal of GaFeO{sub 3}. The measured antisymmetric Compton profile is very small (≃ 10{sup −5} of the symmetric part) and of the same order of magnitude as the statistical errors. Relativistic first-principles simulations of the antisymmetric Compton profile are presented and it is shown that, while the effect is indeed predicted by theory, and scales with the size of the valence spin–orbit interaction, its magnitude is significantly overestimated. The paper outlines some important constraints on the properties of the antisymmetric Compton profile arising from the underlying crystallographic symmetry of the sample.

  7. Optical and X-ray absorption spectroscopy in lead doped lithium fluoride crystals

    Energy Technology Data Exchange (ETDEWEB)

    Somma, F; Aloe, P; D' Acapito, F; Montereali, R M; Polosan, S; Secu, M; Vincenti, M A, E-mail: somma@fis.uniroma3.it

    2010-11-15

    LiF:Pb doped crystals were successfully grown by Kyropoulos method, starting with drying powders. The presence of Pb{sup 2+} ions in the LiF crystals were evidenced by the absorption band at 278 nm and by 375 nm photoluminescence. The presence of some other Pb structures with oxygen compounds in the as made samples was evidenced, decreasing after some annealing procedures. The local environment and valence state of Pb in LiF were studied by X-ray Absorption Spectroscopy at the Pb L{sub III} and L{sub I} edges. XANES data reveal that Pb is present as Pb{sup 2+} whereas EXAFS data show that it is incorporated in the crystal and not forming PbF{sub 2} precipitates. Identical spectra are obtained for samples as prepared and after thermal annealing up to 650 deg. C demonstrating the stability of the incorporation site. Also the concentration of Pb in the crystal has no effect on the location site of the metal as the same spectrum is obtained for specimens with different dopant concentrations.

  8. Crystallization and preliminary X-ray crystallographic studies of the alkanesulfonate FMN reductase from Escherichia coli

    International Nuclear Information System (INIS)

    Gao, Benlian; Bertrand, Adam; Boles, William H.; Ellis, Holly R.; Mallett, T. Conn

    2005-01-01

    Crystallization of the native and SeMet FMN reductase protein of the E. coli alkanesulfonate monooxygenase two-component enzyme system is reported. The alkanesulfonate FMN reductase (SsuE) from Escherichia coli catalyzes the reduction of FMN by NADPH to provide reduced flavin for the monooxygenase (SsuD) enzyme. The vapor-diffusion technique yielded single crystals that grow as hexagonal rods and diffract to 2.9 Å resolution using synchrotron X-ray radiation. The protein crystallizes in the primitive hexagonal space group P622. The SsuE protein lacks any cysteine or methionine residues owing to the role of the SsuE enzyme in the acquisition of sulfur during sulfate starvation. Therefore, substitution of two leucine residues (Leu114 and Leu165) to methionine was performed to obtain selenomethionine-containing SsuE for MAD phasing. The selenomethionine derivative of SsuE has been expressed and purified and crystals of the protein have been obtained with and without bound FMN. These preliminary studies should lead to the structure solution of SsuE. It is anticipated that this new protein structure will provide detailed structural information on specific active-site regions of the protein and insight into the mechanism of flavin reduction and transfer of reduced flavin

  9. Crystallization and preliminary X-ray diffraction analysis of human endoplasmic reticulum aminopeptidase 2

    International Nuclear Information System (INIS)

    Ascher, David B.; Polekhina, Galina; Parker, Michael W.

    2012-01-01

    The luminal domain of human endoplasmic reticulum aminopeptidase 2 has been expressed, purified and crystallized. The crystals belonged to the orthorhombic space group P2 1 2 1 2 and diffracted anisotropically to 3.3 Å resolution in the best direction on an in-house source. Endoplasmic reticulum aminopeptidase 2 (ERAP2) is a critical enzyme involved in the final processing of MHC class I antigens. Peptide trimming by ERAP2 and the other members of the oxytocinase subfamily is essential to customize longer precursor peptides in order to fit them to the correct length required for presentation on major histocompatibility complex class I molecules. While recent structures of ERAP1 have provided an understanding of the ‘molecular-ruler’ mechanism of substrate selection, little is known about the complementary activities of its homologue ERAP2 despite their sharing 49% sequence identity. In order to gain insights into the structure–function relationship of the oxytocinase subfamily, and in particular ERAP2, the luminal region of human ERAP2 has been crystallized in the presence of the inhibitor bestatin. The crystals belonged to an orthorhombic space group and diffracted anisotropically to 3.3 Å resolution in the best direction on an in-house X-ray source. A molecular-replacement solution suggested that the enzyme has adopted the closed state as has been observed in other inhibitor-bound aminopeptidase structures

  10. Overexpression, crystallization, and preliminary X-ray crystallographic analysis of shikimate dehydrogenase from Thermotoga maritima

    International Nuclear Information System (INIS)

    Lee, Hyung Ho

    2011-01-01

    Shikimate dehydrogenase from Thermotoga maritima has been overexpressed, crystallized, and its crystal structure has been determined. X-ray diffraction data have been collected to 1.45 Å. Shikimate dehydrogenase (SDH), which catalyses the NADPH-dependent reduction of 3-dehydroshikimate to shikimate in the shikimate pathway, is an attractive target for the development of herbicides and antimicrobial agents. Previous structural studies showed that SDH exists in two conformations, an open form and a closed form, and it is believed that the conformational state is crucial to understanding a catalytic mechanism. To facilitate further structural comparisons among SDHs, structural analysis of an SDH from Thermotoga maritima encoded by the Tm0346 gene has been initiated. SDH from T. maritima has been overexpressed in Escherichia coli and crystallized at 296 K using ammonium sulfate as a precipitant. Crystals of T. maritima SDH diffracted to 1.45 Å resolution and belonged to orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.21, b = 62.45 and c = 68.68 Å. The asymmetric unit contains a monomer, with a corresponding V M of 2.01 Å 3 Da −1 and a solvent content of 38.9% by volume

  11. X-ray crystal structure of N-6 adenine deoxyribose nucleic acid methyltransferase from Streptococcus pneumoniae

    Science.gov (United States)

    Tran, Phidung Hong

    X-ray diffraction by using resonant anomalous scattering has become a popular tool for solving crystal structures in the last ten years with the expanded availability of tunable synchrotron radiation for protein crystallography. Mercury atoms were used for phasing. The crystal structure of N-6 deoxyribose nucleic acid methyltransferase from Streptoccocus pneumoniae (DpnM) was solved by using the Multiple Anomalous Diffraction technique. The crystal structure reveals the formation of mercaptide between the mercury ion and the thiol group on the cysteine amino acid in a hydrophobic environment. The crystal structure contains the bound ligand, S- adenosyl-l-methionine on the surface of the concave opening. The direction of the β-strands on the beta sheets are identical to other solved methyltransferases. The highly conserved motifs, DPPY and the FxGxG, are found to be important in ligand binding and possibly in methyl group transfer. The structure has a concave cleft with an opening on the order of 30 Å that can accommodate a DNA duplex. By molecular modelling coupled to sequence alignment, two other highly conserved residues Arg21 and Gly19 are found to be important in catalysis.

  12. Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

    Energy Technology Data Exchange (ETDEWEB)

    Pasquo, Alessandra [ENEA Casaccia Research Centre, Dipartimento BIOTEC, Sezione Genetica e Genomica Vegetale, PO Box 2400, I-00100 Rome (Italy); Bonamore, Alessandra; Franceschini, Stefano; Macone, Alberto; Boffi, Alberto; Ilari, Andrea, E-mail: andrea.ilari@uniroma1.it [Istituto di Biologia e Patologia Molecolari, CNR (IBPM) and Department Of Biochemical Sciences, University of Roma ‘La Sapienza’, Piazza Aldo Moro 5, 00179 Roma (Italy); ENEA Casaccia Research Centre, Dipartimento BIOTEC, Sezione Genetica e Genomica Vegetale, PO Box 2400, I-00100 Rome (Italy)

    2008-04-01

    The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.

  13. Perlite-SO3H nanoparticles as an efficient and reusable catalyst for one-pot three-component synthesis of 1,2-dihydro-1-aryl-naphtho[1,2-e][1,3]oxazine-3-one derivatives under both microwave-assisted and thermal solvent-free conditions: Single crystal X-ray structure analysis and theoretical study

    Directory of Open Access Journals (Sweden)

    Ali Ramazani

    2016-01-01

    Full Text Available A general synthetic route for the synthesis of 1,2-dihydro-1-aryl-naphtho[1,2-e][1,3]oxazine-3-one derivatives has been developed using perlite-SO3H nanoparticles as efficient catalyst under both microwave-assisted and thermal solvent-free conditions. The combination of 2-naphthol, aldehyde and urea enabled the synthesis of 1,2-dihydro-1-aryl-naphtho[1,2-e][1,3]oxazine-3-one derivatives in the presence of perlite-SO3H nanoparticles in good to excellent yields. This method provides several advantages like simple work-up, environmentally benign, and shorter reaction times along with high yields. In order to explore the recyclability of the catalyst, the perlite-SO3H nanoparticles in solvent-free conditions were used as catalyst for the same reaction repeatedly and the change in their catalytic activity was studied. It was found that perlite-SO3H nanoparticles could be reused for four cycles with negligible loss of their activity. Single crystal X-ray structure analysis and theoretical studies also were investigated for 4i product. The electronic properties of the compound have been analyzed using DFT calculations (B3LYP/6-311+G*. The FMO analysis suggests that charge transfer takes place within the molecule and the HOMO is localized mainly on naphthalene and oxazinone rings whereas the LUMO resides on the naphthalene ring.

  14. Life in the fast lane for protein crystallization and X-ray crystallography

    Science.gov (United States)

    Pusey, Marc L.; Liu, Zhi-Jie; Tempel, Wolfram; Praissman, Jeremy; Lin, Dawei; Wang, Bi-Cheng; Gavira, Jose A.; Ng, Joseph D.

    2005-01-01

    The common goal for structural genomic centers and consortiums is to decipher as quickly as possible the three-dimensional structures for a multitude of recombinant proteins derived from known genomic sequences. Since X-ray crystallography is the foremost method to acquire atomic resolution for macromolecules, the limiting step is obtaining protein crystals that can be useful of structure determination. High-throughput methods have been developed in recent years to clone, express, purify, crystallize and determine the three-dimensional structure of a protein gene product rapidly using automated devices, commercialized kits and consolidated protocols. However, the average number of protein structures obtained for most structural genomic groups has been very low compared to the total number of proteins purified. As more entire genomic sequences are obtained for different organisms from the three kingdoms of life, only the proteins that can be crystallized and whose structures can be obtained easily are studied. Consequently, an astonishing number of genomic proteins remain unexamined. In the era of high-throughput processes, traditional methods in molecular biology, protein chemistry and crystallization are eclipsed by automation and pipeline practices. The necessity for high-rate production of protein crystals and structures has prevented the usage of more intellectual strategies and creative approaches in experimental executions. Fundamental principles and personal experiences in protein chemistry and crystallization are minimally exploited only to obtain "low-hanging fruit" protein structures. We review the practical aspects of today's high-throughput manipulations and discuss the challenges in fast pace protein crystallization and tools for crystallography. Structural genomic pipelines can be improved with information gained from low-throughput tactics that may help us reach the higher-bearing fruits. Examples of recent developments in this area are reported from

  15. Life in the fast lane for protein crystallization and X-ray crystallography

    Energy Technology Data Exchange (ETDEWEB)

    Pusey, Marc L.; Liu, Zhi-Jie; Tempel, Wolfram; Praissman, Jeremy; Lin, Dawei; Wang, Bi-Cheng; Gavira, Jose A.; Ng, Joseph D. (UAH); (NASA); (Georgia)

    2010-07-20

    The common goal for structural genomic centers and consortiums is to decipher as quickly as possible the three-dimensional structures for a multitude of recombinant proteins derived from known genomic sequences. Since X-ray crystallography is the foremost method to acquire atomic resolution for macromolecules, the limiting step is obtaining protein crystals that can be useful of structure determination. High-throughput methods have been developed in recent years to clone, express, purify, crystallize and determine the three-dimensional structure of a protein gene product rapidly using automated devices, commercialized kits and consolidated protocols. However, the average number of protein structures obtained for most structural genomic groups has been very low compared to the total number of proteins purified. As more entire genomic sequences are obtained for different organisms from the three kingdoms of life, only the proteins that can be crystallized and whose structures can be obtained easily are studied. Consequently, an astonishing number of genomic proteins remain unexamined. In the era of high-throughput processes, traditional methods in molecular biology, protein chemistry and crystallization are eclipsed by automation and pipeline practices. The necessity for high-rate production of protein crystals and structures has prevented the usage of more intellectual strategies and creative approaches in experimental executions. Fundamental principles and personal experiences in protein chemistry and crystallization are minimally exploited only to obtain 'low-hanging fruit' protein structures. We review the practical aspects of today's high-throughput manipulations and discuss the challenges in fast pace protein crystallization and tools for crystallography. Structural genomic pipelines can be improved with information gained from low-throughput tactics that may help us reach the higher-bearing fruits. Examples of recent developments in this area

  16. Full analysis of feldspar texture and crystal structure by combining X-ray and electron techniques

    DEFF Research Database (Denmark)

    Balic Zunic, Tonci; Piazolo, Sandra; Katerinopoulou, Anna

    2013-01-01

    Feldspar crystals typically show a range of exsolution and polysynthetic twinning textures that can present problems for their full characterization, but at the same time give important information about their genesis. We present an integrated procedure for the micro-texture analysis, twin law......-temperature (HT) feldspars had similar global chemical compositions but underwent significantly different cooling histories, with cooling times probably differing by over an order of magnitude. Powder X-ray diffraction with Rietveld refinement was used for a preliminary identification of the mineral components...... a simultaneous calculation for structurally different components. Combined results of various methods helped improve accuracy and resolve ambiguities that arise from the application of a single technique. The approach is widely applicable to the study of mineral intergrowths and bridges an existing gap...

  17. X-ray studies of krypton, xenon and lead inclusions in aluminium single crystals

    International Nuclear Information System (INIS)

    Grabaek, L.; Bohr, J.; Johnson, E.; Andersen, H.H.; Johansen, A.; Sarholt-Kristensen, L.

    1988-01-01

    Samples of aluminum single crystals with [111] normal were implanted with either Kr, Xe or Pb. The small inclusions formed due to the immiscibility of these elements and aluminum were then studied by X-ray diffraction at various temperatures. The analysis showed that the small noble gas inclusions (≅ 23 A) formed after implantation are solid up to at least 541 Kelvin. During the first heating cycle the inclusions grow and in a second heating cycle it is found that the largest of the inclusions (≅ 42 A) melt below 260 Kelvin. The lead inclusions grow during the first and the second temperature cycle. Gradual melting was observed in a temperature interval from 621-660 Kelvin, which is above 603 Kelvin, the melting temperature of bulk lead. (orig.)

  18. X-ray Crystal Structures Elucidate the Nucleotidyl Transfer Reaction of Transcript Initiation Using Two Nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    M Gleghorn; E Davydova; R Basu; L Rothman-Denes; K Murakami

    2011-12-31

    We have determined the X-ray crystal structures of the pre- and postcatalytic forms of the initiation complex of bacteriophage N4 RNA polymerase that provide the complete set of atomic images depicting the process of transcript initiation by a single-subunit RNA polymerase. As observed during T7 RNA polymerase transcript elongation, substrate loading for the initiation process also drives a conformational change of the O helix, but only the correct base pairing between the +2 substrate and DNA base is able to complete the O-helix conformational transition. Substrate binding also facilitates catalytic metal binding that leads to alignment of the reactive groups of substrates for the nucleotidyl transfer reaction. Although all nucleic acid polymerases use two divalent metals for catalysis, they differ in the requirements and the timing of binding of each metal. In the case of bacteriophage RNA polymerase, we propose that catalytic metal binding is the last step before the nucleotidyl transfer reaction.

  19. X-ray absorption anisotropy for polychromatic illumination-Crystal views from inside

    International Nuclear Information System (INIS)

    Korecki, P.; Tolkiehn, M.; Novikov, D.V.

    2009-01-01

    We review an atomic resolution imaging method based on the analysis of the fine structure in X-ray absorption anisotropy, which results from incident beam diffraction. For a polychromatic X-ray beam, due to the suppression of higher order diffraction fringes, X-ray absorption anisotropy patterns can be interpreted as distorted real-space projections of the atomic structure around absorbing atoms. A qualitative method for analysis of X-ray absorption anisotropy patterns is presented, based on modeling of X-ray patterns with ray-traced images calculated for clusters around absorbing atoms.

  20. Syntheses and crystal structure determination by X-ray powder diffraction of new compounds of Benzovesamicol

    International Nuclear Information System (INIS)

    Rukiah, M.; Assaad, Th.

    2012-06-01

    The compound 2,2,2-Trifluoro-N-(1a,2,7,7 a-tetra-hydronaphtho[2,3-b]oxiren-3-yl)- acetamide, C 1 2H 1 0F 3 NO 2 , an important precursor in the preparation of benzovesamicol analogues for the diagnosis of Alzheimers disease, was prepared by the epoxidation of 5,8-dihydronaphthalene-1-amine using 3-chloroperoxybenzoic acid. The structure was determined by X-ray powder diffraction, multinuclear NMR spectroscopy and FT-IR spectroscopy. A pair of molecules form intermolecular N- H...O hydrogen bonds, involving the amino and oxirene groups, to produce a dimer.The two racemic compounds (2RS,3RS)-5-amino-3-(4-phenylpiperazin-1-yl)-1,2,3,4 tetrahydronaphthalene-2-ol, C 2 0H 2 5N 3 O, (I) and (2RS,3RS)-5-amino-3-[4-(3- methoxyphenyl)piperazin-1-yl]-1,2,3,4-tetrahydronaphthalene-2-ol, C 2 1H 2 7N 3 O 2 , (II) important benzovesamicol analogues for the diagnosis of Alzheimer's disease, have been synthesized and characterized by FT-IR, and 1 H and 13 C NMR spectroscopic analyses. The crystal structures were analyses using powder diffraction as no suitable single crystal were obtained. The two compounds are racemic mixtures of enantiomers which crystallize in the monoclinic system in a centrosymmetric space group (P21/c). Crystallography, in particular powder X-ray diffraction, was pivotal in revealing that the enantio-resolution did not succeed. In two compounds, the piperazine ring has a chair conformation, while the cyclohexene ring assumes a half-chair conformation. In (I) the crystal packing is mediated by weak contacts, principally by complementary intermolecular N--H...O hydrogen bonds that connect successive molecules into a chain. Further stabilization is provided by weak C--H...N contacts and by a weak intermolecular C--H...π interaction. While in (II), the crystal packing is dominated by intermolecular O--H...N hydrogen bonding which links molecules along the c direction. (authors)

  1. Effects of x rays on DNA synthesis in synchronized Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    Laughlin, T.J.; Taylor, J.H.

    1980-01-01

    Chinese hamster ovary cells were synchronized at the beginning of S phase with 5-fluorodeoxyuridine and irradiated with moderte levels ( 3 H]thymidine at various times after irradiation. The cells were lysed immediately after termination of the pulse, and the rate of DNA synthesis, size of the nascent strands, and number of active replicons were determined. The level of DNA synthesis in cells pulse-labeled immediately after x irradiation with 1000 rad was suppressed 20 to 25% but returned to control levels within 4 h after irradiation. Our data demonstrate that this x-ray-induced suppression of DNA synthesis was due entirely to a reduction in the number of active replicons, with no appreciable change in the rate of chain growth

  2. To the theory of X-ray and electron dynamic scattering in defect-containing crystals

    International Nuclear Information System (INIS)

    Chukhovskij, F.N.

    1982-01-01

    The novel approach to the X-ray and electron dynamic scattering theory based on the dynamic equations ''in the dispersion surface representation'' is formulated. The formally exact solution of two-wave diffraction scattering problem is obtained using the scattering matrix, the obvious expression for which is found. The general formulae describing the plane wave diffraction scattering in absorbing crystals in the weak distortion range has been obtained. The formulae allows one to determine the total change sign of the displacement function Δα(x,y)=2πg vectorx(R vector (r vector) 1 -R vector(r vector) 2 ) on the base of the known sign of the mean deflection magnitude in a crystal as a whole from the exact Bragg position (g vector - the inverse lattice vector, R vector - the displacement field vector, t - the crystal thickness, R vector(r vector) 1 =R vector (r) ar z=t, R vector(r vector) 2 =R(r) at z=0). In the quasiclassical approximation the formation of the diffraction image of a dislocation positioned in such a way that the dislocation axis is parallel to the diffraction reflection vector is considered for the incident plane and spherical waves

  3. Crystallization and preliminary X-ray diffraction analysis of diaminopimelate epimerase from Escherichia coli

    International Nuclear Information System (INIS)

    Hor, Lilian; Dobson, Renwick C. J.; Dogovski, Con; Hutton, Craig A.; Perugini, Matthew A.

    2009-01-01

    Diaminopimelate (DAP) epimerase, an enzyme in the lysine-biosynthetic pathway, is a promising target for antibiotic development against pathogenic bacteria. Here, the cloning, expression, purification, crystallization and preliminary diffraction analysis of DAP epimerase from E. coli are reported. Diaminopimelate (DAP) epimerase (EC 5.1.1.7) catalyzes the penultimate step of lysine biosynthesis in bacteria and plants, converting l,l-diaminopimelate to meso-diaminopimelate. Here, the cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of DAP epimerase from Escherichia coli are presented. Crystals were obtained in space group P4 1 2 1 2 and diffracted to 2.0 Å resolution, with unit-cell parameters a = b = 89.4, c = 179.6 Å. Molecular replacement was conducted using Bacillus anthracis DAP epimerase as a search model and showed the presence of two molecules in the asymmetric unit, with an initial R free of 0.456 and R work of 0.416

  4. Crystal structure and charge density analysis of Li2NH by synchrotron X-ray diffraction

    International Nuclear Information System (INIS)

    Noritake, T.; Nozaki, H.; Aoki, M.; Towata, S.; Kitahara, G.; Nakamori, Y.; Orimo, S.

    2005-01-01

    Complex hydrides, such as lithium amide (LiNH 2 ) and lithium imide (Li 2 NH), have recently been noticed as one of the most promising materials for reversible hydrogen storage. In this paper, we reveal the bonding nature of hydrogen in Li 2 NH crystal by synchrotron powder X-ray diffraction measurement at room temperature. The crystal structure was refined by Rietveld method and the charge density distribution was analyzed by maximum entropy method (MEM). The Li 2 NH crystal is anti-fluorite type structure (space group Fm3-bar m) consisting of Li and NH. Hydrogen atom occupies randomly the 48h (Wyckoff notation) sites around N atom. The refined lattice constant is a=5.0742(2)A. The charge density distribution around NH anion in Li 2 NH is almost spherical. The number of electrons within the sphere around the Li and NH is estimated from the obtained charge density distribution. As the result, the ionic charge is expressed as [Li 0.99+ ] 2 [NH] 1.21- . Therefore, it is confirmed experimentally that Li 2 NH is ionically bonded

  5. Purification, crystallization and preliminary X-ray crystallographic analysis of diaminopimelate epimerase from Acinetobacter baumannii

    International Nuclear Information System (INIS)

    Park, Jeong Soon; Lee, Woo Cheol; Song, Jung Hyun; Kim, Seung Il; Lee, Je Chul; Cheong, Chaejoon; Kim, Hye-Yeon

    2012-01-01

    The crystallization and preliminary X-ray crystallographic analysis of diaminopimelate epimerase from A. baumannii are reported. The meso isomer of diaminopimelate (meso-DAP) is a biosynthetic precursor of l-lysine in bacteria and plants, and is a key component of the peptidoglycan layer in the cell walls of Gram-negative and some Gram-positive bacteria. Diaminopimelate epimerase (DapF) is a pyridoxal-5′-phosphate-independent racemase which catalyses the interconversion of (6S,2S)-2,6-diaminopimelic acid (ll-DAP) and meso-DAP. In this study, DapF from Acinetobacter baumannii was overexpressed in Escherichia coli strain SoluBL21, purified and crystallized using a vapour-diffusion method. A native crystal diffracted to a resolution of 1.9 Å and belonged to space group P3 1 or P3 2 , with unit-cell parameters a = b = 74.91, c = 113.35 Å, α = β = 90, γ = 120°. There were two molecules in the asymmetric unit

  6. Indentation Size Effects in Single Crystal Copper as Revealed by Synchrotron X-ray Microdiffraction

    Energy Technology Data Exchange (ETDEWEB)

    Feng, G.; Budiman, A. S.; Nix, W. D.; Tamura, N.; Patel, J. R.

    2007-11-19

    The indentation size effect (ISE) has been observed in numerous nanoindentation studies on crystalline materials; it is found that the hardness increases dramatically with decreasing indentation size - a 'smaller is stronger' phenomenon. Some have attributed the ISE to the existence of strain gradients and the geometrically necessary dislocations (GNDs). Since the GND density is directly related to the local lattice curvature, the Scanning X-ray Microdiffraction ({mu}SXRD) technique, which can quantitatively measure relative lattice rotations through the streaking of Laue diffractions, can used to study the strain gradients. The synchrotron {mu}SXRD technique we use - which was developed at the Advanced Light Source (ALS), Berkeley Lab - allows for probing the local plastic behavior of crystals with sub-micrometer resolution. Using this technique, we studied the local plasticity for indentations of different depths in a Cu single crystal. Broadening of Laue diffractions (streaking) was observed, showing local crystal lattice rotation due to the indentation-induced plastic deformation. A quantitative analysis of the streaking allows us to estimate the average GND density in the indentation plastic zones. The size dependence of the hardness, as found by nanoindentation, will be described, and its correlation to the observed lattice rotations will be discussed.

  7. X-ray diffraction topography observations of the core in Bi12SiO20 crystals doped with Mn

    International Nuclear Information System (INIS)

    Milenov, T.I.; Botev, P.A.; Rafailov, P.M.; Gospodinov, M.M.

    2004-01-01

    The core region in a bismuth silicate--Bi 12 SiO 20 (BSO) crystal doped with Mn was examined by X-ray double-crystal diffraction topography. Specific features were observed in the topographies as lines and contrast differences that point to defects occupying the central part of the crystal. We discuss the nature of these defects and propose an explanation in terms of stacking faults arranged in different structures

  8. LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

    International Nuclear Information System (INIS)

    Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.; Kuroda, Teruo; Ishitani, Ryuichiro; Suga, Hiroaki; Nureki, Osamu

    2016-01-01

    A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-ray diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters

  9. A universal treatment of X-ray and neutron diffraction in crystals. II. Extinction

    International Nuclear Information System (INIS)

    Hu Huachen

    1997-01-01

    For pt.I see ibid., p.484-92, 1997. Based on the formalism for calculating the integrated reflection power ratio of a plane mosaic crystal by using three dimensionless parameters exact and universal expressions for the secondary-extinction factors in X-ray and neutron crystallography are developed that can be applied to reflections of all possible values of extinction factor, reflection symmetry and the absorption-to-scattering cross-section ratio of the crystal. The representation by three parameters gives a clear and definite physical meaning to the concept of extinction. The theory has been extended to treat the extinction of a spherical crystal, and the striking difference in the evaluated secondary-extinction factor between the equivalent single-plate and the exact method in the spherical-crystal treatment under θ B = 0 is explained. As a demonstration of the feasibility of using these expressions, the diffraction data for LiF and MgO crystal plates measured by Lawrence [Acta Cryst. (1972), A28, 400-404; (1973), A29, 208-210] are reanalyzed by this method. All the reflections including the strongest ones (Y o down to 0.026) are reanalyzed simultaneously with single-valued particle size and mosaic spread as fitting parameters and allowing for primary extinction if necessary. The results (R factor = 0.014 and 0.053 for LiF and MgO, respectively) are unprecedentedly good. Furthermore, in disagreement with Lawrence, the extinction of LiF is found to be of secondary type and in the case of MgO both primary and secondary extinction should be considered. The analysis also shows that the formula Y ∝ Y p Y s is valid only for very weak extinctions and that the Hamilton-Darwin equations are valid in a range much broader than previously anticipated. (orig.)

  10. X-ray Crystallography Facility

    Science.gov (United States)

    2000-01-01

    Edward Snell, a National Research Council research fellow at NASA's Marshall Space Flight Center (MSFC), prepares a protein crystal for analysis by x-ray crystallography as part of NASA's structural biology program. The small, individual crystals are bombarded with x-rays to produce diffraction patterns, a map of the intensity of the x-rays as they reflect through the crystal.

  11. Crystallization and preliminary X-ray diffraction analysis of l,l-diaminopimelate aminotransferase (DapL) from Chlamydomonas reinhardtii

    International Nuclear Information System (INIS)

    Hudson, André O.; Girón, Irma; Dobson, Renwick C. J.

    2010-01-01

    A variant of the diaminopimelate/lysine pathway has recently been defined following the discovery of the enzyme l,l-diaminopimelate aminotransferase (DapL). The cloning of the cDNA, recombinant expression, purification and preliminary diffraction analysis of DapL from the alga C. reinhardtii are presented. In the anabolic synthesis of diaminopimelate and lysine in plants and in some bacteria, the enzyme l,l-diaminopimelate aminotransferase (DapL; EC 2.6.1.83) catalyzes the conversion of tetrahydrodipicolinic acid (THDPA) to l,l-diaminopimelate, bypassing the DapD, DapC and DapE enzymatic steps in the bacterial acyl pathways. Here, the cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of DapL from the alga Chlamydomonas reinhardtii are presented. Protein crystals were grown in conditions containing 25%(w/v) PEG 3350 and 200 mM lithium sulfate and initially diffracted to ∼1.35 Å resolution. They belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 58.9, b = 91.8, c = 162.9 Å. The data were processed to 1.55 Å resolution with an R merge of 0.081, an R p.i.m. of 0.044, an R r.i.m of 0.093 and a V M of 2.28 Å 3 Da −1

  12. Crystallization and preliminary X-ray diffraction analysis of L,L-diaminopimelate aminotransferase (DapL) from Chlamydomonas reinhardtii.

    Science.gov (United States)

    Hudson, André O; Girón, Irma; Dobson, Renwick C J

    2011-01-01

    In the anabolic synthesis of diaminopimelate and lysine in plants and in some bacteria, the enzyme L,L-diaminopimelate aminotransferase (DapL; EC 2.6.1.83) catalyzes the conversion of tetrahydrodipicolinic acid (THDPA) to L,L-diaminopimelate, bypassing the DapD, DapC and DapE enzymatic steps in the bacterial acyl pathways. Here, the cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of DapL from the alga Chlamydomonas reinhardtii are presented. Protein crystals were grown in conditions containing 25% (w/v) PEG 3350 and 200 mM lithium sulfate and initially diffracted to ∼1.35 Å resolution. They belonged to space group P2(1)2(1)2(1), with unit-cell parameters a=58.9, b=91.8, c=162.9 Å. The data were processed to 1.55 Å resolution with an Rmerge of 0.081, an Rp.i.m. of 0.044, an Rr.i.m of 0.093 and a VM of 2.28 Å3 Da(-1).

  13. Expression, purification, crystallization and preliminary X-ray analysis of Escherichia coli 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase.

    Science.gov (United States)

    Lee, J E; Cornell, K A; Riscoe, M K; Howell, P L

    2001-01-01

    A recombinant form of Escherichia coli 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase (E.C. 3.2.2.9) has been purified to homogeneity and crystallized using the hanging-drop vapour-diffusion technique. While several different crystallization conditions were obtained, only one set of conditions yielded crystals suitable for X-ray diffraction analysis. These crystals grow as diamond-shaped wedges, with unit-cell parameters a = 50.92, b = 133.99, c = 70.88 A, alpha = beta = gamma = 90 degrees. The crystals belong to space group P2(1)2(1)2 and diffract to a minimum d spacing of 2.3 A on a MAR345 image plate with a Rigaku RU-200 rotating-anode X-ray generator. On the basis of density calculations, two monomers are predicted per asymmetric unit (Matthews coefficient, V(M) = 2.37 A(3) Da(-1)), with a solvent content of 48%.

  14. X-ray magnetic microscopy for correlations between magnetic domains and crystal structure

    International Nuclear Information System (INIS)

    Denbeaux, G.; Anderson, E.; Bates, B.; Chao, W.; Liddle, J.A.; Harteneck, B.; Pearson, A.; Salmassi, F.; Schneider, G.; Fischer, P.; Eimuller, T.; Taylor, S.; Chang, H.; Kusinski, G.J.

    2002-01-01

    Accurately determining the resolution of x-ray microscopes has been a challenge because good test patterns for x-ray microscopy have been hard to make. We report on a sputter-deposited multilayer imaged in cross section as a test pattern with small features and high aspect ratios. One application of high-resolution imaging is magnetic materials. Off-axis bend magnet radiation is known to have a component of circular polarization which can be used for x-ray magnetic circular dichroism. We calculate the integrated circular polarization collected by the illumination optics in the XM-1 full-field x-ray microscope. (authors)

  15. Investigation into structure of berylliumaluminium silicate glasses and crystals by X-ray spectroscopy

    International Nuclear Information System (INIS)

    Tykachinskij, I.D.; Gorbachev, V.V.; Petrakov, V.N.; Varshal, B.G.; Bystrakov, A.S.; Dmitriev, I.D.; Zatsepin, A.F.; Blaginina, L.A.

    1983-01-01

    For the purpose of elucidating the structural state of Be 2+ and Al 3+ ions as well as the nature of Be-O bond the investigation of glasses obtained from BeO, Al 2 O 3 and SiO 2 with different component composition is undertaken by X-ray spectroscopy. In three-component beryllium alumosilicate glasses at the ratio γ=Al 2 O 3 /BeO=0.34-1.92 the main part of Al 3+ cations forms AlO 4 groups. Be 2+ cations probably occupy several non-equivalent states. At the ''crystal-glass'' transition the reorganization of near structure of beryllium alumosilicate frame with appearance in a glass in contrast to crystal analog of beryllium cations playing the role of a glass former (being a part of glass net) as well as a modifier role occurs. For compositions with γ=1 the degree of ionic character of the Be-O bond is the greatest. The increase of Be 2+ cations fraction being a part of the glass net is characteristic feature of the glasses with parameter values γ not equal to 1

  16. Crystal structure investigations on cation-substituted alums by X-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Abdeen, A.M.

    1980-04-01

    The crystal structures of the three alums: NH 4 Al(SO 4 ) 2 .12H 2 O, (NH 3 CH 3 )Al(SO 4 ) 2 .12H 2 O and (NH 3 OH)Al(SO 4 ) 2 .12H 2 O have been determined from three-dimensional neutron diffraction data enhanced by X-ray diffraction when necessary. These compounds crystallize cubic in space group Pa3. The structures of the three alums exhibit partial occupancies of crystallographic sites for the NH 4 , (NH 3 CH 3 ) and (NH 3 OH) group atoms. This can be explained by a quantized rotation of the three groups around an axis perpendicular to the [111] direction. Some of the (SO 4 ) 2- groups in the NH 4 -alum are disordered with about 17% of the sulfate tetrahedra being in a reversed orientation around the sulfur atom. The disorder in (NH 3 CH 3 ) and (NH 3 OH)-alums is only 4,3% and 3.0% respectively. The atoms in the alum structures are held together by a system of hydrogen bonds between the water molecules and between the water molecules and the sulfate oxygen atoms. In these three structures there is a strong indication that shorter hydrogen bonds tend to be nearly linear. (orig.)

  17. MraZ from Escherichia coli: cloning, purification, crystallization and preliminary X-ray analysis

    International Nuclear Information System (INIS)

    Adams, Melanie A.; Udell, Christian M.; Pal, Gour Pada; Jia, Zongchao

    2005-01-01

    The crystallization and preliminary X-ray diffraction analysis of MraZ, formerly known as hypothetical protein YabB, from Escherichia coli K-12 is presented. The MraZ family of proteins, also referred to as the UPF0040 family, are highly conserved in bacteria and are thought to play a role in cell-wall biosynthesis and cell division. The murein region A (mra) gene cluster encodes MraZ proteins along with a number of other proteins involved in this complex process. To date, there has been no clear functional assignment provided for MraZ proteins and the structure of a homologue from Mycoplasma pneumoniae, MPN314, failed to suggest a molecular function. The b0081 gene from Escherichia coli that encodes the MraZ protein was cloned and the protein was overexpressed, purified and crystallized. This data is presented along with evidence that the E. coli homologue exists in a different oligomeric state to the MPN314 protein

  18. Preparation, crystallization and preliminary X-ray analysis of YjcG protein from Bacillus subtilis

    International Nuclear Information System (INIS)

    Li, Dan; Chan, Chiomui; Liang, Yu-He; Zheng, Xiaofeng; Li, Lanfen; Su, Xiao-Dong

    2005-01-01

    B. subtilis YjcG protein was expressed, purified and crystallized. A complete diffraction data set was collected at BSRF beamline 3W1A and processed to 2.3 Å resolution. Bacillus subtilis YjcG is a functionally uncharacterized protein with 171 residues that has no structural homologue in the Protein Data Bank. However, it shows sequence homology to bacterial and archaeal 2′–5′ RNA ligases. In order to identify its exact function via structural studies, the yjcG gene was amplified from B. subtilis genomic DNA and cloned into the expression vector pET21-DEST. The protein was expressed in a soluble form in Escherichia coli and was purified to homogeneity. Crystals suitable for X-ray analysis were obtained that diffracted to 2.3 Å and belonged to space group C2, with unit-cell parameters a = 99.66, b = 73.93, c = 61.77 Å, β = 113.56°

  19. High-resolution bent-crystal spectrometer for the ultra-soft x-ray region

    International Nuclear Information System (INIS)

    Beiersdorfer, P.; von Goeler, S.; Bitter, M.; Hill, K.W.; Hulse, R.A.; Walling, R.S.

    1988-10-01

    A multichannel vacuum Brag-crystal spectrometer has been developed for high-resolution measurements of the line emission from tokamak plasmas in the wavelength region between 4 and 25 /angstrom/. The spectrometer employs a bent crystal in Johann geometry and a microchannel-plate intensified photodiode array. The instrument is capable of measuring high-resolution spectra (λ/Δλ ∼ 3000) with fast time resolution (4 msec per spectrum) and good spatial resolution (3 cm). The spectral bandwidth is Δλ/λ 0 = 8/angstrom/. A simple tilt mechanism allows access to different wavelength intervals. In order to illustrate the utility of the new spectrometer, time- and space-resolved measurements of the n = 3 to n = 2 spectrum of selenium from the Princeton Large Torus tokamak plasmas are presented. The data are used to determine the plasma transport parameters and to infer the radial distribution of fluorinelike, neonlike, and sodiumlike ions of selenium in the plasma. The new ultra-soft x-ray spectrometer has thus enabled us to demonstrate the utility of high-resolution L-shell spectroscopy of neonlike ions as a fusion diagnostic. 43 refs., 23 figs

  20. Crystal Engineering on Industrial Diaryl Pigments Using Lattice Energy Minimizations and X-ray Powder Diffraction

    International Nuclear Information System (INIS)

    Schmidt, M.; Dinnebier, R.; Kalkhof, H.

    2007-01-01

    Diaryl azo pigments play an important role as yellow pigments for printing inks, with an annual pigment production of more than 50,000 t. The crystal structures of Pigment Yellow 12 (PY12), Pigment Yellow 13 (PY13), Pigment Yellow 14 (PY14), and Pigment Yellow 83 (PY83) were determined from X-ray powder data using lattice energy minimizations and subsequent Rietveld refinements. Details of the lattice energy minimization procedure and of the development of a torsion potential for the biphenyl fragment are given. The Rietveld refinements were carried out using rigid bodies, or constraints. It was also possible to refine all atomic positions individually without any constraint or restraint, even for PY12 having 44 independent non-hydrogen atoms per asymmetric unit. For PY14 (23 independent non-hydrogen atoms), additionally all atomic isotropic temperature factors could be refined individually. PY12 crystallized in a herringbone arrangement with twisted biaryl fragments. PY13 and PY14 formed a layer structure of planar molecules. PY83 showed a herringbone structure with planar molecules. According to quantum mechanical calculations, the twisting of the biaryl fragment results in a lower color strength of the pigments, whereas changes in the substitution pattern have almost no influence on the color strength of a single molecule. Hence, the experimentally observed lower color strength of PY12 in comparison with that of PY13 and PY83 can be explained as a pure packing effect. Further lattice energy calculations explained that the four investigated pigments crystallize in three different structures because these structures are the energetically most favorable ones for each compound. For example, for PY13, PY14, or PY83, a PY12-analogous crystal structure would lead to considerably poorer lattice energies and lower densities. In contrast, lattice energy calculations revealed that PY12 could adopt a PY13-type structure with only slightly poorer energy. This structure was

  1. Extended Physicochemical Characterization of the Synthetic Anticoagulant Pentasaccharide Fondaparinux Sodium by Quantitative NMR and Single Crystal X-ray Analysis

    NARCIS (Netherlands)

    Wildt, William de; Kooijman, Huub; Funke, Carel; Üstün, Bülent; Leika, Afranina; Lunenburg, Maarten; Kaspersen, Frans; Kellenbach, Edwin

    2017-01-01

    Fondaparinux sodium is a synthetic pentasaccharide representing the high affinity antithrombin III binding site in heparin. It is the active pharmaceutical ingredient of the anticoagulant drug Arixtra(®). The single crystal X-ray structure of Fondaparinux sodium is reported, unequivocally confirming

  2. Extreme UV and X-ray scattering measurements from a rough LiF crystal surface characterized by electron micrography

    DEFF Research Database (Denmark)

    Alehyane; Arbaoui; Barchewitz

    1989-01-01

    XUV and X-ray scattering by a LiF crystal is measured. The angular distribution of the scattered radiation (ADSR) reveals characteristic features, side peaks or asymmetry. The surface of the sample is statistically characterized by a microdensitometer analysis of electron micrographs resolving...

  3. Determination of crystal structures by x-ray diffraction: applications to a lanthanide complex and a natural organic compound

    International Nuclear Information System (INIS)

    Miranda, J.M. de.

    1986-01-01

    The study fir determining crystal structures of the Ho (ReO sub(4)) sub(3) 4 TDTD 3 H sub(2) O complex and the natural organic compound C sub(14) H sub(16) O sub(6) by X-ray diffraction are presented. The experimental equipments are described in details. (M.C.K.)

  4. The first X-ray crystal structure of the glucocorticoid receptor bound to a non-steroidal agonist

    Energy Technology Data Exchange (ETDEWEB)

    Madauss, Kevin P.; Bledsoe, Randy K.; Mclay, Iain; Stewart, Eugene L.; Uings, Iain J.; Weingarten, Gordon; Williams, Shawn P. (GSKNC); (GSK)

    2009-07-23

    The amino-pyrazole 2,6-dichloro-N-ethyl benzamide 1 is a selective GR agonist with dexamethasone-like in vitro potency. Its X-ray crystal structure in the GR LBD (Glucocorticoid ligand-binding domain) is described and compared to other reported structures of steroidal GR agonists in the GR LBD (3E7C).

  5. The application of X-ray, γ-ray and neutron diffraction to the characterization of single crystal perfection

    International Nuclear Information System (INIS)

    Freund, A.; Schneider, J.R.

    1976-01-01

    The work is divided into the following three chapters: 1) diffraction by perfect and imperfect crystals, 2) experimental apparatus (describing gamma ray, X-ray and neutron diffractometers), 3) application of diffraction methods to the development of neutron monochromators. (WBU) [de

  6. Characterization of voids in shock-loaded Al single crystal by combining X-ray tomography and electron microscopy

    DEFF Research Database (Denmark)

    Hong, Chuanshi; Fæster, Søren; Hansen, Niels

    2017-01-01

    A combination of X-ray tomography and electron backscatter diffraction (EBSD) was applied to investigate both the shape of voids and the plastic deformation around voids in an Al single crystal shock-loaded in the direction. The combination of these two techniques allows the addition of crystallo...

  7. Single crystal X-ray structural features of aromatic compounds having a pentafluorosulfuranyl (SF5) functional group

    Czech Academy of Sciences Publication Activity Database

    Du, J.; Hua, G.; Beier, Petr; Slawin, A. M. Z.; Woollins, J. D.

    2017-01-01

    Roč. 28, č. 3 (2017), s. 723-733 ISSN 1040-0400 Institutional support: RVO:61388963 Keywords : pentafluorosulfuranyl (SF5) group * aromatic compounds * single crystal X-ray structure * intramolecular interactions * intermolecular interactions Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 1.582, year: 2016

  8. Flash X-ray

    International Nuclear Information System (INIS)

    Sato, Eiichi

    2003-01-01

    Generation of quasi-monochromatic X-ray by production of weakly ionized line plasma (flash X-ray), high-speed imaging by the X-ray and high-contrast imaging by the characteristic X-ray absorption are described. The equipment for the X-ray is consisted from the high-voltage power supply and condenser, turbo molecular pump, and plasma X-ray tube. The tube has a long linear anticathode to produce the line plasma and flash X-ray at 20 kA current at maximum. X-ray spectrum is measured by the imaging plate equipped in the computed radiography system after diffracted by a LiF single crystal bender. Cu anticathode generates sharp peaks of K X-ray series. The tissue images are presented for vertebra, rabbit ear and heart, and dog heart by X-ray fluoroscopy with Ce anticathode. Generation of K-orbit characteristic X-ray with extremely low bremsstrahung is to be attempted for medical use. (N.I.)

  9. X-ray diffraction study with small- and wide-angle simultaneous measurement of polymorphic crystallization of triacylglycerols

    Energy Technology Data Exchange (ETDEWEB)

    Ueno, Satoru [Hiroshima Univ., Faculty of Applied Biological Science, Higashi-Hiroshima, Hiroshima (Japan)

    2002-01-01

    Polymorphism of triacylglycerols (TAGs) is an important phenomenon which influences the physical chemical properties of fats employed in foods, pharmaceuticals, cosmetics etc. In particular, precise analysis of kinetic properties of polymorphic crystallization is closely related to technical control of fat crystallization in confectionery and food industry. In the melt-mediated crystallization, which is one of the typical methods of crystallizing the more stable form for industrial use, the more stable form is induced by rapidly melting the less stable forms. Recently, X-ray diffraction spectroscopy using a synchrotron radiation source has been used in study of dynamic processes of polymorphic transformations of many TAGs. This approach has allowed us to gain a better understanding of the kinetics of processes occurring during the polymorphic crystallization and transformations of TAGs at the molecular level. In the present study, polymorphic crystallization of TAG has been examined with the time-resolved X-ray diffraction method with small- and wide-angle simultaneous measurement using synchrotron radiation. The main result is as follows: the melt mediation gave rise to the formation of a liquid crystalline structure having long spacing values of 5.1 nm and 4.6 nm in SOS (sn-1,3-distearoyl-2-oleoyl glycerol). Consequently, the use of the time-resolved X-ray diffraction method with small- and wide-angle simultaneous measurement using synchrotron radiation unveiled quite newer aspects of the polymorphic crystallization of the triacylglycerols from neat liquid, which were not detectable in conventional XRD techniques. (author)

  10. High-resolution study of x-rays emitted from highly charged S ions using a bent-crystal spectrometer

    Science.gov (United States)

    Kasthurirangan, S.; Banerjee, A.; Kumar, A.; Agnihotri, A. N.; Misra, D.; Tribedi, L. C.

    2013-09-01

    We have measured the projectile x-rays from 56 MeV sulphur ions in collision with thin carbon foils using a high-resolution bent-crystal spectrometer. The resolution of the spectrometer is good enough to resolve lines arising from transitions in H-, He- and Li-like ions. The line energies are compared with values from the NIST x-ray database. The data have also been used to generate the approximate equilibrium charge state distribution, which is compared with semi-empirical model predictions.

  11. Expression, purification, crystallization and preliminary X-ray analysis of two arginine-biosynthetic enzymes from Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Moradian, Fatemeh; Garen, Craig; Cherney, Leonid; Cherney, Maia; James, Michael N. G.

    2006-01-01

    Two enzymes responsible for arginine biosynthesis in M. tuberculosis were expressed in Escherichia coli, then purified to homogeneity. Preliminary X-ray analysis of diffraction-quality crystals grown from each enzyme are reported. The gene products of two open reading frames from Mycobacterium tuberculosis (Mtb) have been crystallized using the sitting-drop vapour-diffusion method. Rv1652 encodes a putative N-acetyl-γ-glutamyl-phosphate reductase (MtbAGPR), while the Rv1656 gene product is annotated as ornithine carbamoyltransferase (MtbOTC). Both MtbAGPR and MtbOTC were expressed in Escherichia coli, purified to homogeneity and crystallized. Native data for each crystal were collected to resolutions of 2.15 and 2.80 Å, respectively. Preliminary X-ray data are presented for both enzymes

  12. Crystallization and preliminary X-ray diffraction analysis of the protease from Southampton norovirus complexed with a Michael acceptor inhibitor

    International Nuclear Information System (INIS)

    Hussey, R. J.; Coates, L.; Gill, R. S.; Wright, J. N.; Sarwar, M.; Coker, S.; Erskine, P. T.; Cooper, J. B.; Wood, S.; Clarke, I. N.; Lambden, P. R.; Broadbridge, R.; Shoolingin-Jordan, P. M.

    2010-01-01

    The crystallization of the recombinant protease from Southampton norovirus is described. Whilst the native crystals were found to diffract only to medium resolution (2.9 Å), cocrystals with a designed covalently bound inhibitor diffracted X-rays to 1.7 Å resolution. Noroviruses are the predominant cause of human epidemic nonbacterial gastroenteritis. Viral replication requires a cysteine protease that cleaves a 200 kDa viral polyprotein into its constituent functional parts. Here, the crystallization of the recombinant protease from the Southampton norovirus is described. Whilst the native crystals were found to diffract only to medium resolution (2.9 Å), cocrystals of an inhibitor complex diffracted X-rays to 1.7 Å resolution. The polypeptide inhibitor (Ac-EFQLQ-propenyl ethyl ester) possesses an amino-acid sequence designed to match the substrate specificity of the enzyme, but was synthesized with a reactive Michael acceptor group at the C-terminal end

  13. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    Energy Technology Data Exchange (ETDEWEB)

    Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation); Muravieva, T. I.; Esipov, R. S., E-mail: espiov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation)

    2016-11-15

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

  14. Redetermination of the crystal structure of β-zinc molybdate from single-crystal X-ray diffraction data.

    Science.gov (United States)

    Mtioui-Sghaier, Olfa; Mendoza-Meroño, Rafael; Ktari, Lilia; Dammak, Mohamed; García-Granda, Santiago

    2015-07-01

    The crystal structure of the β-polymorph of ZnMoO4 was re-determined on the basis of single-crystal X-ray diffraction data. In comparison with previous powder X-ray diffraction studies [Katikaneani & Arunachalam (2005 ▸). Eur. J. Inorg. Chem. pp. 3080-3087; Cavalcante et al. (2013 ▸). Polyhedron, 54, 13-25], all atoms were refined with anisotropic displacement parameters, leading to a higher precision with respect to bond lengths and angles. β-ZnMoO4 adopts the wolframite structure type and is composed of distorted ZnO6 and MoO6 octa-hedra, both with point group symmetry 2. The distortion of the octa-hedra is reflected by variation of bond lengths and angles from 2.002 (3)-2.274 (4) Å, 80.63 (11)-108.8 (2)° for equatorial and 158.4 (2)- 162.81 (14)° for axial angles (ZnO6), and of 1.769 (3)-2.171 (3) Å, 73.39 (16)-104.7 (2), 150.8 (2)-164.89 (15)° (MoO6), respectively. In the crystal structure, the same type of MO6 octa-hedra share edges to built up zigzag chains extending parallel to [001]. The two types of chains are condensed by common vertices into a framework structure. The crystal structure can alternatively be described as derived from a distorted hexa-gonally closed packed arrangement of the O atoms, with Zn and Mo in half of the octa-hedral voids.

  15. Humidity control and hydrophilic glue coating applied to mounted protein crystals improves X-ray diffraction experiments

    Science.gov (United States)

    Baba, Seiki; Hoshino, Takeshi; Ito, Len; Kumasaka, Takashi

    2013-01-01

    Protein crystals are fragile, and it is sometimes difficult to find conditions suitable for handling and cryocooling the crystals before conducting X-ray diffraction experiments. To overcome this issue, a protein crystal-mounting method has been developed that involves a water-soluble polymer and controlled humid air that can adjust the moisture content of a mounted crystal. By coating crystals with polymer glue and exposing them to controlled humid air, the crystals were stable at room temperature and were cryocooled under optimized humidity. Moreover, the glue-coated crystals reproducibly showed gradual transformations of their lattice constants in response to a change in humidity; thus, using this method, a series of isomorphous crystals can be prepared. This technique is valuable when working on fragile protein crystals, including membrane proteins, and will also be useful for multi-crystal data collection. PMID:23999307

  16. X-ray diffraction studies of NbTe2 single crystal

    Indian Academy of Sciences (India)

    Unknown

    X-ray (EDAX) and remaining structural characterization was also accomplished by X-ray diffraction (XRD) studies. Lattice parameters, volume and ... The layered structure compound, NbTe2, is one of the typical materials which lead to charge .... financial assistance to carry out this work. References. Brown B E 1966 Acta ...

  17. Existence of quasi-stationary neutron and x-ray states near the surface of a deformed single crystal

    CERN Document Server

    Iolin, E

    1999-01-01

    The problem of x-ray or neutron multiply internally reflected inside a bent single crystal plate (Bragg geometry) is considered. It is found that such multiple reflections lead to the existence of quasi-stationary (QS) states. QS states are discrete and correspond to the resonance of motion of the tie point between the front surface and a 'turning place' inside a single crystal. (author)

  18. Crystallization and preliminary X-ray diffraction data analysis of stenodactylin, a highly toxic type 2 ribosome-inactivating protein from Adenia stenodactyla

    International Nuclear Information System (INIS)

    Tosi, Giovanna; Fermani, Simona; Falini, Giuseppe; Polito, Letizia; Bortolotti, Massimo; Bolognesi, Andrea

    2009-01-01

    Stenodactylin is a type 2 RIP from the caudex of Adenia stenodactyla. Stenodactylin crystallization and preliminary X-ray diffraction data analysis are reported. Ribosome-inactivating proteins (RIPs) inhibit protein synthesis and induce cell death by removing a single adenine from a specific rRNA loop. They can be divided into two main groups: type 1 and type 2 RIPs. Type 1 RIPs are single-chain enzymes with N-glycosidase activity. Type 2 RIPs contain two chains (A and B) linked by a disulfide bond. The A chain has RIP enzymatic activity, whereas the B chain shows lectin activity and is able to bind to glycosylated receptors on the cell surface. Stenodactylin is a type 2 RIP from the caudex of Adenia stenodactyla from the Passifloraceae family that has been recently purified and characterized. It shows a strong enzymatic activity towards several substrates and is more cytotoxic than other toxins of the same type. Here, the crystallization and preliminary X-ray diffraction data analysis of stenodactylin are reported. This RIP forms crystals that diffract to high resolution (up to 2.15 Å). The best data set was obtained by merging data collected from two crystals. Stenodactylin crystals belonged to the centred monoclinic space group C2 and contained two molecules in the asymmetric unit

  19. Crystallization and preliminary X-ray diffraction study of recombinant adenine phosphoribosyltransferase from the thermophilic bacterium Thermus thermophilus strain HB27

    Science.gov (United States)

    Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2017-07-01

    Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).

  20. Synthesis of a 2,2'-Bipyridyl Functionalized Oligovinylene-Phenylene Using Heck and Horner-Wadsworth-Emmons Reactions and X-ray Crystal Structure of E-(4-(4-Bromostyryl)phenyl)(methyl)sulfane

    OpenAIRE

    Karácsony, Orsolya; Deschamps, Jeffrey R.; Trammell, Scott A.; Nita, Rafaela; Knight, D. Andrew

    2012-01-01

    The synthesis of a new 2,2'-bipyridyl functionalized oligovinylenephenylene (OVP-5) containing a methyl protected thiol using Heck coupling and the Horner-Wadsworth-Emmons reaction and is described. A key step involving a diisopropylcarbodiimide promoted dehydration of a stable b-hydroxyphosphonate intermediate was identified. The structure of precursor E-(4-(4-bromostyryl)phenyl)(methyl)sulfane (1) was determ...

  1. Tin( ii ) ketoacidoximates: synthesis, X-ray structures and processing to tin( ii ) oxide

    KAUST Repository

    Khanderi, Jayaprakash

    2015-10-21

    Tin(ii) ketoacidoximates of the type [HONCRCOO]Sn (R = Me 1, CHPh 2) and (MeONCMeCOO)Sn] NH·2HO 3 were synthesized by reacting pyruvate- and hydroxyl- or methoxylamine RONH (R = H, Me) with tin(ii) chloride dihydrate SnCl·2HO. The single crystal X-ray structure reveals that the geometry at the Sn atom is trigonal bipyramidal in 1, 2 and trigonal pyramidal in 3. Inter- or intramolecular hydrogen bonding is observed in 1-3. Thermogravimetric (TG) analysis shows that the decomposition of 1-3 to SnO occurs at ca. 160 °C. The evolved gas analysis during TG indicates complete loss of the oximato ligand in one step for 1 whereas a small organic residue is additionally removed at temperatures >400 °C for 2. Above 140 °C, [HONC(Me)COO]Sn (1) decomposes in air to spherical SnO particles of size 10-500 nm. Spin coating of 1 on Si or a glass substrate followed by heating at 200 °C results in a uniform film of SnO. The band gap of the produced SnO film and nanomaterial was determined by diffuse reflectance spectroscopy to be in the range of 3.0-3.3 eV. X-ray photoelectron spectroscopy indicates surface oxidation of the SnO film to SnO in ambient atmosphere.

  2. Nanoscale characterization of local structures and defects in photonic crystals using synchrotron-based transmission soft X-ray microscopy

    Science.gov (United States)

    Nho, Hyun Woo; Kalegowda, Yogesh; Shin, Hyun-Joon; Yoon, Tae Hyun

    2016-01-01

    For the structural characterization of the polystyrene (PS)-based photonic crystals (PCs), fast and direct imaging capabilities of full field transmission X-ray microscopy (TXM) were demonstrated at soft X-ray energy. PS-based PCs were prepared on an O2-plasma treated Si3N4 window and their local structures and defects were investigated using this label-free TXM technique with an image acquisition speed of ~10 sec/frame and marginal radiation damage. Micro-domains of face-centered cubic (FCC (111)) and hexagonal close-packed (HCP (0001)) structures were dominantly found in PS-based PCs, while point and line defects, FCC (100), and 12-fold symmetry structures were also identified as minor components. Additionally, in situ observation capability for hydrated samples and 3D tomographic reconstruction of TXM images were also demonstrated. This soft X-ray full field TXM technique with faster image acquisition speed, in situ observation, and 3D tomography capability can be complementally used with the other X-ray microscopic techniques (i.e., scanning transmission X-ray microscopy, STXM) as well as conventional characterization methods (e.g., electron microscopic and optical/fluorescence microscopic techniques) for clearer structure identification of self-assembled PCs and better understanding of the relationship between their structures and resultant optical properties. PMID:27087141

  3. Novel bimetallic thiocyanate-bridged Cu(II)-Hg(II) compounds-synthesis, X-Ray studies and magnetic properties

    Energy Technology Data Exchange (ETDEWEB)

    Machura, B., E-mail: basia@ich.us.edu.pl [Department of Crystallography, Institute of Chemistry, University of Silesia, 9th Szkolna St., 40-006 Katowice (Poland); Switlicka, A.; Zwolinski, P. [Department of Crystallography, Institute of Chemistry, University of Silesia, 9th Szkolna St., 40-006 Katowice (Poland); Mrozinski, J., E-mail: jmroz@wchuwr.chem.uni.wroc.pl [Faculty of Chemistry, Wroclaw University, F. Joliot-Curie 14 St., 50-383 Wroclaw (Poland); Kalinska, B. [Faculty of Chemistry, Wroclaw University, F. Joliot-Curie 14 St., 50-383 Wroclaw (Poland); Kruszynski, R., E-mail: rafal.kruszynski@p.lodz.pl [Department of X-Ray Crystallography and Crystal Chemistry, Institute of General and Ecological Chemistry, Technical University of Lodz, 116 Zeromski St., 90-924 Lodz (Poland)

    2013-01-15

    Seven novel heterobimetallic Cu/Hg polymers based on thiocyanate bridges have been synthesised and characterised by means of IR, EPR, magnetic measurements and single crystal X-Ray. Three of them, [Cu(pzH){sub 4}Hg(SCN){sub 4}]{sub n} (1) [Cu(indH){sub 4}Hg(SCN){sub 4}]{sub n} (2) and [Cu(ampy){sub 2}Hg(SCN){sub 4}]{sub n} (3), have one-dimensional coordination structure. Two compounds [Cu(pzH){sub 2}Hg(SCN){sub 4}]{sub n} (4) and [Cu(abzimH)Hg(SCN){sub 4}]{sub n} (5) form two-dimensional nets, whereas the complexes [Cu(pyCN){sub 2}Hg(SCN){sub 4}]{sub n} (6) and [Cu(pyCH(OH)(OMe)){sub 2}Hg(SCN){sub 4}]{sub n} (7) are three-dimensional coordination polymers. The chains of 1 are connected by the intermolecular N-H Bullet Bullet Bullet N hydrogen bonds to the three dimensional net. In 2 the N-H Bullet Bullet Bullet S hydrogen bonds link the polymeric chains to the two dimensional layer extending along crystallographic (0 0 1) plane. The polymeric chains of compound 3 are joined by the intermolecular N-H Bullet Bullet Bullet N and N-H Bullet Bullet Bullet S hydrogen bonds to the three dimensional net. The polymeric layers of 4 are connected by the intermolecular N-H Bullet Bullet Bullet N hydrogen bonds to the three dimensional net. - Graphical abstract: Novel bimetallic thiocyanate-bridged Cu(II)-Hg(II) compound-synthesis,X-Ray studies and magnetic properties. Highlights: Black-Right-Pointing-Pointer Novel heterobimetallic Cu/Hg coordination polymers were synthesised. Black-Right-Pointing-Pointer The multidimensional structures have been proved by single X-ray analysIs. Black-Right-Pointing-Pointer A variation in the crystalline architectures was observed depending on auxiliary ligands. Black-Right-Pointing-Pointer Magnetic measurements indicate weak exchange interaction between Cu(II) in the crystal lattices below 10 K.

  4. Stable anilinyl radicals coordinated to nickel: X-ray crystal structure and characterization.

    Science.gov (United States)

    Kochem, Amélie; Gellon, Gisèle; Leconte, Nicolas; Baptiste, Benoit; Philouze, Christian; Jarjayes, Olivier; Orio, Maylis; Thomas, Fabrice

    2013-12-02

    Two anilinosalen and a mixed phenol-anilinosalen ligands involving sterically hindered anilines moieties were synthesized. Their nickel(II) complexes 1, 2, and 3 were prepared and characterized. They could be readily one-electron oxidized (E(1/2)=-0.30, -0.26 and 0.10 V vs. Fc(+)/Fc, respectively) into anilinyl radicals species [1](+), [2](+), and [3](+), respectively. The radical complexes are extremely stable and were isolated as single crystals. X-ray crystallographic structures reveal that the changes in bond length resulting from oxidation do not exceed 0.02 Å within the ligand framework in the symmetrical [1](+) and [2](+). No quinoid bond pattern was present. In contrast, larger structural rearrangements were evidenced for the unsymmetrical [3](+), with shortening of one C(ortho)-C(meta) bond. Radical species [1](+) and [2](+) exhibit a strong absorption band at around 6000 cm(-1) (class III mixed valence compounds). This band is significantly less intense than [3](+), consistent with a rather localized anilinyl radical character, and thus a classification of this species as class II mixed-valence compound. Magnetic and electronic properties, as well as structural parameters, have been computed by DFT methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. X-ray crystal structure of a xanthine oxidase complex with the flavonoid inhibitor quercetin.

    Science.gov (United States)

    Cao, Hongnan; Pauff, James M; Hille, Russ

    2014-07-25

    Xanthine oxidase catalyzes the sequential hydroxylation of hypoxanthine to uric acid via xanthine as intermediate. Deposition of crystals of the catalytic product uric acid or its monosodium salt in human joints with accompanying joint inflammation is the major cause of gout. Natural flavonoids are attractive leads for rational design of preventive and therapeutic xanthine oxidase inhibitors due to their beneficial antioxidant, anti-inflammatory, and antiproliferative activities in addition to their micromolar inhibitory activities toward xanthine oxidase. We determined the first complex X-ray structure of mammalian xanthine oxidase with the natural flavonoid inhibitor quercetin at 2.0 Å resolution. The inhibitor adopts a single orientation with its benzopyran moiety sandwiched between Phe 914 and Phe 1009 and ring B pointing toward the solvent channel leading to the molybdenum active center. The favorable steric complementarity of the conjugated three-ring structure of quercetin with the active site and specific hydrogen-bonding interactions of exocyclic hydroxy groups with catalytically relevant residues Arg 880 and Glu 802 correlate well with a previously reported structure-activity relationship of flavonoid inhibitors of xanthine oxidase. The current complex provides a structural basis for the rational design of flavonoid-type inhibitors against xanthine oxidase useful for the treatment of hyperuricemia, gout, and inflammatory disease states.

  6. Synthesis, spectral and single crystal X-ray structural studies on bis(2,2’-bipyridinesulphidoM(II (M = Cu or Zn and diaqua 2,2’-bipyridine zinc(IIsulphate dihydrate

    Directory of Open Access Journals (Sweden)

    ARUMUGAM MANOHAR

    2010-08-01

    Full Text Available Reaction of bis(diethanoldithiocarbamatocopper(II, [Cu(deadtc2] and bis(di-n-propyldithiocarbamatozinc(II, [Zn(dnpdtc2] complexes with 2,2’-bipyridine (2,2’-bipy (1:1 ratio in ethanol was investigated. Simple mixing of the reactants in 1:1 ratio resulted in five-coordinated [Cu(2,2’--bipy2S]•CH3CH2OSO3H (1 and [Zn(2,2’-bipy2S]•CH3CH2OSO3H·2H2O (2. Refluxing the reactants and cooling the contents result in the formation of [Zn(2,2’-bipy(H2O2]SO4 (3 and [Cu(2,2’-bipy(H2O2]SO4 (4. Complexes 1 and 2 are monomeric with trigonal bipyramidal geometry. A distorted octahedral environment was observed in complexes 3 and 4. The crystal structure of 4 has already been reported in the literature. Crystal structures of 1, 2 and 3 are reported in this paper. The M–S distances in 1 and 2 are 2.318(1 Å and 2.323 Å, respectively. The N–M–S angles are larger than the N–M–N angles due to the steric requirements.

  7. Crystallization and preliminary X-ray diffraction analysis of the phosphate-binding protein PhoX from Xanthomonas citri.

    Science.gov (United States)

    Pegos, Vanessa R; Medrano, Francisco Javier; Balan, Andrea

    2014-12-01

    Xanthomonas axonopodis pv. citri (X. citri) is an important bacterium that causes citrus canker disease in plants in Brazil and around the world, leading to significant economic losses. Determination of the physiology and mechanisms of pathogenesis of this bacterium is an important step in the development of strategies for its containment. Phosphate is an essential ion in all microrganisms owing its importance during the synthesis of macromolecules and in gene and protein regulation. Interestingly, X. citri has been identified to present two periplasmic binding proteins that have not been further characterized: PstS, from an ATP-binding cassette for high-affinity uptake and transport of phosphate, and PhoX, which is encoded by an operon that also contains a putative porin for the transport of phosphate. Here, the expression, purification and crystallization of the phosphate-binding protein PhoX and X-ray data collection at 3.0 Å resolution are described. Biochemical, biophysical and structural data for this protein will be helpful in the elucidation of its function in phosphate uptake and the physiology of the bacterium.

  8. Note: Application of a pixel-array area detector to simultaneous single crystal x-ray diffraction and x-ray absorption spectroscopy measurements

    International Nuclear Information System (INIS)

    Sun, Cheng-Jun; Brewe, Dale L.; Heald, Steve M.; Zhang, Bangmin; Chen, Jing-Sheng; Chow, G. M.; Venkatesan, T.

    2014-01-01

    X-ray diffraction (XRD) and X-ray absorption spectroscopy (XAS) are two main x-ray techniques in synchrotron radiation facilities. In this Note, we present an experimental setup capable of performing simultaneous XRD and XAS measurements by the application of a pixel-array area detector. For XRD, the momentum transfer in specular diffraction was measured by scanning the X-ray energy with fixed incoming and outgoing x-ray angles. By selecting a small fixed region of the detector to collect the XRD signal, the rest of the area was available for collecting the x-ray fluorescence for XAS measurements. The simultaneous measurement of XRD and X-ray absorption near edge structure for Pr 0.67 Sr 0.33 MnO 3 film was demonstrated as a proof of principle for future time-resolved pump-probe measurements. A static sample makes it easy to maintain an accurate overlap of the X-ray spot and laser pump beam

  9. X-ray crystallography

    Science.gov (United States)

    2001-01-01

    X-rays diffracted from a well-ordered protein crystal create sharp patterns of scattered light on film. A computer can use these patterns to generate a model of a protein molecule. To analyze the selected crystal, an X-ray crystallographer shines X-rays through the crystal. Unlike a single dental X-ray, which produces a shadow image of a tooth, these X-rays have to be taken many times from different angles to produce a pattern from the scattered light, a map of the intensity of the X-rays after they diffract through the crystal. The X-rays bounce off the electron clouds that form the outer structure of each atom. A flawed crystal will yield a blurry pattern; a well-ordered protein crystal yields a series of sharp diffraction patterns. From these patterns, researchers build an electron density map. With powerful computers and a lot of calculations, scientists can use the electron density patterns to determine the structure of the protein and make a computer-generated model of the structure. The models let researchers improve their understanding of how the protein functions. They also allow scientists to look for receptor sites and active areas that control a protein's function and role in the progress of diseases. From there, pharmaceutical researchers can design molecules that fit the active site, much like a key and lock, so that the protein is locked without affecting the rest of the body. This is called structure-based drug design.

  10. Overexpression, crystallization and preliminary X-ray crystallographic analysis of a putative xylose isomerase from Bacteroides thetaiotaomicron.

    Science.gov (United States)

    Cho, Jea-Won; Han, Byeong-Gu; Park, Sang Youn; Kim, Seung Jun; Kim, Myoung-Dong; Lee, Byung Il

    2013-10-01

    Bacteroides thetaiotaomicron BT0793, a putative xylose isomerase, was overexpressed in Escherichia coli, purified and crystallized using polyethylene glycol monomethyl ether 550 as the precipitant. X-ray diffraction data were collected to 2.10 Å resolution at 100 K using synchrotron X-rays. The crystal was found to belong to space group P1, with unit-cell parameters a=96.3, b=101.7, c=108.3 Å, α=82.8, β=68.2, γ=83.0°. The asymmetric unit contained eight subunits of xylose isomerase with a crystal volume per protein weight (VM) of 2.38 Å3 Da(-1) and a solvent content of 48.3%.

  11. Synthesis, characterization, and X-ray crystal structure of the manganese(III) complex Mn(Sal.sub.2./sub.hn)(CH.sub.3./sub.OH)(N.sub.3./sub.) [Sal.sub.2./sub.hn = N,N'-bis(Salicylidene)-1,2-Hexanediamine

    Czech Academy of Sciences Publication Activity Database

    Khalaji, A.D.; Hadadzade, H.; Fejfarová, Karla; Dušek, Michal

    2010-01-01

    Roč. 36, č. 8 (2010), s. 618-621 ISSN 1070-3284 Grant - others:AV ČR(CZ) AP0701 Program:Akademická prémie - Praemium Academiae Institutional research plan: CEZ:AV0Z10100521 Keywords : crystal structure * Jana2006 * x-ray diffraction * Schiff bases Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.591, year: 2010

  12. Mapping of Lattice Strain in 4H-SiC Crystals by Synchrotron Double-Crystal X-ray Topography

    Science.gov (United States)

    Guo, Jianqiu; Yang, Yu; Raghothamachar, Balaji; Dudley, Michael; Stoupin, Stanislav

    2018-02-01

    The presence of lattice strain in n-doped 4H-SiC substrate crystals grown by a physical vapor transport method can strongly influence the performance of related power devices that are fabricated on them. Information on the level and the variation of lattice strain in these wafer crystals is thus important. In this study, a non-destructive method is developed based on synchrotron double-crystal x-ray topography to map lattice strains in 4H-SiC wafers. Measurements are made on two 4H-SiC substrate crystals—one is an unprocessed commercial wafer while the other was subject to a post-growth high-temperature heat treatment. Maps of different strain components are generated from the equi-misorientation contour maps recorded using synchrotron monochromatic radiation. The technique is demonstrated to be a powerful tool in estimating strain fields in 4H-SiC crystals. Analysis of the strain maps also shows that the normal strain components vary much more significantly than do the shear/rotation components, indicating that lattice dilation/compression rather than lattice tilt is the major type of deformation caused by both the incorporation of nitrogen dopants and the nucleation of basal plane dislocations.

  13. Wave-dispersive x-ray spectrometer for simultaneous acquisition of several characteristic lines based on strongly and accurately shaped Ge crystal

    International Nuclear Information System (INIS)

    Hayashi, Kouichi; Nakajima, Kazuo; Fujiwara, Kozo; Nishikata, Susumu

    2008-01-01

    Si and Ge are widely used as analyzing crystals for x-rays. Drastic and accurate shaping of Si or Ge gives significant advance in the x-ray field, although covalently bonded Si or Ge crystals have long been believed to be not deformable to various shapes. Recently, we developed a deformation technique for obtaining strongly and accurately shaped Si or Ge wafers of high crystal quality, and the use of the deformed wafer made it possible to produce fine-focused x-rays. In the present study, we prepared a cylindrical Ge wafer with a radius of curvature of 50 mm, and acquired fluorescent x-rays simultaneously from four elements by combining the cylindrical Ge wafer with a position-sensitive detector. The energy resolution of the x-ray fluorescence spectrum was as good as that obtained using a flat single crystal, and its gain was over 100. The demonstration of the simultaneous acquisition of high-resolution x-ray fluorescence spectra indicated various possibilities of x-ray spectrometry, such as one-shot x-ray spectroscopy and highly efficient wave-dispersive x-ray spectrometers

  14. Optimized polychromatic x-ray imaging with asymmetrically cut bent crystals

    Czech Academy of Sciences Publication Activity Database

    Podorov, S. G.; Renner, Oldřich; Wehrhan, O.; Förster, E.

    2001-01-01

    Roč. 34, - (2001), s. 2363-2368 ISSN 0022-3727 Grant - others:-(DE) B508-99027; CZ-DE Bilateral Corporation in Science(XC) CZE-00-008 Institutional research plan: CEZ:AV0Z1010921 Keywords : x-ray imaging * x-ray diffraction * ray-tracing simulations Subject RIV: BH - Optics, Masers, Lasers Impact factor: 1.260, year: 2001

  15. Synthesis, X-ray Structure, Optical, and Electrochemical Properties of a White-Light-Emitting Molecule

    Directory of Open Access Journals (Sweden)

    Jiun-Wei Hu

    2016-01-01

    Full Text Available A new white-light-emitting molecule (1 was synthesized and characterized by NMR spectroscopy, high resolution mass spectrometry, and single-crystal X-ray diffraction. Compound 1 crystallizes in the orthorhombic space group Pnma, with a = 12.6814(6, b = 7.0824(4, c = 17.4628(9 Å, α = 90°, β = 90°, γ = 90°. In the crystal, molecules are linked by weak intermolecular C-H···O hydrogen bonds, forming an infinite chain along [100], generating a C(10 motif. Compound 1 possesses an intramolecular six-membered-ring hydrogen bond, from which excited-state intramolecular proton transfer (ESIPT takes place from the phenolic proton to the carbonyl oxygen, resulting in a tautomer that is in equilibrium with the normal species, exhibiting a dual emission that covers almost all of the visible spectrum and consequently generates white light. It exhibits one irreversible one-electron oxidation and two irreversible one-electron reductions in dichloromethane at modest potentials. Furthermore, the geometric structures, frontier molecular orbitals (MOs, and the potential energy curves (PECs for 1 in the ground and the first singlet excited state were fully rationalized by density functional theory (DFT and time-dependent DFT calculations. The results demonstrate that the forward and backward ESIPT may happen on a similar timescale, enabling the excited-state equilibrium to be established.

  16. Synthesis, X-ray Structure, Optical, and Electrochemical Properties of a White-Light-Emitting Molecule.

    Science.gov (United States)

    Hu, Jiun-Wei; Wu, Ying-Hsuan; Tsai, Hsing-Yang; Chen, Kew-Yu

    2016-01-14

    A new white-light-emitting molecule ( 1 ) was synthesized and characterized by NMR spectroscopy, high resolution mass spectrometry, and single-crystal X-ray diffraction. Compound 1 crystallizes in the orthorhombic space group Pnma , with a = 12.6814(6), b = 7.0824(4), c = 17.4628(9) Å, α = 90°, β = 90°, γ = 90°. In the crystal, molecules are linked by weak intermolecular C-H···O hydrogen bonds, forming an infinite chain along [100], generating a C (10) motif. Compound 1 possesses an intramolecular six-membered-ring hydrogen bond, from which excited-state intramolecular proton transfer (ESIPT) takes place from the phenolic proton to the carbonyl oxygen, resulting in a tautomer that is in equilibrium with the normal species, exhibiting a dual emission that covers almost all of the visible spectrum and consequently generates white light. It exhibits one irreversible one-electron oxidation and two irreversible one-electron reductions in dichloromethane at modest potentials. Furthermore, the geometric structures, frontier molecular orbitals (MOs), and the potential energy curves (PECs) for 1 in the ground and the first singlet excited state were fully rationalized by density functional theory (DFT) and time-dependent DFT calculations. The results demonstrate that the forward and backward ESIPT may happen on a similar timescale, enabling the excited-state equilibrium to be established.

  17. LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

    Energy Technology Data Exchange (ETDEWEB)

    Kusakizako, Tsukasa [Graduate School of Science, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Tanaka, Yoshiki [Graduate School of Biological Sciences, Nara Institute of Science and Technology, 8916-5 Takayama-cho, Ikoma, Nara 630-0192 (Japan); Hipolito, Christopher J. [Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); University of Tsukuba, 1-1-1 Tennodai, Tsukuba 305-8575 (Japan); Kuroda, Teruo [Graduate School of Biomedical and Health Sciences, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Ishitani, Ryuichiro [Graduate School of Science, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan); Suga, Hiroaki [Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan); Nureki, Osamu, E-mail: nureki@bs.s.u-tokyo.ac.jp [Graduate School of Science, The University of Tokyo, 2-11-16 Yayoi, Bunkyo-ku, Tokyo 113-0032 (Japan)

    2016-06-22

    A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-ray diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.

  18. Synthesis of highly stable and biocompatible gold nanoparticles for use as a new X-ray contrast agent.

    Science.gov (United States)

    Iranpour, Pooya; Ajamian, Maral; Safavi, Afsaneh; Iranpoor, Nasser; Abbaspour, Abdolkarim; Javanmardi, Sanaz

    2018-04-18

    This work reports a novel reduction procedure for the synthesis of Gum Arabic (GA) capped-gold nanoparticles (AuNPs) in glucosammonium formate as a new ionic liquid. The GA coated AuNPs show good stability in physiological media. The synthesized AuNPs were characterized by UV-Vis spectroscopy, transmission electron microscopy, dynamic light scattering and X-ray diffraction analysis. These stable AuNPs are introduced as a new contrast agent for X-ray Computed Tomography (X-ray CT). These nanoparticles have higher contrasting properties than the commercial contrast agent, Visipaque. The precursors used (Gum Arabic and glucose based-ionic liquid) for synthesis of AuNPs are biocompatible and non-toxic.

  19. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of the regulator AcrR from Escherichia coli

    International Nuclear Information System (INIS)

    Li, Ming; Qiu, Xi; Su, Chih-Chia; Long, Feng; Gu, Ruoyu; McDermott, Gerry; Yu, Edward W.

    2006-01-01

    The transcriptional regulator AcrR from Escherichia coli has been cloned, overexpressed, purified and crystallized and X-ray diffraction data have been collected to a resolution of 2.5 Å. This paper describes the cloning, expression, purification and preliminary X-ray data analysis of the AcrR regulatory protein. The Escherichia coli AcrR is a member of the TetR family of transcriptional regulators. It regulates the expression of the AcrAB multidrug transporter. Recombinant AcrR with a 6×His tag at the C-terminus was expressed in E. coli and purified by metal-affinity chromatography. The protein was crystallized using hanging-drop vapor diffusion. X-ray diffraction data were collected from cryocooled crystals at a synchrotron light source. The best crystal diffracted to 2.5 Å. The space group was determined to be P3 2 , with unit-cell parameters a = b = 46.61, c = 166.16 Å

  20. Purification, crystallization and preliminary X-ray analysis of isocitrate dehydrogenase kinase/phosphatase from Escherichia coli

    International Nuclear Information System (INIS)

    Zheng, Jimin; Lee, Daniel C.; Jia, Zongchao

    2009-01-01

    Isocitrate dehydrogenase kinase/phosphatase has been crystallized in three different crystal forms. Data were collected from each crystal form for structure determination. The Escherichia coli aceK gene encodes isocitrate dehydrogenase kinase/phosphatase (EC 2.7.11.5), a bifunctional protein that phosphorylates and dephosphorylates isocitrate dehydrogenase (IDH), resulting in its inactivation and activation, respectively. This reversible (de)phosphorylation directs isocitrate, an intermediate of the citric acid cycle, to either go through the full cycle or to enter the glyoxylate bypass. In the present study, the AceK protein from E. coli has been purified and crystallized. Three crystal forms were obtained from very similar crystallization conditions. The crystals belong to space groups P4 1 2 1 2, P3 2 21 and P2 1 2 1 2 1 and diffracted X-rays to resolutions of 2.9, 3.0 and 2.7 Å, respectively

  1. Crystallization and preliminary X-ray diffraction analysis of HML, a lectin from the red marine alga Hypnea musciformis

    International Nuclear Information System (INIS)

    Nagano, Celso S.; Gallego del Sol, Francisca; Cavada, Benildo S.; Nascimento, Kyria Santiago Do; Nunes, Eudismar Vale; Sampaio, Alexandre H.; Calvete, Juan J.

    2005-01-01

    The crystallization and preliminary X-ray diffraction analysis of a red marine alga lectin isolated from H. musciformis is reported. HML, a lectin from the red marine alga Hypnea musciformis, defines a novel lectin family. Orthorhombic crystals of HML belonging to space group P2 1 2 1 2 1 grew within three weeks at 293 K using the hanging-drop vapour-diffusion method. A complete data set was collected at 2.4 Å resolution. HML is the first marine alga lectin to be crystallized

  2. X-ray diagnostics of He-like titanium with the bent crystal spectrometer on FTU

    International Nuclear Information System (INIS)

    Leigheb, M.

    1999-01-01

    X-ray spectra due to intrinsic Titanium are obtained on the FTU tokamak by using a space resolved bent crystal spectrometer. In a single discharge, spectra along five lines of sight with a maximum of 16 acquisitions at different times are recorded. Line identification is straightforward from previously published Ti spectra, and no wavelength disagreement (within the experimental errors) has been observed. To fit the spectra, three different methods are tested, each having as free parameters the background level, position (i.e. channel number of the peak) intensity and width of the resonance w line, and line intensity ratios of the satellites with respect to the resonance. Many information can be deduced from the results of the fit: ion and electron temperatures, He-like/Li-like ion charge ratio. Titanium density in the plasma core. Synthetic spectra built up with the values calculated by the fits are compared with the experimental data, and the temperature values are compared with the values from other diagnostics. The best agreement for ion and electron temperatures is obtained by simultaneous fitting of the resonance with 29 most prominent resolved and unresolved satellites; intensities of the dielectronic satellites have been calculated with the Boltzmann-Saha equation, while intensities of intercombination lines x and y and forbidden line z have been calculated with the Mewe's formula. For the dielectronic satellites as well as for intercombination lines, simulations are satisfactory, whereas for the forbidden line z the simulated lines are only 15-30% of the corresponding experimental values. A comparison of the resonance peak positions in different lines of sight allowed to exclude poloidal plasma rotation velocities > 2 10 4 m/s [it

  3. X-ray diffraction analysis of LiCu2O2 crystals with additives of silver atoms

    International Nuclear Information System (INIS)

    Sirotinkin, V. P.; Bush, A. A.; Kamentsev, K. E.; Dau, H. S.; Yakovlev, K. A.; Tishchenko, E. A.

    2015-01-01

    Silver-containing LiCu 2 O 2 crystals up to 4 × 8 × 8 mm in size were grown by the crystallization of 80(1-x)CuO · 20 x AgNO 3 · 20Li 2 CO 3 (0 ≤ x ≤ 0.5) mixture melt. According to the X-ray spectral and Rietveld X-ray diffraction data, the maximum amount of silver incorporated in the LiCu 2 O 2 structure is about 4 at % relative to the copper content. It was established that silver atoms occupy statistically crystallographic positions of lithium atoms. The incorporation of silver atoms is accompanied by a noticeable increase in parameter c of the LiCu 2 O 2 rhombic unit cell, a slight increase in parameter a, and a slight decrease in parameter b

  4. Influence of real photon diffraction on parametric X-ray radiation angular distribution in thin perfect crystals

    Energy Technology Data Exchange (ETDEWEB)

    Goponov, Yu.A.; Laktionova, S.A.; Pligina, O.O.; Sidnin, M.A.; Vnukov, I.E., E-mail: vnukov@bsu.edu.ru

    2015-07-15

    Using the previously proposed method of calculating diffracted photon yields in thin perfect crystals, analyzed a relative contribution of parametric X-ray radiation and diffracted photons in thin crystals. It is shown that for average energy of electrons and the center of the PXR spot diffracted real photon contribution is comparable to the yield of parametric X-ray radiation and determines the shape of the angular distribution of the total emission in this range of observation angles. The possibility of estimating electron beams parameters based on the results of PXR angular distribution measurements is discussed. It is shown that for energy of electrons by far larger than 1 GeV yield of diffracted transition radiation in narrow angular cone becomes predominating and determines the shape of the angular distribution of total emission in the center of radiation spot.

  5. Influence of real photon diffraction on parametric X-ray radiation angular distribution in thin perfect crystals

    Science.gov (United States)

    Goponov, Yu. A.; Laktionova, S. A.; Pligina, O. O.; Sidnin, M. A.; Vnukov, I. E.

    2015-07-01

    Using the previously proposed method of calculating diffracted photon yields in thin perfect crystals, analyzed a relative contribution of parametric X-ray radiation and diffracted photons in thin crystals. It is shown that for average energy of electrons and the center of the PXR spot diffracted real photon contribution is comparable to the yield of parametric X-ray radiation and determines the shape of the angular distribution of the total emission in this range of observation angles. The possibility of estimating electron beams parameters based on the results of PXR angular distribution measurements is discussed. It is shown that for energy of electrons by far larger than 1 GeV yield of diffracted transition radiation in narrow angular cone becomes predominating and determines the shape of the angular distribution of total emission in the center of radiation spot.

  6. X-ray detection capability of a Cs2ZnCl4 single-crystal scintillator

    International Nuclear Information System (INIS)

    Yahaba, Natsuna; Koshimizu, Masanori; Sun, Yan; Asai, Keisuke; Yanagida, Takayuki; Fujimoto, Yutaka; Haruki, Rie; Nishikido, Fumihiko; Kishimoto, Shunji

    2014-01-01

    The X-ray detection capability of a scintillation detector equipped with a Cs 2 ZnCl 4 single crystal was evaluated. The scintillation decay kinetics can be expressed as the sum of two exponential decay components. The fast decay component had a decay time constant of 1.8 ns, and its relative intensity was 95%. The total light output was 630 photons/MeV, and a subnanosecond timing resolution of 0.66 ns was obtained. The detection efficiency of 67.4 keV X-rays was 80% for a detector equipped with a 2.2-mm-thick Cs 2 ZnCl 4 crystal. Thus, excellent timing resolution and high detection efficiency were achieved simultaneously. (author)

  7. Crystallization and preliminary X-ray analysis of a novel haloalkane dehalogenase DbeA from Bradyrhizobium elkani USDA94

    Czech Academy of Sciences Publication Activity Database

    Prudnikova, T.; Mozga, T.; Řezáčová, Pavlína; Chaloupková, R.; Sato, Y.; Nagata, Y.; Brynda, Jiří; Kutý, Michal; Damborský, J.; Kutá-Smatanová, Ivana

    F65, č. 4 (2009), s. 353-356 ISSN 1744-3091 R&D Projects: GA MŠk(CZ) LC06010 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z60870520; CEZ:AV0Z50520514 Keywords : protein crystallization * X-ray analysis * dehalogenase Subject RIV: CC - Organic Chemistry Impact factor: 0.551, year: 2009

  8. X-ray diffraction study of KTP (KTiOPO4) crystals under a static electric field

    International Nuclear Information System (INIS)

    Sebastian, M.T.; Klapper, H.; Bolt, R.J.

    1992-01-01

    X-ray diffraction studies are made on ion-conducting potassium titanyl phosphate (KTP) crystals with in situ DC electric field along different crystallographic directions. The X-ray rocking curves recorded with an electric field along the polar b axis (which is the direction of ion conduction) show a strong enhancement of the 040 reflection intensity (reflecting planes normal to the b axis) whereas the h0l reflections (reflecting planes parallel to the polar axis) do not show any intensity change. For an electric field normal to the polar axis no intensity change, either in 040 or in h0l reflections occurs. This observation is supplemented by X-ray topography. The 040 X-ray topographs recorded with in situ electric field along b exhibit strong extinction contrast in the form of striations parallel to the polar (ion-conduction) axis. The 040 intensity increase and the striation contrast are attributed to lattice deformation by the space-charge polarization due to the movement of the K + ions under the influence of the electric field. (orig.)

  9. Titanium Dioxide Nanoparticles: Synthesis, X-Ray Line Analysis and Chemical Composition Study

    OpenAIRE

    Chenari,Hossein Mahmoudi; Seibel,Christoph; Hauschild,Dirk; Reinert,Friedrich; Abdollahian,Hossein

    2016-01-01

    TiO$_{2}$ nanoparticleshave been synthesized by the sol-gel method using titanium alkoxide and isopropanolas a precursor. The structural properties and chemical composition of the TiO$_{2}$ nanoparticles were studied usingX-ray diffraction, scanning electron microscopy, and X-ray photoelectron spectroscopy.The X-ray powder diffraction pattern confirms that the particles are mainly composed of the anatase phase with the preferential orientation along [101] direction.The physical parameters suc...

  10. Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth disease

    Energy Technology Data Exchange (ETDEWEB)

    Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei, E-mail: xlyang@scripps.edu [Departments of Molecular Biology and Chemistry, The Skaggs Institute for Chemical Biology, The Scripps Research Institute, BCC-379, 10550 North Torrey Pines Road, La Jolla, CA 92037 (United States)

    2006-12-01

    Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4{sub 3}2{sub 1}2 or its enantiomorphic space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%.

  11. Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth disease

    International Nuclear Information System (INIS)

    Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei

    2006-01-01

    Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4 3 2 1 2 or its enantiomorphic space group P4 1 2 1 2, with unit-cell parameters a = b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%

  12. Crystallization and preliminary X-ray crystallographic analysis of a galactose-specific lectin from Dolichos lablab

    Energy Technology Data Exchange (ETDEWEB)

    Lavanya Latha, V.; Kulkarni, Kiran A. [Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012 (India); Nagender Rao, R.; Siva Kumar, N. [Department of Biochemistry, University of Hyderabad, Hyderabad 500 046 (India); Suguna, K., E-mail: suguna@mbu.iisc.ernet.in [Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012 (India)

    2006-02-01

    The galactose-specific lectin from the seeds of a leguminous plant, D. lablab, has been crystallized. Molecular-replacement solution using 3.0 Å X-ray diffraction data showed the lectin to be a tetramer. The galactose-specific lectin from the seeds of Dolichos lablab has been crystallized using the hanging-drop vapour-diffusion technique. The crystals belong to space group P1, with unit-cell parameters a = 73.99, b = 84.13, c = 93.15 Å, α = 89.92, β = 76.01, γ = 76.99°. X-ray diffraction data to a resolution of 3.0 Å have been collected under cryoconditions (100 K) using a MAR imaging-plate detector system mounted on a rotating-anode X-ray generator. Molecular-replacement calculations carried out using the available structures of legume lectins as search models revealed that the galactose-specific lectin from D. lablab forms a tetramer similar to soybean agglutinin; two such tetramers are present in the asymmetric unit.

  13. Neutron and X-ray scattering as a method of precision determination of electron density distribution in molecules and crystals

    International Nuclear Information System (INIS)

    Ozerov, R.P.; Datt, I.D.

    1975-01-01

    The radiation from nuclear reactors is commonly used at present for research in a variety of fields of human knowledge. Slow neutrons have come to be used in the study of solids, more especially in the atomic structure of solids and in the magnetism and dynamics of crystals. The review describes the fundamentals of methods based on the use of the coherent elastic scattering of neutrons (both nuclear and magnetic scattering) and X-rays in the study of electron (including spin) density distribution in crystals and molecules. It also discusses the fundamentals of X-ray and neutron structural analysis, points out the similarities and differences in the methods based on differences in the elementary scattering event, and proposes ways of carrying the experiments beyond the limits of routine localization of atoms in a crystal in order to obtain further details of the electron density distribution. The most promising method appears to be the combined application of neutrons and X-rays. The basis of this technique is described and a number of examples are given. Results obtained in similar studies are of great scientific importance, especially for the theory of the chemical structure and magnetism of solids. (author)

  14. Cs2AgBiBr6 single-crystal X-ray detectors with a low detection limit

    Science.gov (United States)

    Pan, Weicheng; Wu, Haodi; Luo, Jiajun; Deng, Zhenzhou; Ge, Cong; Chen, Chao; Jiang, Xiaowei; Yin, Wan-Jian; Niu, Guangda; Zhu, Lujun; Yin, Lixiao; Zhou, Ying; Xie, Qingguo; Ke, Xiaoxing; Sui, Manling; Tang, Jiang

    2017-11-01

    Sensitive X-ray detection is crucial for medical diagnosis, industrial inspection and scientific research. The recently described hybrid lead halide perovskites have demonstrated low-cost fabrication and outstanding performance for direct X-ray detection, but they all contain toxic Pb in a soluble form. Here, we report sensitive X-ray detectors using solution-processed double perovskite Cs2AgBiBr6 single crystals. Through thermal annealing and surface treatment, we largely eliminate Ag+/Bi3+ disordering and improve the crystal resistivity, resulting in a detector with a minimum detectable dose rate as low as 59.7 nGyair s-1, comparable to the latest record of 0.036 μGyair s-1 using CH3NH3PbBr3 single crystals. Suppressed ion migration in Cs2AgBiBr6 permits relatively large external bias, guaranteeing efficient charge collection without a substantial increase in noise current and thus enabling the low detection limit.

  15. The Catalytic Conversion of Thiophenes over Large H-ZSM-5 Crystals: An X-Ray, UV/Vis, and Fluorescence Microspectroscopic Study

    NARCIS (Netherlands)

    Kox, M.H.F.; Mijovilovich, A.E.; S ättler, J.J.H.B.; Stavitski, I.; Weckhuysen, B.M.

    2013-01-01

    X-ray absorption, UV/Vis, and fluorescence microspectroscopy have been used to characterize the catalytic conversion of thiophene derivatives within the micropores of an individual H-ZSM-5 zeolite crystal. Space-resolved information into the Si/ Al ratios and sulfur content was provided by X-ray

  16. X-ray Excited Optical Fluorescence and Diffraction Imaging of Reactivity and Crystallinity in a Zeolite Crystal : Crystallography and Molecular Spectroscopy in One

    NARCIS (Netherlands)

    Ristanovic, Zoran; Hofmann, Jan P; Richard, Marie-Ingrid; Jiang, Tao; Chahine, Gilbert A; Schülli, Tobias U; Meirer, Florian; Weckhuysen, Bert M

    2016-01-01

    Structure-activity relationships in heterogeneous catalysis are challenging to be measured on a single-particle level. For the first time, one X-ray beam is used to determine the crystallographic structure and reactivity of a single zeolite crystal. The method generates μm-resolved X-ray diffraction

  17. Deficiency in plasma protein synthesis caused by x-ray-induced lethal albino alleles in mouse

    International Nuclear Information System (INIS)

    Garland, R.C.; Satrustegui, J.; Gluecksohn-Waelsch, S.; Cori, C.F.

    1976-01-01

    Plasma protein synthesis was studied in mice bearing x-ray induced lethal mutations at the albino locus. Newborn albino mutants showed a decrease in each of the three principal plasma proteins, albumin, α-fetoprotein, and transferrin, when compared with colored littermate controls. Incorporation of [ 14 C] leucine into plasma proteins of the newborn albinos 30 min after injection was only 1 / 5 that of the controls, but incorporation into total liver protein was only slightly diminished. Incorporation of [ 14 C] leucine into an albumin fraction obtained by immunoprecipitation from livers incubated in vitro in an amino acid mixture was also strongly diminished. Thus, the liver of 18-day-old albino fetuses incorporated into this fraction 1 / 3 and that of newborn albinos 1 / 8 as much as the controls, but in both cases the incorporation into total liver protein was only 25 percent less than in the respective controls. These results indicate that the rather severe structural abnormalities observed in the mutants in the endoplasmic reticulum and the Golgi apparatus are not associated with a general deficiency of hepatic protein synthesis. Instead the data from this and previous work show that the progressive deficiency from fetal life to birth involves certain specific proteins represented by several perinatally developing enzymes and by plasma proteins. It is suggested that the mutational effects observed in these mice are due to deletions involving regulatory rather than structural genes at or near the albino locus

  18. Application of x-ray diffraction for analysis in the synthesis of ferrites

    International Nuclear Information System (INIS)

    Casanova Gomez, Abdel; Alfonso Olmo, Esteban; Alonso Perez, Jose Antonio; Rodriguez, Joelis; Bercoff, Paula G.; Arana, Mercedes; Correa Reina, Jose Raul

    2016-01-01

    As a fundamental part of the work to obtain ferrites, from waste materials (Tailings) of the nickel industry, it is the analytical control and monitoring products as well as the conditions of synthesis. Through this work the study of magnetic products is carried out using magnetometry and X-ray diffraction characterization of their properties, and the qualitative and quantitative analysis. First, the ideal temperature calcination was determined for which an average crystallite size of magnetic spinel as large as possible and with high magnetic response is obtained. Subsequently the magnetic and phase analysis of final products, following five different formulations synthesis, was performed. This analysis showed, that in general the method results in solids, even with varying amounts of hematite as impurity in four formulations, having a high magnetic saturation after calcination. XRD analysis made to the products featured determining the average crystallite size as indicative aspect of border interference. Furthermore, the structural refinement (profile matching variant) for the quantitative analysis of phases was carried on, fact that arguments the differences of magnetism for the five formulations. Rietveld method for detailed determination of the structure of the ferrite F-59 and its nonstoichiometric formula was also applied. (Author)

  19. High-resolution X-ray study of the effects of deuteration on crystal growth and the crystal structure of proteinase K

    International Nuclear Information System (INIS)

    Chatake, Toshiyuki; Ishikawa, Takuya; Yanagisawa, Yasuhide; Yamada, Taro; Tanaka, Ichiro; Fujiwara, Satoru; Morimoro, Yukio

    2011-01-01

    A high-resolution X-ray crystallographic study of the effects of solvent deuteration on the crystallization of proteinase K shows negligibly small degradations of the crystals owing to solvent deuteration and small structural differences between nondeuterated and deuterated crystals of proteinase K. Deuteration of macromolecules is an important technique in neutron protein crystallography. Solvent deuteration of protein crystals is carried out by replacing water (H 2 O) with heavy water (D 2 O) prior to neutron diffraction experiments in order to diminish background noise. The effects of solvent deuteration on the crystallization of proteinase K (PK) with polyethylene glycol as a precipitant were investigated using high-resolution X-ray crystallography. In previous studies, eight NO 3 − anions were included in the PK crystal unit cell grown in NaNO 3 solution. In this study, however, the PK crystal structure did not contain NO 3 − anions; consequently, distortions of amino acids arising from the presence of NO 3 − anions were avoided in the present crystal structures. High-resolution (1.1 Å) X-ray diffraction studies showed that the degradation of PK crystals induced by solvent deuteration was so small that this degradation would be negligible for the purpose of neutron protein crystallography experiments at medium resolution. Comparison of the nonhydrogen structures of nondeuterated and deuterated crystal structures demonstrated very small structural differences. Moreover, a positive correlation between the root-mean-squared differences and B factors indicated that no systematic difference existed

  20. Synthesis, characterization, X-ray crystal structure, electrochemical ...

    Indian Academy of Sciences (India)

    IRAN SHEIKHSHOAIEa, S YOUSEF EBRAHIMIPOURa,∗, MAHDIEH SHEIKHSHOAIEa,. MARYAM MOHAMADIa,b, MEHDI ABBASNEJADc, HADI AMIRI RUDBARId and. GIUSEPPE BRUNOe. aDepartment of Chemistry, Faculty of Science, Shahid Bahonar University of Kerman, Kerman, Iran. bDepartment of Chemistry ...

  1. Synthesis, characterization, X-ray crystal structure, electrochemical ...

    Indian Academy of Sciences (India)

    ... Department of Chemistry, Payame Noor University (PNU), 19395-4697 Tehran, Iran; Department of Biology, Faculty of Sciences, Shahid Bahonar University of Kerman, Kerman, Iran; Department of Chemistry, University of Isfahan, Isfahan 81746-73441, Iran; Department of Chemical Sciences, University of Messina, Via F.

  2. Sister chromatid exchanges in X-ray irradiated blood lymphocytes from patients with hereditary diseases with radioresistant DNA synthesis

    International Nuclear Information System (INIS)

    Pleskach, N.M.; Andriadze, M.I.; Mikhel'son, V.M.; Zhestyanikov, V.D.

    1988-01-01

    X-ray irradiation induced sister chromatid exchanges (SCE) in blood lymphocytes from patient with Down's syndrome and adult progeria (in both the cases radioresistant DNA synthesis takes place). In normal lymphocytes (in which ionizing radiation inhibits the replicative synthesis of DNA) the rate of SCE rises with the rise of radiation dose. Thus, the rate of SCE in X-ray irradiated lymphocytes is in reverse dependence with radioresistance of replicative synthesis of DNA. The data obtained are explained in accordance with the replicative hypothesis of the SCE nature (Painter, 1980a): in cells of patients with Down's syndrome, xeroderma pigmentosum from 2 and progeria of adults the time of existence of partly replicated clusters of replicons is decreased due to radioresistant replicative synthesis of DNA, but the presence of partly replicated clusters of replicons in necessary for SCE formation. Therefore the rate of SCF in X-irradiated cells of these patients decreases

  3. Expression, purification, crystallization and preliminary X-ray diffraction analysis of Arabidopsis thaliana cyclophilin 38 (AtCyp38)

    International Nuclear Information System (INIS)

    Vasudevan, Dileep; Gopalan, Gayathri; He, Zengyong; Luan, Sheng; Swaminathan, Kunchithapadam

    2005-01-01

    Crystallization of Arabidopsis thaliana cyclophilin 38. The crystal diffracts X-rays to 2.5 Å resolution. AtCyp38 is one of the highly divergent multidomain cyclophilins from Arabidopsis thaliana. A recombinant form of AtCyp38 (residues 83–437) was expressed in Escherichia coli and purified to homogeneity. The protein was crystallized using the vapour-batch technique with PEG 6000 and t-butanol as precipitants. Crystals of recombinant AtCyp38 diffracted X-rays to better than 2.5 Å resolution at 95 K using a synchrotron-radiation source. The crystal belongs to the C-centred orthorhombic space group C222 1 , with unit-cell parameters a = 58.2, b = 95.9, c = 167.5 Å, and contains one molecule in the asymmetric unit. The selenomethionine derivative of the AtCyp38 protein was overexpressed, purified and crystallized in the same space group and data were collected to 3.5 Å at the NSLS synchrotron. The structure is being solved by the MAD method

  4. Humidity control and hydrophilic glue coating applied to mounted protein crystals improves X-ray diffraction experiments

    International Nuclear Information System (INIS)

    Baba, Seiki; Hoshino, Takeshi; Ito, Len; Kumasaka, Takashi

    2013-01-01

    A new crystal-mounting method has been developed that involves a combination of controlled humid air and polymer glue for crystal coating. This method is particularly useful when applied to fragile protein crystals that are known to be sensitive to subtle changes in their physicochemical environment. Protein crystals are fragile, and it is sometimes difficult to find conditions suitable for handling and cryocooling the crystals before conducting X-ray diffraction experiments. To overcome this issue, a protein crystal-mounting method has been developed that involves a water-soluble polymer and controlled humid air that can adjust the moisture content of a mounted crystal. By coating crystals with polymer glue and exposing them to controlled humid air, the crystals were stable at room temperature and were cryocooled under optimized humidity. Moreover, the glue-coated crystals reproducibly showed gradual transformations of their lattice constants in response to a change in humidity; thus, using this method, a series of isomorphous crystals can be prepared. This technique is valuable when working on fragile protein crystals, including membrane proteins, and will also be useful for multi-crystal data collection

  5. Crystallization and preliminary X-ray diffraction analysis of Nsp15 from SARS coronavirus.

    Science.gov (United States)

    Ricagno, Stéfano; Coutard, Bruno; Grisel, Sacha; Brémond, Nicolas; Dalle, Karen; Tocque, Fabienne; Campanacci, Valérie; Lichière, Julie; Lantez, Violaine; Debarnot, Claire; Cambillau, Christian; Canard, Bruno; Egloff, Marie Pierre

    2006-04-01

    The non-structural protein Nsp15 from the aetiological agent of SARS (severe acute respiratory syndrome) has recently been characterized as a uridine-specific endoribonuclease. This enzyme plays an essential role in viral replication and transcription since a mutation in the related H229E human coronavirus nsp15 gene can abolish viral RNA synthesis. SARS full-length Nsp15 (346 amino acids) has been cloned and expressed in Escherichia coli with an N-terminal hexahistidine tag and has been purified to homogeneity. The protein was subsequently crystallized using PEG 8000 or 10 000 as precipitants. Small cubic crystals of the apoenzyme were obtained from 100 nl nanodrops. They belong to space group P4(1)32 or P4(3)32, with unit-cell parameters a = b = c = 166.8 angstroms. Diffraction data were collected to a maximum resolution of 2.7 angstroms.

  6. Crystallization and preliminary X-ray diffraction analysis of Nsp15 from SARS coronavirus

    Energy Technology Data Exchange (ETDEWEB)

    Ricagno, Stéfano; Coutard, Bruno; Grisel, Sacha; Brémond, Nicolas; Dalle, Karen; Tocque, Fabienne; Campanacci, Valérie; Lichière, Julie; Lantez, Violaine; Debarnot, Claire; Cambillau, Christian; Canard, Bruno; Egloff, Marie-Pierre, E-mail: marie-pierre.egloff@afmb.univ-mrs.fr [Centre National de la Recherche Scientifique and Universités d’Aix-Marseille I et II, UMR 6098, Architecture et Fonction des Macromolécules Biologiques, Ecole Supérieure d’Ingénieurs de Luminy-Case 925, 163 Avenue de Luminy, 13288 Marseille CEDEX 9 (France)

    2006-04-01

    Crystals of Nsp15 from the aetiological agent of SARS have been grown at room temperature. Crystals have cubic symmetry and diffract to a maximum resolution of 2.7 Å. The non-structural protein Nsp15 from the aetiological agent of SARS (severe acute respiratory syndrome) has recently been characterized as a uridine-specific endoribonuclease. This enzyme plays an essential role in viral replication and transcription since a mutation in the related H229E human coronavirus nsp15 gene can abolish viral RNA synthesis. SARS full-length Nsp15 (346 amino acids) has been cloned and expressed in Escherichia coli with an N-terminal hexahistidine tag and has been purified to homogeneity. The protein was subsequently crystallized using PEG 8000 or 10 000 as precipitants. Small cubic crystals of the apoenzyme were obtained from 100 nl nanodrops. They belong to space group P4{sub 1}32 or P4{sub 3}32, with unit-cell parameters a = b = c = 166.8 Å. Diffraction data were collected to a maximum resolution of 2.7 Å.

  7. Crystallization and preliminary X-ray diffraction analysis of Nsp15 from SARS coronavirus

    International Nuclear Information System (INIS)

    Ricagno, Stéfano; Coutard, Bruno; Grisel, Sacha; Brémond, Nicolas; Dalle, Karen; Tocque, Fabienne; Campanacci, Valérie; Lichière, Julie; Lantez, Violaine; Debarnot, Claire; Cambillau, Christian; Canard, Bruno; Egloff, Marie-Pierre

    2006-01-01

    Crystals of Nsp15 from the aetiological agent of SARS have been grown at room temperature. Crystals have cubic symmetry and diffract to a maximum resolution of 2.7 Å. The non-structural protein Nsp15 from the aetiological agent of SARS (severe acute respiratory syndrome) has recently been characterized as a uridine-specific endoribonuclease. This enzyme plays an essential role in viral replication and transcription since a mutation in the related H229E human coronavirus nsp15 gene can abolish viral RNA synthesis. SARS full-length Nsp15 (346 amino acids) has been cloned and expressed in Escherichia coli with an N-terminal hexahistidine tag and has been purified to homogeneity. The protein was subsequently crystallized using PEG 8000 or 10 000 as precipitants. Small cubic crystals of the apoenzyme were obtained from 100 nl nanodrops. They belong to space group P4 1 32 or P4 3 32, with unit-cell parameters a = b = c = 166.8 Å. Diffraction data were collected to a maximum resolution of 2.7 Å

  8. Three-dimensional imaging of a complex concaved cuboctahedron copper sulfide crystal by x-ray nanotomography

    International Nuclear Information System (INIS)

    Chen Jie; Tian Jinping; Li Wenjie; Tian Yangchao; Wu Chunyan; Yu Shuhong

    2008-01-01

    By combining Fresnel zone-plate based transmission x-ray microscopy with computed tomography, the nanoscale features in materials with complex shapes can be imaged using synchrotron radiation. The tomographic data sets of a complex copper sulfide crystal were acquired in the angle range ±70 deg. at photon energy of 8.0 keV and then were reconstructed by a standard filtered-back-projection algorithm. This experiment shows the quantifiable three-dimensional information of the copper sulfide crystal, which offers a complete understanding of the concaved cuboctahedron structure with 14 faces comprising of six squares and eight triangles

  9. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of DsrEFH from Allochromatium vinosum

    International Nuclear Information System (INIS)

    Dahl, Christiane; Schulte, Andrea; Shin, Dong Hae

    2007-01-01

    DsrEFH from Allochromatium vinosum has been cloned, expressed, purified, and crystallized. A preliminary X-ray study of DsrEFH has been performed with a good quality crystal. In purple sulfur bacteria, the proteins encoded by dsr genes play an essential role in the oxidation of intracellular sulfur, which is an obligate intermediate during the oxidation of sulfide and thiosulfate. One such gene product, DsrEFH from Allochromatium vinosum, has been cloned, expressed, purified and crystallized. Synchrotron data were collected to 2.5 Å from a crystal of selenomethionine-substituted DsrEFH. The crystal belongs to the primitive monoclinic space group P2 1 , with unit-cell parameters a = 56.6, b = 183.1, c = 107.8 Å, β = 99.6°. A full structure determination is under way in order to provide insight into the structure–function relationships of this protein

  10. Crystallization and preliminary X-ray crystallographic analysis of the tRNA-specific adenosine deaminase from Streptococcus pyogenes

    International Nuclear Information System (INIS)

    Ku, Min-Je; Lee, Won-Ho; Nam, Ki-hyun; Rhee, Kyeong-hee; Lee, Ki-Seog; Kim, Eunice EunKyung; Yu, Myung-Hee; Hwang, Kwang Yeon

    2005-01-01

    The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn 2+ ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4 2 2 1 2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. The asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V M ) of 3.3 Å 3 Da −1 and a solvent content of 62.7%

  11. A high resolution X-ray crystal spectrometer to study electron and heavy-ion impact atomic collisions

    Science.gov (United States)

    Kumar, Ajay; Misra, D.; Kelkar, A. H.; Kadhane, U. R.; Thulasiram, K. V.; Tribedi, Lokesh C.

    2007-06-01

    We have studied fast ion-atom and electron-atom collision processes using a reconditioned high resolution X-ray spectrometer. The X-rays, generated by the collisions, are dispersed by a curved ADP crystal (Johansson geometry) and detected by a gas proportional counter. A self-written LabVIEW based program has been used to give precise and controlled movement to the crystal and for data acquisition. The performance was tested by detecting the Kα diagram and satellite lines of several elements. The Kα satellite lines of Al have been studied in collision with 3-12 keV electrons and 40 MeV C^{4+} ions. In ion collisions as large as four L-vacancies are created simultaneously with the K-vacancy, compared to two satellites in case of the e-impact. In addition, we have measured the X-rays from H-, He- and Li-like Si ions which arise due to the electron loss/capture process in highly charged 80 MeV Si^{7+} ions in collision with thin carbon foil. Approximate charge state distribution has been obtained using this new technique.

  12. High-sensitivity, portable, tunable imaging X-ray spectrometer based on a spherical crystal and MCP

    CERN Document Server

    Monot, P; Dobosz, S; D'Oliveira, P; Hulin, S; Bougeard, M; Faenov, A Y; Pikuz, T A; Skobelev, I Y

    2002-01-01

    A portable (200x100x100 mm sup 3), high-luminosity, spherically bent crystal spectrometer was designed to measure very low emissivity X-ray spectra of different elements with spatial resolution in a wide spectral range (1.2-19.6 A). A large (50x15 mm sup 2) open aperture mica spherically bent crystal with R=150 mm was used as dispersive and focusing element. This spectrometer was associated with a large sensitive area (phi=40 mm) micro-channel plates assembly. This apparatus provides simultaneously high spectral (lambda/delta lambda approx 1800) and spatial (100-200 mu m) resolutions. Its large tunability allowed, without any adjustment of the spectrometer set-up, to record spectra in the 1.38-17.5 A wavelength range. We used the X-ray emission of femtosecond laser-produced plasmas from different materials ((CF sub 2) sub n , CaF sub 2 , Cu, Al) to test the spectrometer. Thanks to the high sensitivity (high collection efficiency) of the system, high quality space-resolved X-ray spectra of Fluorine and Aluminu...

  13. Azo dicarboxylates are not conjugated: X-ray crystal structure and theoretical calculations on di-t-butylazodicarboxylate

    Science.gov (United States)

    Goh, Mean See; Rintoul, Llew; Pfrunder, Michael C.; McMurtrie, John C.; Arnold, Dennis P.

    2015-10-01

    The X-ray crystal structure of trans-di-t-butyl azodicarboxylate (DTBAD, 2) was determined and this revealed that the torsion angle between the Ndbnd N and Cdbnd O double bonds is 84.0(2)°, and that between the anti-disposed Cdbnd O vectors is 180°. This is the first report of the solid state structure of an azodicarboxylate ester. The molecule was subjected to Density Functional Theory geometry optimization at the B3LYP/6-31G(d) level in cyclohexane medium, and the global minimum structure agreed in principle with that determined in the solid state by crystallography. The N-C(O) torsion angle in the optimized structure is 107.7°, and the Cdbnd O vectors lie in an anti relationship. Similar calculations on the unknown cis-Ndbnd N isomer revealed an optimum geometry whose energy is predicted to lie only 11.9 kJ/mol higher than that of the trans isomer. M062X/6-311+G(d) model chemistry was used to determine relative electronic energies and to conduct Natural Bond Orbital (NBO) calculations. Exploration of the energetics of rotations about the N-C(O) bonds revealed a clear preference for near-orthogonality in azodicarboxylates, and suggests almost complete absence of classical conjugation between the neighbouring π bonds. Electronic transitions were simulated using the time-dependent DFT (TD-DFT) approach at the B3LYP/6-311+G(d) level, and the weak band in the near-UV for 2 in cyclohexane was reproduced in the calculations. The electronic isolation of the Ndbnd N bond may be important in the numerous applications of azodicarboxylates in organic synthesis, and the small energy difference between the trans and cis isomers implies the likely involvement of the latter in the successful photochemical diaza-Diels-Alder reaction of diethyl azodicarboxylate with 1,3-cyclohexadiene.

  14. High-pressure X-ray diffraction of L-ALANINE crystal

    DEFF Research Database (Denmark)

    Olsen, J.S.; Gerward, Leif; Souza, A.G.

    2006-01-01

    L-ALANINE has been studied by X-ray diffraction at ambient temperature and pressure up to 10.3 GPa. The material is found to transform to a tetragonal structure between 2 and 3 GPa. and to a monoclinic structure between 8 and 10 GPa. The experimental bulk modulus is 25(5) GPa for the orthorhombic...

  15. Characterization, crystallization and preliminary X-ray diffraction studies of tomato nuclease I

    Czech Academy of Sciences Publication Activity Database

    Koval, Tomáš; Dohnálek, Jan; Lipovová, P.; Podzimek, T.; Matoušek, Jaroslav

    2009-01-01

    Roč. 16, 1a (2009), b33 ISSN 1211-5894. [Discussions in Structural Molecular Biology /7./. 12.03.2009-14.03.2009, Nové Hrady] Institutional research plan: CEZ:AV0Z40500505 Keywords : X-ray diffraction * tomato nuclease Subject RIV: CD - Macromolecular Chemistry

  16. X-ray crystal structure of divalent metal-activated ß-xyloisdase, RS223BX

    Science.gov (United States)

    We report the first X-ray structure of a glycoside hydrolase family 43 ß-xylosidase, RS223BX, which is strongly activated by the addition of divalent metal cations. The 2.69 Å structure reveals that the Ca2+ cation is located at the back of the active site pocket. The Ca2+ coordinates to H274 to sta...

  17. Orientation of mineral crystals by collagen fibers during in vivo bone engineering: An X-ray diffraction imaging study

    International Nuclear Information System (INIS)

    Cedola, A.; Mastrogiacomo, M.; Lagomarsino, S.; Cancedda, R.; Giannini, C.; Guagliardi, A.; Ladisa, M.; Burghammer, M.; Rustichelli, F.; Komlev, V.

    2007-01-01

    The mechanism of mineralized bone matrix deposition was investigated taking advantage of a tissue engineering approach in which bone tissue is formed when porous ceramic scaffold is loaded with bone marrow stromal cells and implanted in vivo. The aim of our study is to point out the interaction between the newly formed mineral crystals and the scaffold imposing the three-dimensional desired architecture to the growing bone. High spatial resolution Small Angle X-ray Scattering measurements obtained using synchrotron radiation and X-ray waveguide as optical element allowed a local structural study at the bone-scaffold interface. Using an original methodology for data analysis, we obtained a two-dimensional microscopic map of the mineralization degree, the collagen presence and the mineral orientation degree around the scaffold pore

  18. Specular and non-specular X-ray reflection from a single-crystal molybdenum mirror surface

    CERN Document Server

    Mizusawa, M

    2003-01-01

    The surface morphology of a super-polished mirror of single-crystal molybdenum has been studied by grazing-incidence X-ray reflection. It yields a rather high specular reflectivity (82.0%) for 16.0 keV X-rays below the critical angle. The data suggest that the mirror has a small roughness (0.7 nm rms) unlike other metal mirrors, but, on the other hand, strongly damaged layers (6.35 nm in total) exist at the near surface. It has been also found that the surface has a large correlation length (>3 mu m) and a small Hurst parameter (0.2-0.3) from the non-specular reflection.

  19. Cloning, recombinant production, crystallization and preliminary X-ray diffraction analysis of SDF2-like protein from Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Radzimanowski, Jens; Ravaud, Stephanie; Schott, Andrea; Strahl, Sabine; Sinning, Irmgard

    2009-01-01

    Overexpression, purification, crystallization and preliminary X-ray diffraction of the stromal-cell-derived factor 2-like protein of Arabidopsis thaliana are reported. The crystals belonged to the space group P6 1 and diffracted to 1.95 Å resolution. The stromal-cell-derived factor 2-like protein of Arabidopsis thaliana (AtSDL) has been shown to be highly up-regulated in response to unfolded protein response (UPR) inducing reagents, suggesting that it plays a crucial role in the plant UPR pathway. AtSDL has been cloned, overexpressed, purified and crystallized using the vapour-diffusion method. Two crystal forms have been obtained under very similar conditions. The needle-shaped crystals did not diffract X-rays, while the other form diffracted to 1.95 Å resolution using a synchrotron-radiation source and belonged to the hexagonal space group P6 1 , with unit-cell parameters a = b = 96.1, c = 69.3 Å

  20. Accurate structure analyses of polymer crystals on the basis of wide-angle X-ray and neutron diffractions

    International Nuclear Information System (INIS)

    Tashiro, Kohji; Hanesaka, Makoto; Yamamoto, Hiroko; Wasanasuk, Kaewkan; Jayaratri, Paramita; Yoshizawa, Yoshinori; Tanaka, Ichiro; Niimura, Nobuo; Kusaka, Katsuhiro; Hosoya, Takaaki; Ohhara, Takashi; Kurihara, Kazuo; Kuroki, Ryota; Tamada, Taro; Fujiwara, Satoru; Katsube, Katsuyoshi; Morikawa, Keisuke; Komiya, Yukiatsu; Kitano, Toshiaki; Nishu, Takashi; Ozeki, Tomoji

    2014-01-01

    The crystal structure analysis of various polymer substances has been reviewed on the basis of wide-angle high-energy X-ray and neutron diffraction data. The progress in structural analytical techniques of polymer crystals have been reviewed at first. The structural models proposed so far were reinvestigated and new models have been proposed for various kinds of polymer crystals including polyethylene, poly(vinyl alcohol), poly(lactic acid) and its stereocomplex etc. The hydrogen atomic positions were also clarified by the quantitative analysis of wide-angle neutron diffraction data, from which the physical properties of polymer crystals have been evaluated theoretically. The bonded electron density distribution has been estimated for a polydiacetylene single crystal on the basis of the so-called X-N method or by the combination of structural information derived from X-ray and neutron diffraction data analysis. Some comments have been added about future developments in the field of structure-property relationship determination. (author)

  1. Crystallization and preliminary X-ray diffraction analysis of a glutathione S-transferase from Xylella fastidiosa

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Wanius, E-mail: wanius@if.sc.usp.br [Laboratório de Biofísica Molecular ‘Sérgio Mascarenhas’, Instituto de Física de São Carlos, Universidade de São Paulo (USP), São Carlos (Brazil); Travensolo, Regiane F. [Grupo de Bioanalítica, Microfabricação e Separações, Instituto de Química de São Carlos, Universidade de São Paulo (USP), São Carlos (Brazil); Rodrigues, Nathalia C.; Muniz, João R. C. [Laboratório de Biofísica Molecular ‘Sérgio Mascarenhas’, Instituto de Física de São Carlos, Universidade de São Paulo (USP), São Carlos (Brazil); Caruso, Célia S. [Grupo de Bioanalítica, Microfabricação e Separações, Instituto de Química de São Carlos, Universidade de São Paulo (USP), São Carlos (Brazil); Lemos, Eliana G. M. [Laboratório de Bioquímica de Microrganismos e de Plantas, Departamento de Tecnologia, UNESP, Jaboticabal (Brazil); Araujo, Ana Paula U. [Laboratório de Biofísica Molecular ‘Sérgio Mascarenhas’, Instituto de Física de São Carlos, Universidade de São Paulo (USP), São Carlos (Brazil); Carrilho, Emanuel, E-mail: wanius@if.sc.usp.br [Grupo de Bioanalítica, Microfabricação e Separações, Instituto de Química de São Carlos, Universidade de São Paulo (USP), São Carlos (Brazil); Laboratório de Biofísica Molecular ‘Sérgio Mascarenhas’, Instituto de Física de São Carlos, Universidade de São Paulo (USP), São Carlos (Brazil)

    2008-02-01

    Glutathione S-transferase from X. fastidiosa (xfGST) has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 2.23 Å. Glutathione S-transferases (GSTs) form a group of multifunctional isoenzymes that catalyze the glutathione-dependent conjugation and reduction reactions involved in the cellular detoxification of xenobiotic and endobiotic compounds. GST from Xylella fastidiosa (xfGST) was overexpressed in Escherichia coli and purified by conventional affinity chromatography. In this study, the crystallization and preliminary X-ray analysis of xfGST is described. The purified protein was crystallized by the vapour-diffusion method, producing crystals that belonged to the triclinic space group P1. The unit-cell parameters were a = 47.73, b = 87.73, c = 90.74 Å, α = 63.45, β = 80.66, γ = 94.55°. xfGST crystals diffracted to 2.23 Å resolution on a rotating-anode X-ray source.

  2. Fluctuations on the X-ray intensity beam using a portable X-ray probe based on {sup 6}LiI(Eu) crystal

    Energy Technology Data Exchange (ETDEWEB)

    Araujo, Geraldo P.; Oliveira, Arno H. [Universidade Federal de Minas Gerais (PCTN/UFMG), Belo Horizonte, MG (Brazil). Programa de Pos-Graduacao em Ciencias e Tecnicas Nucleares; Carneiro, Andre C.; Carneiro, Clemente J.G.; Milian, Felix M.; Velasco, Fermin G., E-mail: fermin@uesc.b [Universidade Estadual de Santa Cruz (CPqCTR/UESC), Ilheus, BA (Brazil). Centro de Pesquisa em Ciencias e Tecnologias das Radiacoes

    2011-07-01

    X-rays are produced by accelerating electrons with a high voltage and allowing them to collide with a metal target. This high voltage presents fluctuations that define peak, minimum, and average voltages. Different voltages are applied to the X-ray tube depending on the radiographic applications. A rectifier circuit converts the alternating high voltage to unidirectional high voltage to accelerate electrons in this tube. The fluctuations on the energy in the electron beam depend on the mode of rectification. Both energy of the electrons and X rays intensity fluctuates. A portable probe built with a {sup 6}LiI(Eu) detector coupled to a 10 m light guide and a Hamamatsu photon counting head H9319 was used to measuring X ray intensities. This system is designed to collect up to 10000 counts in intervals of 10 ms to 1 s. Counts were accumulated in time intervals of 10 ms during 10 s. The system starts the count before activating the X-ray apparatus, which is on during a time interval of 100ms. During this period, counts may overflow in consequence high voltage was adjusted to be 40kV, in order to avoid such a problem. For each of these points dose was measured using an ionization chamber. The objectives of this work are to study fluctuations on the X-ray beam and to calibrate the portable probe for measuring radiation doses. Counting rates measured for each 10 ms presented strong variations due to high voltages fluctuations. Both dose and counting rate when correlated with distances between source and detector followed the inverse square law and presented values of R2 near of unit. A calibration curve of the portable system for dose measurements showed also R2 value near of unity. (author)

  3. Synthesis, X-ray Structure, Spectroscopic Properties and DFT Studies of a Novel Schiff Base

    Directory of Open Access Journals (Sweden)

    Kew-Yu Chen

    2014-10-01

    Full Text Available A series of Schiff bases, salicylideneaniline derivatives 1–4, was synthesized under mild conditions and characterized by 1H NMR, HRMS, UV-Vis and fluorescence spectra, and single-crystal X-ray diffraction. In solid and aprotic solvents 1–4 exist mainly as E conformers that possess an intramolecular six-membered-ring hydrogen bond. A weak intramolecular C–H×××F hydrogen bond is also observed in fluoro-functionalized Schiff base 4, which generates another S(6 ring motif. The C–H×××F hydrogen bond further stabilizes its structure and leads it to form a planar configuration. Compounds 1–3 exhibit solely a long-wavelength proton-transfer tautomer emission, while dipole-functionalized Schiff base 4 shows remarkable dual emission originated from the excited-state intramolecular charge transfer (ESICT and excited-state intramolecular proton transfer (ESIPT states. Furthermore, the geometric structures, frontier molecular orbitals (MOs and the potential energy curves for 1–4 in the ground and the first singlet excited state were fully rationalized by density functional theory (DFT and time-dependent DFT calculations.

  4. Synthesis, X-ray structure, spectroscopic properties and DFT studies of a novel Schiff base.

    Science.gov (United States)

    Chen, Kew-Yu; Tsai, Hsing-Yang

    2014-10-17

    A series of Schiff bases, salicylideneaniline derivatives 1-4, was synthesized under mild conditions and characterized by 1H NMR, HRMS, UV-Vis and fluorescence spectra, and single-crystal X-ray diffraction. In solid and aprotic solvents 1-4 exist mainly as E conformers that possess an intramolecular six-membered-ring hydrogen bond. A weak intramolecular C-H···F hydrogen bond is also observed in fluoro-functionalized Schiff base 4, which generates another S(6) ring motif. The C-H···F hydrogen bond further stabilizes its structure and leads it to form a planar configuration. Compounds 1-3 exhibit solely a long-wavelength proton-transfer tautomer emission, while dipole-functionalized Schiff base 4 shows remarkable dual emission originated from the excited-state intramolecular charge transfer (ESICT) and excited-state intramolecular proton transfer (ESIPT) states. Furthermore, the geometric structures, frontier molecular orbitals (MOs) and the potential energy curves for 1-4 in the ground and the first singlet excited state were fully rationalized by density functional theory (DFT) and time-dependent DFT calculations.

  5. Crystallization and preliminary X-ray diffraction studies of the glutaminyl cyclase from Carica papaya latex

    Energy Technology Data Exchange (ETDEWEB)

    Azarkan, Mohamed [Laboratoire de Chimie Générale I, Faculté de Médecine-ULB CP609, 808 Route de Lennik, B-1070 Brussels (Belgium); Clantin, Bernard; Bompard, Coralie [CNRS-UMR 8525, Institut de Biologie de Lille, BP 477, 1 Rue du Professeur Calmette, F-59021 Lille (France); Belrhali, Hassan [EMBL Grenoble Outstation, 6 Rue Jules Horowitz, BP 181, F-38042 Grenoble CEDEX 9 (France); Baeyens-Volant, Danielle [Laboratoire de Chimie Générale I, Faculté de Médecine-ULB CP609, 808 Route de Lennik, B-1070 Brussels (Belgium); Looze, Yvan [Laboratoire de Chimie Générale, Institut de Pharmacie-ULB CP206/04, Boulevard du Triomphe, B-1050 Brussels (Belgium); Villeret, Vincent, E-mail: vincent.villeret@ibl.fr [CNRS-UMR 8525, Institut de Biologie de Lille, BP 477, 1 Rue du Professeur Calmette, F-59021 Lille (France); Wintjens, René, E-mail: vincent.villeret@ibl.fr [Laboratoire de Chimie Générale, Institut de Pharmacie-ULB CP206/04, Boulevard du Triomphe, B-1050 Brussels (Belgium); Laboratoire de Chimie Générale I, Faculté de Médecine-ULB CP609, 808 Route de Lennik, B-1070 Brussels (Belgium)

    2005-01-01

    The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance to chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.

  6. Focusing and imaging sharp line x-ray and gamma-ray sources using variable-metric diffraction crystals

    International Nuclear Information System (INIS)

    Smither, R.K.

    1982-01-01

    A new method has been devised for focusing and imaging the radiation from sharp-line sources of x-rays and gamma-rays, which makes use of variable-metric diffraction crystals. A variable-metric diffraction crystal is one in which the spacings between the crystalline planes is varied as a function of position in the crystal by either the application of a thermal gradient or by changing the composition of a two component or multiple component crystal. This change in planar spacing changes the Bragg diffraction angle for monochromatic radiation as a function of position in the crystal and makes it possible to obtain focusing and in some cases imaging of a sharp-line point source or parallel beam source. This new approach to focusing x-rays and gamma-rays is used to design a number of gamma ray telescopes suitable for focusing the 511 keV annihilation radiation from the strong source of the center of our galaxy. The new designs are surprisingly efficient with approximately 20% of the radiation incident on the variable-metric diffraction crystals being focused on the image spot. Crystals of Ge, Ge + Si, Si, and quartz are used with mosaic widths of 10 arc sec. The size of the telescope can be scaled up or down without affecting the angular resolution or the energy resolution. The largest model described is 50 m long and has 10 crystal diffraction ring assembles with radii between 71 and 200 cm. The total area of the diffraction crystal is 24,610 cm 2 and the effective area (total x diffraction coefficient x transmission) is 4745 cm 2 . An example of a smaller telescope is also given that is only 12.5 m long and has an effective area of 297 cm 2

  7. On the Use of Wide-Angle Energy-Sensitive Detectors in White-Beam X-Ray Single-Crystal Diffraction

    DEFF Research Database (Denmark)

    Buras, B.; Staun Olsen, J.; Gerward, Leif

    1980-01-01

    The possible applications of multiple-element or large-area semiconductor detectors in single-crystal X-ray diffraction are discussed on the basis of experimental results using Bremsstrahlung as well as synchrotron radiation.......The possible applications of multiple-element or large-area semiconductor detectors in single-crystal X-ray diffraction are discussed on the basis of experimental results using Bremsstrahlung as well as synchrotron radiation....

  8. Large-surface-area diamond (111) crystal plates for applications in high-heat-load wavefront-preserving X-ray crystal optics.

    Science.gov (United States)

    Stoupin, Stanislav; Antipov, Sergey; Butler, James E; Kolyadin, Alexander V; Katrusha, Andrey

    2016-09-01

    Fabrication and results of high-resolution X-ray topography characterization of diamond single-crystal plates with large surface area (10 mm × 10 mm) and (111) crystal surface orientation for applications in high-heat-load X-ray crystal optics are reported. The plates were fabricated by laser-cutting of the (111) facets of diamond crystals grown using high-pressure high-temperature methods. The intrinsic crystal quality of a selected 3 mm × 7 mm crystal region of one of the studied samples was found to be suitable for applications in wavefront-preserving high-heat-load crystal optics. Wavefront characterization was performed using sequential X-ray diffraction topography in the pseudo plane wave configuration and data analysis using rocking-curve topography. The variations of the rocking-curve width and peak position measured with a spatial resolution of 13 µm × 13 µm over the selected region were found to be less than 1 µrad.

  9. Crystallization and preliminary X-ray analysis of a bifunctional catalase-phenol oxidase from Scytalidium thermophilum

    International Nuclear Information System (INIS)

    Sutay Kocabas, Didem; Pearson, Arwen R.; Phillips, Simon E. V.; Bakir, Ufuk; Ogel, Zumrut B.; McPherson, Michael J.; Trinh, Chi H.

    2009-01-01

    The bifunctional enzyme catalase-phenol oxidase from S. thermophilum was crystallized by the hanging-drop vapour-diffusion method in space group P2 1 and diffraction data were collected to 2.8 Å resolution. Catalase-phenol oxidase from Scytalidium thermophilum is a bifunctional enzyme: its major activity is the catalase-mediated decomposition of hydrogen peroxide, but it also catalyzes phenol oxidation. To understand the structural basis of this dual functionality, the enzyme, which has been shown to be a tetramer in solution, has been purified by anion-exchange and gel-filtration chromatography and has been crystallized using the hanging-drop vapour-diffusion technique. Streak-seeding was used to obtain larger crystals suitable for X-ray analysis. Diffraction data were collected to 2.8 Å resolution at the Daresbury Synchrotron Radiation Source. The crystals belonged to space group P2 1 and contained one tetramer per asymmetric unit

  10. Crystallization and X-ray diffraction analysis of human CLEC5A (MDL-1), a dengue virus receptor

    International Nuclear Information System (INIS)

    Watson, Aleksandra A.; O’Callaghan, Christopher A.

    2009-01-01

    Recombinant human CLEC5A was crystallized in the trigonal space group P3 1 and X-ray diffraction data were collected to 1.56 Å resolution. The human C-type lectin-like protein CLEC5A (also known as MDL-1) is expressed on the surface of myeloid cells and plays a critical role in dengue-virus-induced disease by signalling through the transmembrane adaptor protein DAP12. The C-type lectin-like domain of CLEC5A was expressed in Escherichia coli, refolded and purified. Recombinant CLEC5A crystals were grown by sitting-drop vapour diffusion using polyethylene glycol 6000 as a precipitant. After optimization, crystals were grown which diffracted to 1.56 Å using synchrotron radiation. The results presented in this paper suggest that crystals producing diffraction of this quality will be suitable for structural determination of human CLEC5A

  11. Escherichia coli tRNAArg acceptor-stem isoacceptors: comparative crystallization and preliminary X-ray diffraction analysis

    International Nuclear Information System (INIS)

    Eichert, André; Schreiber, Angela; Fürste, Jens P.; Perbandt, Markus; Betzel, Christian; Erdmann, Volker A.; Förster, Charlotte

    2009-01-01

    Various E. coli tRNA Arg acceptor-stem microhelix isoacceptors have been crystallized and investigated by high-resolution X-ray diffraction analysis. The aminoacylation of tRNA is a crucial step in cellular protein biosynthesis. Recognition of the cognate tRNA by the correct aminoacyl-tRNA synthetase is ensured by tRNA identity elements. In tRNA Arg , the identity elements consist of the anticodon, parts of the D-loop and the discriminator base. The minor groove of the aminoacyl stem interacts with the arginyl-tRNA synthetase. As a consequence of the redundancy of the genetic code, six tRNA Arg isoacceptors exist. In the present work, three different Escherichia coli tRNA Arg acceptor-stem helices were crystallized. Two of them, the tRNA Arg microhelices RR-1660 and RR-1662, were examined by X-ray diffraction analysis and diffracted to 1.7 and 1.8 Å resolution, respectively. The tRNA Arg RR-1660 helix crystallized in space group P1, with unit-cell parameters a = 26.28, b = 28.92, c = 29.00 Å, α = 105.74, β = 99.01, γ = 97.44°, whereas the tRNA Arg RR-1662 helix crystallized in space group C2, with unit-cell parameters a = 33.18, b = 46.16, c = 26.04 Å, β = 101.50°

  12. Crystallization and preliminary X-ray analysis of the haloalkane dehalogenase DatA from Agrobacterium tumefaciens C58

    International Nuclear Information System (INIS)

    Mase, Tomoko; Yabuki, Hideya; Okai, Masahiko; Ohtsuka, Jun; Imai, Fabiana Lica; Nagata, Yuji; Tanokura, Masaru

    2012-01-01

    The haloalkane dehalogenase DatA from A. tumefaciens C58 was expressed, purified and crystallized by the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to 1.70 Å resolution. Haloalkane dehalogenases are enzymes that catalyze the hydrolytic reaction of a wide variety of haloalkyl substrates to form the corresponding alcohol and hydrogen halide products. DatA from Agrobacterium tumefaciens C58 is a haloalkane dehalogenase that has a unique pair of halide-binding residues, asparagine (Asn43) and tyrosine (Tyr109), instead of the asparagine and tryptophan that are conserved in other members of the subfamily. DatA was expressed in Escherichia coli, purified and crystallized using the sitting-drop vapour-diffusion method with a reservoir solution consisting of 0.1 M CHES pH 8.6, 1.0 M potassium sodium tartrate, 0.2 M lithium sulfate, 0.01 M barium chloride. X-ray diffraction data were collected to 1.70 Å resolution. The space group of the crystal was determined as the primitive tetragonal space group P422, with unit-cell parameters a = b = 123.7, c = 88.1 Å. The crystal contained two molecules in the asymmetric unit

  13. Purification, crystallization and preliminary X-ray diffraction analysis of NADP-dependent glutamate dehydrogenase from Aspergillus niger.

    Science.gov (United States)

    Prakash, Prem; Walvekar, Adhish S; Punekar, Narayan S; Bhaumik, Prasenjit

    2014-11-01

    Glutamate dehydrogenase (GDH) catalyzes the NAD-dependent or NADP-dependent oxidative deamination of L-glutamate to 2-oxoglutarate and ammonia. This important reversible reaction establishes the link between carbon and nitrogen metabolism. In this study, Aspergillus niger NADP-GDH (AnGDH) has been overexpressed and purified. Purified AnGDH, with a high specific activity of 631.1 units per milligram of protein, was crystallized and the crystal diffracted to 2.9 Å resolution using a home X-ray source. Preliminary analysis of the X-ray diffraction data showed that the crystal belonged to space group R32, with unit-cell parameters a=b=173.8, c=241.5 Å, α=β=90, γ=120°. The crystals exhibited an unusually high solvent content (83.0%) and had only one molecule in the asymmetric unit. Initial phases were obtained by molecular replacement, and model building and structure refinement of AnGDH are in progress.

  14. Experiment of optical axis angle of electro-optic crystal by conoscopic interference and x-ray diffraction method

    Science.gov (United States)

    Li, Dong; Liu, Yong; Liu, Xu; Jiang, Hongzhen; Zheng, Fanglan

    2017-10-01

    Owing to the advantages of low loss, high spatial uniformity and high damage threshold, plasma electrode pockels cell (PEPC) is the key element of multi-pass amplifying technology in large laser facilities. Properties of PEPC is directly affected by the optical axis angle of the electro-optic crystal. Therefore, high precision measurement of the optical axis angle is indispensable. X-ray diffraction analysis method is a traditional way to determine the direction of optical axis of crystal, which is presented. By using conoscopic interference technique, a measurement system for optical axis angle of electro-optic crystal is introduced. The principle of conoscopic interference method is described in detail, and a series of techniques are implied in this measurement system to improve the accuracy. The optical axis angle two different electro-optic crystal is measured by X-ray diffraction analysis method and our conoscopic interference measurement system, respectively. The absolute error is less than 0.01mrad, while the relative error is nearly 2%.

  15. Crystallization, X-ray diffraction analysis and phasing of 17β-hydroxysteroid dehydrogenase from the fungus Cochliobolus lunatus

    International Nuclear Information System (INIS)

    Cassetta, Alberto; Büdefeld, Tomaž; Lanišnik Rižner, Tea; Kristan, Katja; Stojan, Jure; Lamba, Doriano

    2005-01-01

    The expression, purification and crystallization of 17β-hydroxysteroid dehydrogenase from the filamentous fungus C. lunatus and its Y167F mutant, both in the apo form, are described. X-ray diffraction analysis and phasing by Patterson-search techniques are reported. 17β-Hydroxysteroid dehydrogenase from the filamentous fungus Cochliobolus lunatus (17β-HSDcl) is an NADP(H)-dependent enzyme that preferentially catalyses the oxidoreduction of oestrogens and androgens. The enzyme belongs to the short-chain dehydrogenase/reductase superfamily and is the only fungal hydroxysteroid dehydrogenase known to date. 17β-HSDcl has recently been characterized and cloned and has been the subject of several functional studies. Although several hypotheses on the physiological role of 17β-HSDcl in fungal metabolism have been formulated, its function is still unclear. An X-ray crystallographic study has been undertaken and the optimal conditions for crystallization of 17β-HSDcl (apo form) were established, resulting in well shaped crystals that diffracted to 1.7 Å resolution. The space group was identified as I4 1 22, with unit-cell parameters a = b = 67.14, c = 266.77 Å. Phasing was successfully performed by Patterson search techniques. A catalytic inactive mutant Tyr167Phe was also engineered, expressed, purified and crystallized for functional and structural studies

  16. Crystallization and preliminary X-ray diffraction analysis of the haem-binding protein HemS from Yersinia enterocolitica

    International Nuclear Information System (INIS)

    Schneider, Sabine; Paoli, Massimo

    2005-01-01

    The haem binding protein HemS from Y. enterocolitica has been crystallized in complex with its ligand. The crystals diffracted X-rays to 2.6 Å in-house. Bacteria have evolved strategies to acquire iron from their environment. Pathogenic microbes rely on specialized proteins to ‘steal’ haem from their host and use it as an iron source. HemS is the ultimate recipient of a molecular-relay system for haem uptake in Gram-negative species, functioning as the cytosolic carrier of haem. Soluble expression and high-quality diffraction crystals were obtained for HemS from Yersinia enterocolitica. Crystals belong to the orthorhombic space group I222, with unit-cell parameters a = 74.86, b = 77.45, c = 114.09 Å, and diffract X-rays to 2.6 Å spacing in-house. Determination of the structure of the haem–HemS complex will reveal the molecular basis of haem binding

  17. Crystallization and preliminary X-ray diffraction analysis of the haem-binding protein HemS from Yersinia enterocolitica

    Energy Technology Data Exchange (ETDEWEB)

    Schneider, Sabine; Paoli, Massimo, E-mail: max.paoli@nottingham.ac.uk [School of Pharmacy and Centre for Biomolecular Sciences, University of Nottingham, University Park, Nottingham NG7 2RD (United Kingdom)

    2005-08-01

    The haem binding protein HemS from Y. enterocolitica has been crystallized in complex with its ligand. The crystals diffracted X-rays to 2.6 Å in-house. Bacteria have evolved strategies to acquire iron from their environment. Pathogenic microbes rely on specialized proteins to ‘steal’ haem from their host and use it as an iron source. HemS is the ultimate recipient of a molecular-relay system for haem uptake in Gram-negative species, functioning as the cytosolic carrier of haem. Soluble expression and high-quality diffraction crystals were obtained for HemS from Yersinia enterocolitica. Crystals belong to the orthorhombic space group I222, with unit-cell parameters a = 74.86, b = 77.45, c = 114.09 Å, and diffract X-rays to 2.6 Å spacing in-house. Determination of the structure of the haem–HemS complex will reveal the molecular basis of haem binding.

  18. Role of Molecular Structure on X-ray Diffraction in Uniaxial and Biaxial Phases of Thermotropic Liquid Crystals

    Energy Technology Data Exchange (ETDEWEB)

    Acharya, Bharat R.; Kang, Shin-Woong; Prasad, Veena; Kumar, Satyendra; (Kent); (CLCR); (Platypus)

    2009-04-29

    X-ray diffraction is one of the most definitive methods to determine the structure of condensed matter phases, and it has been applied to unequivocally infer the structures of conventional calamitic and lyotropic liquid crystals. With the advent of bent-core and tetrapodic mesogens and the discovery of the biaxial nematic phase in them, the experimental results require more careful interpretation and analysis. Here, we present ab-initio calculations of X-ray diffraction patterns in the isotropic, uniaxial nematic, and biaxial nematic phases of bent-core mesogens. A simple Meier-Saupe-like molecular distribution function is employed to describe both aligned and unaligned mesophases. The distribution function is decomposed into two, polar and azimuthal, distribution functions to calculate the effect of the evolution of uniaxial and biaxial nematic orientational order. The calculations provide satisfactory semiquantitative interpretations of experimental results. The calculations presented here should provide a pathway to more refined and quantitative analysis of X-ray diffraction data from the biaxial nematic phase.

  19. Role of Molecular Structure on X-ray Diffraction in Thermotropic Uniaxial and Biaxial Nematic Liquid Crystal Phases

    Energy Technology Data Exchange (ETDEWEB)

    Acharya, Bharat R.; Kang, Shin-Woong; Prasad, Veena; Kumar, Satyendra; (Kent); (Platypus)

    2009-08-27

    X-ray diffraction is one of the most definitive methods to determine the structure of condensed matter phases, and it has been applied to unequivocally infer the structures of conventional calamitic and lyotropic liquid crystals. With the advent of bent-core and tetrapodic mesogens and the discovery of the biaxial nematic phase in them, the experimental results require more careful interpretation and analysis. Here, we present ab-initio calculations of X-ray diffraction patterns in the isotropic, uniaxial nematic, and biaxial nematic phases of bent-core mesogens. A simple Meier-Saupe-like molecular distribution function is employed to describe both aligned and unaligned mesophases. The distribution function is decomposed into two, polar and azimuthal, distribution functions to calculate the effect of the evolution of uniaxial and biaxial nematic orientational order. The calculations provide satisfactory semiquantitative interpretations of experimental results. The calculations presented here should provide a pathway to more refined and quantitative analysis of X-ray diffraction data from the biaxial nematic phase.

  20. Synthesis, X-ray structure determination and germination studies on some smoke-derived karrikins

    Czech Academy of Sciences Publication Activity Database

    Nair, J. J.; Pošta, Martin; Papenfus, H. B.; Munro, O. Q.; Beier, Petr; van Staden, J.

    2014-01-01

    Roč. 91, Mar (2014), s. 53-57 ISSN 0254-6299 Institutional support: RVO:61388963 Keywords : germination * karrikin * plant growth regulator * smoke * X-ray Subject RIV: CC - Organic Chemistry Impact factor: 0.978, year: 2014

  1. Characteristic Ligand-Induced Crystal Forms of HIV-1 Protease Complexes: A Novel Discovery of X-Ray Crystallography

    International Nuclear Information System (INIS)

    Olajuyigbe, Folasade M.; Geremia, Silvano

    2009-10-01

    Mixtures of saquinavir (SQV) and ritonavir (RTV) were cocrystallized with HIV-1 protease (PR) in an attempt to compare their relative potencies using a crystallographic approach and factors responsible for the respective crystal forms obtained were examined. The mixture ratio of the SQV/RTV was in the range of 1:1 to 1:50 with increasing concentration of dimethyl sulphoxide (DMSO) used. Two crystal forms of PR complexes were obtained. At concentrations of 0.8 and 1.2 % DMSO using 1:1 and 1:15 ratios of SQV/RTV, the crystal form was monoclinic while increasing the concentration of DMSO to 3.2 and 5.0% using 1:15 and 1:50 ratios of SQV/RTV, the orthorhombic crystal form was obtained. The high resolution X-ray crystal structures of the PR/ inhibitor complexes reveal that crystal forms with respective space groups are dependent on the occupancy of either SQV or RTV in the active site of the PR. The occupancy of either of the PR inhibitors in the active site of PR has interestingly demonstrated unique cooperativity effects in crystallization of protein-ligand complexes. The crystal forms obtained were also related to the concentration of DMSO and ammonium sulphate in crystallization, and storage conditions of purified PR. Surprisingly, the relative occupancies of these inhibitors in the active site suggested a competition between the two inhibitors which were not inhibition constants related. Analysis of the structures in both crystal forms show no difference in DMSO content but at higher concentration of DMSO (3.2 - 5.0%) in the orthorhombic crystal forms, there were protein-sulphate interactions which were absent in the monoclinic forms with lower concentration (0.8 - 1.2%) of DMSO. This work has clearly demonstrated that there is cooperativity in crystallization and the conditions of crystallization influence specific intermolecular contacts in crystal packing (crystal form). (author)

  2. Single crystal preparation and x-ray structure analysis of non-peripherally alkyl-substituted phthalocyanine blends

    Science.gov (United States)

    Nakano, Chika; Ohmori, Masashi; Tohnai, Norimitsu; Fujii, Akihiko; Ozaki, Masanori

    2017-06-01

    Single crystals of non-peripherally alkyl-substituted macrocycle molecules, such as octahexylphthalocyanine (C6PcH2), octapentylphthalocyanine (C5PcH2), octahexyltetrabenzotriazaporphyrin (C6TBTAPH2), and their blends were prepared. The crystal structures of C6PcH2 and C5PcH2, which were determined by single-crystal X-ray structure analysis, were identified as monoclinic lattices, while that of C6TBTAPH2 was identified as a triclinic lattice. Despite the similarity between the crystal structures of C6PcH2 and C5PcH2, the single crystals grown from the blended solutions of C6PcH2 and C5PcH2 were based on a triclinic lattice. On the other hand, in the case of the single crystals composed of C6PcH2 and C6TBTAPH2, another type of crystal structure did not appear. The crystal structures of these single crystals are discussed by taking the differences in the alkyl-substituent length and the core structure into consideration.

  3. Crystallization and preliminary X-ray structural studies of a Melan-A pMHC–TCR complex

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Fang [Nuffield Department of Clinical Medicine, John Radcliffe Hospital, Oxford University, Oxford OX3 9DU (United Kingdom); Georgiou, Theonie; Hillon, Theresa [STFC Daresbury Laboratory, Warrington, Cheshire WA4 4AD (United Kingdom); Gostick, Emma; Price, David A. [Nuffield Department of Clinical Medicine, John Radcliffe Hospital, Oxford University, Oxford OX3 9DU (United Kingdom); Sewell, Andrew K. [Medical Biochemistry and Immunology, Cardiff University School of Medicine, Cardiff CF14 4XN,Wales (United Kingdom); Moysey, Ruth; Gavarret, Jessie; Vuidepot, Annelise; Sami, Malkit [Medigene, 57c Milton Park, Abingdon, Oxdfordshire OX14 4RX (United Kingdom); Bell, John I. [Nuffield Department of Clinical Medicine, John Radcliffe Hospital, Oxford University, Oxford OX3 9DU (United Kingdom); Gao, George F. [Center for Molecular Immunology, Institute of Microbiology, Chinese Academy of Sciences, 13 Beiyitiao, Zhongguancun, Beijing 100080 (China); Rizkallah, Pierre J., E-mail: p.j.rizkallah@dl.ac.uk [STFC Daresbury Laboratory, Warrington, Cheshire WA4 4AD (United Kingdom); Jakobsen, Bent K., E-mail: p.j.rizkallah@dl.ac.uk [Medigene, 57c Milton Park, Abingdon, Oxdfordshire OX14 4RX (United Kingdom); Nuffield Department of Clinical Medicine, John Radcliffe Hospital, Oxford University, Oxford OX3 9DU (United Kingdom)

    2007-09-01

    A preliminary X-ray crystal structural study of a soluble cognate T-cell receptor (TCR) in complex with a pMHC presenting the Melan-A peptide (ELAGIGILTV) is reported. The TCR and pMHC were refolded, purified and mixed together to form complexes, which were crystallized using the sitting-drop vapour-diffusion method. Single TCR–pMHC complex crystals were cryocooled and used for data collection. Melanocytes are specialized pigmented cells that are found in all healthy skin tissue. In certain individuals, diseased melanocytes can form malignant tumours, melanomas, which cause the majority of skin-cancer-related deaths. The melanoma-associated antigenic peptides are presented on cell surfaces via the class I major histocompatibility complex (MHC). Among the melanoma-associated antigens, the melanoma self-antigen A/melanoma antigen recognized by T cells (Melan-A/MART-1) has attracted attention because of its wide expression in primary and metastatic melanomas. Here, a preliminary X-ray crystal structural study of a soluble cognate T-cell receptor (TCR) in complex with a pMHC presenting the Melan-A peptide (ELAGIGILTV) is reported. The TCR and pMHC were refolded, purified and mixed together to form complexes, which were crystallized using the sitting-drop vapour-diffusion method. Single TCR–pMHC complex crystals were cryocooled and used for data collection. Diffraction data showed that these crystals belonged to space group P4{sub 1}/P4{sub 3}, with unit-cell parameters a = b = 120.4, c = 81.6 Å. A complete data set was collected to 3.1 Å and the structure is currently being analysed.

  4. Crystallization and preliminary X-ray structural studies of a Melan-A pMHC–TCR complex

    International Nuclear Information System (INIS)

    Yuan, Fang; Georgiou, Theonie; Hillon, Theresa; Gostick, Emma; Price, David A.; Sewell, Andrew K.; Moysey, Ruth; Gavarret, Jessie; Vuidepot, Annelise; Sami, Malkit; Bell, John I.; Gao, George F.; Rizkallah, Pierre J.; Jakobsen, Bent K.

    2007-01-01

    A preliminary X-ray crystal structural study of a soluble cognate T-cell receptor (TCR) in complex with a pMHC presenting the Melan-A peptide (ELAGIGILTV) is reported. The TCR and pMHC were refolded, purified and mixed together to form complexes, which were crystallized using the sitting-drop vapour-diffusion method. Single TCR–pMHC complex crystals were cryocooled and used for data collection. Melanocytes are specialized pigmented cells that are found in all healthy skin tissue. In certain individuals, diseased melanocytes can form malignant tumours, melanomas, which cause the majority of skin-cancer-related deaths. The melanoma-associated antigenic peptides are presented on cell surfaces via the class I major histocompatibility complex (MHC). Among the melanoma-associated antigens, the melanoma self-antigen A/melanoma antigen recognized by T cells (Melan-A/MART-1) has attracted attention because of its wide expression in primary and metastatic melanomas. Here, a preliminary X-ray crystal structural study of a soluble cognate T-cell receptor (TCR) in complex with a pMHC presenting the Melan-A peptide (ELAGIGILTV) is reported. The TCR and pMHC were refolded, purified and mixed together to form complexes, which were crystallized using the sitting-drop vapour-diffusion method. Single TCR–pMHC complex crystals were cryocooled and used for data collection. Diffraction data showed that these crystals belonged to space group P4 1 /P4 3 , with unit-cell parameters a = b = 120.4, c = 81.6 Å. A complete data set was collected to 3.1 Å and the structure is currently being analysed

  5. A program for the derivation of crystal unit cell parameters from X-ray powder diffraction measurements

    International Nuclear Information System (INIS)

    Ferguson, I.F.; Rogerson, A.H.

    1984-01-01

    The program, FIRESTAR, determines the dimensions of a crystallographic unit cell from a set of X-ray powder diffraction measurements corresponding to a set of Bragg reflections, provided that the crystal system applicable is known and the Bragg reflections have been indexed. The program includes a range of possible extrapolation functions, and the data may be weighted. Provision is made for detecting and rejecting a single 'bad' measurement, and then rejecting measurements which lie outside an error limit set in the input data. (orig.)

  6. Characteristics and performance of thin LaBr3(Ce) crystal for hard X-ray astronomy

    Science.gov (United States)

    Manchanda, R. K.

    2011-01-01

    We have developed a new detector using thin lanthanum bromide crystal (32 × 3 mm) for use in X-ray astronomy. The instrument was launched in high altitude balloon flight on two different occasions, December 21, 2007, which reached a ceiling altitude of 4.3 mbs and April 25, 2008 reaching a ceiling altitude 2.8 mbs. The observed background counting rate at the ceiling altitude of 4 mbs was ˜4 × 10-3 ct cm-2 s-1 keV-1 sr-1. This paper describes the details of the experiment, the detector characteristics, and the background behaviour at the ceiling altitude.

  7. Single-crystal X-ray and neutron powder diffraction investigation of the phase transition in tetrachlorobenzene.

    Science.gov (United States)

    Barnett, Sarah A; Broder, Charlotte K; Shankland, Kenneth; David, William I F; Ibberson, Richard M; Tocher, Derek A

    2006-04-01

    The polymorphic phase transition of 1,2,4,5-tetrachlorobenzene (TCB) has been investigated using neutron powder diffraction and single-crystal X-ray diffraction. The diffraction experiments show a reversible phase change that occurs as a function of temperature with no apparent loss of sample quality on transition between the two phases. Neutron powder diffraction gives detailed information on the molecular structural changes and lattice parameters from 2 K to room temperature. The structure of the low-temperature form has been elucidated for the first time using single-crystal X-ray diffraction. Comparison of the alpha and beta structures show that they are both based on the same sheet motif, with the differences between the two being very subtle, except in terms of crystal symmetry. Detailed analysis of the structures revealed the changes required for inter-conversion. A computational polymorph search showed that these two sheet structures are more thermodynamically stable than alternative herringbone-type structures.

  8. Mineral crystal alignment in mineralized fracture callus determined by 3D small-angle X-ray scattering

    International Nuclear Information System (INIS)

    Liu Yifei; Manjubala, Inderchand; Fratzl, Peter; Roschger, Paul; Schell, Hanna; Duda, Georg N

    2010-01-01

    Callus tissue formed during bone fracture healing is a mixture of different tissue types as revealed by histological analysis. But the structural characteristics of mineral crystals within the healing callus are not well known. Since two-dimensional (2D) scanning small-angle X-ray scattering (sSAXS) patterns showed that the size and orientation of callus crystals vary both spatially and temporally [1] and 2D electron microscopic analysis implies an anisotropic property of the callus morphology, the mineral crystals within the callus are also expected to vary in size and orientation in 3D. Three-dimensional small-angle X-ray scattering (3D SAXS), which combines 2D SAXS patterns collected at different angles of sample tilting, has been previously applied to investigate bone minerals in horse radius [2] and oim/oim mouse femur/tibia [3]. We implement a similar 3D SAXS method but with a different way of data analysis to gather information on the mineral alignment in fracture callus. With the proposed accurate yet fast assessment of 3D SAXS information, it was shown that the plate shaped mineral particles in the healing callus were aligned in groups with their predominant orientations occurring as a fiber texture.

  9. Red mercuric iodide crystals obtained by isothermal solution evaporation: Characterization for mammographic X-ray imaging detectors

    Energy Technology Data Exchange (ETDEWEB)

    Caldeira, A.M.F.; Ugucioni, J.C.; Mulato, M.

    2014-02-11

    Millimeter-sized mercury iodide crystals were obtained by the isothermal evaporation technique using dimethylformamide (DMF), diethyl-ether/DMF mixture and THF. Different concentrations (18 mM and 400 mM) and solution temperature (25–80 °C) were used to obtain varied evaporation rates (0.1×10{sup −4}–5000×10{sup −4} ml/h). Different crystal sizes and shapes were obtained by changing solvents, mixture and initial solution volume. According to X-ray diffraction the samples are monocrystalline. The top surface was investigated by SEM. Optical band-gaps above 2 eV were obtained from photoacoustic spectroscopy. Photoluminescence spectra indicated band-to-band electronic transitions, and the presence of sub-band gap states. Excitons, structural defects and the presence of impurities are discussed and correlated to the electrical measurements. Crystals obtained using pure DMF as solvent showed better general properties, including under the exposure to mammographic X-ray energy range that led to sensibility of about 25 μC/Rcm{sup 2}.

  10. Mineral crystal alignment in mineralized fracture callus determined by 3D small-angle X-ray scattering

    Energy Technology Data Exchange (ETDEWEB)

    Liu Yifei; Manjubala, Inderchand; Fratzl, Peter [Department of Biomaterials, Max Planck Institute of Colloids and Interfaces, 14424 Potsdam (Germany); Roschger, Paul [4th Medical Department, Ludwig Boltzmann Institute of Osteology at Hanusch Hospital of WGKK and AUVA Trauma Centre Meidling, 1140 Vienna (Austria); Schell, Hanna; Duda, Georg N, E-mail: fratzl@mpikg.mpg.d [Julius Wolff Institut and Center for Musculoskeletal Surgery, Charite- University Medicine Berlin, Augustenburger Platz 1, 13353 Berlin (Germany)

    2010-10-01

    Callus tissue formed during bone fracture healing is a mixture of different tissue types as revealed by histological analysis. But the structural characteristics of mineral crystals within the healing callus are not well known. Since two-dimensional (2D) scanning small-angle X-ray scattering (sSAXS) patterns showed that the size and orientation of callus crystals vary both spatially and temporally [1] and 2D electron microscopic analysis implies an anisotropic property of the callus morphology, the mineral crystals within the callus are also expected to vary in size and orientation in 3D. Three-dimensional small-angle X-ray scattering (3D SAXS), which combines 2D SAXS patterns collected at different angles of sample tilting, has been previously applied to investigate bone minerals in horse radius [2] and oim/oim mouse femur/tibia [3]. We implement a similar 3D SAXS method but with a different way of data analysis to gather information on the mineral alignment in fracture callus. With the proposed accurate yet fast assessment of 3D SAXS information, it was shown that the plate shaped mineral particles in the healing callus were aligned in groups with their predominant orientations occurring as a fiber texture.

  11. Crystallization and preliminary X-ray analysis of the reductase component of p-hydroxyphenylacetate 3-hydroxylase from Acinetobacter baumannii

    International Nuclear Information System (INIS)

    Oonanant, Worrapoj; Sucharitakul, Jeerus; Chaiyen, Pimchai; Yuvaniyama, Jirundon

    2012-01-01

    The reductase component of p-hydroxyphenylacetate 3-hydroxylase from A. baumannii was overexpressed, purified and crystallized. X-ray diffraction data were collected and processed to 2.3 Å resolution. p-Hydroxyphenylacetate 3-hydroxylase (HPAH) from Acinetobacter baumannii catalyzes the hydroxylation of p-hydroxyphenylacetate (HPA) at the ortho position to yield 3,4-dihydroxyphenylacetate (DHPA). HPAH from A. baumannii is a two-component flavoprotein consisting of a smaller reductase (C 1 ) component and a larger oxygenase (C 2 ) component. The C 1 component supplies a reduced flavin in its free form to the C 2 counterpart for hydroxylation. In addition, HPA can bind to C 1 and enhance the flavin-reduction rate without becoming hydroxylated. The recombinant C 1 component was purified and crystallized using the microbatch method at 295 K. X-ray diffraction data were collected to 2.3 Å resolution using synchrotron radiation on the BL13B1 beamline at NSRRC, Taiwan. The crystal belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 47.78, b = 59.92, c = 211.85 Å, and contained two molecules of C 1 per asymmetric unit

  12. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of the mannose 6-phosphate isomerase from Salmonella typhimurium

    Energy Technology Data Exchange (ETDEWEB)

    Gowda, Giri; Sagurthi, Someswar Rao [Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012 (India); Savithri, H. S. [Department of Biochemistry, Indian Institute of Science, Bangalore 560 012 (India); Murthy, M. R. N., E-mail: mrn@mbu.iisc.ernet.in [Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012 (India)

    2008-02-01

    The cloning, expression, purification, crystallization and preliminary X-ray crystallographic studies of mannose 6-phosphate isomerase from S. typhimurium are reported. Mannose 6-phosphate isomerase (MPI; EC 5.3.1.8) catalyzes the reversible isomerization of d-mannose 6-phosphate (M6P) and d-fructose 6-phosphate (F6P). In the eukaryotes and prokaryotes investigated to date, the enzyme has been reported to play a crucial role in d-mannose metabolism and supply of the activated mannose donor guanosine diphosphate d-mannose (GDP-d-mannose). In the present study, MPI was cloned from Salmonella typhimurium, overexpressed in Escherichia coli and purified using Ni–NTA affinity column chromatography. Purified MPI crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 36.03, b = 92.2, c = 111.01 Å. A data set extending to 1.66 Å resolution was collected with 98.8% completeness using an image-plate detector system mounted on a rotating-anode X-ray generator. The asymmetric unit of the crystal cell was compatible with the presence of a monomer of MPI. A preliminary structure solution of the enzyme has been obtained by molecular replacement using Candida albicans MPI as the phasing model and the program Phaser. Further refinement and model building are in progress.

  13. The synthesis, spectroscopy and X-ray single crystal structure of catena-[(μ-anacardato)-copper(II)bipyridine][Cu2{(μ-O2CC6H3(o-OH)(o-C15H31)}4(NC5H5)2].

    Science.gov (United States)

    Malik, Mohammad Azad; O'Brien, Paul; Tuna, Floriana; Pritchard, Robin; Buchweishaija, Joseph; Kimambo, Elianaso; Mubofu, Egid B

    2013-10-28

    Hydrogenation of crude anacardic acid gave a transparent crystalline product on recrystallization. When reacted with copper nitrate in the presence of pyridine it produced green crystals of a pyridine adduct of a dimeric copper(II) anacardate with the copper acetate structure. The X-ray single crystal structures of both anacardic acid and the copper complex were determined. Magnetic studies have confirmed strong antiferromagnetic coupling between copper(II) centre in the dimer. The exchange coupling constant was determined to be J = -324 cm(-1). The EPR spectra of the polycrystalline product are consistent with spin S = 1. The zero-field splitting parameter and g tensor values are |D| = 0.36 cm(-1), g(||) = 2.36 and g(⊥) = 2.06.

  14. Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

    International Nuclear Information System (INIS)

    Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

    2005-01-01

    Monoclinic (P2 1 ) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2 1 , with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit

  15. Introduction to crystal structure determination methods using x-ray diffraction: application to some rare earth complexes

    International Nuclear Information System (INIS)

    Oliveira, M.A. de.

    1986-01-01

    This work is composed by a theoretical introduction studying crystal concept, interaction between X-ray and crystal medium, and methods for determining small molecular structures applied in solution of crystal structures of praseodymium, neodymium and europium complexes with perrhenate and trans - 1,4 - dithiane - 1,4 - dioxide, (TDTD), which general formula is [ Ln (H sub(2) O) sub(4) (η-TDTD) (η'Re O sub(4)) (μ-η sup(2)-TDTD)] sub(n) (Re O sub(4)) sub(2n). nTDTD, where, Ln = Eu, Pr, Nd and methyl-2,6-anhydrous-3-azido-4-0-benzoyl-3-deoxy-α-D-iodo pyranoside. The structure of C sub(14) H sub(15) N sub(3) O sub(5) organic complex was determined using direct methods. (M.C.K.)

  16. Crystallization and preliminary X-ray diffraction analysis of salutaridine reductase from the opium poppy Papaver somniferum

    International Nuclear Information System (INIS)

    Higashi, Yasuhiro; Smith, Thomas J.; Jez, Joseph M.; Kutchan, Toni M.

    2010-01-01

    Recombinant P. somniferum salutaridine reductase (SalR) was purified and crystallized with NADPH using the hanging-drop vapor-diffusion method. Crystals of the SalR–NADPH complex diffracted X-rays to a resolution of 1.9 Å. The opium poppy Papaver somniferum is the source of the narcotic analgesics morphine and codeine. Salutaridine reductase (SalR; EC 1.1.1.248) reduces the C-7 keto group of salutaridine to the C-7 (S)-hydroxyl group of salutaridinol in the biosynthetic pathway that leads to morphine in the opium poppy plant. P. somniferum SalR was overproduced in Escherichia coli and purified using cobalt-affinity and size-exclusion chromatography. Hexagonal crystals belonging to space group P6 4 22 or P6 2 22 were obtained using ammonium sulfate as precipitant and diffracted to a resolution of 1.9 Å

  17. Crystallization of a fungal lytic polysaccharide monooxygenase expressed from glycoengineered Pichia pastoris for X-ray and neutron diffraction.

    Science.gov (United States)

    O'Dell, William B; Swartz, Paul D; Weiss, Kevin L; Meilleur, Flora

    2017-02-01

    Lytic polysaccharide monooxygenases (LPMOs) are carbohydrate-disrupting enzymes secreted by bacteria and fungi that break glycosidic bonds via an oxidative mechanism. Fungal LPMOs typically act on cellulose and can enhance the efficiency of cellulose-hydrolyzing enzymes that release soluble sugars for bioethanol production or other industrial uses. The enzyme PMO-2 from Neurospora crassa (NcPMO-2) was heterologously expressed in Pichia pastoris to facilitate crystallographic studies of the fungal LPMO mechanism. Diffraction resolution and crystal morphology were improved by expressing NcPMO-2 from a glycoengineered strain of P. pastoris and by the use of crystal seeding methods, respectively. These improvements resulted in high-resolution (1.20 Å) X-ray diffraction data collection at 100 K and the production of a large NcPMO-2 crystal suitable for room-temperature neutron diffraction data collection to 2.12 Å resolution.

  18. Crystallization and preliminary X-ray analysis of the MaoC-like dehydratase from Phytophthora capsici

    International Nuclear Information System (INIS)

    Wang, Huizheng; Guo, Jiubiao; Pang, Hai; Zhang, Xiuguo

    2010-01-01

    The MaoC-like dehydratase from P. capsici was cloned, expressed and purified to homogeneity. Crystals were obtained that diffracted to 1.93 Å resolution. MaoC-like dehydratase (MaoC) plays an important role in supplying (R)-3-hydroxyacyl-CoA from the fatty-acid oxidation pathway to polyhydroxyalkanoate (PHA) biosynthetic pathways. PHAs have been attracting much attention as they can be used in the biosynthesis of synthetic plastics. Crystals of MaoC from Phytophora capsici were grown by the hanging-drop vapour-diffusion method at 289 K in a number of screening conditions. An MaoC crystal diffracted to 1.93 Å resolution using X-ray radiation and belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 81.458, b = 82.614, c = 124.228 Å, α = β = γ = 90°

  19. The determination of the crystal structures of some uranium compounds by means of x-ray and neutron diffraction

    International Nuclear Information System (INIS)

    Adrian, H.W.W.

    1977-10-01

    In industrial uranium processing or reprocessing procedures, aqueous uranyl nitrate solutions are an intermediate product. The compounds, whose structures are reported, might prove valuable as alternative crystallization products to existing methods of extracting the uranium from solution. The compounds are obtained by the addition of hydroxylammonium to the uranyl nitrate solution and are of the general formula UO 2 (NH 2 0) 2 .xH 2 0, where x can take the values zero, two, three and four. In addition a compound of the formula UO 2 (NH 2 0) 2 .2(NH 2 CH).2H 2 0 was obtained. The UO 2 (NH 2 0) compound crystallized in a monoclinic crystal form. Crystals large enough for neutron diffraction were not obtained. The structure of the UO 2 (NH 2 0) 2 .2H 2 0 could not be solved because only disordered crystalline material was available. The structure of UO 2 (NH 2 0) 2 .3H 2 0 was solved by means of room- and low-temperature neutron diffraction. The unit cell is orthorhombic. The structure of α-UO 2 (NH 2 0) 2 .4H 2 0 was investigated by means of room-temperature x-ray and room- and low-temperature neutron diffraction. The unit cell is triclinic. This compound strongly resembles the trihydrate. The UO 2 (NH 2 0) 2 .2(NH 2 0H).2H 2 0 compound gave crystals large enough for single crystal x-ray but not neutron diffraction. The unit cell is orthorhombic. The characteristic powder patterns (indexed except for the dihydrate compound) of the above compounds are reported [af

  20. Atomic motion of resonantly vibrating quartz crystal visualized by time-resolved X-ray diffraction

    International Nuclear Information System (INIS)

    Aoyagi, Shinobu; Osawa, Hitoshi; Sugimoto, Kunihisa; Fujiwara, Akihiko; Takeda, Shoichi; Moriyoshi, Chikako; Kuroiwa, Yoshihiro

    2015-01-01

    Transient atomic displacements during a resonant thickness-shear vibration of AT-cut α-quartz are revealed by time-resolved X-ray diffraction under an alternating electric field. The lattice strain resonantly amplified by the alternating electric field is ∼10 4 times larger than that induced by a static electric field. The resonantly amplified lattice strain is achieved by fast displacements of oxygen anions and collateral resilient deformation of Si−O−Si angles bridging rigid SiO 4 tetrahedra, which efficiently transduce electric energy into elastic energy

  1. Probing vibrational excitations in molecular crystals by inelastic scattering: From neutrons to X-rays

    International Nuclear Information System (INIS)

    Plazanet, Marie; Beraud, Alexandre; Johnson, Mark; Krisch, Michael; Trommsdorff, H. Peter

    2005-01-01

    Inelastic X-ray scattering spectra of single crystalline benzoic acid have been measured as a function of the momentum transfer vector, Q , in the frequency range of 300-1800 cm -1 . These measurements are confronted with dispersion curves that have been calculated using force constants derived from periodic DFT calculations in a (2, 2, 1) supercell. Even though limited by the signal-to-noise ratio and the resolution of the spectra, all spectral features and their Q -vector dependence are reproduced by the calculations. A comparison of this technique with inelastic neutron and light (Raman) scattering is made

  2. Superoxide reductase from the syphilis spirochete Treponema pallidum: crystallization and structure determination using soft X-rays

    Energy Technology Data Exchange (ETDEWEB)

    Santos-Silva, Teresa; Trincão, José; Carvalho, Ana L.; Bonifácio, Cecília; Auchère, Françoise; Moura, Isabel; Moura, José J. G.; Romão, Maria J., E-mail: mromao@dq.fct.unl.pt [REQUIMTE Departamento de Química, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa, 2829-516 Caparica (Portugal)

    2005-11-01

    Superoxide reductase is a non-haem iron-containing protein involved in resistance to oxidative stress. The oxidized form of the protein has been crystallized and its three-dimensional structure solved. A highly redundant X-ray diffraction data set was collected on a rotating-anode generator using Cu Kα X-ray radiation. Four Fe atoms were located in the asymmetric unit corresponding to four protein molecules arranged as a dimer of homodimers. Superoxide reductase is a 14 kDa metalloprotein containing a catalytic non-haem iron centre [Fe(His){sub 4}Cys]. It is involved in defence mechanisms against oxygen toxicity, scavenging superoxide radicals from the cell. The oxidized form of Treponema pallidum superoxide reductase was crystallized in the presence of polyethylene glycol and magnesium chloride. Two crystal forms were obtained depending on the oxidizing agents used after purification: crystals grown in the presence of K{sub 3}Fe(CN){sub 6} belonged to space group P2{sub 1} (unit-cell parameters a = 60.3, b = 59.9, c = 64.8 Å, β = 106.9°) and diffracted beyond 1.60 Å resolution, while crystals grown in the presence of Na{sub 2}IrCl{sub 6} belonged to space group C2 (a = 119.4, b = 60.1, c = 65.6 Å, β = 104.9°) and diffracted beyond 1.55 Å. A highly redundant X-ray diffraction data set from the C2 crystal form collected on a copper rotating-anode generator (λ = 1.542 Å) clearly defined the positions of the four Fe atoms present in the asymmetric unit by SAD methods. A MAD experiment at the iron absorption edge confirmed the positions of the previously determined iron sites and provided better phases for model building and refinement. Molecular replacement using the P2{sub 1} data set was successful using a preliminary trace as a search model. A similar arrangement of the four protein molecules could be observed.

  3. Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

    Energy Technology Data Exchange (ETDEWEB)

    Garrote, Ana M.; Redondo, Pilar [Spanish National Cancer Research Centre (CNIO), Melchor Fernández Almagro 3, 28029 Madrid (Spain); Montoya, Guillermo, E-mail: gmontoya@cnio.es [Spanish National Cancer Research Centre (CNIO), Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Muñoz, Inés G., E-mail: gmontoya@cnio.es [Spanish National Cancer Research Centre (CNIO), Melchor Fernández Almagro 3, 28029 Madrid (Spain)

    2014-02-19

    The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- or hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.

  4. Effect of X-rays on protein synthesis and RNA synthesis in adenovirus-infected cells

    International Nuclear Information System (INIS)

    Gorzkowski, B.; Majle, T.; Obrepalska, B.; Semkow, R.

    1977-01-01

    Ionizing radiation exerts a deteriorating effect on the rate of protein and RNA synthesis in HeLa cells. This effect is higher in cells infected with adenovirus, thus pointing to a higher radiosensitivity of viral syntheses compared with the cellular ones. (author)

  5. Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

    Energy Technology Data Exchange (ETDEWEB)

    Enderle, Mathias [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany); McCarthy, Andrew [EMBL Grenoble, 71 Avenue des Martyrs, 38042 Grenoble CEDEX 9 (France); Paithankar, Karthik Shivaji, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Grininger, Martin, E-mail: paithankar@em.uni-frankfurt.de [Goethe University Frankfurt, Max-von-Laue-Strasse 15, 60438 Frankfurt am Main (Germany); Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried (Germany)

    2015-10-23

    Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungal FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.

  6. Synthesis of Novel Amphiphilic Azobenzenes and X-ray Scattering Studies of Their Langmuir Monolayers

    DEFF Research Database (Denmark)

    Sørensen, Thomas Just; Kjær, Kristian; Breiby, Dag Werner

    2008-01-01

    . At the air-water interface, the amphiphilic azobenzenes form noncrystalline but stable Langmuir films that display an unusual reversible monolayer collapse close to 35 mN/m. The structures and phase transitions were studied by X-ray reflectivity (XR) and grazing-incidence X-ray diffraction, both utilizing...... synchrotron radiation. Compression beyond the collapse point does not change the XR data, showing that the film is unchanged at the molecular level, even at areas less than half of that of the collapse. This leads to the conclusion that few macroscopic collapse sites are responsible for reversibly removing...

  7. Crystallization and preliminary X-ray characterization of the tetrapyrrole-biosynthetic enzyme porphobilinogen deaminase from Bacillus megaterium

    International Nuclear Information System (INIS)

    Azim, N.; Deery, E.; Warren, M. J.; Erskine, P.; Cooper, J. B.; Wood, S. P.; Akhtar, M.

    2013-01-01

    The enzyme porphobilinogen deaminase (PBGD; hydroxymethylbilane synthase; EC 2.5.1.61) catalyses a key early step in the biosynthesis of tetrapyrroles in which four molecules of the monopyrrole porphobilinogen are condensed to form a linear tetrapyrrole. PBGD from B. megaterium was expressed and the enzyme was crystallized in a form which diffracts synchrotron radiation to high resolution. The enzyme porphobilinogen deaminase (PBGD; hydroxymethylbilane synthase; EC 2.5.1.61) catalyses an early step of the tetrapyrrole-biosynthesis pathway in which four molecules of the monopyrrole porphobilinogen are condensed to form a linear tetrapyrrole. The enzyme possesses a dipyrromethane cofactor which is covalently linked by a thioether bridge to an invariant cysteine residue. Expression in Escherichia coli of a His-tagged form of Bacillus megaterium PBGD permitted the crystallization and preliminary X-ray analysis of the enzyme from this species at high resolution

  8. Neutron and X-ray single-crystal diffraction from protein microcrystals via magnetically oriented microcrystal arrays in gels.

    Science.gov (United States)

    Tsukui, Shu; Kimura, Fumiko; Kusaka, Katsuhiro; Baba, Seiki; Mizuno, Nobuhiro; Kimura, Tsunehisa

    2016-07-01

    Protein microcrystals magnetically aligned in D2O hydrogels were subjected to neutron diffraction measurements, and reflections were observed for the first time to a resolution of 3.4 Å from lysozyme microcrystals (∼10 × 10 × 50 µm). This result demonstrated the possibility that magnetically oriented microcrystals consolidated in D2O gels may provide a promising means to obtain single-crystal neutron diffraction from proteins that do not crystallize at the sizes required for neutron diffraction structure determination. In addition, lysozyme microcrystals aligned in H2O hydrogels allowed structure determination at a resolution of 1.76 Å at room temperature by X-ray diffraction. The use of gels has advantages since the microcrystals are measured under hydrated conditions.

  9. Anisotropy of x-ray reflectivity: chemical and structural effects on K-shell excitations in hexagonal BN crystal

    CERN Document Server

    Filatova, E O

    2002-01-01

    The experimental investigation of the B and N K-reflection spectra using both s-polarized synchrotron radiation and unpolarized radiation for different crystal orientations with respect to the electric field vector E was carried out. The absorption spectra calculated from the reflection spectra using Kramers-Kronig analysis are presented. A strong orientation dependence of both reflection and absorption spectra is exhibited. Analysis of the orientation dependences of the x-ray reflection and absorption spectra near both edges strongly supports a possibility of tracing the role of each excitation canal in the formation of fine structure. The high sensitivity of the reflection spectra fine structure to the vibronic interaction connected with Jahn-Teller distortions as well to the core-hole relaxation is discussed. A very strong dependence of the absolute values of the reflectivity on planar crystal anisotropy was discovered.

  10. Upgraded high time-resolved x-ray imaging crystal spectroscopy system for J-TEXT ohmic plasmas

    International Nuclear Information System (INIS)

    Jin, W.; Chen, Z. Y.; Huang, D. W.; Li, Q. L.; Yan, W.; Luo, Y. H.; Huang, Y. H.; Tong, R. H.; Yang, Z. J.; Rao, B.; Ding, Y. H.; Zhuang, G.; Lee, S. G.; Shi, Y. J.

    2014-01-01

    This paper presents the upgraded x-ray imaging crystal spectrometer (XICS) system on Joint Texas Experimental Tokamak (J-TEXT) tokamak and the latest experimental results obtained in last campaign. With 500 Hz frame rate of the new Pilatus detector and 5 cm × 10 cm spherically bent crystal, the XICS system can provide core electron temperature (T e ), core ion temperature (T i ), and plasma toroidal rotation (V Φ ) with a maximum temporal resolution of 2 ms for J-TEXT pure ohmic plasmas. These parameters with high temporal resolution are very useful in tokamak plasma research, especially for rapidly changed physical processes. The experimental results from the upgraded XICS system are presented

  11. Crystallization and preliminary X-ray diffraction data analysis of stenodactylin, a highly toxic type 2 ribosome-inactivating protein from Adenia stenodactyla

    Science.gov (United States)

    Tosi, Giovanna; Fermani, Simona; Falini, Giuseppe; Polito, Letizia; Bortolotti, Massimo; Bolognesi, Andrea

    2010-01-01

    Ribosome-inactivating proteins (RIPs) inhibit protein synthesis and induce cell death by removing a single adenine from a specific rRNA loop. They can be divided into two main groups: type 1 and type 2 RIPs. Type 1 RIPs are single-chain enzymes with N-glycosidase activity. Type 2 RIPs contain two chains (A and B) linked by a disulfide bond. The A chain has RIP enzymatic activity, whereas the B chain shows lectin activity and is able to bind to glycosylated receptors on the cell surface. Stenodactylin is a type 2 RIP from the caudex of Adenia stenodactyla from the Passifloraceae family that has been recently purified and characterized. It shows a strong enzymatic activity towards several substrates and is more cytotoxic than other toxins of the same type. Here, the crystallization and preliminary X-ray diffraction data analysis of stenodactylin are reported. This RIP forms crystals that diffract to high resolution (up to 2.15 Å). The best data set was obtained by merging data collected from two crystals. Stenodactylin crystals belonged to the centred monoclinic space group C2 and contained two molecules in the asymmetric unit. PMID:20057070

  12. Crystallization and preliminary X-ray crystallographic analysis of Aquifex aeolicus SelA, a bacterial selenocysteine synthase

    International Nuclear Information System (INIS)

    Itoh, Yuzuru; Sekine, Shun-ichi; Yokoyama, Shigeyuki

    2012-01-01

    The bacterial selenocysteine synthase SelA from Aquifex aeolicus was crystallized and the diffraction resolution was improved by lysine-residue methylation, truncation of N-terminal region (ΔN), and Lys-to-Ala point mutations. Phases were determined by using a selenomethionine-substituted crystal of the ΔN mutant. Selenocysteine (Sec), the 21st amino acid, is synthesized on its specific tRNA (tRNA Sec ) via a multi-step process. In bacteria, tRNA Sec is ligated first with serine by seryl-tRNA synthetase, which is followed by Ser-to-Sec conversion by Sec synthase (SelA). To elucidate its structure and catalytic mechanism, Aquifex aeolicus SelA was crystallized. Although wild-type SelA crystals diffracted X-rays poorly (to up to 8 Å resolution), the resolution was improved by introducing a quadruple point mutation targeting the loop regions and by methylating the lysine residues, which yielded 3.9 Å resolution diffraction data from a full-length SelA crystal. Truncation of the N-terminal region (ΔN) also improved the resolution. A 3.3 Å resolution data set for phase determination was obtained from a crystal of selenomethionine-substituted Lys-methylated SelA-ΔN

  13. Crystallization and preliminary X-ray diffraction analysis of the lytic transglycosylase MltE from Escherichia coli

    International Nuclear Information System (INIS)

    Artola-Recolons, Cecilia; Llarrull, Leticia I.; Lastochkin, Elena; Mobashery, Shahriar; Hermoso, Juan A.

    2010-01-01

    Crystals of the lytic transglycosylase MltE from E. coli were grown using the microbatch method and diffracted to a resolution of 2.1 Å. MltE from Escherichia coli (193 amino acids, 21 380 Da) is a lytic transglycosylase that initiates the first step of cell-wall recycling. This enzyme is responsible for the cleavage of the cell-wall peptidoglycan at the β-1,4-glycosidic bond between the N-acetylglucosamine and N-acetylmuramic acid units. At the end this reaction generates a disaccharide that is internalized and initiates the recycling process. To obtain insights into the biological functions of MltE, crystallization trials were performed and crystals of MltE protein that were suitable for X-ray diffraction analysis were obtained. The MltE protein of E. coli was crystallized using the hanging-drop vapour-diffusion method at 291 K. Crystals grew from a mixture consisting of 28% polyethylene glycol 4000, 0.1 M Tris pH 8.4 and 0.2 M magnesium chloride. Further optimization was performed using the microbatch technique. Single crystals were obtained that belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 123.32, b = 183.93, c = 35.29 Å, and diffracted to a resolution of 2.1 Å

  14. Dosimetric characteristics of ultraviolet and x-ray-irradiated KBr:Eu{sup 2+} thermoluminescence crystals

    Energy Technology Data Exchange (ETDEWEB)

    Melendrez, R.; Perez-Salas, R. [Programa de Posgrado en Fisica de Materiales, Centro de Investigacion, Cientifica y de Educacion Superior de Ensenada, Apartado Postal 2681, Ensenada, Baja California, 22800 (Mexico); Aceves, R.; Piters, T.M.; Barboza-Flores, M. [Centro de Investigacion en Fisica, Universidad de Sonora, Apartado Postal 5-088, Hermosillo, Sonora, 83190 (Mexico)

    1996-08-01

    Thermoluminescence (TL) characteristics of KBr:Eu{sup 2+} (150 ppm) previously exposed to ultraviolet (UV) light (200{endash}300 nm) and x-ray radiation at room temperature have been determined. The TL glow curve of UV-irradiated samples is composed of six peaks located at 337, 384, 402, 435, 475, and 510 K. The TL glow curves of x-irradiated samples show mainly a TL peak around 384 K. The TL intensities of UV-irradiated (402 and 510 K glow peaks) and x-irradiated specimens present a linear dependence as a function of radiation dose as well as fading stability 300 s after irradiation. These results further enhance the possibilities of using europium-doped materials in nonionizing (actinic region) and ionizing radiation detection and dosimetry applications. {copyright} {ital 1996 American Institute of Physics.}

  15. Performance characteristics needed for protein crystal diffraction x-ray detectors.

    Energy Technology Data Exchange (ETDEWEB)

    Westbrook, E. M.

    1999-09-21

    During the 1990's, macromolecular crystallography became progressively more dependent on synchrotrons X-ray sources for diffraction data collection. Detectors of this diffraction data at synchrotrons beamlines have evolved over the decade, from film to image phosphor plates, and then to CCD systems. These changes have been driven by the data quality and quantity improvements each newer detector technology provided. The improvements have been significant. It is likely that newer detector technologies will be adopted at synchrotron beamlines for crystallographic diffraction data collection in the future, but these technologies will have to compete with existing CCD detector systems which are already excellent and are getting incrementally better in terms of size, speed, efficiency, and resolving power. Detector development for this application at synchrotrons must concentrate on making systems which are bigger and faster than CCDs and which can capture weak data more efficiently. And there is a need for excellent detectors which are less expensive than CCD systems.

  16. Dosimetric characteristics of ultraviolet and x-ray-irradiated KBr:Eu2+ thermoluminescence crystals

    International Nuclear Information System (INIS)

    Melendrez, R.; Perez-Salas, R.; Aceves, R.; Piters, T.M.; Barboza-Flores, M.

    1996-01-01

    Thermoluminescence (TL) characteristics of KBr:Eu 2+ (150 ppm) previously exposed to ultraviolet (UV) light (200 endash 300 nm) and x-ray radiation at room temperature have been determined. The TL glow curve of UV-irradiated samples is composed of six peaks located at 337, 384, 402, 435, 475, and 510 K. The TL glow curves of x-irradiated samples show mainly a TL peak around 384 K. The TL intensities of UV-irradiated (402 and 510 K glow peaks) and x-irradiated specimens present a linear dependence as a function of radiation dose as well as fading stability 300 s after irradiation. These results further enhance the possibilities of using europium-doped materials in nonionizing (actinic region) and ionizing radiation detection and dosimetry applications. copyright 1996 American Institute of Physics

  17. Performance characteristics needed for protein crystal diffraction x-ray detectors

    International Nuclear Information System (INIS)

    Westbrook, E. M.

    1999-01-01

    During the 1990's, macromolecular crystallography became progressively more dependent on synchrotrons X-ray sources for diffraction data collection. Detectors of this diffraction data at synchrotrons beamlines have evolved over the decade, from film to image phosphor plates, and then to CCD systems. These changes have been driven by the data quality and quantity improvements each newer detector technology provided. The improvements have been significant. It is likely that newer detector technologies will be adopted at synchrotron beamlines for crystallographic diffraction data collection in the future, but these technologies will have to compete with existing CCD detector systems which are already excellent and are getting incrementally better in terms of size, speed, efficiency, and resolving power. Detector development for this application at synchrotrons must concentrate on making systems which are bigger and faster than CCDs and which can capture weak data more efficiently. And there is a need for excellent detectors which are less expensive than CCD systems

  18. Crystallization and preliminary X-ray diffraction studies of the putative haloalkane dehalogenase DppA from Plesiocystis pacifica SIR-I

    International Nuclear Information System (INIS)

    Bogdanović, Xenia; Hesseler, Martin; Palm, Gottfried J.; Bornscheuer, Uwe T.; Hinrichs, Winfried

    2010-01-01

    The crystallization and preliminary X-ray diffraction studies of DppA from P. pacifica SIR-I are reported. DppA from Plesiocystis pacifica SIR-I is a putative haloalkane dehalogenase (EC 3.8.1.5) and probably catalyzes the conversion of halogenated alkanes to the corresponding alcohols. The enzyme was expressed in Escherichia coli BL21 and purified to homogeneity by ammonium sulfate precipitation and reversed-phase and ion-exchange chromatography. The DppA protein was crystallized by the vapour-diffusion method and protein crystals suitable for data collection were obtained in the orthorhombic space group P2 1 2 1 2. The DppA crystal diffracted X-rays to 1.9 Å resolution using an in-house X-ray generator

  19. Development of speckle-free channel-cut crystal optics using plasma chemical vaporization machining for coherent x-ray applications

    Science.gov (United States)

    Hirano, Takashi; Osaka, Taito; Sano, Yasuhisa; Inubushi, Yuichi; Matsuyama, Satoshi; Tono, Kensuke; Ishikawa, Tetsuya; Yabashi, Makina; Yamauchi, Kazuto

    2016-06-01

    We have developed a method of fabricating speckle-free channel-cut crystal optics with plasma chemical vaporization machining, an etching method using atmospheric-pressure plasma, for coherent X-ray applications. We investigated the etching characteristics to silicon crystals and achieved a small surface roughness of less than 1 nm rms at a removal depth of >10 μm, which satisfies the requirements for eliminating subsurface damage while suppressing diffuse scattering from rough surfaces. We applied this method for fabricating channel-cut Si(220) crystals for a hard X-ray split-and-delay optical system and confirmed that the crystals provided speckle-free reflection profiles under coherent X-ray illumination.

  20. Synthesis, X-ray crystallography, and DFT calculations of a novel phosphoramide

    Czech Academy of Sciences Publication Activity Database

    Shariatinia, Z.; Dušek, Michal; Eigner, Václav

    2014-01-01

    Roč. 640, č. 14 (2014), 2945-2955 ISSN 0044-2313 R&D Projects: GA ČR(CZ) GA14-03276S Institutional support: RVO:68378271 Keywords : phosphoramide * x-ray structure * DFT Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.160, year: 2014

  1. Synthesis, spectroscopy, X-ray crystallography, and DFT computations of nanosized phosphazenes

    Czech Academy of Sciences Publication Activity Database

    Shariatinia, Z.; Moghadam, E.J.; Maghsoudi, N.; Mousavi, H.S.M.; Dušek, Michal; Eigner, Václav

    2015-01-01

    Roč. 641, č. 5 (2015), s. 967-978 ISSN 0044-2313 Grant - others:AV ČR(CZ) Praemium Academiae Institutional support: RVO:68378271 Keywords : phosphazene * ultrasonic * nanoparticle * x-ray crystallography * DFT calculation Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 1.261, year: 2015

  2. Titanium dioxide nanoparticles: synthesis, X-Ray line analysis and chemical composition study

    Energy Technology Data Exchange (ETDEWEB)

    Chenari, Hossein Mahmoudi, E-mail: mahmoudi_hossein@guilan.ac.ir, E-mail: h.mahmoudiph@gmail.com [University of Guilan, Rasht (Iran, Islamic Republic of); Seibel, Christoph; Hauschild, Dirk; Reinert, Friedrich [Karlsruhe Institute of Technology - KIT, Gemeinschaftslabor für Nanoanalytik, Karlsruhe (Germany); Abdollahian, Hossein [Nanotechnology Research Center of Urmia University, Urmia, (Iran, Islamic Republic of)

    2016-11-15

    TiO{sub 2} nanoparticles have been synthesized by the sol-gel method using titanium alkoxide and isopropanol as a precursor. The structural properties and chemical composition of the TiO{sub 2} nanoparticles were studied using X-ray diffraction, scanning electron microscopy, and X-ray photoelectron spectroscopy.The X-ray powder diffraction pattern confirms that the particles are mainly composed of the anatase phase with the preferential orientation along [101] direction. The physical parameters such as strain, stress and energy density were investigated from the Williamson- Hall (W-H) plot assuming a uniform deformation model (UDM), and uniform deformation energy density model (UDEDM). The W-H analysis shows an anisotropic nature of the strain in nano powders. The scanning electron microscopy image shows clear TiO{sub 2} nanoparticles with particle sizes varying from 60 to 80nm. The results of mean particle size of TiO{sub 2} nanoparticles show an inter correlation with the W-H analysis and SEM results. Our X-ray photoelectron spectroscopy spectra show that nearly a complete amount of titanium has reacted to TiO{sub 2}. (author)

  3. Monitoring of the YBa2Cu3O7 synthesis by X-ray powder diffraction

    International Nuclear Information System (INIS)

    Gonzalez G, J.C.; Osorio A, Ana M.; Bejar R, Manuel; Bustamante D, Angel

    2011-01-01

    We study the formation dynamics of the YBa 2 Cu 3 O 7 superconducting phase, from Y, Ba and Cu acetates prepared by the Sol-Gel method. The monitoring is done through by Rietveld refinement of the X-ray powder diffractograms at the end product resulting in three specific stages of the thermal treatment: (a) precursor, (b) calcined and (c) sinterized. (author).

  4. Overexpression, purification, crystallization and preliminary X-ray analysis of uracil N-glycosylase from Mycobacterium tuberculosis in complex with a proteinaceous inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Prem [Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012 (India); Talawar, Ramappa K.; Krishna, P. D. V.; Varshney, Umesh [Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore 560 012 (India); Vijayan, M., E-mail: mv@mbu.iisc.ernet.in [Molecular Biophysics Unit, Indian Institute of Science, Bangalore 560 012 (India)

    2006-12-01

    Uracil N-glycosylase from M. tuberculosis has been crystallized in complex with a proteinaceous inhibitor (Ugi) and X-ray diffraction data have been collected. Uracil N-glycosylase is an enzyme which initiates the pathway of uracil-excision repair of DNA. The enzyme from Mycobacterium tuberculosis was co-expressed with a proteinaceous inhibitor from Bacillus subtilis phage and was crystallized in monoclinic space group C2, with unit-cell parameters a = 201.14, b = 64.27, c = 203.68 Å, β = 109.7°. X-ray data from the crystal have been collected for structure analysis.

  5. Overexpression, purification, crystallization and preliminary X-ray analysis of uracil N-glycosylase from Mycobacterium tuberculosis in complex with a proteinaceous inhibitor

    International Nuclear Information System (INIS)

    Singh, Prem; Talawar, Ramappa K.; Krishna, P. D. V.; Varshney, Umesh; Vijayan, M.

    2006-01-01

    Uracil N-glycosylase from M. tuberculosis has been crystallized in complex with a proteinaceous inhibitor (Ugi) and X-ray diffraction data have been collected. Uracil N-glycosylase is an enzyme which initiates the pathway of uracil-excision repair of DNA. The enzyme from Mycobacterium tuberculosis was co-expressed with a proteinaceous inhibitor from Bacillus subtilis phage and was crystallized in monoclinic space group C2, with unit-cell parameters a = 201.14, b = 64.27, c = 203.68 Å, β = 109.7°. X-ray data from the crystal have been collected for structure analysis

  6. High-resolution X-ray study of the effects of deuteration on crystal growth and the crystal structure of proteinase K.

    Science.gov (United States)

    Chatake, Toshiyuki; Ishikawa, Takuya; Yanagisawa, Yasuhide; Yamada, Taro; Tanaka, Ichiro; Fujiwara, Satoru; Morimoro, Yukio

    2011-11-01

    Deuteration of macromolecules is an important technique in neutron protein crystallography. Solvent deuteration of protein crystals is carried out by replacing water (H(2)O) with heavy water (D(2)O) prior to neutron diffraction experiments in order to diminish background noise. The effects of solvent deuteration on the crystallization of proteinase K (PK) with polyethylene glycol as a precipitant were investigated using high-resolution X-ray crystallography. In previous studies, eight NO(3)(-) anions were included in the PK crystal unit cell grown in NaNO(3) solution. In this study, however, the PK crystal structure did not contain NO(3)(-) anions; consequently, distortions of amino acids arising from the presence of NO(3)(-) anions were avoided in the present crystal structures. High-resolution (1.1 Å) X-ray diffraction studies showed that the degradation of PK crystals induced by solvent deuteration was so small that this degradation would be negligible for the purpose of neutron protein crystallography experiments at medium resolution. Comparison of the nonhydrogen structures of nondeuterated and deuterated crystal structures demonstrated very small structural differences. Moreover, a positive correlation between the root-mean-squared differences and B factors indicated that no systematic difference existed. © 2011 International Union of Crystallography. All rights reserved.

  7. New structural studies of liquid crystal by reflectivity and resonant X-ray diffraction; Nouvelles etudes structurales de cristaux liquides par reflectivite et diffraction resonante des rayons X

    Energy Technology Data Exchange (ETDEWEB)

    Fernandes, P

    2007-04-15

    This memory presents three structural studies of smectic Liquid Crystals by reflectivity and resonant diffraction of X-rays. It is divided in five chapters. In the first a short introduction to Liquid Crystals is given. In particular, the smectic phases that are the object of this study are presented. The second chapter is consecrated to the X-ray experimental techniques that were used in this work. The three last chapters present the works on which this thesis can be divided. Chapter three demonstrates on free-standing films of MHPOBC (historic liquid crystal that possesses the antiferroelectric sub-phases) the possibility to extend the technique of resonant X-ray diffraction to liquid crystals without resonant element. In the fourth chapter the structure of the B{sub 2} liquid crystal phase of bent-core molecules (or banana molecules) is elucidated by using resonant X-ray diffraction combined with polarization analysis of the diffracted beam. A model of the polarization of the resonant beam diffracted by four different structures proposed for the B{sub 2} phase is developed in this chapter. In the fifth chapter a smectic binary mixture presenting a very original critical point of phase separation is studied by X-ray reflectivity and optical microscopy. A concentration gradient in the direction perpendicular to the plane of the film seems to be induced by the free-standing film geometry. The results of a simplified model of the system are compatible with this interpretation.

  8. Crystallization and X-ray diffraction analysis of a novel surface-adhesin protein: protein E from Haemophilus influenzae

    International Nuclear Information System (INIS)

    Singh, Birendra; Al Jubair, Tamim; Förnvik, Karolina; Thunnissen, Marjolein M.; Riesbeck, Kristian

    2012-01-01

    Protein E of the respiratory pathogen H. influenzae is a multifunctional adhesin that is involved in bacterial attachment to host epithelium and direct interactions with vitronectin, laminin and plasminogen. The method of crystallization and X-ray data collection for protein E at 1.8 Å is presented. Protein E (PE) is a ubiquitous multifunctional surface protein of Haemophilus spp. and other bacterial pathogens of the Pasteurellaceae family. H. influenzae utilizes PE for attachment to respiratory epithelial cells. In addition, PE interacts directly with plasminogen and the extracellular matrix (ECM) components vitronectin and laminin. Vitronectin is a complement regulator that inhibits the formation of the membrane-attack complex (MAC). PE-mediated vitronectin recruitment at the H. influenzae surface thus inhibits MAC and protects against serum bactericidal activity. Laminin is an abundant ECM protein and is present in the basement membrane that helps in adherence of H. influenzae during colonization. Here, the expression, purification and crystallization of and the collection of high-resolution data for this important H. influenzae adhesin are reported. To solve the phase problem for PE, Met residues were introduced and an SeMet variant was expressed and crystallized. Both native and SeMet-containing PE gave plate-like crystals in space group P2 1 , with unit-cell parameters a = 44, b = 57, c = 61 Å, β = 96°. Diffraction data collected from native and SeMet-derivative crystals extended to resolutions of 1.8 and 2.6 Å, respectively

  9. Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

    Energy Technology Data Exchange (ETDEWEB)

    Jagadeesan, G. [Presidency College, Chennai 600 005 (India); Malathy, P.; Gunasekaran, K. [University of Madras, Chennai 600 025 (India); Harikrishna Etti, S. [GKM College of Engineering and Technology, Kamaraj Salai, Chennai 600 063 (India); Aravindhan, S., E-mail: aravindhanpresidency@gmail.com [Presidency College, Chennai 600 005 (India)

    2014-10-25

    The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

  10. Crystallization and preliminary X-ray crystallographic analysis of polyphenol oxidase from Juglans regia (jrPPO1)

    Energy Technology Data Exchange (ETDEWEB)

    Zekiri, Florime; Bijelic, Aleksandar; Molitor, Christian; Rompel, Annette, E-mail: annette.rompel@univie.ac.at [Universität Wien, Althanstrasse 14, 1090 Wien (Austria)

    2014-05-28

    The crystallization and preliminary X-ray crystallographic analysis of a plant PPO exhibiting monophenolase activity from J. regia (jrPPO1) in its active form (Asp{sup 101}–Arg{sup 445}) are reported. Tyrosinase is a type 3 copper enzyme that catalyzes the ortho-hydroxylation of monophenols to diphenols as well as their subsequent oxidation to quinones, which are precursors for the biosynthesis of melanins. The first plant tyrosinase from walnut leaves (Juglans regia) was purified to homogeneity and crystallized. During the purification, two forms of the enzyme differing only in their C-termini [jrPPO1(Asp{sup 101}–Pro{sup 444}) and jrPPO1(Asp{sup 101}–Arg{sup 445})] were obtained. The most abundant form jrPPO1(Asp{sup 101}–Arg{sup 445}), as described in Zekiri et al. [Phytochemistry (2014 ▶), 101, 5–15], was crystallized, resulting in crystals that belonged to space group C121, with unit-cell parameters a = 115.56, b = 91.90, c = 86.87 Å, α = 90, β = 130.186, γ = 90°, and diffracted to 2.39 Å resolution. Crystals were only obtained from solutions containing at least 30% polyethylene glycol 5000 monomethyl ether in a close-to-neutral pH range.

  11. Crystallization and preliminary X-ray crystallographic analysis of the tRNA-specific adenosine deaminase from Streptococcus pyogenes

    Energy Technology Data Exchange (ETDEWEB)

    Ku, Min-Je [Functional Proteomics Center, Korea Institute of Science and Technology, 39-1 Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Lee, Won-Ho [Functional Proteomics Center, Korea Institute of Science and Technology, 39-1 Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Biotechnology and Genetic Engineering, Korea University, Seoul 136-701 (Korea, Republic of); Nam, Ki-hyun; Rhee, Kyeong-hee [Biomedical Research Center, Life Science Division, Korea Institute of Science and Technology, 39-1 Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Lee, Ki-Seog [Biotechnology and Genetic Engineering, Korea University, Seoul 136-701 (Korea, Republic of); Kim, Eunice EunKyung [Biomedical Research Center, Life Science Division, Korea Institute of Science and Technology, 39-1 Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Yu, Myung-Hee [Functional Proteomics Center, Korea Institute of Science and Technology, 39-1 Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Hwang, Kwang Yeon, E-mail: hwangky@kist.re.kr [Biomedical Research Center, Life Science Division, Korea Institute of Science and Technology, 39-1 Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Functional Proteomics Center, Korea Institute of Science and Technology, 39-1 Hawolgok-dong, Seongbuk-gu, Seoul 136-791 (Korea, Republic of)

    2005-04-01

    The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn{sup 2+} ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. The asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V{sub M}) of 3.3 Å{sup 3} Da{sup −1} and a solvent content of 62.7%.

  12. Crystallization and preliminary X-ray diffraction analysis of the metalloregulatory protein DtxR from Thermoplasma acidophilum

    International Nuclear Information System (INIS)

    Yeo, Hyun Ku; Kang, Jina; Park, Young Woo; Sung, Jung-Suk; Lee, Jae Young

    2012-01-01

    Orthorhombic crystals of DtxR from T. acidophilum have been obtained. X-ray data were collected to 1.8 Å resolution using synchrotron radiation. The diphtheria toxin repressor (DtxR) is a metal-ion-dependent transcriptional regulator which regulates genes encoding proteins involved in metal-ion uptake to maintain metal-ion homeostasis. DtxR from Thermoplasma acidophilum was cloned and overexpressed in Escherichia coli. Crystals of N-terminally His-tagged DtxR were obtained by hanging-drop vapour diffusion and diffracted to 1.8 Å resolution. DtxR was crystallized at 296 K using polyethylene glycol 4000 as a precipitant. The crystals belonged to the orthorhombic space group P2 1 2 1 2, with unit-cell parameters a = 61.14, b = 84.61, c = 46.91 Å, α = β = γ = 90°. The asymmetric unit contained approximately one monomer of DtxR, giving a crystal volume per mass (V M ) of 2.22 Å 3 Da −1 and a solvent content of 44.6%

  13. Explosives under pressure - the crystal structure of gamma-RDX as determined by high-pressure X-ray and neutron diffraction

    OpenAIRE

    Davidson, A.J.; Oswald, Iain D H; Francis, A.R.; Pulham, Colin

    2008-01-01

    Using a combination of X-ray single crystal and neutron powder diffraction, the crystal structure of the high-pressure γ-form of RDX has been determined at 5.2 GPa and shows that the RDX molecules adopt different conformations compared to the conformation found in the ambient-pressure α-form.

  14. Small-angle X-ray scattering study of conditions for the formation of growth units of protein crystals in lysozyme solutions

    Science.gov (United States)

    Dyakova, Yu. A.; Ilina, K. B.; Konarev, P. V.; Kryukova, A. E.; Marchenkova, M. A.; Blagov, A. E.; Volkov, V. V.; Pisarevsky, Yu. V.; Kovalchuk, M. V.

    2017-05-01

    The structural composition of lysozyme solutions favorable for the formation of the tetragonal form of protein crystals was studied by synchrotron-based small-angle X-ray scattering depending on the protein concentration and the temperature. Along with lysozyme monomers, dimers and octamers are found in crystallization solutions; the octamer content increases with an increase in the protein concentration.

  15. Crystallization and preliminary X-ray analysis of Na-SAA-2 from the human hookworm parasite Necator americanus

    International Nuclear Information System (INIS)

    Asojo, Oluwatoyin A.; Goud, Gaddam N.; Zhan, Bin; Ordonez, Katherine; Sedlacek, Meghan; Homma, Kohei; Deumic, Vehid; Gupta, Richi; Brelsford, Jill; Price, Merelyn K.; Ngamelue, Michelle N.; Hotez, Peter J.

    2010-01-01

    The purification, crystallization and preliminary X-ray diffraction analysis of a surface-associated antigen from the major human hookworm N. americanus is presented. Human hookworms are among the most pathogenic soil-transmitted helminths. These parasitic nematodes have co-evolved with the host and are able to maintain a high worm burden for decades without killing the human host. However, it is possible to develop vaccines against laboratory-challenge hookworm infections using either irradiated third-state infective larvae (L3) or enzymes from the adult parasites. In an effort to control hookworm infection globally, the Human Hookworm Vaccine Initiative, a product-development partnership with the Sabin Vaccine Institute to develop new control tools including vaccines, has identified a battery of protein antigens, including surface-associated antigens (SAAs) from L3. SAA proteins are characterized by a 13 kDa conserved domain of unknown function. SAA proteins are found on the surface of infective L3 stages (and some adult stages) of different nematode parasites, suggesting that they may play important roles in these organisms. The atomic structures and function of SAA proteins remain undetermined and in an effort to remedy this situation recombinant Na-SAA-2 from the most prevalent human hookworm parasite Necator americanus has been expressed, purified and crystallized. Useful X-ray data have been collected to 2.3 Å resolution from a crystal that belonged to the monoclinic space group C2 with unit-cell parameters a = 73.88, b = 35.58, c = 42.75 Å, β = 116.1°

  16. Crystal structure analysis of LaMnO3 with x-ray diffraction technique using the Rietveld method

    International Nuclear Information System (INIS)

    Engkir Sukirman; Wisnu Ari Adi; Yustinus Purwamargapratala

    2010-01-01

    Crystal structure analysis of LaMnO 3 using the Rietveld method has been carried out. The LaMnO 3 sample was synthesized with high energy mechanical milling from the raw materials of La 2 O 3 and MnO 2 with the appropriate mol ratio. Milling were performed for 10 hours, pelletized and hereinafter sintered at 1350 °C for 6 hours. The sample characterizations covered the crystal structure and electric-magnetic properties of the materials by X-ray diffraction technique using the Rietveld method and the four point probe, respectively. The Rietveld refinement results based on the X-rays diffraction data indicate that the sample of LaMnO 3 is single phase with the crystal system: orthorhombic, the space group: Pnma No. 62 and the lattice parameters: a = 55.4405(9) Å; b = 7.717(1) Å dan c = 5.537(1) Å. The material owns Magnetic Resonance (MR) respond of 7 %, the mean value of crystallite size, D = 17 nm and lattice strain, e = - 0.5 %. So, the material go through a compressive strain, and according to the Nanda's strain model, it becomes a type G antiferromagnetic insulator. Because the insulator properties of the material does not change although being hit by the external magnetic field, hence the MR respond is only caused by the order of electron spin. Therefore at room temperature, LaMnO 3.0 just exhibits a small MR respond. (author)

  17. First spin-resolved electron distributions in crystals from combined polarized neutron and X-ray diffraction experiments

    Directory of Open Access Journals (Sweden)

    Maxime Deutsch

    2014-05-01

    Full Text Available Since the 1980s it has been possible to probe crystallized matter, thanks to X-ray or neutron scattering techniques, to obtain an accurate charge density or spin distribution at the atomic scale. Despite the description of the same physical quantity (electron density and tremendous development of sources, detectors, data treatment software etc., these different techniques evolved separately with one model per experiment. However, a breakthrough was recently made by the development of a common model in order to combine information coming from all these different experiments. Here we report the first experimental determination of spin-resolved electron density obtained by a combined treatment of X-ray, neutron and polarized neutron diffraction data. These experimental spin up and spin down densities compare very well with density functional theory (DFT calculations and also confirm a theoretical prediction made in 1985 which claims that majority spin electrons should have a more contracted distribution around the nucleus than minority spin electrons. Topological analysis of the resulting experimental spin-resolved electron density is also briefly discussed.

  18. In situ X-ray diffraction study of crystallization process of GeSbTe thin films during heat treatment

    International Nuclear Information System (INIS)

    Kato, Naohiko; Konomi, Ichiro; Seno, Yoshiki; Motohiro, Tomoyoshi

    2005-01-01

    The crystallization processes of the Ge 2 Sb 2 Te 5 thin film used for PD and DVD-RAM were studied in its realistic optical disk film configurations for the first time by X-ray diffraction using an intense X-ray beam of a synchrotron orbital radiation facility (SPring-8) and in situ quick detection with a Position-Sensitive-Proportional-Counter. The dependence of the amorphous-to-fcc phase-change temperature T 1 on the rate of temperature elevation R et gave an activation energy E a : 0.93 eV much less than previously reported 2.2 eV obtained from a model sample 25-45 times thicker than in the real optical disks. The similar measurement on the Ge 4 Sb 1 Te 5 film whose large reflectance change attains the readability by CD-ROM drives gave E a : 1.13 eV with larger T 1 than Ge 2 Sb 2 Te 5 thin films at any R et implying a lower sensitivity in erasing as well as a better data stability of the phase-change disk

  19. Crystallization and preliminary X-ray diffraction analysis of transaldolase from Thermoplasma acidophilum

    International Nuclear Information System (INIS)

    Lehwess-Litzmann, Anja; Neumann, Piotr; Golbik, Ralph; Parthier, Christoph; Tittmann, Kai

    2011-01-01

    The transaldolase enzyme from T. acidophilum has been crystallized in two different space groups. The metabolic enzyme transaldolase from Thermoplasma acidophilum was recombinantly expressed in Escherichia coli and could be crystallized in two polymorphic forms. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 6000 as precipitant. Native data sets for crystal forms 1 and 2 were collected in-house to resolutions of 3.0 and 2.7 Å, respectively. Crystal form 1 belonged to the orthorhombic space group C222 1 with five monomers per asymmetric unit and crystal form 2 belonged to the monoclinic space group P2 1 with ten monomers per asymmetric unit

  20. X-ray physico-chemical imaging during activation of cobalt-based Fischer-Tropsch synthesis catalysts

    Science.gov (United States)

    Beale, Andrew M.; Jacques, Simon D. M.; Di Michiel, Marco; Mosselmans, J. Frederick W.; Price, Stephen W. T.; Senecal, Pierre; Vamvakeros, Antonios; Paterson, James

    2017-11-01

    The imaging of catalysts and other functional materials under reaction conditions has advanced significantly in recent years. The combination of the computed tomography (CT) approach with methods such as X-ray diffraction (XRD), X-ray fluorescence (XRF) and X-ray absorption near-edge spectroscopy (XANES) now enables local chemical and physical state information to be extracted from within the interiors of intact materials which are, by accident or design, inhomogeneous. In this work, we follow the phase evolution during the initial reduction step(s) to form Co metal, for Co-containing particles employed as Fischer-Tropsch synthesis (FTS) catalysts; firstly, working at small length scales (approx. micrometre spatial resolution), a combination of sample size and density allows for transmission of comparatively low energy signals enabling the recording of `multimodal' tomography, i.e. simultaneous XRF-CT, XANES-CT and XRD-CT. Subsequently, we show high-energy XRD-CT can be employed to reveal extent of reduction and uniformity of crystallite size on millimetre-sized TiO2 trilobes. In both studies, the CoO phase is seen to persist or else evolve under particular operating conditions and we speculate as to why this is observed. This article is part of a discussion meeting issue 'Providing sustainable catalytic solutions for a rapidly changing world'.

  1. A comparison between the Structural Results obtained by X-ray Single Crystal Data and by Neutron Powder Data for BaVs/sb3/

    International Nuclear Information System (INIS)

    Marezio, M.

    1986-01-01

    The structure of BaVs/sb3/, as refined from X-ray single-crystal data to an R factor of 0.011, is compared to the structure of the same compound obtained from neutron powder data (Rsb(ro) = 6.82, Rsb(psilon) = 4.09). As expected, the X-ray standard deviations of the positional and thermal parameters are smaller than the corresponding neutron standard deviations. However, the dynamical disorder deduced from the anomalously large thermal vibrations of the vanadium atoms obtained from the X-ray data is also evidenced by the neutron refinement. On the other hand, the neutron standard deviations of the lattice parameters are smaller than the X-ray counterparts

  2. X-ray source on the basis of the piroelectric crystal Sr0.61Ba0.39Nb2O6

    Directory of Open Access Journals (Sweden)

    V. A. Andrianov

    2017-11-01

    Full Text Available The properties of X-ray source based on Sr0.61Ba0.39Nb2O6 crystals (SBN-61 having a large pyroelectric coefficient γ = 85 nC/(cm2K was studied. When the crystal was heated to 60 ° C, X-rays from a tungsten target with energy of 8.4 keV were detected. The maximum energy of the electron beam was 52 keV. The visualization of the electron beam with a grid electrode and a fluorescent screen showed that the electron beam was inhomogeneous in the polar plane of the crystal and varied during heating.The radiation intensity was unstable in time. The work of the X-ray source was limited to electrical breakdowns between the polar faces of the crystal. When the crystal was cooled, there was no X-ray emission, which could be due to the depolarization of the crystal by the total electric field or as a result of electrical breakdowns. The crystals SBN-61 and LiNbO3 are compared.

  3. A compact low cost “master–slave” double crystal monochromator for x-ray cameras calibration of the Laser MégaJoule Facility

    Energy Technology Data Exchange (ETDEWEB)

    Hubert, S., E-mail: sebastien.hubert@cea.fr; Prévot, V.

    2014-12-21

    The Alternative Energies and Atomic Energy Commission (CEA-CESTA, France) built a specific double crystal monochromator (DCM) to perform calibration of x-ray cameras (CCD, streak and gated cameras) by means of a multiple anode diode type x-ray source for the MégaJoule Laser Facility. This DCM, based on pantograph geometry, was specifically modeled to respond to relevant engineering constraints and requirements. The major benefits are mechanical drive of the second crystal on the first one, through a single drive motor, as well as compactness of the entire device. Designed for flat beryl or Ge crystals, this DCM covers the 0.9–10 keV range of our High Energy X-ray Source. In this paper we present the mechanical design of the DCM, its features quantitatively measured and its calibration to finally provide monochromatized spectra displaying spectral purities better than 98%.

  4. Crystal Structure and Dynamics of K$_{2-x}$(NH$_{4}$)$_{x}$SeO$_{4}$ Mixed Crystals Studied by X-ray and Neutron Scattering

    CERN Document Server

    Smirnov, L S; Loose, A; Martínez-Sarrion, M L; Melnyk, G; Mestres, L; Natkaniec, I; Nowak, D; Pawlukojc, A; Wozniak, K; Zink, N

    2006-01-01

    The K$_{2-x}$(NH$_{4}$)$_{x}$SeO$_{4}$ mixed crystals have been studied by powder X-ray and neutron diffraction and inelastic incoherent neutron scattering in a wide temperature range from 300 to 16 K. No phase transition is observed in (NH$_{4}$)$_{2}$SeO$_{4}$ in the range from room temperature to 20 K. The reorientation potential barriers of ammonium ions in the K$_{2-x}$(NH$_{4}$)$_{x}$SeO$_{4}$ mixed crystals increase with the increasing concentration of ammonium ions.

  5. Crystal structure and dynamics of K2-x(NH4)xSeO4 mixed crystals studied by x-ray and neutron scattering

    International Nuclear Information System (INIS)

    Smirnov, L.S.; Natkaniec, I.; Loose, A.

    2006-01-01

    The K 2-x (NH 4 ) x SeO 4 mixed crystals have been studied by powder X-ray and neutron diffraction and inelastic incoherent neutron scattering in a wide temperature range from 300 to 16 K. No phase transition is observed in (NH 4 ) 2 SeO 4 in the range from room temperature to 20 K. The reorientation potential barriers of ammonium ions in the K 2-x (NH 4 ) x SeO 4 mixed crystals increase with the increasing concentration of ammonium ions

  6. Crystallization and preliminary X-ray crystallographic studies of succinic semialdehyde dehydrogenase from Streptococcus pyogenes

    International Nuclear Information System (INIS)

    Jang, Eun Hyuk; Lim, Jong Eun; Chi, Young Min; Lee, Ki Seog

    2012-01-01

    Succinic semialdehyde dehydrogenase (SSADH) from S. pyogenes was purified and crystallized. Crystals of native and NAD + -complexed SSADH diffracted to resolutions of 1.6 and 1.7 Å, respectively. Succinic semialdehyde dehydrogenase (SSADH) plays a critical role in the metabolism of the inhibitory neurotransmitter γ-aminobutyric acid (GABA) and catalyzes the NAD(P) + -coupled oxidation of succinic semialdehyde (SSA) to succinic acid (SA). SSADH from Streptococcus pyogenes has been purified and crystallized as the apoenzyme and in a complex with NAD + . The crystals of native and NAD + -complexed SSADH diffracted to resolutions of 1.6 and 1.7 Å, respectively, using a synchrotron-radiation source. Both crystals belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 93.3, b = 100.3, c = 105.1 Å for the native crystal and a = 93.3, b = 100.3, c = 105.0 Å for the complex crystal. Preliminary molecular replacement confirmed the presence of one dimer in both crystals, corresponding to a Matthews coefficient (V M ) of 2.37 Å 3 Da −1 and a solvent content of 48.0%

  7. Crystallization and preliminary X-ray studies of recombinant amylosucrase from Neisseria polysaccharea

    DEFF Research Database (Denmark)

    Skov, L K; Mirza, Osman Asghar; Henriksen, A

    2000-01-01

    Recombinant amylosucrase from Neisseria polysaccharea was crystallized by the vapour-diffusion procedure in the presence of polyethylene glycol 6000. The crystals belong to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 95.7, b = 117.2, c = 62.1 A, and diffract to 1.6 A re...

  8. Cationic metal complex, carbonatobis(1,10-phenanthroline)cobalt(III) as anion receptor: Synthesis, characterization, single crystal X-ray structure and packing analysis of [Co(phen) 2CO 3](3,5-dinitrobenzoate)·5H 2O

    Science.gov (United States)

    Sharma, Raj Pal; Singh, Ajnesh; Brandão, Paula; Felix, Vitor; Venugopalan, Paloth

    2009-03-01

    To explore the potential of [Co(phen) 2CO 3] + as anion receptor, red coloured single crystals of [Co(phen) 2CO 3](dnb)·5H 2O (dnb = 3,5-dinitrobenzoate) were obtained by recrystallizing the red microcrystalline product synthesised by the reaction of carbonatobis (1,10-phenanthroline)cobalt(III)chloride with sodium salt of 3,5-dinitrobenzoic acid in aqueous medium (1:1 molar ratio). The newly synthesized complex salt has been characterized by elemental analysis, spectroscopic studies (IR, UV/visible, 1H and 13C NMR), solubility and conductance measurements. The complex salt crystallizes in the triclinic crystal system with space group P1¯, having the cell dimensions a = 10.3140(8), b = 12.2885(11), c = 12.8747(13), α = 82.095(4), β = 85.617(4), γ = 79.221(4)°, V = 1585.6(2) Å 3, Z = 2. Single crystal X-ray structure determination revealed ionic structure consisting of cationic carbonatobis(1,10-phenanthroline)cobalt(III), dnb anion and five lattice water molecule. In the complex cation [Co(phen) 2CO 3] +, the cobalt(III) is bonded to four nitrogen atoms, originating from two phenanthroline ligands and two oxygen atoms from the bidentate carbonato group showing an octahedral geometry around cobalt(III) center. Supramolecular networks between ionic groups [ CHphen+⋯Xanion-] by second sphere coordination i.e. C sbnd H⋯O (benzoate), C sbnd H⋯O (nitro), C sbnd H⋯O (water) besides electrostatic forces of attraction alongwith π-π interactions stabilize the crystal lattice.

  9. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of bacterioferritin A from Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, Vibha [Department of Biochemistry, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021 (India); Gupta, Rakesh K. [Department of Biochemistry, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021 (India); Ram Lal Anand College, University of Delhi, Benito Juarez Road, New Delhi 110021 (India); Khare, Garima [Department of Biochemistry, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021 (India); Salunke, Dinakar M. [National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi 110067 (India); Tyagi, Anil K., E-mail: aniltyagi@south.du.ac.in [Department of Biochemistry, University of Delhi South Campus, Benito Juarez Road, New Delhi 110021 (India)

    2008-05-01

    The cloning, purification and crystallization of a bacterioferritin from M. tuberculosis together with preliminary X-ray characterization of its crystals are reported. Bacterioferritins (Bfrs) comprise a subfamily of the ferritin superfamily of proteins that play an important role in bacterial iron storage and homeostasis. Bacterioferritins differ from ferritins in that they have additional noncovalently bound haem groups. To assess the physiological role of this subfamily of ferritins, a greater understanding of the structural details of bacterioferritins from various sources is required. The gene encoding bacterioferritin A (BfrA) from Mycobacterium tuberculosis was cloned and expressed in Escherichia coli. The recombinant protein product was purified by affinity chromatography on a Strep-Tactin column and crystallized with sodium chloride as a precipitant at pH 8.0 using the vapour-diffusion technique. The crystals diffracted to 2.1 Å resolution and belonged to space group P4{sub 2}, with unit-cell parameters a = 123.0, b = 123.0, c = 174.6 Å.

  10. Dynamics of mineral crystallization from precipitated slab-derived fluid phase: first in situ synchrotron X-ray measurements

    Science.gov (United States)

    Malaspina, Nadia; Alvaro, Matteo; Campione, Marcello; Wilhelm, Heribert; Nestola, Fabrizio

    2015-03-01

    Remnants of the fluid phase at ultrahigh pressure (UHP) in subduction environments may be preserved as primary multiphase inclusions in UHP minerals. The mode of crystallization of daughter minerals during precipitation within the inclusion and/or the mechanism of interaction between the fluid at supercritical conditions and the host mineral are still poorly understood from a crystallographic point of view. A case study is represented by garnet-orthopyroxenites from the Maowu Ultramafic Complex (China) deriving from harzburgite precursors metasomatized at ~4 GPa, 750 °C by a silica- and incompatible trace element-rich fluid phase. This metasomatism produced poikilitic orthopyroxene and inclusion-rich garnet porphyroblasts. Solid multiphase primary inclusions in garnet display a size within a few tens of micrometres and negative crystal shapes. Infilling minerals (spinel: 10-20 vol%; amphibole, chlorite, talc, mica: 80-90 vol%) occur with constant volume proportions and derive from trapped solute-rich aqueous fluids. To constrain the possible mode of precipitation of daughter minerals, we performed for the first time a single-crystal X-ray diffraction experiment by synchrotron radiation at Diamond Light Source. In combination with electron probe microanalyses, this measurement allowed the unique identification of each mineral phase and reciprocal orientations. We demonstrated the epitaxial relationship between spinel and garnet and between some hydrous minerals. Such information is discussed in relation to the physico-chemical aspects of nucleation and growth, shedding light on the mode of mineral crystallization from a fluid phase trapped at supercritical conditions.

  11. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of bacterioferritin A from Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Gupta, Vibha; Gupta, Rakesh K.; Khare, Garima; Salunke, Dinakar M.; Tyagi, Anil K.

    2008-01-01

    The cloning, purification and crystallization of a bacterioferritin from M. tuberculosis together with preliminary X-ray characterization of its crystals are reported. Bacterioferritins (Bfrs) comprise a subfamily of the ferritin superfamily of proteins that play an important role in bacterial iron storage and homeostasis. Bacterioferritins differ from ferritins in that they have additional noncovalently bound haem groups. To assess the physiological role of this subfamily of ferritins, a greater understanding of the structural details of bacterioferritins from various sources is required. The gene encoding bacterioferritin A (BfrA) from Mycobacterium tuberculosis was cloned and expressed in Escherichia coli. The recombinant protein product was purified by affinity chromatography on a Strep-Tactin column and crystallized with sodium chloride as a precipitant at pH 8.0 using the vapour-diffusion technique. The crystals diffracted to 2.1 Å resolution and belonged to space group P4 2 , with unit-cell parameters a = 123.0, b = 123.0, c = 174.6 Å

  12. Protein preparation, crystallization and preliminary X-ray crystallographic analysis of SMU.961 protein from the caries pathogen Streptococcus mutans

    International Nuclear Information System (INIS)

    Gao, Xiong-Zhuo; Li, Lan-Fen; Su, Xiao-Dong; Zhao, XiaoJun; Liang, Yu-He

    2007-01-01

    The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni 2+ -chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°

  13. Protein preparation, crystallization and preliminary X-ray crystallographic analysis of SMU.961 protein from the caries pathogen Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Xiong-Zhuo [Institute for Nanobiomedical Technology and Membrane Biology, West China Hospital, Sichuan University, Chengdu 610065, Sichuan (China); National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Li, Lan-Fen; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Zhao, XiaoJun, E-mail: zhaoxj@scu.edu.cn [Institute for Nanobiomedical Technology and Membrane Biology, West China Hospital, Sichuan University, Chengdu 610065, Sichuan (China); Liang, Yu-He, E-mail: zhaoxj@scu.edu.cn [National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871 (China); Institute for Nanobiomedical Technology and Membrane Biology, West China Hospital, Sichuan University, Chengdu 610065, Sichuan (China)

    2007-10-01

    The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.

  14. Complex assembly, crystallization and preliminary X-ray crystallographic analysis of the human Rod–Zwilch–ZW10 (RZZ) complex

    International Nuclear Information System (INIS)

    Altenfeld, Anika; Wohlgemuth, Sabine; Wehenkel, Annemarie; Vetter, Ingrid R.; Musacchio, Andrea

    2015-01-01

    The 800 kDa complex of the human Rod, Zwilch and ZW10 proteins (the RZZ complex) was reconstituted in insect cells, purified, crystallized and subjected to preliminary X-ray diffraction analysis. The spindle-assembly checkpoint (SAC) monitors kinetochore–microtubule attachment during mitosis. In metazoans, the three-subunit Rod–Zwilch–ZW10 (RZZ) complex is a crucial SAC component that interacts with additional SAC-activating and SAC-silencing components, including the Mad1–Mad2 complex and cytoplasmic dynein. The RZZ complex contains two copies of each subunit and has a predicted molecular mass of ∼800 kDa. Given the low abundance of the RZZ complex in natural sources, its recombinant reconstitution was attempted by co-expression of its subunits in insect cells. The RZZ complex was purified to homogeneity and subjected to systematic crystallization attempts. Initial crystals containing the entire RZZ complex were obtained using the sitting-drop method and were subjected to optimization to improve the diffraction resolution limit. The crystals belonged to space group P3 1 (No. 144) or P3 2 (No. 145), with unit-cell parameters a = b = 215.45, c = 458.7 Å, α = β = 90.0, γ = 120.0°

  15. Cloning, expression, purification, crystallization and X-ray crystallographic analysis of recombinant human C1ORF123 protein.

    Science.gov (United States)

    Rahaman, Siti Nurulnabila A; Mat Yusop, Jastina; Mohamed-Hussein, Zeti-Azura; Ho, Kok Lian; Teh, Aik-Hong; Waterman, Jitka; Ng, Chyan Leong

    2016-03-01

    C1ORF123 is a human hypothetical protein found in open reading frame 123 of chromosome 1. The protein belongs to the DUF866 protein family comprising eukaryote-conserved proteins with unknown function. Recent proteomic and bioinformatic analyses identified the presence of C1ORF123 in brain, frontal cortex and synapses, as well as its involvement in endocrine function and polycystic ovary syndrome (PCOS), indicating the importance of its biological role. In order to provide a better understanding of the biological function of the human C1ORF123 protein, the characterization and analysis of recombinant C1ORF123 (rC1ORF123), including overexpression and purification, verification by mass spectrometry and a Western blot using anti-C1ORF123 antibodies, crystallization and X-ray diffraction analysis of the protein crystals, are reported here. The rC1ORF123 protein was crystallized by the hanging-drop vapor-diffusion method with a reservoir solution comprised of 20% PEG 3350, 0.2 M magnesium chloride hexahydrate, 0.1 M sodium citrate pH 6.5. The crystals diffracted to 1.9 Å resolution and belonged to an orthorhombic space group with unit-cell parameters a = 59.32, b = 65.35, c = 95.05 Å. The calculated Matthews coefficient (VM) value of 2.27 Å(3) Da(-1) suggests that there are two molecules per asymmetric unit, with an estimated solvent content of 45.7%.

  16. Complex assembly, crystallization and preliminary X-ray crystallographic analysis of the human Rod–Zwilch–ZW10 (RZZ) complex

    Energy Technology Data Exchange (ETDEWEB)

    Altenfeld, Anika; Wohlgemuth, Sabine [Max Planck Institute of Molecular Physiology, Otto Hahn Strasse 11, 44227 Dortmund (Germany); Wehenkel, Annemarie [Institut Curie, CNRS UMR 3348/INSERM U1005, Bâtiment 110, Centre Universitaire, 91405 Orsay CEDEX (France); Vetter, Ingrid R. [Max Planck Institute of Molecular Physiology, Otto Hahn Strasse 11, 44227 Dortmund (Germany); Musacchio, Andrea, E-mail: andrea.musacchio@mpi-dortmund.mpg.de [Max Planck Institute of Molecular Physiology, Otto Hahn Strasse 11, 44227 Dortmund (Germany); University of Duisburg-Essen, Universitätstrasse 1, 45141 Essen (Germany)

    2015-03-20

    The 800 kDa complex of the human Rod, Zwilch and ZW10 proteins (the RZZ complex) was reconstituted in insect cells, purified, crystallized and subjected to preliminary X-ray diffraction analysis. The spindle-assembly checkpoint (SAC) monitors kinetochore–microtubule attachment during mitosis. In metazoans, the three-subunit Rod–Zwilch–ZW10 (RZZ) complex is a crucial SAC component that interacts with additional SAC-activating and SAC-silencing components, including the Mad1–Mad2 complex and cytoplasmic dynein. The RZZ complex contains two copies of each subunit and has a predicted molecular mass of ∼800 kDa. Given the low abundance of the RZZ complex in natural sources, its recombinant reconstitution was attempted by co-expression of its subunits in insect cells. The RZZ complex was purified to homogeneity and subjected to systematic crystallization attempts. Initial crystals containing the entire RZZ complex were obtained using the sitting-drop method and were subjected to optimization to improve the diffraction resolution limit. The crystals belonged to space group P3{sub 1} (No. 144) or P3{sub 2} (No. 145), with unit-cell parameters a = b = 215.45, c = 458.7 Å, α = β = 90.0, γ = 120.0°.

  17. X-ray photoelectron spectra and electronic structure of quasi-one-dimensional SbSeI crystals

    Directory of Open Access Journals (Sweden)

    J.Grigas

    2007-01-01

    Full Text Available The paper presents the X-ray photoelectron spectra (XPS of the valence band (VB and of the principal core levels from the (110 and (001 crystal surfaces for the quasi-one-dimensional high permittivity SbSeI single crystal isostructural to ferroelectric SbSI. The XPS were measured with monochromatized Al Ka radiation in the energy range of 0-1400 eV at room temperature. The VB is located from 1.6 to 20 eV below the Fermi level. Experimental energies of the VB and core levels are compared with the results of theoretical ab initio calculations of the molecular model of the SbSeI crystal. The electronic structure of the VB is revealed. Shifts in the core-level binding energies of surface atoms relative to bulk ones, which show a dependency on surface crystallography, have been observed. The chemical shifts of the core levels (CL in the SbSeI crystal for the Sb, I and Se states are obtained.

  18. Expression, purification, crystallization and preliminary X-ray analysis of the RecQ helicase catalytic core from Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Chen, Sheng-Chia; Huang, Chi-Hung; Yang, Chia-Shin; Chang, Chi-Huang; Kuan, Shu-Min; Chan, Nei-Li; Chen, Yeh

    2012-01-01

    The DrRecQ helicase catalytic core has been crystallized to a resolution of 2.9 Å. The determination of its structure will lead to structural and functional insight into the DNA repair mechanism. The RecQ proteins are a highly conserved group of DNA helicases which play crucial roles in the maintenance of genome stability. DrRecQ from the radioresistant bacterium Deinococcus radiodurans is a special member of the RecQ family because it contains three Helicase-and-RNase-D-C-terminal (HRDC) domains at the C-terminus. The helicase catalytic core is essential for ATPase and DNA-unwinding activities. In this work, the helicase catalytic core of DrRecQ was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour diffusion method and X-ray diffraction data were collected to 2.9 Å resolution. The crystals belong to space group P2 1 2 1 2 1 , with unit-cell parameters a = 84.75, b = 95.61, c = 183.83 Å

  19. Purification, crystallization and preliminary X-ray analysis of 3-hydroxy-3-methylglutaryl-coenzyme A reductase of Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Zhang, Liping; Feng, Lingling; Zhou, Li; Gui, Jie; Wan, Jian; Hu, Xiaopeng

    2010-01-01

    3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase of Streptococcus pneumoniae has been cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. Class II 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductases are potential targets for novel antibiotic development. In order to obtain a precise structural model for use in virtual screening and inhibitor design, HMG-CoA reductase of Streptococcus pneumoniae was cloned, overexpressed and purified to homogeneity using Ni–NTA affinity chromatography. Crystals were obtained using the hanging-drop vapour-diffusion method. A complete data set was collected from a single frozen crystal on a home X-ray source. The crystal diffracted to 2.3 Å resolution and belonged to the orthorhombic space group C222 1 , with unit-cell parameters a = 773.4836, b = 90.3055, c = 160.5592 Å, α = β = γ = 90°. Assuming the presence of two molecules in the asymmetric unit, the solvent content was estimated to be 54.1% (V M = 2.68 Å 3 Da −1 )

  20. Crystallization and preliminary X-ray crystallographic analysis of SMU.412c protein from the caries pathogen Streptococcus mutans

    International Nuclear Information System (INIS)

    Ye, Zhao-Yang; Hou, Qiao-Ming; Li, Lan-Fen; Su, Xiao-Dong

    2009-01-01

    Crystallization of SMU.412c protein from the caries pathogen Streptococcus mutans can easily appear in the condition 2.8 M sodium acetate pH 7.0 and its crystal belongs to space group P4 1 2 1 2. The smu.412c gene encodes a putative histidine triad-like protein (SMU.412c) with 139 residues that is involved in cell-cycle regulation in Streptococcus mutans. The gene was cloned into the expression vector pET28a and subsequently expressed in Escherichia coli strain BL21 (DE3) to give a substantially soluble form of SMU.412c with a His 6 tag at its N-terminus. The recombinant protein was purified to homogeneity in a two-step procedure involving Ni 2+ -chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction were obtained using the sitting-drop vapour-diffusion method and diffracted to 1.8 Å resolution on beamline BL6A at Photon Factory, Tsukuba, Japan. The crystal belonged to space group P4 1 2 1 2, with unit-cell parameters a = b = 53.5, c = 141.1 Å

  1. Synthesis, X-ray crystallography, spectroscopy, electrochemistry, thermal and kinetic study of uranyl Schiff base complexes

    Czech Academy of Sciences Publication Activity Database

    Asadi, Z.; Golzard, F.; Eigner, Václav; Dušek, Michal

    2013-01-01

    Roč. 66, č. 20 (2013), s. 3629-3646 ISSN 0095-8972 R&D Projects: GA ČR(CZ) GAP204/11/0809 Institutional support: RVO:68378271 Keywords : X-ray crystallography * uranyl Schiff base complex * kinetics of thermal decomposition * cyclic voltammetry * kinetics and mechanism Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.224, year: 2013

  2. Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

    Energy Technology Data Exchange (ETDEWEB)

    Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp [Research Faculty of Agriculture, Hokkaido University, Sapporo, Hokkaido 060-8589 (Japan); Unno, Hideaki [Faculty of Engineering, Nagasaki University, Bunkyo-machi, Nagasaki 852-8521 (Japan); Okuyama, Masayuki; Mori, Haruhide [Research Faculty of Agriculture, Hokkaido University, Sapporo, Hokkaido 060-8589 (Japan); Nakada, Toshitaka [Faculty of Science and Engineering, Ritsumeikan University, Kusatsu, Shiga 525-8577 (Japan); Matsuura, Yoshiki [Institute for Protein Research, Osaka University, Suita, Osaka 565-0871 (Japan); Kimura, Atsuo [Research Faculty of Agriculture, Hokkaido University, Sapporo, Hokkaido 060-8589 (Japan)

    2007-09-01

    Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, c = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.

  3. Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

    International Nuclear Information System (INIS)

    Saburi, Wataru; Hondoh, Hironori; Unno, Hideaki; Okuyama, Masayuki; Mori, Haruhide; Nakada, Toshitaka; Matsuura, Yoshiki; Kimura, Atsuo

    2007-01-01

    Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 72.72, b = 86.47, c = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal

  4. Crystallization and preliminary X-ray diffraction analysis of phosphoglycerate kinase from Streptococcus pneumoniae

    International Nuclear Information System (INIS)

    Bernardo-García, Noelia; Bartual, Sergio G.; Fulde, Marcus; Bergmann, Simone; Hermoso, Juan A.

    2011-01-01

    Phosphoglycerate kinase, a two-domain enzyme involved in the glycolytic pathway, has been crystallized. Both the N-terminal domain and a ternary complex of the full-length enzyme with substrates were crystallized by the sitting-drop vapour-diffusion method. Inclusion of the substrates was critical in order to obtain crystals of the full-length protein. Phosphoglycerate kinase (PGK) is a widespread two-domain enzyme that plays a critical role in the glycolytic pathway. Several glycolytic enzymes from streptococci have been identified as surface-exposed proteins that are involved in streptococcal virulence by their ability to bind host proteins. This binding allows pneumococcal cells to disseminate through the epithelial and endothelial layers. Crystallization of PGK from Streptococcus pneumoniae yielded orthorhombic crystals (space group I222, unit-cell parameters a = 62.73, b = 75.38, c = 83.63 Å). However, the unit cell of these crystals was not compatible with the presence of full-length PGK. Various analytical methods showed that only the N-terminal domain of PGK was present in the I222 crystals. The ternary complex of PGK with adenylyl imidodiphosphate (AMP-PNP) and 3-phospho-d-glycerate (3PGA) produced monoclinic crystals (space group P2 1 , unit-cell parameters a = 40.35, b = 78.23, c = 59.03 Å, β = 96.34°). Molecular replacement showed that this new crystal form contained full-length PGK, thereby indicating the relevance of including substrates in order to avoid proteolysis during the crystallization process

  5. 1.55 Å resolution X-ray crystal structure of Rv3902c from Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Reddy, Bharat G.; Moates, Derek B.; Kim, Heung-Bok; Green, Todd J.; Kim, Chang-Yub; Terwilliger, Thomas C.; DeLucas, Lawrence J.

    2014-01-01

    The 1.55 Å resolution X-ray crystal structure of Rv3902c from M. tuberculosis reveals a novel fold. The crystallographic structure of the Mycobacterium tuberculosis (TB) protein Rv3902c (176 residues; molecular mass of 19.8 kDa) was determined at 1.55 Å resolution. The function of Rv3902c is unknown, although several TB genes involved in bacterial pathogenesis are expressed from the operon containing the Rv3902c gene. The unique structural fold of Rv3902c contains two domains, each consisting of antiparallel β-sheets and α-helices, creating a hand-like binding motif with a small binding pocket in the palm. Structural homology searches reveal that Rv3902c has an overall structure similar to that of the Salmonella virulence-factor chaperone InvB, with an r.m.s.d. for main-chain atoms of 2.3 Å along an aligned domain

  6. Performances of a bent-crystal spectrometer adapted to resonant x-ray emission measurements on gas-phase samples

    Energy Technology Data Exchange (ETDEWEB)

    Journel, Loiec; El Khoury, Lara; Marin, Thierry; Guillemin, Renaud; Carniato, Stephane; Avila, Antoine; Delaunay, Renaud; Hague, Coryn F.; Simon, Marc [Laboratoire de Chimie Physique-Matiere et Rayonnement, UPMC University of Paris 06, UMR 7614, F-75005 Paris (France) and Laboratoire de Chimie Physique-Matiere et Rayonnement, CNRS, UMR 7614, F-75005 Paris (France)

    2009-09-15

    We describe a bent-crystal spectrometer adapted to measure x-ray emission resulting from core-level excitation of gas-phase molecules in the 0.8-8 keV energy range. The spectrometer is based on the Johann principle, and uses a microfocused photon beam to provide high-resolution (resolving power of {approx}7500). A gas cell was designed to hold a high-pressure (300 mbar) sample of gas while maintaining a high vacuum (10{sup -9} mbar) in the chamber. The cell was designed to optimize the counting rate (2000 cts/s at the maximum of the Cl K{alpha} emission line), while minimizing self-absorption. Example of the K{alpha} emission lines of CH{sub 3}Cl molecules is presented to illustrate the capabilities of this new instrument.

  7. 1.55 Å resolution X-ray crystal structure of Rv3902c from Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, Bharat G.; Moates, Derek B. [University of Alabama at Birmingham, 1025 18th Street South, Birmingham, AL 35233 (United States); Kim, Heung-Bok [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Green, Todd J. [University of Alabama at Birmingham, 1025 18th Street South, Birmingham, AL 35233 (United States); Kim, Chang-Yub; Terwilliger, Thomas C. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); DeLucas, Lawrence J., E-mail: duke2@uab.edu [University of Alabama at Birmingham, 1025 18th Street South, Birmingham, AL 35233 (United States)

    2014-03-25

    The 1.55 Å resolution X-ray crystal structure of Rv3902c from M. tuberculosis reveals a novel fold. The crystallographic structure of the Mycobacterium tuberculosis (TB) protein Rv3902c (176 residues; molecular mass of 19.8 kDa) was determined at 1.55 Å resolution. The function of Rv3902c is unknown, although several TB genes involved in bacterial pathogenesis are expressed from the operon containing the Rv3902c gene. The unique structural fold of Rv3902c contains two domains, each consisting of antiparallel β-sheets and α-helices, creating a hand-like binding motif with a small binding pocket in the palm. Structural homology searches reveal that Rv3902c has an overall structure similar to that of the Salmonella virulence-factor chaperone InvB, with an r.m.s.d. for main-chain atoms of 2.3 Å along an aligned domain.

  8. Synthesis of hydroxyapatite and structural refinement by X-ray diffraction; Sintese da hidroxiapatita e refinamento estrutural por difracao de raios-X

    Energy Technology Data Exchange (ETDEWEB)

    Araujo, Jorge Correa de [Universidade do Estado do Rio de Janeiro (UERJ), Sao Goncalo, RJ (Brazil). Faculdade de Formacao de Professores; Sena, Lidia [Instituto Nacional de Metrologia, Normalizacao e Qualidade Industrial (INMETRO), Duque de Caxias, RJ (Brazil). Div. de Metrologia de Materiais; Bastos, Ivan Napoleao [Universidade do Estado do Rio de Janeiro (UERJ), Nova Friburgo, RJ (Brazil). Inst. Politecnico]. E-mail: jcaraujo@iprj.uerj.br; Soares, Gloria Dulce de Almeida [Universidade Federal do Rio de Janeiro (UFRJ), RJ (Brazil)

    2007-07-01

    A sample of hydroxyapatite was synthesized and its crystalline structure was analyzed by X-ray diffraction by means of the Rietveld method. Two functions were used to fit the peak profiles, modified Voigt (TCHZ) and Pearson VII. The occupational factors and lattice parameters obtained by both models show that the sample does not contain relevant cationic substitutions. The interatomic distances from Ca1 to oxygens O1, O2 and O3 were adequate for a pure hydroxyapatite without defect at site Ca1. Besides, the use of multiple lines in planes (300) and (002) associated with the model Pearson VII resulted in good agreement with the TCHZ model with respect to the size-strain effects with an ellipsoidal shape of crystallites. In conclusion, the procedures adopted in the synthesis of hydroxyapatite produced a pure and crystalline material. The experimental results of transmission electron microscopy confirmed the predicted shape of crystals. (author)

  9. Structure-based design, synthesis, X-ray studies, and biological evaluation of novel HIV-1 protease inhibitors containing isophthalamide-derived P2-ligands.

    Science.gov (United States)

    Ghosh, Arun K; Takayama, Jun; Kassekert, Luke A; Ella-Menye, Jean-Rene; Yashchuk, Sofiya; Agniswamy, Johnson; Wang, Yuan-Fang; Aoki, Manabu; Amano, Masayuki; Weber, Irene T; Mitsuya, Hiroaki

    2015-11-01

    We describe the design, synthesis and biological evaluation of a series of novel HIV-1 protease inhibitors bearing isophthalamide derivatives as the P2-P3 ligands. We have investigated a range of acyclic and heterocyclic amides as the extended P2-P3 ligands. These inhibitors displayed good to excellent HIV-1 protease inhibitory activity. Also, a number of inhibitors showed very good antiviral activity in MT cells. Compound 5n has shown an enzyme Ki of 0.17 nM and antiviral IC50 of 14 nM. An X-ray crystal structure of inhibitor 5o-bound to HIV-1 protease was determined at 1.11Å resolution. This structure revealed important molecular insight into the inhibitor-HIV-1 protease interactions in the active site. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Solid state characterization and crystal structure from X-ray powder diffraction of two polymorphic forms of ranitidine base.

    Science.gov (United States)

    de Armas, Héctor Novoa; Peeters, Oswald M; Blaton, Norbert; Van Gyseghem, Elke; Martens, Johan; Van Haele, Gerrit; Van Den Mooter, Guy

    2009-01-01

    Ranitidine hydrochloride (RAN-HCl), a known anti-ulcer drug, is the product of reaction between HCl and ranitidine base (RAN-B). RAN-HCl has been extensively studied; however this is not the case of the RAN-B. The solid state characterization of RAN-B polymorphs has been carried out using different analytical techniques (microscopy, thermal analysis, Fourier transform infrared spectrometry in the attenuated total reflection mode, (13)C-CPMAS-NMR spectroscopy and X-ray powder diffraction). The crystal structures of RAN-B form I and form II have been determined using conventional X-ray powder diffraction in combination with simulated annealing and whole profile pattern matching, and refined using rigid-body Rietveld refinement. RAN-B form I is a monoclinic polymorph with cell parameters: a = 7.317(2), b = 9.021(2), c = 25.098(6) A, beta = 95.690(1) degrees and space group P2(1)/c. The form II is orthorhombic: a = 31.252(4), b = 13.052(2), c = 8.0892(11) A with space group Pbca. In RAN-B polymorphs, the nitro group is involved in a strong intramolecular hydrogen bond responsible for the existence of a Z configuration in the enamine portion of the molecules. A tail to tail packing motif can be denoted via intermolecular hydrogen bonds. The crystal structures of RAN-B forms are compared to those of RAN-HCl polymorphs. RAN-B polymorphs are monotropic polymorphic pairs. (c) 2008 Wiley-Liss, Inc. and the American Pharmacists Association

  11. Bulk Crystal Growth, and High-Resolution X-ray Diffraction Results of LiZnAs Semiconductor Material

    Science.gov (United States)

    Montag, Benjamin W.; Reichenberger, Michael A.; Sunder, Madhana; Ugorowski, Philip B.; Nelson, Kyle A.; Henson, Luke C.; McGregor, Douglas S.

    2017-08-01

    LiZnAs is being explored as a candidate for solid-state neutron detectors. The compact form, solid-state device would have greater efficiency than present day gas-filled 3He and 10BF3 detectors. Devices fabricated from LiZnAs having either natural Li (nominally 7.5% 6Li) or enriched 6Li (usually 95% 6Li) as constituent atoms may provide a material for compact high efficiency neutron detectors. The 6Li( n, t)4He reaction yields a total Q-value of 4.78 MeV, an energy larger than that of the 10B reaction, which can easily be identified above background radiations. LiZnAs material was synthesized by preparing equimolar portions of Li, Zn, and As sealed under vacuum (10-6 Torr) in quartz ampoules lined with boron nitride and subsequently reacted in a compounding furnace (Montag et al. in J Cryst Growth 412:103, 2015). The raw synthesized LiZnAs was purified by a static vacuum sublimation in quartz (Montag et al. in J Cryst Growth 438:99, 2016). Bulk crystalline LiZnAs ingots were grown from the purified material with a high-temperature Bridgman-style growth process described here. One of the largest LiZnAs ingots harvested was 9.6 mm in diameter and 4.2 mm in length. Samples were harvested from the ingot and were characterized for crystallinity using a Bruker AXS Inc. D8 AXS Inc. D2 CRYSO, energy dispersive x-ray diffractometer, and a Bruker AXS Inc. D8 DISCOVER, high-resolution x-ray diffractometer equipped with molybdenum radiation, Gobel mirror, four bounce germanium monochromator and a scintillation detector. The primary beam divergence was determined to be 0.004°, using a single crystal Si standard. The x-ray based characterization revealed that the samples nucleated in the (110) direction and a high-resolution open detector rocking curve recorded on the (220) LiZnAs yielded a full width at half maximum (FWHM) of 0.235°. Sectional pole figures using off-axis reflections of the (211) LiZnAs confirmed in-plane ordering, and also indicated the presence of multiple

  12. Structure-based design of potent HIV-1 protease inhibitors with modified P1-biphenyl ligands: synthesis, biological evaluation, and enzyme-inhibitor X-ray structural studies.

    Science.gov (United States)

    Ghosh, Arun K; Yu, Xufen; Osswald, Heather L; Agniswamy, Johnson; Wang, Yuan-Fang; Amano, Masayuki; Weber, Irene T; Mitsuya, Hiroaki

    2015-07-09

    We report the design, synthesis, X-ray structural studies, and biological evaluation of a novel series of HIV-1 protease inhibitors. We designed a variety of functionalized biphenyl derivatives to make enhanced van der Waals interactions in the S1 subsite of HIV-1 protease. These biphenyl derivatives were conveniently synthesized using a Suzuki-Miyaura cross-coupling reaction as the key step. We examined the potential of these functionalized biphenyl-derived P1 ligands in combination with 3-(S)-tetrahydrofuranyl urethane and bis-tetrahydrofuranyl urethane as the P2 ligands. Inhibitor 21e, with a 2-methoxy-1,1'-biphenyl derivative as P1 ligand and bis-THF as the P2 ligand, displayed the most potent enzyme inhibitory and antiviral activity. This inhibitor also exhibited potent activity against a panel of multidrug-resistant HIV-1 variants. A high resolution X-ray crystal structure of related Boc-derivative 17a-bound HIV-1 protease provided important molecular insight into the ligand-binding site interactions of the biphenyl core in the S1 subsite of HIV-1 protease.

  13. Severe Acute Respiratory Syndrome-Coronavirus Papain-Like Novel Protease Inhibitors: Design, Synthesis, Protein-Ligand X-ray Structure and Biological Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Ghosh, Arun K.; Takayama, Jun; Rao, Kalapala Venkateswar; Ratia, Kiira; Chaudhuri, Rima; Mulhearn, Debbie C.; Lee, Hyun; Nichols, Daniel B.; Baliji, Surendranath; Baker, Susan C.; Johnson, Michael E.; Mesecar, Andrew D. (Purdue); (UC); (UIC)

    2012-02-21

    The design, synthesis, X-ray crystal structure, molecular modeling, and biological evaluation of a series of new generation SARS-CoV PLpro inhibitors are described. A new lead compound 3 (6577871) was identified via high-throughput screening of a diverse chemical library. Subsequently, we carried out lead optimization and structure-activity studies to provide a series of improved inhibitors that show potent PLpro inhibition and antiviral activity against SARS-CoV infected Vero E6 cells. Interestingly, the (S)-Me inhibitor 15h (enzyme IC{sub 50} = 0.56 {mu}M; antiviral EC{sub 50} = 9.1 {mu}M) and the corresponding (R)-Me 15g (IC{sub 50} = 0.32 {mu}M; antiviral EC{sub 50} = 9.1 {mu}M) are the most potent compounds in this series, with nearly equivalent enzymatic inhibition and antiviral activity. A protein-ligand X-ray structure of 15g-bound SARS-CoV PLpro and a corresponding model of 15h docked to PLpro provide intriguing molecular insight into the ligand-binding site interactions.

  14. Crystallization and preliminary X-ray analysis of SDR-type pyridoxal dehydrogenase from Mesorhizobium loti.

    Science.gov (United States)

    Chu, Huy Nhat; Kobayashi, Jun; Yoshikane, Yu; Mikami, Bunzo; Yagi, Toshiharu

    2010-06-01

    Pyridoxal 4-dehydrogenase from Mesorhizobium loti MAFF303099 was overexpressed in Escherichia coli. The recombinant selenomethionine-substituted enzyme was purified and crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. Crystals grew in the presence of 0.45 mM NAD(+). The crystals diffracted to 2.9 A resolution and belonged to the monoclinic space group P2(1), with unit-cell parameters a = 86.20, b = 51.11, c = 91.73 A, beta = 89.36 degrees. The calculated V(M) values suggested that the asymmetric unit contained four molecules.

  15. Crystallization and preliminary X-ray characterization of prolyl tripeptidyl aminopeptidase from Porphyromonas gingivalis

    Energy Technology Data Exchange (ETDEWEB)

    Nakajima, Yoshitaka; Ito, Kiyoshi, E-mail: k-ito@net.nagasaki-u.ac.jp; Xu, Yue; Yamada, Nozomi; Onohara, Yuko; Ito, Takashi; Yoshimoto, Tadashi [Graduate School of Biomedical Sciences, Nagasaki University, Nagasaki 852-8521 (Japan)

    2005-12-01

    P. gingivalis prolyl tripeptidyl aminopeptidase has been crystallized by the vapour-diffusion method. Diffraction data have been collected and processed to 2.1 Å resolution. A recombinant form of prolyl tripeptidyl aminopeptidase from Porphyromonas gingivalis has been crystallized by the hanging-drop vapour-diffusion method using potassium sodium tartrate as a precipitating agent. The crystals belong to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = b = 149.4, c = 159.7 Å. The crystals are most likely to contain one subunit of a dimer in the asymmetric unit, with a V{sub M} value of 3.14 Å{sup 3} Da{sup −1}. Diffraction data were collected to 2.1 Å resolution using synchrotron radiation at the BL5 station of the Photon Factory.

  16. Crystallization and preliminary X-ray characterization of prolyl tripeptidyl aminopeptidase from Porphyromonas gingivalis

    International Nuclear Information System (INIS)

    Nakajima, Yoshitaka; Ito, Kiyoshi; Xu, Yue; Yamada, Nozomi; Onohara, Yuko; Ito, Takashi; Yoshimoto, Tadashi

    2005-01-01

    P. gingivalis prolyl tripeptidyl aminopeptidase has been crystallized by the vapour-diffusion method. Diffraction data have been collected and processed to 2.1 Å resolution. A recombinant form of prolyl tripeptidyl aminopeptidase from Porphyromonas gingivalis has been crystallized by the hanging-drop vapour-diffusion method using potassium sodium tartrate as a precipitating agent. The crystals belong to the hexagonal space group P6 3 22, with unit-cell parameters a = b = 149.4, c = 159.7 Å. The crystals are most likely to contain one subunit of a dimer in the asymmetric unit, with a V M value of 3.14 Å 3 Da −1 . Diffraction data were collected to 2.1 Å resolution using synchrotron radiation at the BL5 station of the Photon Factory

  17. Crystallization and preliminary X-ray diffraction analysis of the hyperthermophilic Sulfolobus solfataricus phosphotriesterase

    International Nuclear Information System (INIS)

    Elias, Mikael; Dupuy, Jérôme; Merone, Luigia; Lecomte, Claude; Rossi, Mosè; Masson, Patrick; Manco, Giuseppe; Chabriere, Eric

    2007-01-01

    A phosphotriesterase (PTE) from the hyperthermophilic archaeon S. solfataricus has been crystallized. Combined with biochemical and bioengineering studies, it is expected that the structure of this protein will provide insight into the natural function of the PTE family and provide important data for achieving an efficient organophosphate biodecontaminant. Organophosphates constitute the largest class of insecticides used worldwide and some of them are potent nerve agents. Consequently, organophosphate-degrading enzymes are of paramount interest as they could be used as bioscavengers and biodecontaminants. Phosphotriesterases (PTEs) are capable of hydrolyzing these toxic compounds with high efficiency. A distant and hyperthermophilic representative of the PTE family was cloned from the archeon Sulfolobus solfataricus MT4, overexpressed in Escherichia coli and crystallized; the crystals diffracted to 2.54 Å resolution. Owing to its exceptional thermostability, this PTE may be an excellent candidate for obtaining an efficient organophosphate biodecontaminant. Here, the crystallization conditions and data collection for the hyperthermophilic S. solfataricus PTE are reported

  18. Crystallization and preliminary X-ray diffraction studies of Murraya koenigii trypsin inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Shee, Chandan [Department of Biotechnology, Indian Institute of Technology Roorkee, Roorkee 247 667 (India); Singh, Tej P. [Department of Biophysics, All India Institute of Medical Sciences, New Delhi 100 029 (India); Kumar, Pravindra, E-mail: kumarfbs@iitr.ernet.in; Sharma, Ashwani K., E-mail: kumarfbs@iitr.ernet.in [Department of Biotechnology, Indian Institute of Technology Roorkee, Roorkee 247 667 (India)

    2007-04-01

    A Kunitz-type trypsin inhibitor purified from the seeds of Murraya koenigii has been crystallized by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitating agent. A Kunitz-type trypsin inhibitor purified from the seeds of Murraya koenigii has been crystallized by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitating agent. The crystals belong to the tetragonal space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 75.8, c = 150.9 Å. The crystals contain two molecules in the asymmetric unit with a V{sub M} value of 2.5 Å{sup 3} Da{sup −1}. Diffraction was observed to 2.65 Å resolution and a complete data set was collected to 2.9 Å resolution.

  19. Crystallization and preliminary X-ray analysis of four cysteine proteases from Ficus carica latex.

    Science.gov (United States)

    Haesaerts, Sarah; Rodriguez Buitrago, John Alexander; Loris, Remy; Baeyens-Volant, Danielle; Azarkan, Mohamed

    2015-04-01

    The latex of the common fig (Ficus carica) contains a mixture of at least five cysteine proteases commonly known as ficins (EC 3.4.22.3). Four of these proteases were purified to homogeneity and crystals were obtained in a variety of conditions. The four ficin (iso)forms appear in ten different crystal forms. All diffracted to better than 2.10 Å resolution and for each form at least one crystal form diffracted to 1.60 Å resolution or higher. Ficin (iso)forms B and C share a common crystal form, suggesting close sequence and structural similarity. The latter diffracted to a resolution of 1.20 Å and belonged to space group P3₁21 or P3₂21, with unit-cell parameters a = b = 88.9, c = 55.9 Å.

  20. Expression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae pseudopilin EpsH

    International Nuclear Information System (INIS)

    Raghunathan, Kannan; Vago, Frank S.; Ball, Terry; Yakubova, Nafissa; Grindem, David; Wedemeyer, William J.; Arvidson, Dennis N.

    2009-01-01

    Recombinant V. cholerae EpsH has been expressed, purified and crystallized. The crystals diffracted to 1.71 Å resolution. EpsH is a minor pseudopilin protein of the Vibrio cholerae type II secretion system. A truncated form of EpsH with a C-terminal noncleavable His tag was constructed and expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 1.71 Å resolution. The crystals belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 53.39, b = 71.11, c = 84.64 Å. There were two protein molecules in the asymmetric unit, which gave a Matthews coefficient V M of 2.1 Å 3 Da −1 , corresponding to 41.5% solvent content