Arabidopsis CDS blastp result: AK242585 [KOME

Lifescience Database Archive (English)

Full Text Available AK242585 J090010M20 At3g03050.1 68416.m00301 cellulose synthase family protein (CslD3) similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose syntha

Arabidopsis CDS blastp result: AK242601 [KOME

Lifescience Database Archive (English)

Full Text Available AK242601 J090014G03 At3g03050.1 68416.m00301 cellulose synthase family protein (CslD3) similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose syntha

Arabidopsis CDS blastp result: AK242890 [KOME

Lifescience Database Archive (English)

Full Text Available AK242890 J090079L19 At3g03050.1 68416.m00301 cellulose synthase family protein (CslD3) similar to cellulose... synthase catalytic subunit gi:2827143 from [Arabidopsis thaliana], cellulose syntha

Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles.

Science.gov (United States)

Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

2002-11-01

In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

DEFF Research Database (Denmark)

Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

2007-01-01

from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

Natural Variation in Monoterpene Synthesis in Kiwifruit: Transcriptional Regulation of Terpene Synthases by NAC and ETHYLENE-INSENSITIVE3-Like Transcription Factors1

Science.gov (United States)

Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.

2015-01-01

Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633

Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

Science.gov (United States)

Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

2012-06-01

Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

Beta-Glucan Synthase Gene Expression in Pleurotus sp

International Nuclear Information System (INIS)

Azhar Mohamad; Nie, H.J.

2016-01-01

Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

Science.gov (United States)

Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

2017-11-03

Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

Directory of Open Access Journals (Sweden)

Bua-In Saowaluck

2014-01-01

Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

Molecular cloning of a novel GSK3/shaggy-like gene from Triticum ...

African Journals Online (AJOL)

The deduced amino acid sequence showed a high homology with shaggy-like kinases from Triticum aestivum, Zea mays, Trifolium repens, Nicotine tabacum, Medicago sativa and Arabidopsis thaliana; therefore, the gene was named TmGSK1 (Triticum monococcum Glycogen Synthase Kinase 1,GenBank Accession No.

Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

Science.gov (United States)

Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

2015-01-01

Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

Directory of Open Access Journals (Sweden)

Mirian Perez Maluf

2009-01-01

Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

Science.gov (United States)

Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

2014-01-01

Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

Science.gov (United States)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

Science.gov (United States)

Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

2009-02-01

Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

Directory of Open Access Journals (Sweden)

Mariela V Catone

Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

Chromosomal localization of the human and mouse hyaluronan synthase genes

Energy Technology Data Exchange (ETDEWEB)

Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

1997-05-01

We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

Science.gov (United States)

Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

2014-01-13

Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

Science.gov (United States)

Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

2015-01-01

Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

NARCIS (Netherlands)

Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

2000-01-01

The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

Directory of Open Access Journals (Sweden)

Marquez Rodolfo

2004-09-01

Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

STORAGESEVER

2010-05-24

May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

Geranylgeranyl diphosphate synthase in fission yeast is a heteromer of farnesyl diphosphate synthase (FPS), Fps1, and an FPS-like protein, Spo9, essential for sporulation.

Science.gov (United States)

Ye, Yanfang; Fujii, Makoto; Hirata, Aiko; Kawamukai, Makoto; Shimoda, Chikashi; Nakamura, Taro

2007-09-01

Both farnesyl diphosphate synthase (FPS) and geranylgeranyl diphosphate synthase (GGPS) are key enzymes in the synthesis of various isoprenoid-containing compounds and proteins. Here, we describe two novel Schizosaccharomyces pombe genes, fps1(+) and spo9(+), whose products are similar to FPS in primary structure, but whose functions differ from one another. Fps1 is essential for vegetative growth, whereas, a spo9 null mutant exhibits temperature-sensitive growth. Expression of fps1(+), but not spo9(+), suppresses the lethality of a Saccharomyces cerevisiae FPS-deficient mutant and also restores ubiquinone synthesis in an Escherichia coli ispA mutant, which lacks FPS activity, indicating that S. pombe Fps1 in fact functions as an FPS. In contrast to a typical FPS gene, no apparent GGPS homologues have been found in the S. pombe genome. Interestingly, although neither fps1(+) nor spo9(+) expression alone in E. coli confers clear GGPS activity, coexpression of both genes induces such activity. Moreover, the GGPS activity is significantly reduced in the spo9 mutant. In addition, the spo9 mutation perturbs the membrane association of a geranylgeranylated protein, but not that of a farnesylated protein. Yeast two-hybrid and coimmunoprecipitation analyses indicate that Fps1 and Spo9 physically interact. Thus, neither Fps1 nor Spo9 alone functions as a GGPS, but the two proteins together form a complex with GGPS activity. Because spo9 was originally identified as a sporulation-deficient mutant, we show here that expansion of the forespore membrane is severely inhibited in spo9Delta cells. Electron microscopy revealed significant accumulation membrane vesicles in spo9Delta cells. We suggest that lack of GGPS activity in a spo9 mutant results in impaired protein prenylation in certain proteins responsible for secretory function, thereby inhibiting forespore membrane formation.

Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.

Science.gov (United States)

Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice

2018-01-06

The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.

PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

International Nuclear Information System (INIS)

Enan, M. R.; Bashandy, S.A.

2006-01-01

Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

NARCIS (Netherlands)

Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

2004-01-01

The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

Science.gov (United States)

Jain, Parul; Tar'an, Bunyamin

2014-11-01

Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

Directory of Open Access Journals (Sweden)

Lydia J R Hunter

Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

DEFF Research Database (Denmark)

Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

2016-01-01

identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

Science.gov (United States)

Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

2007-10-01

Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

Science.gov (United States)

Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

2008-01-01

FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.

Science.gov (United States)

Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke

2011-11-01

Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

Directory of Open Access Journals (Sweden)

Bechard Matthew E.

2003-01-01

Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

Science.gov (United States)

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Natural variation in monoterpene synthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors.

Science.gov (United States)

Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G

2015-04-01

Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American

Chitin Synthases with a Myosin Motor-Like Domain Control the Resistance of Aspergillus fumigatus to Echinocandins

Science.gov (United States)

Jiménez-Ortigosa, Cristina; Aimanianda, Vishukumar; Muszkieta, Laetitia; Mouyna, Isabelle; Alsteens, David; Pire, Stéphane; Beau, Remi; Krappmann, Sven; Beauvais, Anne; Dufrêne, Yves F.

2012-01-01

Aspergillus fumigatus has two chitin synthases (CSMA and CSMB) with a myosin motor-like domain (MMD) arranged in a head-to-head configuration. To understand the function of these chitin synthases, single and double csm mutant strains were constructed and analyzed. Although there was a slight reduction in mycelial growth of the mutants, the total chitin synthase activity and the cell wall chitin content were similar in the mycelium of all of the mutants and the parental strain. In the conidia, chitin content in the ΔcsmA strain cell wall was less than half the amount found in the parental strain. In contrast, the ΔcsmB mutant strain and, unexpectedly, the ΔcsmA/ΔcsmB mutant strain did not show any modification of chitin content in their conidial cell walls. In contrast to the hydrophobic conidia of the parental strain, conidia of all of the csm mutants were hydrophilic due to the presence of an amorphous material covering the hydrophobic surface-rodlet layer. The deletion of CSM genes also resulted in an increased susceptibility of resting and germinating conidia to echinocandins. These results show that the deletion of the CSMA and CSMB genes induced a significant disorganization of the cell wall structure, even though they contribute only weakly to the overall cell wall chitin synthesis. PMID:22964252

Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

International Nuclear Information System (INIS)

Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

1991-01-01

Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

Directory of Open Access Journals (Sweden)

Xiudao Yu

2013-10-01

Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

Science.gov (United States)

Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

1999-03-01

The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

Science.gov (United States)

Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

2015-12-01

Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

Science.gov (United States)

Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

2017-10-01

Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

Science.gov (United States)

Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

2017-01-01

Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

myo-Inositol-1-phosphate synthase is required for polar auxin transport and organ development

KAUST Repository

Chen, Hao

2010-06-01

myo-Inositol-1-phosphate synthase is a conserved enzyme that catalyzes the first committed and rate-limiting step in inositol biosynthesis. Despite its wide occurrence in all eukaryotes, the role of myo-inositol-1-phosphate synthase and de novo inositol biosynthesis in cell signaling and organism development has been unclear. In this study, we isolated loss-of-function mutants in the Arabidopsis MIPS1 gene from different ecotypes. It was found that all mips1 mutants are defective in embryogenesis, cotyledon venation patterning, root growth, and root cap development. The mutant roots are also agravitropic and have reduced basipetal auxin transport. mips1 mutants have significantly reduced levels of major phosphatidylinositols and exhibit much slower rates of endocytosis. Treatment with brefeldin A induces slower PIN2 protein aggregation in mips1, indicating altered PIN2 trafficking. Our results demonstrate that MIPS1 is critical for maintaining phosphatidylinositol levels and affects pattern formation in plants likely through regulation of auxin distribution. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

DEFF Research Database (Denmark)

Vestergaard, H; Lund, S; Bjørbaek, C

1995-01-01

We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

Science.gov (United States)

Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

2016-12-01

Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne

2004-01-01

The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

Directory of Open Access Journals (Sweden)

Yan Yang

2017-04-01

Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

Nuclear receptor 5A (NR5A) family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells.

Science.gov (United States)

Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru

2012-11-01

5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.

Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

Directory of Open Access Journals (Sweden)

Kattina Zavala

Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

Science.gov (United States)

Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

2008-07-01

Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

Energy Technology Data Exchange (ETDEWEB)

Somerville, Chris R.; Scieble, Wolf

2000-10-11

Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

DEFF Research Database (Denmark)

von Wettstein, Penny

2017-01-01

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

Science.gov (United States)

Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

2014-01-01

Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

Nitric oxide synthase gene G298 allele

International Nuclear Information System (INIS)

Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

2004-01-01

Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases

Directory of Open Access Journals (Sweden)

Saito Koji

2005-08-01

Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1

Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

Directory of Open Access Journals (Sweden)

Yanjing Su

2012-06-01

Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

Association between Insulin Like Growth Factor-1 (IGF-1) gene ...

African Journals Online (AJOL)

The insulin-like growth factor-1 (IGF1) is a key regulator of muscle development and metabolism in birds and other vertebrate. Our objective was to determine the association between IGF1 gene polymorphism and carcass traits in FUNAAB Alpha chicken. Genomic DNA was extracted from the blood of 50 normal feathered ...

Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

OpenAIRE

Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

2017-01-01

Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

LMI1-like genes involved in leaf margin development of Brassica napus.

Science.gov (United States)

Ni, Xiyuan; Liu, Han; Huang, Jixiang; Zhao, Jianyi

2017-06-01

In rapeseed (Brassica napus L.), leaf margins are variable and can be entire, serrate, or lobed. In our previous study, the lobed-leaf gene (LOBED-LEAF 1, BnLL1) was mapped to a 32.1 kb section of B. napus A10. Two LMI1-like genes, BnaA10g26320D and BnaA10g26330D, were considered the potential genes that controlled the lobed-leaf trait in rapeseed. In the present study, these two genes and another homologous gene (BnaC04g00850D) were transformed into Arabidopsis thaliana (L.) Heynh. plants to identify their functions. All three LMI1-like genes of B. napus produced serrate leaf margins. The expression analysis indicated that the expression level of BnaA10g26320D determined the difference between lobed- and entire-leaved lines in rapeseed. Therefore, it is likely that BnaA10g26320D corresponds to BnLL1.

The Eucalyptus terpene synthase gene family.

Science.gov (United States)

Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

2015-06-11

Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

Indian Academy of Sciences (India)

Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.

The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

Science.gov (United States)

von Wettstein-Knowles, Penny

2017-07-10

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

Science.gov (United States)

Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

2014-01-01

Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

Directory of Open Access Journals (Sweden)

Jill C Preston

Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

Science.gov (United States)

Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

2017-08-09

Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

DEFF Research Database (Denmark)

Edman, U; Edman, J C; Lundgren, B

1989-01-01

The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

Analysis of genomic DNA of DcACS1, a 1-aminocyclopropane-1-carboxylate synthase gene, expressed in senescing petals of carnation (Dianthus caryophyllus) and its orthologous genes in D. superbus var. longicalycinus.

Science.gov (United States)

Harada, Taro; Murakoshi, Yuino; Torii, Yuka; Tanase, Koji; Onozaki, Takashi; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru

2011-04-01

Carnation (Dianthus caryophyllus) flowers exhibit climacteric ethylene production followed by petal wilting, a senescence symptom. DcACS1, which encodes 1-aminocyclopropane-1-carboxylate synthase (ACS), is a gene involved in this phenomenon. We determined the genomic DNA structure of DcACS1 by genomic PCR. In the genome of 'Light Pink Barbara', we found two distinct nucleotide sequences: one corresponding to the gene previously shown as DcACS1, designated here as DcACS1a, and the other novel one designated as DcACS1b. It was revealed that both DcACS1a and DcACS1b have five exons and four introns. These two genes had almost identical nucleotide sequences in exons, but not in some introns and 3'-UTR. Analysis of transcript accumulation revealed that DcACS1b is expressed in senescing petals as well as DcACS1a. Genomic PCR analysis of 32 carnation cultivars showed that most cultivars have only DcACS1a and some have both DcACS1a and DcACS1b. Moreover, we found two DcACS1 orthologous genes with different nucleotide sequences from D. superbus var. longicalycinus, and designated them as DsuACS1a and DsuACS1b. Petals of D. superbus var. longicalycinus produced ethylene in response to exogenous ethylene, accompanying accumulation of DsuACS1 transcripts. These data suggest that climacteric ethylene production in flowers was genetically established before the cultivation of carnation.

Comparative and evolutionary studies of vertebrate ALDH1A-like genes and proteins.

Science.gov (United States)

Holmes, Roger S

2015-06-05

Vertebrate ALDH1A-like genes encode cytosolic enzymes capable of metabolizing all-trans-retinaldehyde to retinoic acid which is a molecular 'signal' guiding vertebrate development and adipogenesis. Bioinformatic analyses of vertebrate and invertebrate genomes were undertaken using known ALDH1A1, ALDH1A2 and ALDH1A3 amino acid sequences. Comparative analyses of the corresponding human genes provided evidence for distinct modes of gene regulation and expression with putative transcription factor binding sites (TFBS), CpG islands and micro-RNA binding sites identified for the human genes. ALDH1A-like sequences were identified for all mammalian, bird, lizard and frog genomes examined, whereas fish genomes displayed a more restricted distribution pattern for ALDH1A1 and ALDH1A3 genes. The ALDH1A1 gene was absent in many bony fish genomes examined, with the ALDH1A3 gene also absent in the medaka and tilapia genomes. Multiple ALDH1A1-like genes were identified in mouse, rat and marsupial genomes. Vertebrate ALDH1A1, ALDH1A2 and ALDH1A3 subunit sequences were highly conserved throughout vertebrate evolution. Comparative amino acid substitution rates showed that mammalian ALDH1A2 sequences were more highly conserved than for the ALDH1A1 and ALDH1A3 sequences. Phylogenetic studies supported an hypothesis for ALDH1A2 as a likely primordial gene originating in invertebrate genomes and undergoing sequential gene duplication to generate two additional genes, ALDH1A1 and ALDH1A3, in most vertebrate genomes. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

Science.gov (United States)

Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

2013-01-01

Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

DEFF Research Database (Denmark)

Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri

2014-01-01

BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...

Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

Science.gov (United States)

Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

2013-03-01

Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

Science.gov (United States)

Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

2017-03-01

This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

Directory of Open Access Journals (Sweden)

Meng eWang

2013-05-01

Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

Science.gov (United States)

Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

2018-04-01

Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

The evolution of function in strictosidine synthase-like proteins.

Science.gov (United States)

Hicks, Michael A; Barber, Alan E; Giddings, Lesley-Ann; Caldwell, Jenna; O'Connor, Sarah E; Babbitt, Patricia C

2011-11-01

The exponential growth of sequence data provides abundant information for the discovery of new enzyme reactions. Correctly annotating the functions of highly diverse proteins can be difficult, however, hindering use of this information. Global analysis of large superfamilies of related proteins is a powerful strategy for understanding the evolution of reactions by identifying catalytic commonalities and differences in reaction and substrate specificity, even when only a few members have been biochemically or structurally characterized. A comparison of >2500 sequences sharing the six-bladed β-propeller fold establishes sequence, structural, and functional links among the three subgroups of the functionally diverse N6P superfamily: the arylesterase-like and senescence marker protein-30/gluconolactonase/luciferin-regenerating enzyme-like (SGL) subgroups, representing enzymes that catalyze lactonase and related hydrolytic reactions, and the so-called strictosidine synthase-like (SSL) subgroup. Metal-coordinating residues were identified as broadly conserved in the active sites of all three subgroups except for a few proteins from the SSL subgroup, which have been experimentally determined to catalyze the quite different strictosidine synthase (SS) reaction, a metal-independent condensation reaction. Despite these differences, comparison of conserved catalytic features of the arylesterase-like and SGL enzymes with the SSs identified similar structural and mechanistic attributes between the hydrolytic reactions catalyzed by the former and the condensation reaction catalyzed by SS. The results also suggest that despite their annotations, the great majority of these >500 SSL sequences do not catalyze the SS reaction; rather, they likely catalyze hydrolytic reactions typical of the other two subgroups instead. This prediction was confirmed experimentally for one of these proteins. Copyright © 2011 Wiley-Liss, Inc.

Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

Science.gov (United States)

Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

2016-09-01

Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

Science.gov (United States)

Flynn, Christopher M; Schmidt-Dannert, Claudia

2018-06-01

The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

Science.gov (United States)

Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

2013-03-01

Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

Science.gov (United States)

Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

2018-03-06

Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

Science.gov (United States)

Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

2011-10-01

Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

Science.gov (United States)

Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

2015-09-01

In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

Science.gov (United States)

Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

2014-11-01

The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.)

Science.gov (United States)

Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.

2006-01-01

Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Elicitor and fusarium-induced expression of NPR-1 like genes in banana

CSIR Research Space (South Africa)

Endah, R

2008-11-01

Full Text Available NPR1 is an essential positive regulator of salicylic acid-induced PR gene expression and systemic acquired resistance. Two novel full-length NPR1-like genes; MNPR1A and MNPR1B, were isolated by application of the PCR and RACE techniques. The two...

Polymorphism of glucagon-like peptide-1 receptor gene (rs1042044 ...

African Journals Online (AJOL)

Previous investigations indicated that glucagon-like peptide-1 (GLP-1) played important roles in bone turnover via GLP-1 receptors (GLP1Rs) in postmenopausal state. Furthermore, polymorphisms in GLP1R gene were suggested to affect the function of GLP1Rs and be associated with many diseases. However, the ...

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

OpenAIRE

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

Science.gov (United States)

Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

2017-02-01

Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Comparative studies of vertebrate endothelin-converting enzyme-like 1 genes and proteins

Directory of Open Access Journals (Sweden)

Holmes RS

2013-01-01

Full Text Available Roger S Holmes,1,2 Laura A Cox11Department of Genetics and Southwest National Primate Research Center, Texas Biomedical Research Institute, San Antonio, TX, USA; 2Eskitis Institute for Cell and Molecular Therapies and School of Biomolecular and Physical Sciences, Griffith University, Nathan, Queensland, AustraliaAbstract: Endothelin-converting enzyme-like 1 (ECEL1 is a member of the M13 family of neutral endopeptidases which play an essential role in the neural regulation of vertebrate respiration. Genetic deficiency of this protein results in respiratory failure soon after birth. Comparative ECEL1 amino acid sequences and structures and ECEL1 gene locations were examined using data from several vertebrate genome projects. Vertebrate ECEL1 sequences shared 66%–99% identity as compared with 30%–63% sequence identities with other M13-like family members, ECE1, ECE2, and NEP (neprilysin or MME. Three N-glycosylation sites were conserved among most vertebrate ECEL1 proteins examined. Sequence alignments, conserved key amino acid residues, and predicted secondary and tertiary structures were also studied, including cytoplasmic, transmembrane, and luminal sequences and active site residues. Vertebrate ECEL1 genes usually contained 18 exons and 17 coding exons on the negative strand. Exons 1 and 2 of the human ECEL1 gene contained 5'-untranslated (5'-UTR regions, a large CpG island (CpG256, and several transcription factor binding sites which may contribute to the high levels of gene expression previously reported in neural tissues. Phylogenetic analyses examined the relationships and potential evolutionary origins of the vertebrate ECEL1 gene with six other vertebrate neutral endopeptidase M13 family genes. These suggested that ECEL1 originated in an ancestral vertebrate genome from a duplication event in an ancestral neutral endopeptidase M13-like gene.Keywords: vertebrates, amino acid sequence, ECEL1, ECE1, ECE2, KELL, NEP, NEPL1, PHEX

Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

International Nuclear Information System (INIS)

Rothenberg, M.; Hanson, M.R.

1988-01-01

A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

Science.gov (United States)

Cascini, Fidelia; Passerotti, Stella; Martello, Simona

2012-04-10

In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

Science.gov (United States)

Schindler, Daniel; Nowrousian, Minou

2014-07-01

Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

International Nuclear Information System (INIS)

Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

2011-01-01

Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

Energy Technology Data Exchange (ETDEWEB)

Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

2011-12-01

Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

Reconstructing the Evolutionary History of Paralogous APETALA1/FRUITFULL-Like Genes in Grasses (Poaceae)

Science.gov (United States)

Preston, Jill C.; Kellogg, Elizabeth A.

2006-01-01

Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429

DOG1-like genes in cereals: investigation of their function by means of ectopic expression in Arabidopsis.

Science.gov (United States)

Ashikawa, Ikuo; Abe, Fumitaka; Nakamura, Shingo

2013-07-01

The Arabidopsis gene DOG1 (AtDOG1) functions in seed dormancy and in sugar signaling. Little is known about the structural and functional features of plant genes homologous to AtDOG1, except for one type (clade 1) of Triticeae AtDOG1-like genes, which was previously demonstrated to be functionally orthologous to AtDOG1. Here, through phylogenetic, structural, and functional analyses of cereal AtDOG1-like genes, we characterized their features: these genes exist as a gene family that can be classified into five distinct clades (1-5). Of these, AtDOG1-like genes in clades 1-4 have a similar architecture to AtDOG1: they encode proteins with three conserved regions. In contrast, the clade 5 genes are distinct; their encoded proteins lack these conserved regions, but harbor domains that interact with DNA. Ectopic expression of the cereal AtDOG1-like genes of clades 2-4 in Arabidopsis demonstrated that like the clade 1 genes, they performed the same function as AtDOG1. The correlation between the depth of seed dormancy and the efficiency of sugar signaling in transgenic Arabidopsis conferred by genes in clades 1-4 suggests a close link in the underlying mechanisms between the seed dormancy and sugar signaling functions of AtDOG1. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

Science.gov (United States)

Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

2016-03-09

Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

Science.gov (United States)

Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

2014-09-01

Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.

Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

Science.gov (United States)

Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

2016-06-01

Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

Diversification of the insulin-like growth factor 1 gene in mammals.

Directory of Open Access Journals (Sweden)

Peter Rotwein

Full Text Available Insulin-like growth factor 1 (IGF1, a small, secreted peptide growth factor, is involved in a variety of physiological and patho-physiological processes, including somatic growth, tissue repair, and metabolism of carbohydrates, proteins, and lipids. IGF1 gene expression appears to be controlled by several different signaling cascades in the few species in which it has been evaluated, with growth hormone playing a major role by activating a pathway involving the Stat5b transcription factor. Here, genes encoding IGF1 have been evaluated in 25 different mammalian species representing 15 different orders and ranging over ~180 million years of evolutionary diversification. Parts of the IGF1 gene have been fairly well conserved. Like rat Igf1 and human IGF1, 21 of 23 other genes are composed of 6 exons and 5 introns, and all 23 also contain recognizable tandem promoters, each with a unique leader exon. Exon and intron lengths are similar in most species, and DNA sequence conservation is moderately high in orthologous exons and proximal promoter regions. In contrast, putative growth hormone-activated Stat5b-binding enhancers found in analogous locations in rodent Igf1 and in human IGF1 loci, have undergone substantial variation in other mammals, and a processed retro-transposed IGF1 pseudogene is found in the sloth locus, but not in other mammalian genomes. Taken together, the fairly high level of organizational and nucleotide sequence similarity in the IGF1 gene among these 25 species supports the contention that some common regulatory pathways had existed prior to the beginning of mammalian speciation.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

OpenAIRE

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

Tyrosine kinase fusion genes in pediatric BCR-ABL1-like acute lymphoblastic leukemia

Science.gov (United States)

Boer, Judith M.; Steeghs, Elisabeth M.P.; Marchante, João R.M.; Boeree, Aurélie; Beaudoin, James J.; Berna Beverloo, H.; Kuiper, Roland P.; Escherich, Gabriele; van der Velden, Vincent H.J.; van der Schoot, C. Ellen; de Groot-Kruseman, Hester A.; Pieters, Rob; den Boer, Monique L.

2017-01-01

Approximately 15% of pediatric B cell precursor acute lymphoblastic leukemia (BCP-ALL) is characterized by gene expression similar to that of BCR-ABL1-positive disease and unfavorable prognosis. This BCR-ABL1-like subtype shows a high frequency of B-cell development gene aberrations and tyrosine kinase-activating lesions. To evaluate the clinical significance of tyrosine kinase gene fusions in children with BCP-ALL, we studied the frequency of recently identified tyrosine kinase fusions, associated genetic features, and prognosis in a representative Dutch/German cohort. We identified 14 tyrosine kinase fusions among 77 BCR-ABL1-like cases (18%) and none among 76 non-BCR-ABL1-like B-other cases. Novel exon fusions were identified for RCSD1-ABL2 and TERF2-JAK2. JAK2 mutation was mutually exclusive with tyrosine kinase fusions and only occurred in cases with high CRLF2 expression. The non/late response rate and levels of minimal residual disease in the fusion-positive BCR-ABL1-like group were higher than in the non-BCR-ABL1-like B-others (p<0.01), and also higher, albeit not statistically significant, compared with the fusion-negative BCR-ABL1-like group. The 8-year cumulative incidence of relapse in the fusion-positive BCR-ABL1-like group (35%) was comparable with that in the fusion-negative BCR-ABL1-like group (35%), and worse than in the non-BCR-ABL1-like B-other group (17%, p=0.07). IKZF1 deletions, predominantly other than the dominant-negative isoform and full deletion, co-occurred with tyrosine kinase fusions. This study shows that tyrosine kinase fusion-positive cases are a high-risk subtype of BCP-ALL, which warrants further studies with specific kinase inhibitors to improve outcome. PMID:27894077

Methionine synthase A2756G and reduced folate carrier1 A80G ...

African Journals Online (AJOL)

Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This study was conducted in the Medical Genetics Center, Ain-Shams University hospitals, on a total of 170 mothers of children, diagnosed with ...

Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

Science.gov (United States)

González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

2015-01-01

Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

Functional specificity of cardiolipin synthase revealed by the identification of a cardiolipin synthase CrCLS1 in Chlamydomonas reinhardtii

Directory of Open Access Journals (Sweden)

Chun-Hsien eHung

2016-01-01

Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.

Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

Science.gov (United States)

Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

2013-01-01

The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6

OpenAIRE

Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan

2016-01-01

Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

Science.gov (United States)

Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

2012-03-01

Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

OpenAIRE

Good, Laura Lee

2001-01-01

The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

A missense mutation in PFAS (phosphoribosylformylglycinamidine synthase) is likely causal for embryonic lethality associated with the MH1 haplotype in Montbéliarde dairy cattle.

Science.gov (United States)

Michot, Pauline; Fritz, Sébastien; Barbat, Anne; Boussaha, Mekki; Deloche, Marie-Christine; Grohs, Cécile; Hoze, Chris; Le Berre, Laurène; Le Bourhis, Daniel; Desnoes, Olivier; Salvetti, Pascal; Schibler, Laurent; Boichard, Didier; Capitan, Aurélien

2017-10-01

A candidate mutation in the sex hormone binding globulin gene was proposed in 2013 to be responsible for the MH1 recessive embryonic lethal locus segregating in the Montbéliarde breed. In this follow-up study, we excluded this candidate variant because healthy homozygous carriers were observed in large-scale genotyping data generated in the framework of the genomic selection program. We fine mapped the MH1 locus in a 702-kb interval and analyzed genome sequence data from the 1,000 bull genomes project and 54 Montbéliarde bulls (including 14 carriers and 40 noncarriers). We report the identification of a strong candidate mutation in the gene encoding phosphoribosylformylglycinamidine synthase (PFAS), a protein involved in de novo purine synthesis. This mutation, located in a class I glutamine amidotransferase-like domain, results in the substitution of an arginine residue that is entirely conserved among eukaryotes by a cysteine (p.R1205C). No homozygote for the cysteine-encoding allele was observed in a large population of more than 25,000 individuals despite a 6.7% allelic frequency and 122 expected homozygotes under neutrality assumption. Genotyping of 18 embryos collected from heterozygous parents as well as analysis on nonreturn rates suggested that most homozygous carriers died between 7 and 35 d postinsemination. The identification of this strong candidate mutation will enable the accurate testing of the reproducers and the efficient selection against this lethal recessive embryonic defect in the Montbéliarde breed. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

Directory of Open Access Journals (Sweden)

Resnanti Utami Handayani

2014-07-01

Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

International Nuclear Information System (INIS)

Soliman, S.E.T.; Zaater, M.K.

2010-01-01

Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

Topology of transmembrane channel-like gene 1 protein.

Science.gov (United States)

Labay, Valentina; Weichert, Rachel M; Makishima, Tomoko; Griffith, Andrew J

2010-10-05

Mutations of transmembrane channel-like gene 1 (TMC1) cause hearing loss in humans and mice. TMC1 is the founding member of a family of genes encoding proteins of unknown function that are predicted to contain multiple transmembrane domains. The goal of our study was to define the topology of mouse TMC1 expressed heterologously in tissue culture cells. TMC1 was retained in the endoplasmic reticulum (ER) membrane of five tissue culture cell lines that we tested. We used anti-TMC1 and anti-HA antibodies to probe the topologic orientation of three native epitopes and seven HA epitope tags along full-length TMC1 after selective or complete permeabilization of transfected cells with digitonin or Triton X-100, respectively. TMC1 was present within the ER as an integral membrane protein containing six transmembrane domains and cytosolic N- and C-termini. There is a large cytoplasmic loop, between the fourth and fifth transmembrane domains, with two highly conserved hydrophobic regions that might associate with or penetrate, but do not span, the plasma membrane. Our study is the first to demonstrate that TMC1 is a transmembrane protein. The topologic organization revealed by this study shares some features with that of the shaker-TRP superfamily of ion channels.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

Science.gov (United States)

Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

2017-12-01

An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

Directory of Open Access Journals (Sweden)

R. Vasudevan

2014-06-01

Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

[Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

Science.gov (United States)

Boris, K V; Kochieva, E Z; Kudryavtsev, A M

2014-12-01

The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

Science.gov (United States)

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

Directory of Open Access Journals (Sweden)

Mariateresa eVolpicella

2016-03-01

Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

Identification of GIG1, a GlcNAc-induced gene in Candida albicans needed for normal sensitivity to the chitin synthase inhibitor nikkomycin Z.

Science.gov (United States)

Gunasekera, Angelo; Alvarez, Francisco J; Douglas, Lois M; Wang, Hong X; Rosebrock, Adam P; Konopka, James B

2010-10-01

The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism.

Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

Science.gov (United States)

Ober, Dietrich; Hartmann, Thomas

1999-01-01

Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

Influence of EARLI1-like genes on flowering time and lignin synthesis of Arabidopsis thaliana.

Science.gov (United States)

Shi, Y; Zhang, X; Xu, Z-Y; Li, L; Zhang, C; Schläppi, M; Xu, Z-Q

2011-09-01

EARLI1 encodes a 14.7 kDa protein in the cell wall, is a member of the PRP (proline-rich protein) family and has multiple functions, including resistance to low temperature and fungal infection. RNA gel blot analyses in the present work indicated that expression of EARLI1-like genes, EARLI1, At4G12470 and At4G12490, was down-regulated in Col-FRI-Sf2 RNAi plants derived from transformation with Agrobacterium strain ABI, which contains a construct encoding a double-strand RNA targeting 8CM of EARLI1. Phenotype analyses revealed that Col-FRI-Sf2 RNAi plants of EARLI1 flowered earlier than Col-FRI-Sf2 wild-type plants. The average bolting time of Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants was 39.7 and 19.4 days, respectively, under a long-day photoperiod. In addition, there were significant differences in main stem length, internode number and rosette leaf number between Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants. RT-PCR showed that EARLI1-like genes might delay flowering time through the autonomous and long-day photoperiod pathways by maintaining the abundance of FLC transcripts. In Col-FRI-Sf2 RNAi plants, transcription of FLC was repressed, while expression of SOC1 and FT was activated. Microscopy observations showed that EARLI1-like genes were also associated with morphogenesis of leaf cells in Arabidopsis. Using histochemical staining, EARLI1-like genes were found to be involved in regulation of lignin synthesis in inflorescence stems, and Col-FRI-Sf2 and Col-FRI-Sf2 RNAi plants had 9.67% and 8.76% dry weight lignin, respectively. Expression analysis revealed that cinnamoyl-CoA reductase, a key enzyme in lignin synthesis, was influenced by EARLI1-like genes. These data all suggest that EARLI1-like genes could control the flowering process and lignin synthesis in Arabidopsis. © 2011 German Botanical Society and The Royal Botanical Society of the Netherlands.

Sphingomyelin Synthase 1 Is Essential for Male Fertility in Mice.

Directory of Open Access Journals (Sweden)

Anke Wittmann

Full Text Available Sphingolipids and the derived gangliosides have critical functions in spermatogenesis, thus mutations in genes involved in sphingolipid biogenesis are often associated with male infertility. We have generated a transgenic mouse line carrying an insertion in the sphingomyelin synthase gene Sms1, the enzyme which generates sphingomyelin species in the Golgi apparatus. We describe the spermatogenesis defect of Sms1-/- mice, which is characterized by sloughing of spermatocytes and spermatids, causing progressive infertility of male homozygotes. Lipid profiling revealed a reduction in several long chain unsaturated phosphatidylcholins, lysophosphatidylcholins and sphingolipids in the testes of mutants. Multi-Spectral Optoacoustic Tomography indicated blood-testis barrier dysfunction. A supplementary diet of the essential omega-3 docosahexaenoic acid and eicosapentaenoic acid diminished germ cell sloughing from the seminiferous epithelium and restored spermatogenesis and fertility in 50% of previously infertile mutants. Our findings indicate that SMS1 has a wider than anticipated role in testis polyunsaturated fatty acid homeostasis and for male fertility.

Expression of phytoene synthase1 and carotene desaturase crtI genes result in an increase in the total carotenoids content in transgenic elite wheat (Triticum aestivum L.).

Science.gov (United States)

Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan

2009-09-23

Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.

A maize spermine synthase 1 PEST sequence fused to the GUS reporter protein facilitates proteolytic degradation.

Science.gov (United States)

Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco

2014-05-01

Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

Directory of Open Access Journals (Sweden)

Piotr Szymczyk

2016-09-01

Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

Directory of Open Access Journals (Sweden)

Lin-Hui Gao

2018-01-01

Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

Science.gov (United States)

Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

2016-02-10

In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

Evolution of the C-Type Lectin-Like Receptor Genes of the DECTIN-1 Cluster in the NK Gene Complex

Directory of Open Access Journals (Sweden)

Susanne Sattler

2012-01-01

Full Text Available Pattern recognition receptors are crucial in initiating and shaping innate and adaptive immune responses and often belong to families of structurally and evolutionarily related proteins. The human C-type lectin-like receptors encoded in the DECTIN-1 cluster within the NK gene complex contain prominent receptors with pattern recognition function, such as DECTIN-1 and LOX-1. All members of this cluster share significant homology and are considered to have arisen from subsequent gene duplications. Recent developments in sequencing and the availability of comprehensive sequence data comprising many species showed that the receptors of the DECTIN-1 cluster are not only homologous to each other but also highly conserved between species. Even in Caenorhabditis elegans, genes displaying homology to the mammalian C-type lectin-like receptors have been detected. In this paper, we conduct a comprehensive phylogenetic survey and give an up-to-date overview of the currently available data on the evolutionary emergence of the DECTIN-1 cluster genes.

Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

Science.gov (United States)

Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

2016-12-01

Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

DEFF Research Database (Denmark)

Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

1999-01-01

Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

Identification of GIG1, a GlcNAc-Induced Gene in Candida albicans Needed for Normal Sensitivity to the Chitin Synthase Inhibitor Nikkomycin Z▿§

Science.gov (United States)

Gunasekera, Angelo; Alvarez, Francisco J.; Douglas, Lois M.; Wang, Hong X.; Rosebrock, Adam P.; Konopka, James B.

2010-01-01

The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism. PMID:20675577

The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

Science.gov (United States)

Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

2005-06-01

Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

Gain-of-function mutations in the phosphatidylserine synthase 1 (PTDSS1) gene cause Lenz-Majewski syndrome.

Science.gov (United States)

Sousa, Sérgio B; Jenkins, Dagan; Chanudet, Estelle; Tasseva, Guergana; Ishida, Miho; Anderson, Glenn; Docker, James; Ryten, Mina; Sa, Joaquim; Saraiva, Jorge M; Barnicoat, Angela; Scott, Richard; Calder, Alistair; Wattanasirichaigoon, Duangrurdee; Chrzanowska, Krystyna; Simandlová, Martina; Van Maldergem, Lionel; Stanier, Philip; Beales, Philip L; Vance, Jean E; Moore, Gudrun E

2014-01-01

Lenz-Majewski syndrome (LMS) is a syndrome of intellectual disability and multiple congenital anomalies that features generalized craniotubular hyperostosis. By using whole-exome sequencing and selecting variants consistent with the predicted dominant de novo etiology of LMS, we identified causative heterozygous missense mutations in PTDSS1, which encodes phosphatidylserine synthase 1 (PSS1). PSS1 is one of two enzymes involved in the production of phosphatidylserine. Phosphatidylserine synthesis was increased in intact fibroblasts from affected individuals, and end-product inhibition of PSS1 by phosphatidylserine was markedly reduced. Therefore, these mutations cause a gain-of-function effect associated with regulatory dysfunction of PSS1. We have identified LMS as the first human disease, to our knowledge, caused by disrupted phosphatidylserine metabolism. Our results point to an unexplored link between phosphatidylserine synthesis and bone metabolism.

Cloning, functional characterization and genomic organization of 1,8-cineole synthases from Lavandula.

Science.gov (United States)

Demissie, Zerihun A; Cella, Monica A; Sarker, Lukman S; Thompson, Travis J; Rheault, Mark R; Mahmoud, Soheil S

2012-07-01

Several members of the genus Lavandula produce valuable essential oils (EOs) that are primarily constituted of the low molecular weight isoprenoids, particularly monoterpenes. We isolated over 8,000 ESTs from the glandular trichomes of L. x intermedia flowers (where bulk of the EO is synthesized) to facilitate the discovery of genes that control the biosynthesis of EO constituents. The expression profile of these ESTs in L. x intermedia and its parents L. angustifolia and L. latifolia was established using microarrays. The resulting data highlighted a differentially expressed, previously uncharacterized cDNA with strong homology to known 1,8-cineole synthase (CINS) genes. The ORF, excluding the transit peptide, of this cDNA was expressed in E. coli, purified by Ni-NTA agarose affinity chromatography and functionally characterized in vitro. The ca. 63 kDa bacterially produced recombinant protein, designated L. x intermedia CINS (LiCINS), converted geranyl diphosphate (the linear monoterpene precursor) primarily to 1,8-cineole with K ( m ) and k ( cat ) values of 5.75 μM and 8.8 × 10(-3) s(-1), respectively. The genomic DNA of CINS in the studied Lavandula species had identical exon-intron architecture and coding sequences, except for a single polymorphic nucleotide in the L. angustifolia ortholog which did not alter protein function. Additional nucleotide variations restricted to L. angustifolia introns were also observed, suggesting that LiCINS was most likely inherited from L. latifolia. The LiCINS mRNA levels paralleled the 1,8-cineole content in mature flowers of the three lavender species, and in developmental stages of L. x intermedia inflorescence indicating that the production of 1,8 cineole in Lavandula is most likely controlled through transcriptional regulation of LiCINS.

Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

Science.gov (United States)

Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

2016-03-01

Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

Science.gov (United States)

Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

2017-07-01

Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1) in Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.)

OpenAIRE

Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek

2014-01-01

Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...

Different patterns of gene expression in rice varieties undergoing a ...

African Journals Online (AJOL)

Some genes specifically up-regulated in infected 9804-Rxo1 were defenserelated, including the genes encoding pathogenesis-related protein, terpene synthase family, transcription factors (TFs) AP2 domain containing protein, myb-like deoxyribonucleic acid (DNA)- binding domain containing protein, and C2H2-type ...

Insulin like growth factor-1 prevents 1-mentyl-4-phenylphyridinium-induced apoptosis in PC12 cells through activation of glycogen synthase kinase-3beta

International Nuclear Information System (INIS)

Sun, Xin; Huang, Luqi; Zhang, Min; Sun, Shenggang; Wu, Yan

2010-01-01

Dopaminergic neurons are lost mainly through apoptosis in Parkinson's disease. Insulin like growth factor-1 (IGF-1) inhibits apoptosis in a wide variety of tissues. Here we have shown that IGF-1 protects PC12 cells from toxic effects of 1-methyl-4-phenylpyridiniumion (MPP + ). Treatment of PC12 cells with recombinant human IGF-1 significantly decreased apoptosis caused by MPP + as measured by acridine orange/ethidium bromide staining. IGF-1 treatment induced sustained phosphorylation of glycogen synthase kinase-3beta (GSK-3beta) as shown by western blot analysis. The anti-apoptotic effect of IGF-1 was abrogated by LY294002, which indirectly inhibits phosphorylation of GSK-3beta. Lithium chloride (LiCl), a known inhibitor of GSK-3beta, also blocked MPP + -induced apoptosis. Finally, although IGF-1 enhanced phosphorylation of extracellular signal-regulated kinases ERK1 and 2 (ERK1/2), PD98059, a specific inhibitor of ERK1/2, did not alter the survival effect of IGF-1. Thus, our findings indicate that IGF-1 protects PC12 cells exposed to MPP + from apoptosis via the GSK-3beta signaling pathway.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Analysis of genetic variation of inducible nitric oxide synthase and ...

African Journals Online (AJOL)

The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

Identification of Putative Precursor Genes for the Biosynthesis of Cannabinoid-Like Compound in Radula marginata

Directory of Open Access Journals (Sweden)

Tajammul Hussain

2018-05-01

Full Text Available The liverwort Radula marginata belongs to the bryophyte division of land plants and is a prospective alternate source of cannabinoid-like compounds. However, mechanistic insights into the molecular pathways directing the synthesis of these cannabinoid-like compounds have been hindered due to the lack of genetic information. This prompted us to do deep sequencing, de novo assembly and annotation of R. marginata transcriptome, which resulted in the identification and validation of the genes for cannabinoid biosynthetic pathway. In total, we have identified 11,421 putative genes encoding 1,554 enzymes from 145 biosynthetic pathways. Interestingly, we have identified all the upstream genes of the central precursor of cannabinoid biosynthesis, cannabigerolic acid (CBGA, including its two first intermediates, stilbene acid (SA and geranyl diphosphate (GPP. Expression of all these genes was validated using quantitative real-time PCR. We have characterized the protein structure of stilbene synthase (STS, which is considered as a homolog of olivetolic acid in R. marginata. Moreover, the metabolomics approach enabled us to identify CBGA-analogous compounds using electrospray ionization mass spectrometry (ESI-MS/MS and gas chromatography mass spectrometry (GC-MS. Transcriptomic analysis revealed 1085 transcription factors (TF from 39 families. Comparative analysis showed that six TF families have been uniquely predicted in R. marginata. In addition, the bioinformatics analysis predicted a large number of simple sequence repeats (SSRs and non-coding RNAs (ncRNAs. Our results collectively provide mechanistic insights into the putative precursor genes for the biosynthesis of cannabinoid-like compounds and a novel transcriptomic resource for R. marginata. The large-scale transcriptomic resource generated in this study would further serve as a reference transcriptome to explore the Radulaceae family.

Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

Directory of Open Access Journals (Sweden)

Leila ePazouki

2015-03-01

Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

Complementation of a threonine dehydratase-deficient Nicotiana plumbaginifolia mutant after Agrobacterium tumefaciens-mediated transfer of the Saccharomyces cerevisiae ILV1 gene.

OpenAIRE

Colau, D; Negrutiu, I; Van Montagu, M; Hernalsteens, J P

1987-01-01

The Saccharomyces cerevisiae ILV1 gene, encoding threonine dehydratase (EC 4.2.1.16) was fused to the transferred DNA nopaline synthase promoter and the 3' noncoding region of the octopine synthase gene. It was introduced, by Agrobacterium tumefaciens-mediated gene transfer, into an isoleucine-requiring Nicotiana plumbaginifolia auxotroph deficient in threonine dehydratase. Functional complementation by the ILV1 gene product was demonstrated by the selection of several transformed lines on a ...

Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

International Nuclear Information System (INIS)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-01-01

The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

TAIL1: an isthmin-like gene, containing type 1 thrombospondin-repeat and AMOP domain, mapped to ARVD1 critical region.

Science.gov (United States)

Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio

2004-06-23

Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.

Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

Directory of Open Access Journals (Sweden)

Gnanasambandan Ramanathan

2017-01-01

Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

Science.gov (United States)

Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

2016-01-01

Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

Directory of Open Access Journals (Sweden)

Hongxia Miao

Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

Science.gov (United States)

Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

2014-01-01

Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

Identification of a STOP1-like protein in Eucalyptus that regulates transcription of Al tolerance genes.

Science.gov (United States)

Sawaki, Yoshiharu; Kobayashi, Yuriko; Kihara-Doi, Tomonori; Nishikubo, Nobuyuki; Kawazu, Tetsu; Kobayashi, Masatomo; Kobayashi, Yasufumi; Iuchi, Satoshi; Koyama, Hiroyuki; Sato, Shigeru

2014-06-01

Tolerance to soil acidity is an important trait for eucalyptus clones that are introduced to commercial forestry plantations in pacific Asian countries, where acidic soil is dominant in many locations. A conserved transcription factor regulating aluminum (Al) and proton (H⁺) tolerance in land-plant species, STOP1 (SENSITIVE TOPROTON RHIZOTOXICITY 1)-like protein, was isolated by polymerase chain reaction-based cloning, and then suppressed by RNA interference in hairy roots produced by Agrobacterium rhizogenes-mediated transformation. Eucalyptus STOP1-like protein complemented proton tolerance in an Arabidopsis thaliana stop1-mutant, and localized to the nucleus in a transient assay of a green fluorescent protein fusion protein expressed in tobacco leaves by Agrobacterium tumefaciens-mediated transformation. Genes encoding a citrate transporting MULTIDRUGS AND TOXIC COMPOUND EXTRUSION protein and an orthologue of ALUMINUM SENSITIVE 3 were suppressed in transgenic hairy roots in which the STOP1 orthologue was knocked down. In summary, we identified a series of genes for Al-tolerance in eucalyptus, including a gene for STOP1-like protein and the Al-tolerance genes it regulates. These genes may be useful for molecular breeding and genomic selection of elite clones to introduce into acid soil regions. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Plant oxidosqualene metabolism: cycloartenol synthase-dependent sterol biosynthesis in Nicotiana benthamiana.

Science.gov (United States)

Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert

2014-01-01

The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

Directory of Open Access Journals (Sweden)

Praveen Balabaskaran Nina

2010-07-01

Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

Science.gov (United States)

Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

1998-01-01

The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

OpenAIRE

Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

2012-01-01

The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

International Nuclear Information System (INIS)

Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

2013-01-01

1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

Loss of the gene for the alpha subunit of ATP synthase (ATP5A1) from the W chromosome in the African grey parrot (Psittacus erithacus).

Science.gov (United States)

de Kloet, S R

2001-08-01

This study describes the results of an analysis using Southern blotting, the polymerase chain reaction, and sequencing which shows that the African grey parrot (Psittacus erithacus) lacks the W-chromosomal gene for the alpha subunit of mitochondrial ATP synthase (ATP5A1W). Additional evidence shows that in other psittacines a fragment of the ATP5A1W gene contains five times as many nonsynonymous nucleotide replacements as the homologous fragment of the Z gene. Therefore, whereas in these other psittacines the corresponding ATP5A1Z protein fragment is highly conserved and varies by only a few, moderately conservative amino acid substitutions, the homologous ATP5A1W fragments contain a considerable number of, sometimes highly nonconservative, amino acid replacements. In one of these species, the ringneck parakeet (Psittacula krameri), the ATP5A1W gene is present in an inactive form because of the presence of a nonsense codon. Other changes, possibly leading to an inactive ATP5A1W gene product, involve the substitution of arginine residues by cysteine in the ATP5A1W protein of the mitred conure (Aratinga mitrata) and the blue and gold macaw (Ara ararauna). The data suggest also that although the divergence of the psittacine ATP5A1W and ATP5A1Z genes preceded the origin of the psittacidae, this divergence occurred independently of a similar process in the myna (Gracula religiosa), the outgroup used in this study.

Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

International Nuclear Information System (INIS)

Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

2010-01-01

The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

Science.gov (United States)

Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

2018-05-11

Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

Chitinase and chitin synthase 1: counterbalancing activities in cell separation of Saccharomyces cerevisiae.

Science.gov (United States)

Cabib, E; Silverman, S J; Shaw, J A

1992-01-01

Previous results [E. Cabib, A. Sburlati, B. Bowers & S. J. Silverman (1989) Journal of Cell Biology 108, 1665-1672] strongly suggested that the lysis observed in daughter cells of Saccharomyces cerevisiae defective in chitin synthase 1 (Chs1) was caused by a chitinase that partially degrades the chitin septum in the process of cell separation. Consequently, it was proposed that in wild-type cells, Chs1 acts as a repair enzyme by replenishing chitin during cytokinesis. The chitinase requirement for lysis has been confirmed in two different ways: (a) demethylallosamidin, a more powerful chitinase inhibitor than the previously used allosamidin, is also a much better protector against lysis and (b) disruption of the chitinase gene in chs1 cells eliminates lysis. Reintroduction of a normal chitinase gene, by transformation of those cells with a suitable plasmid, restores lysis. The percentage of lysed cells in strains lacking Chs1 was not increased by elevating the chitinase level with high-copy-number plasmids carrying the hydrolase gene. Furthermore, the degree of lysis varied in different chs1 strains; lysis was abolished in chs1 mutants containing the scs1 suppressor. These results indicate that, in addition to chitinase, lysis requires other gene products that may become limiting.

Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

DEFF Research Database (Denmark)

Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

2003-01-01

The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

Directory of Open Access Journals (Sweden)

Bin Wang

2010-07-01

Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

Regulation of Fumonisin B1 Biosynthesis and Conidiation in Fusarium verticillioides by a Cyclin-Like (C-Type) Gene, FCC1†

Science.gov (United States)

Shim, Won-Bo; Woloshuk, Charles P.

2001-01-01

Fumonisins are a group of mycotoxins produced in corn kernels by the plant-pathogenic fungus Fusarium verticillioides. A mutant of the fungus, FT536, carrying a disrupted gene named FCC1 (for Fusarium cyclin C1) resulting in altered fumonisin B1 biosynthesis was generated. FCC1 contains an open reading frame of 1,018 bp, with one intron, and encodes a putative 319-amino-acid polypeptide. This protein is similar to UME3 (also called SRB11 or SSN8), a cyclin C of Saccharomyces cerevisiae, and contains three conserved motifs: a cyclin box, a PEST-rich region, and a destruction box. Also similar to the case for C-type cyclins, FCC1 was constitutively expressed during growth. When strain FT536 was grown on corn kernels or on defined minimal medium at pH 6, conidiation was reduced and FUM5, the polyketide synthase gene involved in fumonisin B1 biosynthesis, was not expressed. However, when the mutant was grown on a defined minimal medium at pH 3, conidiation was restored, and the blocks in expression of FUM5 and fumonisin B1 production were suppressed. Our data suggest that FCC1 plays an important role in signal transduction regulating secondary metabolism (fumonisin biosynthesis) and fungal development (conidiation) in F. verticillioides. PMID:11282612

Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

Science.gov (United States)

Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

2016-09-01

Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions.

CrWSKP1, an SKP1-like Gene, Is Involved in the Self-Incompatibility Reaction of "Wuzishatangju" (Citrus reticulata Blanco).

Science.gov (United States)

Li, Peng; Miao, Hongxia; Ma, Yuewen; Wang, Lu; Hu, Guibing; Ye, Zixing; Zhao, Jietang; Qin, Yonghua

2015-09-09

Plant S-phase kinase-associated protein 1 (SKP1) genes play crucial roles in plant development and differentiation. However, the role of SKP1 in citrus is unclear. Herein, we described a novel SKP1-like gene, designated as CrWSKP1, from "Wuzishatangju" (Citrus reticulata Blanco). The cDNA sequence of CrWSKP1 is 779 base pairs (bp) and contains an open reading frame (ORF) of 477 bp. The genomic sequence of the CrWSKP1 gene is 1296 bp with two exons and one intron. CrWSKP1 has high identity with SKP1-like genes from other plant species within two conserved regions. Approximately 85% of pollen tubes of self-pollinated CrWSKP1 transgenic tobaccos became twisted at four days after self-pollination. Pollen tube numbers of self-pollinated CrWSKP1 transformants entering into ovules were significantly fewer than that of the control. Seed number of self-pollinated CrWSKP1 transformants was significantly reduced. These results suggested that the CrWSKP1 is involved in the self-incompatibility (SI) reaction of "Wuzishatangju".

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

Science.gov (United States)

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

International Nuclear Information System (INIS)

Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

2005-01-01

Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ 1 -Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å 3 Da −1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively

Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

Science.gov (United States)

Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

2015-10-01

GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

Science.gov (United States)

Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

2013-12-01

Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effects of disrupting the polyketide synthase gene WdPKS1 in Wangiella [Exophiala] dermatitidis on melanin production and resistance to killing by antifungal compounds, enzymatic degradation, and extremes in temperature

Directory of Open Access Journals (Sweden)

Mandal Piyali

2006-06-01

Full Text Available Abstract Background Wangiella dermatitidis is a human pathogenic fungus that is an etiologic agent of phaeohyphomycosis. W. dermatitidis produces a black pigment that has been identified as a dihydroxynaphthalene melanin and the production of this pigment is associated with its virulence. Cell wall pigmentation in W. dermatitidis depends on the WdPKS1 gene, which encodes a polyketide synthase required for generating the key precursor for dihydroxynaphthalene melanin biosynthesis. Results We analyzed the effects of disrupting WdPKS1 on dihydroxynaphthalene melanin production and resistance to antifungal compounds. Transmission electron microscopy revealed that wdpks1Δ-1 yeast had thinner cell walls that lacked an electron-opaque layer compared to wild-type cells. However, digestion of the wdpks1Δ-1 yeast revealed small black particles that were consistent with a melanin-like compound, because they were acid-resistant, reacted with melanin-binding antibody, and demonstrated a free radical signature by electron spin resonance analysis. Despite lacking the WdPKS1 gene, the mutant yeast were capable of catalyzing the formation of melanin from L-3,4-dihyroxyphenylalanine. The wdpks1Δ-1 cells were significantly more susceptible to killing by voriconazole, amphotericin B, NP-1 [a microbicidal peptide], heat and cold, and lysing enzymes than the heavily melanized parental or complemented strains. Conclusion In summary, W. dermatitidis makes WdPKS-dependent and -independent melanins, and the WdPKS1-dependent deposition of melanin in the cell wall confers protection against antifungal agents and environmental stresses. The biological role of the WdPKS-independent melanin remains unclear.

Identification and expression analysis of CYS-A1, CYS-C1, NIT4 genes in rice seedlings exposed to cyanide.

Science.gov (United States)

Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong

2017-09-01

Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-01-01

Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Directory of Open Access Journals (Sweden)

Roslyn D Noar

Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

Association of a neuronal nitric oxide synthase gene polymorphism with levodopa-induced dyskinesia in Parkinson's disease.

Science.gov (United States)

Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor

2018-04-01

Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.

Methionine synthase A2756G and reduced folate carrier1 A80G ...

African Journals Online (AJOL)

Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...

Comprehensive Analysis of the COBRA-Like (COBL) Gene Family in Gossypium Identifies Two COBLs Potentially Associated with Fiber Quality

Science.gov (United States)

Niu, Erli; Shang, Xiaoguang; Cheng, Chaoze; Bao, Jianghao; Zeng, Yanda; Cai, Caiping; Du, Xiongming; Guo, Wangzhen

2015-01-01

COBRA-Like (COBL) genes, which encode a plant-specific glycosylphosphatidylinositol (GPI) anchored protein, have been proven to be key regulators in the orientation of cell expansion and cellulose crystallinity status. Genome-wide analysis has been performed in A. thaliana, O. sativa, Z. mays and S. lycopersicum, but little in Gossypium. Here we identified 19, 18 and 33 candidate COBL genes from three sequenced cotton species, diploid cotton G. raimondii, G. arboreum and tetraploid cotton G. hirsutum acc. TM-1, respectively. These COBL members were anchored onto 10 chromosomes in G. raimondii and could be divided into two subgroups. Expression patterns of COBL genes showed highly developmental and spatial regulation in G. hirsutum acc. TM-1. Of them, GhCOBL9 and GhCOBL13 were preferentially expressed at the secondary cell wall stage of fiber development and had significantly co-upregulated expression with cellulose synthase genes GhCESA4, GhCESA7 and GhCESA8. Besides, GhCOBL9 Dt and GhCOBL13 Dt were co-localized with previously reported cotton fiber quality quantitative trait loci (QTLs) and the favorable allele types of GhCOBL9 Dt had significantly positive correlations with fiber quality traits, indicating that these two genes might play an important role in fiber development. PMID:26710066

Sucrose Phosphate Synthase and Sucrose Accumulation at Low Temperature 1

Science.gov (United States)

Guy, Charles L.; Huber, Joan L. A.; Huber, Steven C.

1992-01-01

The influence of growth temperature on the free sugar and sucrose phosphate synthase content and activity of spinach (Spinacia oleracea) leaf tissue was studied. When plants were grown at 25°C for 3 weeks and then transferred to a constant 5°C, sucrose, glucose, and fructose accumulated to high levels during a 14-d period. Predawn sugar levels increased from 14- to 20-fold over the levels present at the outset of the low-temperature treatment. Sucrose was the most abundant free sugar before, during, and after exposure to 5°C. Leaf sucrose phosphate synthase activity was significantly increased by the low-temperature treatment, whereas sucrose synthase and invertases were not. Synthesis of the sucrose phosphate synthase subunit was increased during and after low-temperature exposure and paralleled an increase in the steady-state level of the subunit. The increases in sucrose and its primary biosynthetic enzyme, sucrose phosphate synthase, are discussed in relation to adjustment of metabolism to low nonfreezing temperature and freezing stress tolerance. Images Figure 1 Figure 2 Figure 3 PMID:16652990

Pu-erh Tea Reduces Nitric Oxide Levels in Rats by Inhibiting Inducible Nitric Oxide Synthase Expression through Toll-Like Receptor 4

Science.gov (United States)

Xu, Yang; Wang, Guan; Li, Chunjie; Zhang, Min; Zhao, Hang; Sheng, Jun; Shi, Wei

2012-01-01

Pu-erh tea undergoes a unique fermentation process and contains theabrownins, polysaccharides and caffeine; although it is unclear about which component is associated with the down regulation of nitric oxide levels or how this process is mediated. To address this question we examined the effects of pu-erh tea on nitric oxide synthase (NOS) genes. Cohorts of rats were separately given four-week treatments of water as control, pu-erh tea, or the tea components: theabrownins, caffeine or polysaccharides. Five experimental groups were injected with lipopolysaccharides (LPS) to induce nitric oxide (NO) production, while the corresponding five control groups were injected with saline as a negative control. The serum and liver NO concentrations were examined and the NOS expression of both mRNA and protein was measured in liver. The results showed that the rats which were fed pu-erh tea or polysaccharides had lower levels of NO which corresponded with the down-regulation of inducible nitric oxide synthase (iNOS) expression. We further demonstrate that this effect is mediated through reduction of Toll-like receptor 4 (TLR4) signaling. Thus we find that the polysaccharide components in pu-erh tea reduce NO levels in an animal model by inhibiting the iNOS expression via signaling through TLR4. PMID:22837686

A novel role of BELL1-like homeobox genes, PENNYWISE and POUND-FOOLISH, in floral patterning.

Science.gov (United States)

Yu, Lifeng; Patibanda, Varun; Smith, Harley M S

2009-02-01

Flowers are determinate shoots comprised of perianth and reproductive organs displayed in a whorled phyllotactic pattern. Floral organ identity genes display region-specific expression patterns in the developing flower. In Arabidopsis, floral organ identity genes are activated by LEAFY (LFY), which functions with region-specific co-regulators, UNUSUAL FLORAL ORGANS (UFO) and WUSCHEL (WUS), to up-regulate homeotic genes in specific whorls of the flower. PENNYWISE (PNY) and POUND-FOOLISH (PNF) are redundant functioning BELL1-like homeodomain proteins that are expressed in shoot and floral meristems. During flower development, PNY functions with a co-repressor complex to down-regulate the homeotic gene, AGAMOUS (AG), in the outer whorls of the flower. However, the function of PNY as well as PNF in regulating floral organ identity in the central whorls of the flower is not known. In this report, we show that combining mutations in PNY and PNF enhance the floral patterning phenotypes of weak and strong alleles of lfy, indicating that these BELL1-like homeodomain proteins play a role in the specification of petals, stamens and carpels during flower development. Expression studies show that PNY and PNF positively regulate the homeotic genes, APETALA3 and AG, in the inner whorls of the flower. Moreover, PNY and PNF function in parallel with LFY, UFO and WUS to regulate homeotic gene expression. Since PNY and PNF interact with the KNOTTED1-like homeodomain proteins, SHOOTMERISTEMLESS (STM) and KNOTTED-LIKE from ARABIDOPSIS THALIANA2 (KNAT2) that regulate floral development, we propose that PNY/PNF-STM and PNY/PNF-KNAT2 complexes function in the inner whorls to regulate flower patterning events.

Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

Energy Technology Data Exchange (ETDEWEB)

Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

2013-09-13

Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.

Science.gov (United States)

Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae

2017-11-15

Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd

Directory of Open Access Journals (Sweden)

Mei Lan Jin

2017-11-01

Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

cDNA cloning and expression analyses of phytoene synthase 1, phytoene desaturase and ζ-carotene desaturase genes from Solanum lycopersicum KKU-T34003

Directory of Open Access Journals (Sweden)

Krittaya Supathaweewat

2013-10-01

Full Text Available We report on the cloning of Psy1, Pds and Zds cDNAs encoding the enzymes responsible for lycopene biosynthesis,namely phytoene synthase 1 (PSY1, phytoene desaturase (PDS and -carotene desaturase (ZDS, respectively, from high-lycopene tomato cultivar, Solanum lycopersicum KKU-T34003. DNA sequence analyses showed that the complete openreading frames of Psy1, Pds and Zds cDNAs were 1,239, 1,752 and 1,767 base pairs in length and encoded proteins of 412,583 and 588 amino acids, respectively. Phylogenetic and the conserved domain analyses suggest that PSY1, PDS and ZDSfrom S. lycopersicum KKU-T34003 potentially have similar structures and biological functions to the corresponding proteinsfrom other plants. Gene expression studies showed that Psy1 was expressed only in the petal and the breaker fruit, whereasthe expressions of Pds and Zds were observed in the petal, the breaker fruit and the leaf. The highest expression level for allgenes was detected in the breaker-stage fruit, suggesting that carotenoid accumulation was developmentally regulated inthe chromoplast-containing tissues.

Interrupted thymidylate synthase gene of bacteriophages T2 and T6 and other potential self-splicing introns in the T-even bacteriophages

International Nuclear Information System (INIS)

Chu, F.K.; Maley, F.; Martinez, J.; Maley, G.F.

1987-01-01

Southern hybridization analyses of procaryotic DNA from Escherchia coli, λ bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. [α- 32 P]GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns

Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

Directory of Open Access Journals (Sweden)

Dullat Harpreet K

2011-03-01

Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

Down-regulation of a chitin synthase a gene by RNA interference enhances pathogenicity of Beauveria bassiana ANU1 against Spodoptera exigua (HÜBNER).

Science.gov (United States)

Lee, Jung-Bok; Kim, Hyun Soo; Park, Youngjin

2017-02-01

Chitin synthase (CHS) is an important enzymatic component, which is required for chitin formation in the cuticles and cuticular linings of other tissues in insects. CHSs have been divided into two classes, classes A and B, based on their amino acid sequence similarities and functions. Class A CHS (CHS-A) is specifically expressed in the epidermis and related ectodermal cells such as tracheal cells, while class B CHS (CHS-B) is expressed in gut epithelial cells that produce peritrophic matrices. In this study, we cloned the CHS-A gene from the beet armyworm, Spodoptera exigua (SeCHS-A). The SeCHS-A contains an open reading frame of 4,698 nucleotides, encoding a protein of 1,565 amino acids with a predicted molecular mass of approximately 177.8 kDa. The SeCHS-A mRNA was expressed in all developmental stages and specifically in the epidermis and tracheae tissue by quantitative real-time-PCR analysis. Expression of SeCHS-A gene was suppressed by feeding double-stranded RNA (dsCHS-A, 400 ng/larva) in the third instar larvae of S. exigua. Suppression of the SeCHS-A gene expression significantly increased 35% of mortality on pupation of S. exigua. Also, the third instar larvae fed with dsCHS-A significantly increased susceptibility to entomopathogenic fungi, Beauveria bassiana ANU1 at 3 days after treatment. These results suggest that the SeCHS-A gene plays an important role in development of S. exigua and RNA interference may apply to effective pest control with B. bassiana. © 2017 Wiley Periodicals, Inc.

Molecular Characterization and Expression Analysis of Insulin-like Growth Factor-1 and Insulin-like Growth Factor Binding Protein-1 Genes in Qinghai-Tibet Plateau and Lowland

Directory of Open Access Journals (Sweden)

Ya-bing Chen

2015-01-01

Full Text Available Insulin-like growth factor-1 (IGF-1 and insulin-like growth factor binding protein-1 (IGFBP-1 play a pivotal role in regulating cellular hypoxic response. In this study, we cloned and characterized the genes encoding IGF-1 and IGFBP-1 to improve the current knowledge on their roles in highland Bos grunniens (Yak. We also compared their expression levels in the liver and kidney tissues between yaks and lowland cattle. We obtained full-length 465 bp IGF-1 and 792 bp IGFBP-1, encoding 154 amino acids (AA IGF-1, and 263 AA IGFBP-1 protein, respectively using reverse transcriptase-polyerase chain reaction (RT-PCR technology. Analysis of their corresponding amino acid sequences showed a high identity between B. grunniens and lowland mammals. Moreover, the two genes were proved to be widely distributed in the examined tissues through expression pattern analysis. Real-time PCR results revealed that IGF-1 expression was higher in the liver and kidney tissues in B. grunniens than in Bos taurus (p<0.05. The IGFBP-1 gene was expressed at a higher level in the liver (p<0.05 of B. taurus than B. grunniens, but it has a similar expression level in the kidneys of the two species. These results indicated that upregulated IGF-1 and downregulated IGFBP-1 are associated with hypoxia adaptive response in B. grunniens.

Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

International Nuclear Information System (INIS)

Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

2008-01-01

Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

Monoterpene synthases from common sage (Salvia officinalis)

Energy Technology Data Exchange (ETDEWEB)

Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

1999-01-01

cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

Cloning and functional characterization of β-phellandrene synthase from Lavandula angustifolia.

Science.gov (United States)

Demissie, Zerihun A; Sarker, Lukman S; Mahmoud, Soheil S

2011-04-01

En route to building genomics resources for Lavandula, we have obtained over 14,000 ESTs for leaves and flowers of L. angustifolia, a major essential oil crop, and identified a number of previously uncharacterized terpene synthase (TPS) genes. Here we report the cloning, expression in E. coli, and functional characterization of β-phellandrene synthase, LaβPHLS. The ORF--excluding the transit peptide--for this gene encoded a 62.3 kDa protein that contained all conserved motifs present in plant TPSs. Expression in bacteria resulted in the production of a soluble protein that was purified by Ni-NTA agarose affinity chromatography. While the recombinant LaβPHLS did not utilize FPP as a substrate, it converted GPP (the preferred substrate) and NPP into β-phellandrene as the major product, with K (m) and k (cat) of 6.55 μM and 1.75 × 10(-2) s(-1), respectively, for GPP. The LaβPHLS transcripts were highly abundant in young leaves where β-phellandrene is produced, but were barely detectable in flowers and older leaves, where β-phellandrene is not synthesized in significant quantities. This data indicate that β-phellandrene biosynthesis is transcriptionally and developmentally regulated. We also cloned and expressed in E. coli a second TPS-like protein, LaTPS-I, that lacks an internal stretch of 73 amino acids, including the signature DDxxD divalent metal binding motif, compared to other plant TPSs. The recombinant LaTPS-I did not produce detectable products in vitro when assayed with GPP, NPP or FPP as substrates. The lack of activity is most likely due to the absence of catalytically important amino acid residues within the missing region.

ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

Science.gov (United States)

Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

2008-05-01

The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

Role of Lysyl oxidase-like 1 gene polymorphisms in Pakistani patients with pseudoexfoliative glaucoma

NARCIS (Netherlands)

Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.

2012-01-01

PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been

Disruption of ATCSLD5 results in reduced growth, reduced xylan and homogalacturonan synthase activity and altered xylan occurrence in Arabidopsis

DEFF Research Database (Denmark)

Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper

2007-01-01

Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...

First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

Directory of Open Access Journals (Sweden)

Patrick C Y Woo

Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

Science.gov (United States)

Lane, Courtney E; Benton, Michael G

2015-12-01

A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

International Nuclear Information System (INIS)

Mohareer, Krishnaveni; Sahdev, Sudhir; Hasnain, Seyed E.

2011-01-01

Highlights: ► Baculovirus p35 is regulated by both viral and host factors. ► Baculovirus p35 is negatively regulated by SfP53-like factor. ► Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at −1401 while P53 motif is at −1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda

Energy Technology Data Exchange (ETDEWEB)

Mohareer, Krishnaveni [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Sahdev, Sudhir [Laboratory of Molecular and Cell Biology, Center for DNA Fingerprinting and Diagnostics, Hyderabad 500001 (India); Ranbaxy Pharmaceuticals, Gurgaon, New Delhi (India); Hasnain, Seyed E., E-mail: seh@bioschool.iitd.ac.in [Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046 (India); Kusuma School of Biological Sciences, IIT Delhi, New Delhi 110016 (India); ILBS, Vasant Kunj, New Delhi (India); King Saud University, Riyadh, KSA (Saudi Arabia)

2011-11-04

Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors, which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.

Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

Energy Technology Data Exchange (ETDEWEB)

Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota [Neutron Science Research Center, Japan Atomic Energy Research Institute, 2-4 Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Shoyama, Yukihiro; Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

2005-08-01

Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.

Transplantation of Gene-Edited Hepatocyte-like Cells Modestly Improves Survival of Arginase-1-Deficient Mice

Directory of Open Access Journals (Sweden)

Yuan Yan Sin

2018-03-01

Full Text Available Progress in gene editing research has been accelerated by utilizing engineered nucleases in combination with induced pluripotent stem cell (iPSC technology. Here, we report transcription activator-like effector nuclease (TALEN-mediated reincorporation of Arg1 exons 7 and 8 in iPSCs derived from arginase-1-deficient mice possessing Arg1Δ alleles lacking these terminal exons. The edited cells could be induced to differentiate into hepatocyte-like cells (iHLCs in vitro and were subsequently used for transplantation into our previously described (Sin et al., PLoS ONE 2013 tamoxifen-inducible Arg1-Cre arginase-1-deficient mouse model. While successful gene-targeted repair was achieved in iPSCs containing Arg1Δ alleles, only minimal restoration of urea cycle function could be observed in the iHLC-transplanted mice compared to control mice, and survival in this lethal model was extended by up to a week in some mice. The partially rescued phenotype may be due to inadequate regenerative capacity of arginase-1-expressing cells in the correct metabolic zones. Technical hurdles exist and will need to be overcome for gene-edited iPSC to iHLC rescue of arginase-1 deficiency, a rare urea cycle disorder.

A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

Science.gov (United States)

Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

2016-12-28

The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

International Nuclear Information System (INIS)

Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

2006-01-01

The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

Energy Technology Data Exchange (ETDEWEB)

Rinker, Torri E.; Baker, Scott E.

2007-01-29

Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

Topoisomerase 1 Inhibition Promotes Cyclic GMP-AMP Synthase-Dependent Antiviral Responses

Directory of Open Access Journals (Sweden)

Geneviève Pèépin

2017-10-01

Full Text Available Inflammatory responses, while essential for pathogen clearance, can also be deleterious to the host. Chemical inhibition of topoisomerase 1 (Top1 by low-dose camptothecin (CPT can suppress transcriptional induction of antiviral and inflammatory genes and protect animals from excessive and damaging inflammatory responses. We describe the unexpected finding that minor DNA damage from topoisomerase 1 inhibition with low-dose CPT can trigger a strong antiviral immune response through cyclic GMP-AMP synthase (cGAS detection of cytoplasmic DNA. This argues against CPT having only anti-inflammatory activity. Furthermore, expression of the simian virus 40 (SV40 large T antigen was paramount to the proinflammatory antiviral activity of CPT, as it potentiated cytoplasmic DNA leakage and subsequent cGAS recruitment in human and mouse cell lines. This work suggests that the capacity of Top1 inhibitors to blunt inflammatory responses can be counteracted by viral oncogenes and that this should be taken into account for their therapeutic development.

An Arabidopsis callose synthase

DEFF Research Database (Denmark)

Ostergaard, Lars; Petersen, Morten; Mattsson, Ole

2002-01-01

in the Arabidopsis mpk4 mutant which exhibits systemic acquired resistance (SAR), elevated beta-1,3-glucan synthase activity, and increased callose levels. In addition, AtGsl5 is a likely target of salicylic acid (SA)-dependent SAR, since AtGsl5 mRNA accumulation is induced by SA in wild-type plants, while...... expression of the nahG salicylate hydroxylase reduces AtGsl5 mRNA levels in the mpk4 mutant. These results indicate that AtGsl5 is likely involved in callose synthesis in flowering tissues and in the mpk4 mutant....

Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

DEFF Research Database (Denmark)

Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

2008-01-01

of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

OpenAIRE

Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

2013-01-01

Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

International Nuclear Information System (INIS)

Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

2017-01-01

Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

Application of Various Statistical Models to Explore Gene-Gene Interactions in Folate, Xenobiotic, Toll-Like Receptor and STAT4 Pathways that Modulate Susceptibility to Systemic Lupus Erythematosus.

Science.gov (United States)

Rupasree, Yedluri; Naushad, Shaik Mohammad; Varshaa, Ravi; Mahalakshmi, Govindaraj Swathika; Kumaraswami, Konda; Rajasekhar, Liza; Kutala, Vijay Kumar

2016-02-01

In view of our previous studies showing an independent association of genetic polymorphisms in folate, xenobiotic, and toll-like receptor (TLR) pathways with the risk for systemic lupus erythematosus (SLE), we have developed three statistical models to delineate complex gene-gene interactions between folate, xenobiotic, TLR, and signal transducer and activator of transcription 4 (STAT4) signaling pathways in association with the molecular pathophysiology of SLE. We developed additive, multifactor dimensionality reduction (MDR), and artificial neural network (ANN) models. The additive model, although the simplest, suggested a moderate predictability of 30 polymorphisms of these four pathways (area under the curve [AUC] 0.66). MDR analysis revealed significant gene-gene interactions among glutathione-S-transferase (GST)T1 and STAT4 (rs3821236 and rs7574865) polymorphisms, which account for moderate predictability of SLE. The MDR model for specific auto-antibodies revealed the importance of gene-gene interactions among cytochrome P450, family1, subfamily A, polypeptide 1 (CYP1A1) m1, catechol-O-methyltransferase (COMT) H108L, solute carrier family 19 (folate transporter), member 1 (SLC19A1) G80A, estrogen receptor 1 (ESR1), TLR5, 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), thymidylate synthase (TYMS). and STAT4 polymorphisms. The ANN model for disease prediction showed reasonably good predictability of SLE risk with 30 polymorphisms (AUC 0.76). These polymorphisms contribute towards the production of SSB and anti-dsDNA antibodies to the extent of 48 and 40%, respectively, while their contribution for the production of antiRNP, SSA, and anti-cardiolipin antibodies varies between 20 and 30%. The current study highlighted the importance of genetic polymorphisms in folate, xenobiotic, TLR, and STAT4 signaling pathways as moderate predictors of SLE risk and delineates the molecular pathophysiology associated with these single nucleotide

Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

Directory of Open Access Journals (Sweden)

Linda Koshy

2008-01-01

Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

Cyclophilin D Promotes Brain Mitochondrial F1FO ATP Synthase Dysfunction in Aging Mice.

Science.gov (United States)

Gauba, Esha; Guo, Lan; Du, Heng

2017-01-01

Brain aging is the known strongest risk factor for Alzheimer's disease (AD). In recent years, mitochondrial deficits have been proposed to be a common mechanism linking brain aging to AD. Therefore, to elucidate the causative mechanisms of mitochondrial dysfunction in aging brains is of paramount importance for our understanding of the pathogenesis of AD, in particular its sporadic form. Cyclophilin D (CypD) is a specific mitochondrial protein. Recent studies have shown that F1FO ATP synthase oligomycin sensitivity conferring protein (OSCP) is a binding partner of CypD. The interaction of CypD with OSCP modulates F1FO ATP synthase function and mediates mitochondrial permeability transition pore (mPTP) opening. Here, we have found that increased CypD expression, enhanced CypD/OSCP interaction, and selective loss of OSCP are prominent brain mitochondrial changes in aging mice. Along with these changes, brain mitochondria from the aging mice demonstrated decreased F1FO ATP synthase activity and defective F1FO complex coupling. In contrast, CypD deficient mice exhibited substantially mitigated brain mitochondrial F1FO ATP synthase dysfunction with relatively preserved mitochondrial function during aging. Interestingly, the aging-related OSCP loss was also dramatically attenuated by CypD depletion. Therefore, the simplest interpretation of this study is that CypD promotes F1FO ATP synthase dysfunction and the resultant mitochondrial deficits in aging brains. In addition, in view of CypD and F1FO ATP synthase alterations seen in AD brains, the results further suggest that CypD-mediated F1FO ATP synthase deregulation is a shared mechanism linking mitochondrial deficits in brain aging and AD.

Loop-mediated isothermal amplification: Rapid and sensitive detection of the antibiotic resistance gene ISAba1-blaOXA-51-like in Acinetobacter baumannii.

Science.gov (United States)

Mu, Xiaoqin; Nakano, Ryuichi; Nakano, Akiyo; Ubagai, Tsuneyuki; Kikuchi-Ueda, Takane; Tansho-Nagakawa, Shigeru; Kikuchi, Hirotoshi; Kamoshida, Go; Endo, Shiro; Yano, Hisakazu; Ono, Yasuo

2016-02-01

Carbapenem-resistant Acinetobacter baumannii, which are mainly induced by the production of OXA-type β-lactamases, are among the leading causes of nosocomial infections worldwide. Among the β-lactamase genes, the presence of the OXA-51-like gene carrying the upstream insertion sequence, ISAba1, was found to be one of the most prevalent carbapenem resistance mechanisms utilized by these bacteria. Consequently, it is necessary to develop a rapid detection method for ISAba1-blaOXA-51-like sequence for the timely and appropriate antibiotic treatment of A. baumannii infection. In this study, a loop-mediated isothermal amplification (LAMP) assay was optimized for ISAba1-blaOXA-51-like detection. The LAMP primer set was designed to recognize distinct sequences in the ISAba1-blaOXA-51-like gene and could amplify the gene within 25 min at an isothermal temperature of 60°C. This LAMP assay was able to detect the ISAba1-blaOXA-51-like gene with high specificity; in addition, no cross-reactivity was observed for other types of β-lactamase producers (OXA-23-like, OXA-40-like, OXA-58-like, and IMP-1), as indicated by the absence of false positive or false negative results. The detection limit for this assay was found to be 10(0)CFU per tube which was 100-fold more sensitive than a polymerase chain reaction assay for ISAba1-blaOXA-51-like detection. Furthermore, the LAMP assay provided swift detection of the ISAba1-blaOXA-51-like gene, even directly from clinical specimens. In summary, we have described a new, rapid assay for the detection of the ISAba1-blaOXA-51-like gene from A. baumannii that could be useful in a clinical setting. This method might facilitate epidemiological studies and allow monitoring of the emergence of drug resistant strains. Copyright © 2015 Elsevier B.V. All rights reserved.

Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

Science.gov (United States)

González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

2016-02-01

Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

[PREPARATION OF HUMAN TISSUE PROTEIN EXTRACTS ENRICHED WITH THE SPHINGOMYELIN SYNTHASE 1].

Science.gov (United States)

Sudarkina, O Yu; Dergunova, L V

2015-01-01

Sphingomyelin synthase 1 (SMS 1) catalyzes sphingomyelin biosynthesis in eukaryotic cells. We previously studied the structure of the human SGMS1 gene, which encodes the enzyme and its numerous transcripts. The tissue-specific expression of the transcripts was also described. Analysis of the SMS1 protein expression in human tissues using immunoblotting of tissue extracts prepared in the RIPA (Radio Immuno-Precipitation Assay) buffer revealed a weak signal in renal cortex, testis, lung, and no signal in placenta and lymphatic node. In this work, a new method of preparation of the tissue protein extracts enriched with SMS1 was suggested. The method based on the consecutive extraction with a buffer containing 0.05 and 1 mg/ml of the Quillaja saponaria saponin allowed SMS1 to be detected in all tissues tested. The SMS1 content in the saponin extract of kidney cortex is about 12-fold higher compared to the RIPA extraction procedure.

Subunit rotation in a single FoF1-ATP synthase in a living bacterium monitored by FRET

Science.gov (United States)

Seyfert, K.; Oosaka, T.; Yaginuma, H.; Ernst, S.; Noji, H.; Iino, R.; Börsch, M.

2011-03-01

FoF1-ATP synthase is the ubiquitous membrane-bound enzyme in mitochondria, chloroplasts and bacteria which provides the 'chemical energy currency' adenosine triphosphate (ATP) for cellular processes. In Escherichia coli ATP synthesis is driven by a proton motive force (PMF) comprising a proton concentration difference ΔpH plus an electric potential ΔΨ across the lipid membrane. Single-molecule in vitro experiments have confirmed that proton-driven subunit rotation within FoF1-ATP synthase is associated with ATP synthesis. Based on intramolecular distance measurements by single-molecule fluorescence resonance energy transfer (FRET) the kinetics of subunit rotation and the step sizes of the different rotor parts have been unraveled. However, these experiments were accomplished in the presence of a PMF consisting of a maximum ΔpH ~ 4 and an unknown ΔΨ. In contrast, in living bacteria the maximum ΔpH across the plasma membrane is likely 0.75, and ΔΨ has been measured between -80 and -140 mV. Thus the problem of in vivo catalytic turnover rates, or the in vivo rotational speed in single FoF1-ATP synthases, respectively, has to be solved. In addition, the absolute number of functional enzymes in a single bacterium required to maintain the high ATP levels has to be determined. We report our progress of measuring subunit rotation in single FoF1-ATP synthases in vitro and in vivo, which was enabled by a new labeling approach for single-molecule FRET measurements.

Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

Science.gov (United States)

El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

2016-11-01

Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

DEFF Research Database (Denmark)

Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

1994-01-01

To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

Niemann-Pick C1 like 1 gene expression is down-regulated by LXR activators in the intestine

International Nuclear Information System (INIS)

Duval, Caroline; Touche, Veronique; Tailleux, Anne; Fruchart, Jean-Charles; Fievet, Catherine; Clavey, Veronique; Staels, Bart; Lestavel, Sophie

2006-01-01

Niemann-Pick C1 like 1 (NPC1L1) is a protein critical for intestinal cholesterol absorption. The nuclear receptors peroxisome proliferator-activated receptor alpha (PPARα) and liver X receptors (LXRα and LXRβ) are major regulators of cholesterol homeostasis and their activation results in a reduced absorption of intestinal cholesterol. The goal of this study was to define the role of PPARα and LXR nuclear receptors in the regulation of NPC1L1 gene expression. We show that LXR activators down-regulate NPC1L1 mRNA levels in the human enterocyte cell line Caco-2/TC7, whereas PPARα ligands have no effect. Furthermore, NPC1L1 mRNA levels are decreased in vivo, in duodenum of mice treated with the LXR agonist T0901317. In conclusion, the present study identifies NPC1L1 as a novel LXR target gene further supporting a crucial role of LXR in intestinal cholesterol homeostasis

Influence of gibberellin and daminozide on the expression of terpene synthases and on monoterpenes in common sage (Salvia officinalis).

Science.gov (United States)

Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes

2010-07-01

Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

Science.gov (United States)

Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

2017-07-01

The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

Science.gov (United States)

Xiang, Lin; Zhao, Kaige; Chen, Longqing

2010-01-01

Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Neuronal Nitric Oxide Synthase (NOS1) Polymorphisms Interact with Financial Hardship to Affect Depression Risk

Science.gov (United States)

Sarginson, Jane E; Deakin, JF William; Anderson, Ian M; Downey, Darragh; Thomas, Emma; Elliott, Rebecca; Juhasz, Gabriella

2014-01-01

There is increasing evidence that genetic factors have a role in differential susceptibility to depression in response to severe or chronic adversity. Studies in animals suggest that nitric oxide (NO) signalling has a key role in depression-like behavioural responses to stress. This study investigated whether genetic variation in the brain-expressed nitric oxide synthase gene NOS1 modifies the relationship between psychosocial stress and current depression score. We recruited a population sample of 1222 individuals who provided DNA and questionnaire data on symptoms and stress. Scores on the List of Life-Threatening Experiences (LTE) questionnaire for the last year and self-rated current financial hardship were used as measures of recent/ongoing psychosocial stress. Twenty SNPs were genotyped. Significant associations between eight NOS1 SNPs, comprising two regional haplotypes, and current depression score were identified that survived correction for multiple testing when current financial hardship was used as the interaction term. A smaller three-SNP haplotypes (rs10507279, rs1004356 and rs3782218) located in a regulatory region of NOS1 showed one of the strongest effects, with the A-C-T haplotype associating with higher depression scores at low adversity levels but lower depression scores at higher adversity levels (p=2.3E-05). These results suggest that NOS1 SNPs interact with exposure to economic and psychosocial stressors to alter individual's susceptibility to depression. PMID:24917196

Neuronal nitric oxide synthase (NOS1) polymorphisms interact with financial hardship to affect depression risk.

Science.gov (United States)

Sarginson, Jane E; Deakin, J F William; Anderson, Ian M; Downey, Darragh; Thomas, Emma; Elliott, Rebecca; Juhasz, Gabriella

2014-11-01

There is increasing evidence that genetic factors have a role in differential susceptibility to depression in response to severe or chronic adversity. Studies in animals suggest that nitric oxide (NO) signalling has a key role in depression-like behavioural responses to stress. This study investigated whether genetic variation in the brain-expressed nitric oxide synthase gene NOS1 modifies the relationship between psychosocial stress and current depression score. We recruited a population sample of 1222 individuals who provided DNA and questionnaire data on symptoms and stress. Scores on the List of Life-Threatening Experiences (LTE) questionnaire for the last year and self-rated current financial hardship were used as measures of recent/ongoing psychosocial stress. Twenty SNPs were genotyped. Significant associations between eight NOS1 SNPs, comprising two regional haplotypes, and current depression score were identified that survived correction for multiple testing when current financial hardship was used as the interaction term. A smaller three-SNP haplotypes (rs10507279, rs1004356 and rs3782218) located in a regulatory region of NOS1 showed one of the strongest effects, with the A-C-T haplotype associating with higher depression scores at low adversity levels but lower depression scores at higher adversity levels (p=2.3E-05). These results suggest that NOS1 SNPs interact with exposure to economic and psychosocial stressors to alter individual's susceptibility to depression.

Full Genome Characterization of Novel DS-1-Like G8P[8] Rotavirus Strains that Have Emerged in Thailand: Reassortment of Bovine and Human Rotavirus Gene Segments in Emerging DS-1-Like Intergenogroup Reassortant Strains.

Directory of Open Access Journals (Sweden)

Ratana Tacharoenmuang

Full Text Available The emergence and rapid spread of unusual DS-1-like intergenogroup reassortant rotavirus strains have been recently reported in Asia, Australia, and Europe. During rotavirus surveillance in Thailand in 2013-2014, novel DS-1-like intergenogroup reassortant strains having G8P[8] genotypes (i.e., strains KKL-17, PCB-79, PCB-84, PCB-85, PCB-103, SKT-107, SWL-12, NP-130, PCB-656, SKT-457, SSKT-269, and SSL-55 were identified in stool samples from hospitalized children with severe diarrhea. In this study, we determined and characterized the complete genomes of these 12 strains (seven strains, KKL-17, PCB-79, PCB-84, PCB-85, PCB-103, SKT-107, and SWL-12, found in 2013 (2013 strains, and five, NP-130, PCB-656, SKT-457, SSKT-269, and SSL-55, in 2014 (2014 strains. On full genomic analysis, all 12 strains showed a unique genotype constellation comprising a mixture of genogroup 1 and 2 genes: G8-P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2. With the exception of the G genotype, the unique genotype constellation of the 12 strains (P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2 was found to be shared with DS-1-like intergenogroup reassortant strains. On phylogenetic analysis, six of the 11 genes of the 2013 strains (VP4, VP2, VP3, NSP1, NSP3, and NSP5 appeared to have originated from DS-1-like intergenogroup reassortant strains, while the remaining four (VP7, VP6, VP1, and NSP2 and one (NSP4 gene appeared to be of bovine and human origin, respectively. Thus, the 2013 strains appeared to be reassortant strains as to DS-1-like intergenogroup reassortant, bovine, bovine-like human, and/or human rotaviruses. On the other hand, five of the 11 genes of the 2014 strains (VP4, VP2, VP3, NSP1, and NSP3 appeared to have originated from DS-1-like intergenogroup reassortant strains, while three (VP7, VP1, and NSP2 and one (NSP4 were assumed to be of bovine and human origin, respectively. Notably, the remaining two genes, VP6 and NSP5, of the 2014 strains appeared to have originated from locally

Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

Science.gov (United States)

Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

2007-11-01

Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.

Directory of Open Access Journals (Sweden)

Imke Schmitt

Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.

Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

Directory of Open Access Journals (Sweden)

Ro Dae-Kyun

2009-07-01

Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

Evolution of the F0F1 ATP synthase complex in light of the patchy distribution of different bioenergetic pathways across prokaryotes.

Directory of Open Access Journals (Sweden)

Vassiliki Lila Koumandou

2014-09-01

Full Text Available Bacteria and archaea are characterized by an amazing metabolic diversity, which allows them to persist in diverse and often extreme habitats. Apart from oxygenic photosynthesis and oxidative phosphorylation, well-studied processes from chloroplasts and mitochondria of plants and animals, prokaryotes utilize various chemo- or lithotrophic modes, such as anoxygenic photosynthesis, iron oxidation and reduction, sulfate reduction, and methanogenesis. Most bioenergetic pathways have a similar general structure, with an electron transport chain composed of protein complexes acting as electron donors and acceptors, as well as a central cytochrome complex, mobile electron carriers, and an ATP synthase. While each pathway has been studied in considerable detail in isolation, not much is known about their relative evolutionary relationships. Wanting to address how this metabolic diversity evolved, we mapped the distribution of nine bioenergetic modes on a phylogenetic tree based on 16S rRNA sequences from 272 species representing the full diversity of prokaryotic lineages. This highlights the patchy distribution of many pathways across different lineages, and suggests either up to 26 independent origins or 17 horizontal gene transfer events. Next, we used comparative genomics and phylogenetic analysis of all subunits of the F0F1 ATP synthase, common to most bacterial lineages regardless of their bioenergetic mode. Our results indicate an ancient origin of this protein complex, and no clustering based on bioenergetic mode, which suggests that no special modifications are needed for the ATP synthase to work with different electron transport chains. Moreover, examination of the ATP synthase genetic locus indicates various gene rearrangements in the different bacterial lineages, ancient duplications of atpI and of the beta subunit of the F0 subcomplex, as well as more recent stochastic lineage-specific and species-specific duplications of all subunits. We

Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

International Nuclear Information System (INIS)

Taguchi, Chiho; Taura, Futoshi; Tamada, Taro; Shoyama, Yoshinari; Shoyama, Yukihiro; Tanaka, Hiroyuki; Kuroki, Ryota; Morimoto, Satoshi

2008-01-01

Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2 1 2 1 2 1 , with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1

Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

Energy Technology Data Exchange (ETDEWEB)

Taguchi, Chiho [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Taura, Futoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Tamada, Taro; Shoyama, Yoshinari [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Shoyama, Yukihiro; Tanaka, Hiroyuki [Faculty of Pharmaceutical Sciences, Kyushu University (Japan); Kuroki, Ryota [Quantum Beam Science Directorate, Japan Atomic Energy Agency (Japan); Morimoto, Satoshi [Faculty of Pharmaceutical Sciences, Kyushu University (Japan)

2008-03-01

Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b = 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.

Astakine LvAST binds to the β subunit of F1-ATP synthase and likely plays a role in white shrimp Litopeneaus vannamei defense against white spot syndrome virus.

Science.gov (United States)

Liang, Gao-Feng; Liang, Yan; Xue, Qinggang; Lu, Jin-Feng; Cheng, Jun-Jun; Huang, Jie

2015-03-01

Cytokines play a critical role in innate and adaptive immunity. Astakines represent a group of invertebrate cytokines that are related to vertebrate prokineticin and function in promoting hematopoiesis in crustaceans. We have identified an astakine from the white shrimp Litopeneaus vannamei and named it LvAST in a previous research. In the present research, we investigated the interactions among LvAST, the envelope protein VP37 of white spot syndrome virus (i.e., WSSV), and the β subunit of F1-ATP synthase (ATPsyn-β) of the white shrimp (i.e., BP53) using binding assays and co-precipitations. We also examined the effects of LvAST on shrimp susceptibility to WSSV. We found that LvAST and VP37 competitively bound to BP53, but did not bind to each other. Shrimps that had been injected with recombinant LvAST exhibited significantly lower mortality and longer survival time in experimental infections by WSSV. In contrast, shrimps whose LvAST gene expression had been inhibited by RNA interference showed significantly higher WSSV infection intensity and shorter survival time following viral challenges. These results suggested that LvAST and WSSV both likely use ATPsyn-β as a receptor and LvAST plays a role in shrimp defense against WSSV infection. This represented the first research showing the involvement of astakines in host antiviral immunity. Copyright © 2014 Elsevier Ltd. All rights reserved.

An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

Science.gov (United States)

Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.

Science.gov (United States)

Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng

2017-03-01

Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.

Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

International Nuclear Information System (INIS)

Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

2008-01-01

Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

Homocysteine threshold value based on cystathionine beta synthase and paraoxonase 1 activities in mice.

Science.gov (United States)

Hamelet, J; Aït-Yahya-Graison, E; Matulewicz, E; Noll, C; Badel-Chagnon, A; Camproux, A-C; Demuth, K; Paul, J-L; Delabar, J M; Janel, N

2007-12-01

Hyperhomocysteinaemia is a metabolic disorder associated with the development of premature atherosclerosis. Among the determinants which predispose to premature thromboembolic and atherothrombotic events, serum activity of paraoxonase 1, mainly synthesized in the liver, has been shown to be a predictor of cardiovascular disease and to be negatively correlated with serum homocysteine levels in human. Even though treatments of hyperhomocysteinaemic patients ongoing cardiovascular complications are commonly used, it still remains unclear above which homocysteine level a preventive therapy should be started. In order to establish a threshold of plasma homocysteine concentration we have analyzed the hepatic cystathionine beta synthase and paraoxonase 1 activities in a moderate to intermediate murine model of hyperhomocysteinaemia. Using wild type and heterozygous cystathionine beta synthase deficient mice fed a methionine enriched diet or a control diet, we first studied the link between cystathionine beta synthase and paraoxonase 1 activities and plasma homocysteine concentration. Among the animals used in this study, we observed a negative correlation between plasma homocysteine level and cystathionine beta synthase activity (rho=-0.52, P=0.0008) or paraoxonase 1 activity (rho=-0.49, P=0.002). Starting from these results, a homocysteine cut-off value of 15 microm has been found for both cystathionine beta synthase (P=0.0003) and paraoxonase 1 (P=0.0007) activities. Our results suggest that both cystathionine beta synthase and paraoxonase 1 activities are significantly decreased in mice with a plasma homocysteine value greater than 15 microm. In an attempt to set up preventive treatment for cardiovascular disease our results indicate that treatments should be started from 15 microm of plasma homocysteine.

Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

International Nuclear Information System (INIS)

Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

2014-01-01

Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

Energy Technology Data Exchange (ETDEWEB)

Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

2014-07-01

Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

1-Aminocyclopropane-1-carboxylic acid (ACC) concentration and ACC synthase expression in soybean roots, root tips, and soybean cyst nematode (Heterodera glycines)-infected roots.

Science.gov (United States)

Tucker, Mark L; Xue, Ping; Yang, Ronghui

2010-01-01

Colonization of plant roots by root knot and cyst nematodes requires a functional ethylene response pathway. However, ethylene plays many roles in root development and whether its role in nematode colonization is direct or indirect, for example lateral root initiation or root hair growth, is not known. The temporal requirement for ethylene and localized synthesis of ethylene during the life span of soybean cyst nematode (SCN) on soybean roots was further investigated. Although a significant increase in ethylene evolution was not detected from SCN-colonized roots, the concentration of the immediate precursor to ethylene, 1-aminocyclopropane-1-carboxylic acid (ACC), was higher in SCN-colonized root pieces and root tips than in other parts of the root. Moreover, expression analysis of 17 ACC synthase (ACS) genes indicated that a select set of ACS genes is expressed in SCN-colonized root pieces that is clearly different from the set of genes expressed in non-colonized roots or root tips. Semi-quantitative real-time PCR indicated that ACS transcript accumulation correlates with the high concentration of ACC in root tips. In addition, an ACS-like sequence was found in the public SCN nucleotide database. Acquisition of a full-length sequence for this mRNA (accession GQ389647) and alignment with transcripts for other well-characterized ACS proteins indicated that the nematode sequence is missing a key element required for ACS activity and therefore probably is not a functional ACS. Moreover, no significant amount of ACC was found in any growth stage of SCN that was tested.

Suppression of a NAC-Like Transcription Factor Gene Improves Boron-Toxicity Tolerance in Rice1

Science.gov (United States)

Ochiai, Kumiko; Shimizu, Akifumi; Okumoto, Yutaka; Fujiwara, Toru; Matoh, Toru

2011-01-01

We identified a gene responsible for tolerance to boron (B) toxicity in rice (Oryza sativa), named BORON EXCESS TOLERANT1. Using recombinant inbred lines derived from the B-toxicity-sensitive indica-ecotype cultivar IR36 and the tolerant japonica-ecotype cultivar Nekken 1, the region responsible for tolerance to B toxicity was narrowed to 49 kb on chromosome 4. Eight genes are annotated in this region. The DNA sequence in this region was compared between the B-toxicity-sensitive japonica cultivar Wataribune and the B-toxicity-tolerant japonica cultivar Nipponbare by eco-TILLING analysis and revealed a one-base insertion mutation in the open reading frame sequence of the gene Os04g0477300. The gene encodes a NAC (NAM, ATAF, and CUC)-like transcription factor and the function of the transcript is abolished in B-toxicity-tolerant cultivars. Transgenic plants in which the expression of Os04g0477300 is abolished by RNA interference gain tolerance to B toxicity. PMID:21543724

Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

Directory of Open Access Journals (Sweden)

Emilia Wilmowicz

2016-03-01

Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

Science.gov (United States)

Ghosh, Subhabrata; Mandi, Swati Sen

2015-07-25

Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants.

Science.gov (United States)

Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai

2017-02-01

Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

International Nuclear Information System (INIS)

Dotson, G.D.; Woodard, R.W.

1994-01-01

The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O

Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

Energy Technology Data Exchange (ETDEWEB)

Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)

1994-12-01

The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

Sbg1 Is a Novel Regulator for the Localization of the β-Glucan Synthase Bgs1 in Fission Yeast.

Directory of Open Access Journals (Sweden)

Reshma Davidson

Full Text Available Glucan synthases synthesize glucans, complex polysaccharides that are the major components in fungal cell walls and division septa. Studying regulation of glucan synthases is important as they are essential for fungal cell survival and thus popular targets for anti-fungal drugs. Linear 1,3-β-glucan is the main component of primary septum and is synthesized by the conserved β-glucan synthase Bgs1 in fission yeast cytokinesis. It is known that Rho1 GTPase regulates Bgs1 catalytic activity and the F-BAR protein Cdc15 plays a role in Bgs1 delivery to the plasma membrane. Here we characterize a novel protein Sbg1 that is present in a complex with Bgs1 and regulates its protein levels and localization. Sbg1 is essential for contractile-ring constriction and septum formation during cytokinesis. Sbg1 and Bgs1 physically interact and are interdependent for localization to the plasma membrane. Bgs1 is less stable and/or mis-targeted to vacuoles in sbg1 mutants. Moreover, Sbg1 plays an earlier and more important role in Bgs1 trafficking and localization than Cdc15. Together, our data reveal a new mode of regulation for the essential β-glucan synthase Bgs1 by the novel protein Sbg1.

Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

Directory of Open Access Journals (Sweden)

Kawamukai Makoto

2004-11-01

Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

Reassortant H9N2 influenza viruses containing H5N1-like PB1 genes isolated from black-billed magpies in Southern China.

Directory of Open Access Journals (Sweden)

Guoying Dong

Full Text Available H9N2 influenza A viruses have become endemic in different types of terrestrial poultry and wild birds in Asia, and are occasionally transmitted to humans and pigs. To evaluate the role of black-billed magpies (Pica pica in the evolution of influenza A virus, we conducted two epidemic surveys on avian influenza viruses in wild black-billed magpies in Guangxi, China in 2005 and characterized three isolated black-billed magpie H9N2 viruses (BbM viruses. Phylogenetic analysis indicated that three BbM viruses were almost identical with 99.7 to 100% nucleotide homology in their whole genomes, and were reassortants containing BJ94-like (Ck/BJ/1/94 HA, NA, M, and NS genes, SH/F/98-like (Ck/SH/F/98 PB2, PA, and NP genes, and H5N1-like (Ck/YN/1252/03, clade 1 PB1 genes. Genetic analysis showed that BbM viruses were most likely the result of multiple reassortments between co-circulating H9N2-like and H5N1-like viruses, and were genetically different from other H9N2 viruses because of the existence of H5N1-like PB1 genes. Genotypical analysis revealed that BbM viruses evolved from diverse sources and belonged to a novel genotype (B46 discovered in our recent study. Molecular analysis suggested that BbM viruses were likely low pathogenic reassortants. However, results of our pathogenicity study demonstrated that BbM viruses replicated efficiently in chickens and a mammalian mouse model but were not lethal for infected chickens and mice. Antigenic analysis showed that BbM viruses were antigenic heterologous with the H9N2 vaccine strain. Our study is probably the first report to document and characterize H9N2 influenza viruses isolated from black-billed magpies in southern China. Our results suggest that black-billed magpies were susceptible to H9N2 influenza viruses, which raise concerns over possible transmissions of reassortant H9N2 viruses among poultry and wild birds.

Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

Science.gov (United States)

Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

2013-09-06

Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular

Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

Science.gov (United States)

Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

2001-09-01

The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

A novel haplotype of low-frequency variants in the aldosterone synthase gene among northern Han Chinese with essential hypertension.

Science.gov (United States)

Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun

2017-09-01

Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.

[Blue-light induced expression of S-adenosy-L-homocysteine hydrolase-like gene in Mucor amphibiorum RCS1].

Science.gov (United States)

Gao, Ya; Wang, Shu; Fu, Mingjia; Zhong, Guolin

2013-09-04

To determine blue-light induced expression of S-adenosyl-L-homocysteine hydrolase-like (sahhl) gene in fungus Mucor amphibiorum RCS1. In the random process of PCR, a sequence of 555 bp was obtained from M. amphibiorum RCS1. The 555 bp sequence was labeled with digoxin to prepare the probe for northern hybridization. By northern hybridization, the transcription of sahhl gene was analyzed in M. amphibiorum RCS1 mycelia culture process from darkness to blue light to darkness. Simultaneously real-time PCR method was used to the sahhl gene expression analysis. Compared with the sequence of sahh gene from Homo sapiens, Mus musculus and some fungi species, a high homology of the 555 bp sequence was confirmed. Therefore, the preliminary confirmation has supported that the 555 bp sequence should be sahhl gene from M. amphibiorum RCS1. Under the dark pre-culture in 24 h, a large amounts of transcript of sahhl gene in the mycelia can be detected by northern hybridization and real-time PCR in the condition of 24 h blue light. But a large amounts of transcript of sahhl gene were not found in other detection for the dark pre-culture of 48 h, even though M. amphibiorum RCS1 mycelia were induced by blue light. Blue light can induce the expression of sahhl gene in the vigorous growth of M. amphibiorum RCS1 mycelia.

Association of Nitric Oxide Synthase2 gene polymorphisms with leprosy reactions in northern Indian population.

Science.gov (United States)

Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja

2017-07-01

The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.

Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

Directory of Open Access Journals (Sweden)

Linjie Wang

Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

NARCIS (Netherlands)

Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

2001-01-01

Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

Microsomal prostaglandin E synthase-1 in rheumatic diseases

Directory of Open Access Journals (Sweden)

Marina eKorotkova

2011-01-01

Full Text Available Microsomal prostaglandin E synthase-1 (mPGES-1 is a well recognized target for the development of novel anti-inflammatory drugs that can reduce symptoms of inflammation in rheumatic diseases and other inflammatory conditions. In this review, we focus on mPGES-1 in rheumatic diseases with the aim to cover the most recent advances in the understanding of mPGES-1 in rheumatoid arthritis, osteoarthritis and inflammatory myopathies. Novel findings regarding regulation of mPGES1 cell expression as well as enzyme inhibitors are also summarized.

Loss of Ceramide Synthases Elicits a PHA-4/FoxA-, SKN-1-, and Autophagy-Dependent Lifespan Extension in C. elegans

DEFF Research Database (Denmark)

Jensen, Mai-Britt Mosbech; Færgeman, Nils J.; Ejsing, Christer S.

2011-01-01

, these lipid species are recognized as bioactive signalling molecules involved in regulation of cell growth, differentiation, senescence, and apoptosis, and thus a delicate equilibrium between the levels of these interconvertible lipid species underlies the balance between cell survival and death. The C....... elegans genome comprises three ceramide synthase genes; hyl-1, hyl-2, and lagr-1. Here we show that functional loss of HYL-1 and LAGR-1 depletes 43:1;3 sphingolipids and extends lifespan in a PHA-4-, SKN-1-, and ATG-12-dependent manner. The transcription factors PHA-4 and SKN-1 as well as ATG-12, which...

RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

Directory of Open Access Journals (Sweden)

Smrati Mishra

Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

Directory of Open Access Journals (Sweden)

T. Angeline

2011-01-01

Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.

Science.gov (United States)

PORRA, R J; ROSS, B D

1965-03-01

1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

NARCIS (Netherlands)

Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

2001-01-01

Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

International Nuclear Information System (INIS)

Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.

2006-01-01

α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity

New gene targets for glucagon-like peptide-1 during embryonic development and in undifferentiated pluripotent cells.

Science.gov (United States)

Sanz, Carmen; Blázquez, Enrique

2011-09-01

In humans, glucagon-like peptide (GLP-1) functions during adult life as an incretin hormone with anorexigenic and antidiabetogenic properties. Also, the therapeutic potential of GLP-1 in preventing the adipocyte hyperplasia associated with obesity and in bolstering the maintenance of human mesenchymal stem cell (hMSC) stores by promoting the proliferation and cytoprotection of hMSC seems to be relevant. Since these observations suggest a role for GLP-1 during developmental processes, the aim of the present work was to characterize GLP-1 in early development as well as its gene targets in mouse embryonic stem (mES) cells. Mouse embryos E6, E8, and E10.5 and pluripotent mES were used for the inmunodetection of GLP-1 and GLP-1 receptor. Quantitative real-time PCR was used to determine the expression levels of GLP-1R in several tissues from E12.5 mouse embryos. Additionally, GLP-1 gene targets were studied in mES by multiple gene expression analyses. GLP-1 and its receptors were identified in mES and during embryonic development. In pluripotent mES, GLP-1 modified the expression of endodermal, ectodermal, and mesodermal gene markers as well as sonic hedgehog, noggin, members of the fibroblast and hepatic growth factor families, and others involved in pancreatic development. Additionally, GLP-1 promoted the expression of the antiapoptotic gene bcl2 and at the same time reduced proapoptotic caspase genes. Our results indicate that apart from the effects and therapeutic benefits of GLP-1 in adulthood, it may have additional gene targets in mES cells during embryonic life. Furthermore, the pathophysiological implications of GLP-1 imbalance in adulthood may have a counterpart during development.

Cloning and sequence analysis of putative type II fatty acid synthase ...

Indian Academy of Sciences (India)

Prakash

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

Presence of the glycogen synthase 1 (GYS1) mutation causing type 1 polysaccharide storage myopathy in continental European draught horse breeds.

Science.gov (United States)

Baird, J D; Valberg, S J; Anderson, S M; McCue, M E; Mickelson, J R

2010-11-13

The purpose of this study was to determine which continental European draught horse breeds harbour a mutation in the glycogen synthase 1 gene (GYS1) that is known to be responsible for type 1 polysaccharide storage myopathy in quarter horses and North American draught horses. Of a non-random selection of continental European draught horses belonging to 13 breeds, 62 per cent (250 of 403) tested were found to carry the mutant allele. The horses were located in Belgium, France, Germany, The Netherlands, Spain and Sweden. The mutation was identified in animals from each of the breeds examined. In the breeds in which more than 15 animals were available for testing, the highest percentages of GYS1-positive horses were found in the Belgian trekpaard (92 per cent; 35 of 38 horses tested), Comtois (80 per cent; 70 of 88), Netherlands trekpaard (74 per cent; 17 of 23), Rheinisch-Deutsches kaltblut (68 per cent; 30 of 44) and Breton (64 per cent; 32 of 51).

Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

International Nuclear Information System (INIS)

Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

2003-01-01

Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

Science.gov (United States)

Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

2008-08-01

Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

Genetic testing of the FBN1 gene in Chinese patients with Marfan/Marfan-like syndrome.

Science.gov (United States)

Yang, Hang; Luo, Mingyao; Chen, Qianlong; Fu, Yuanyuan; Zhang, Jing; Qian, Xiangyang; Sun, Xiaogang; Fan, Yuxin; Zhou, Zhou; Chang, Qian

2016-08-01

Marfan syndrome (MFS) is an autosomal dominant connective tissue disorder typically involving the ocular, skeletal and cardiovascular systems, and aortic aneurysms/dissection mainly contributes to its mortality. Here, we performed genetic testing of the FBN1 gene in 39 Chinese probands with Marfan/Marfan-like syndrome and their related family members by Sanger sequencing. In total, 29 pathogenic/likely pathogenic FBN1 mutations, including 17 novel ones, were identified. In addition, most MFS patients with aortic disease (62%) had a truncating or splicing mutation. These results expand the FBN1 mutation spectrum and enrich our knowledge of genotype-phenotype correlations. Genetic testing for MFS and its related aortic diseases is increasingly important for early intervention and treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

Science.gov (United States)

Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

2014-02-01

Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Chitin synthases from Saprolegnia are involved in tip growth and represent a potential target for anti-oomycete drugs.

Directory of Open Access Journals (Sweden)

Gea Guerriero

Full Text Available Oomycetes represent some of the most devastating plant and animal pathogens. Typical examples are Phytophthora infestans, which causes potato and tomato late blight, and Saprolegnia parasitica, responsible for fish diseases. Despite the economical and environmental importance of oomycete diseases, their control is difficult, particularly in the aquaculture industry. Carbohydrate synthases are vital for hyphal growth and represent interesting targets for tackling the pathogens. The existence of 2 different chitin synthase genes (SmChs1 and SmChs2 in Saprolegnia monoica was demonstrated using bioinformatics and molecular biology approaches. The function of SmCHS2 was unequivocally demonstrated by showing its catalytic activity in vitro after expression in Pichia pastoris. The recombinant SmCHS1 protein did not exhibit any activity in vitro, suggesting that it requires other partners or effectors to be active, or that it is involved in a different process than chitin biosynthesis. Both proteins contained N-terminal Microtubule Interacting and Trafficking domains, which have never been reported in any other known carbohydrate synthases. These domains are involved in protein recycling by endocytosis. Enzyme kinetics revealed that Saprolegnia chitin synthases are competitively inhibited by nikkomycin Z and quantitative PCR showed that their expression is higher in presence of the inhibitor. The use of nikkomycin Z combined with microscopy showed that chitin synthases are active essentially at the hyphal tips, which burst in the presence of the inhibitor, leading to cell death. S. parasitica was more sensitive to nikkomycin Z than S. monoica. In conclusion, chitin synthases with species-specific characteristics are involved in tip growth in Saprolegnia species and chitin is vital for the micro-organisms despite its very low abundance in the cell walls. Chitin is most likely synthesized transiently at the apex of the cells before cellulose, the major

Zac1, an Sp1-like protein, regulates human p21WAF1/Cip1 gene expression in HeLa cells

International Nuclear Information System (INIS)

Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting; Chang, Yung-Lung; Lin, Wei-Shiang; Wang, Wei-Ming; Huang, Shih-Ming

2011-01-01

Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21 WAF1/Cip1 gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein–protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21 WAF1/Cip1 gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

Functional Characterization of Sesquiterpene Synthase from Polygonum minus

Directory of Open Access Journals (Sweden)

Su-Fang Ee

2014-01-01

Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

Evolutionary maintenance of filovirus-like genes in bat genomes

Directory of Open Access Journals (Sweden)

Taylor Derek J

2011-11-01

Full Text Available Abstract Background Little is known of the biological significance and evolutionary maintenance of integrated non-retroviral RNA virus genes in eukaryotic host genomes. Here, we isolated novel filovirus-like genes from bat genomes and tested for evolutionary maintenance. We also estimated the age of filovirus VP35-like gene integrations and tested the phylogenetic hypotheses that there is a eutherian mammal clade and a marsupial/ebolavirus/Marburgvirus dichotomy for filoviruses. Results We detected homologous copies of VP35-like and NP-like gene integrations in both Old World and New World species of Myotis (bats. We also detected previously unknown VP35-like genes in rodents that are positionally homologous. Comprehensive phylogenetic estimates for filovirus NP-like and VP35-like loci support two main clades with a marsupial and a rodent grouping within the ebolavirus/Lloviu virus/Marburgvirus clade. The concordance of VP35-like, NP-like and mitochondrial gene trees with the expected species tree supports the notion that the copies we examined are orthologs that predate the global spread and radiation of the genus Myotis. Parametric simulations were consistent with selective maintenance for the open reading frame (ORF of VP35-like genes in Myotis. The ORF of the filovirus-like VP35 gene has been maintained in bat genomes for an estimated 13. 4 MY. ORFs were disrupted for the NP-like genes in Myotis. Likelihood ratio tests revealed that a model that accommodates positive selection is a significantly better fit to the data than a model that does not allow for positive selection for VP35-like sequences. Moreover, site-by-site analysis of selection using two methods indicated at least 25 sites in the VP35-like alignment are under positive selection in Myotis. Conclusions Our results indicate that filovirus-like elements have significance beyond genomic imprints of prior infection. That is, there appears to be, or have been, functionally maintained

Direct Regulation of tRNA and 5S rRNA Gene Transcription by Polo-like Kinase 1

NARCIS (Netherlands)

Fairley, Jennifer A.; Mitchell, Louise E.; Berg, Tracy; Kenneth, Niall S.; von Schubert, Conrad; Sillje, Herman H. W.; Medema, Rene H.; Nigg, Erich A.; White, Robert J.

2012-01-01

Polo-like kinase Plk1 controls numerous aspects of cell-cycle progression. We show that it associates with tRNA and 5S rRNA genes and regulates their transcription by RNA polymerase Ill (pol Ill) through direct binding and phosphorylation of transcription factor Brit During interphase, Plk1 promotes

The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

Science.gov (United States)

Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

2015-07-28

Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

Mice lacking the kf-1 gene exhibit increased anxiety- but not despair-like behavior

Directory of Open Access Journals (Sweden)

Atsushi Tsujimura

2008-09-01

Full Text Available KF-1 was originally identified as a protein encoded by human gene with increased expression in the cerebral cortex of a patient with Alzheimer’s disease. In mouse brain, kf-1 mRNA is detected predominantly in the hippocampus and cerebellum, and kf-1 gene expression is elevated also in the frontal cortex of rats after chronic antidepressant treatments. KF-1 mediates E2-dependent ubiquitination and may modulate cellular protein levels as an E3 ubiquitin ligase, though its target proteins are not yet identified. To elucidate the role of kf-1 in the central nervous system, we generated kf-1 knockout mice by gene targeting, using Cre-lox recombination. The resulting kf-1−/− mice were normal and healthy in appearance. Behavioral analyses revealed that kf-1−/− mice showed significantly increased anxiety-like behavior compared with kf-1+/+ littermates in the light/dark transition and elevated plus maze tests; however, no significant differences were observed in exploratory locomotion using the open field test or in behavioral despair using the forced swim and tail suspension tests. These observations suggest that KF-1 suppresses selectively anxiety under physiological conditions probably through modulating protein levels of its unknown target(s. Interestingly, kf-1−/− mice exhibited significantly increased prepulse inhibition, which is usually reduced in human schizophrenic patients. Thus, the kf-1−/− mice provide a novel animal model for elucidating molecular mechanisms of psychiatric diseases such as anxiety/depression, and may be useful for screening novel anxiolytic/antidepressant compounds.

Cloning and expression of pineapple sucrose- phosphate synthase ...

African Journals Online (AJOL)

hope&shola

2010-12-06

Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

Identification and phylogenetic analysis of a novel starch synthase in maize

Directory of Open Access Journals (Sweden)

Hanmei eLiu

2015-11-01

Full Text Available Starch is an important reserve of carbon and energy in plants, providing the majority of calories in the human diet and animal feed. Its synthesis is orchestrated by several key enzymes, and the amount and structure of starch, affecting crop yield and quality, are determined mainly by starch synthase (SS activity. To date, five SS isoforms, including SSI-IV and Granule Bound Starch Synthase (GBSS have been identified and their physiological functions have been well characterized. Here, we report the identification of a new SS isoform in maize, designated SSV. By searching sequenced genomes, SSV has been found in all green plants with conserved sequences and gene structures. Our phylogenetic analysis based on 780 base pairs has suggested that SSIV and SSV resulted from a gene duplication event, which may have occurred before the algae formation. An expression profile analysis of SSV in maize has indicated that ZmSSV is mainly transcribed in the kernel and ear leaf during the grain filling stage, which is partly similar to other SS isoforms. Therefore, it is likely that SSV may play an important role in starch biosynthesis. Subsequent analysis of SSV function may facilitate understanding the mechanism of starch granules formation, number and structure.

Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

Directory of Open Access Journals (Sweden)

Yue Ming

2009-06-01

Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

[Inhibition of glycogen synthase kinase 3b activity regulates Toll-like receptor 4-mediated liver inflammation].

Science.gov (United States)

Ren, Feng; Zhang, Hai-yan; Piao, Zheng-fu; Zheng, Su-jun; Chen, Yu; Chen, De-xi; Duan, Zhong-ping

2012-09-01

To determine the mechanism underlying the therapeutic activities of glycogen synthase kinase 3b (GSK3b) against hepatic ischemia-reperfusion (H-IR) injury by investigating the inhibitive effects of GSK3b on inflammation mediated by Toll-like receptor 4 (TLR4). C57BL/6 male mice were subjected to 90 min of warm liver cephalad lobe ischemia, followed by reperfusion for various lengths of time. The mice were divided into three groups: the H-IR untreated model (control group), and the H-IR inflammation-induced models that received an intraperitoneal injection of purified lipopolysaccharide (LPS) endotoxin alone (inflammation group) or with pretreatment of the SB216763 GSK3b-specific inhibitor (intervention group). To create a parallel isolated cell system for detailed investigations of macrophages, marrow-derived stem cells were isolated from femurs of the H-IR control group of mice and used to derive primary macrophages. The cells were then divided into the same three groups as the whole mouse system: control, LPS-induced inflammation model, and inflammation model with SB216763 intervention. Differential expressions of inflammation-related proteins and genes were detected by Western blotting and real-time quantitative PCR, respectively. The phosphorylation levels of ERK, JNK and p38 MAPK were induced in liver at 1 h after reperfusion, but then steadily decreased and returned to baseline levels by 4 h after reperfusion. In addition, the phosphorylation levels of ERK and JNK were induced in macrophages at 15 min after LPS stimulation, while the phosphorylation level of p38 MAPK was induced at 1 h; SB216763 pretreatment suppressed the LPS-stimulated ERK, JNK and p38 phosphorylation in macrophages. In the mouse model, GSK3b activity was found to promote the gene expression of anti-inflammatory cytokine IL-10 (control: 0.21 ± 0.08, inflammation: 0.83 ± 0.21, intervention: 1.76 ± 0.67; F = 3.16, P = 0.027) but to significantly inhibit the gene expression of pro

4G/5G Variant of Plasminogen Activator Inhibitor-1 Gene and Severe Pregnancy-Induced Hypertension: Subgroup Analyses of Variants of Angiotensinogen and Endothelial Nitric Oxide Synthase

Science.gov (United States)

Kobashi, Gen; Ohta, Kaori; Yamada, Hideto; Hata, Akira; Minakami, Hisanori; Sakuragi, Noriaki; Tamashiro, Hiko; Fujimoto, Seiichiro

2009-01-01

Background Pregnancy-induced hypertension (PIH) is a common cause of perinatal mortality. It is believed to result from the interaction of several factors, including those related to the blood coagulation system. We performed genotyping and subgroup analyses to determine if the 4G/5G genotypes of the plasminogen activator inhibitor-1 gene (PAI-1) play a role in the pathogenesis of PIH, and to evaluate possible interactions of the PAI-1 polymorphisms with those of the angiotensinogen gene (AGT) and the endothelial nitric oxide synthase gene (NOS3). Methods An association study of PAI-1 polymorphism, and subgroup analyses of common variants of AGT and NOS3, among 128 patients with PIH and 376 healthy pregnant controls. Results No significant differences were found between the cases and controls in the frequencies of allele 4G or the 4G/4G genotype. In subgroup analyses, after adjustment for multiple comparison, a significant association with the AGT TT genotype was found among women with the PAI-1 4G/4G genotype, and an association with the NOS3 GA+AA genotype was found among women with the 5G/5G or 4G/5G genotypes. Conclusions Our findings suggest that there are at least 2 pathways in the pathogenesis of severe PIH. However, with respect to early prediction and prevention of severe PIH, although the PAI-1 4G/4G genotype alone was not a risk factor for severe PIH, the fact that PAI-1 genotypes are associated with varying risks for severe PIH suggests that PAI-1 genotyping of pregnant women, in combination with other tests, may be useful in the development of individualized measures that may prevent severe PIH. PMID:19838007

A highly prevalent equine glycogen storage disease is explained by constitutive activation of a mutant glycogen synthase

DEFF Research Database (Denmark)

Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K

2017-01-01

BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...

Polyketide synthases from poison hemlock (Conium maculatum L.).

Science.gov (United States)

Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko

2015-11-01

Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.

X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

International Nuclear Information System (INIS)

Lamas, Maria J.; Duran, Goretti; Gomez, Antonio; Balboa, Emilia; Anido, Urbano; Bernardez, Beatriz; Rana-Diez, Pablo; Lopez, Rafael; Carracedo, Angel; Barros, Francisco

2012-01-01

Purpose: 5-Fluorouracil–based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m 2 /d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62–10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10–6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR C 677 and MTHFR A 1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

Energy Technology Data Exchange (ETDEWEB)

Lamas, Maria J., E-mail: mlamasd@yahoo.es [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Duran, Goretti [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Gomez, Antonio [Department of Oncology Radiotherapy, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Balboa, Emilia [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Anido, Urbano [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Bernardez, Beatriz [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Rana-Diez, Pablo [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Lopez, Rafael [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Carracedo, Angel; Barros, Francisco [Fundacion Publica Galega de Medicina Xenomica and Genomic Medicine Group-CIBERER, University of Santiago de Compostela, Calle San Fransisco S/N, Santiago de Compostela (Spain)

2012-01-01

Purpose: 5-Fluorouracil-based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m{sup 2}/d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62-10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10-6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR{sub C}677 and MTHFR{sub A}1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

Organellar and cytosolic localization of four phosphoribosyl diphosphate synthase isozymes in spinach

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1999-01-01

Four cDNAs encoding phosphoribosyl diphosphate (PRPP) synthase were isolated from a spinach (Spinacia oleracea) cDNA library by complementation of an Escherichia coli Δprs mutation. The four gene products produced PRPP in vitro from ATP and ribose-5-phosphate. Two of the enzymes (isozymes 1 and 2...

Brassica juncea nitric oxide synthase like activity is stimulated by PKC activators and calcium suggesting modulation by PKC-like kinase.

Science.gov (United States)

Talwar, Pooja Saigal; Gupta, Ravi; Maurya, Arun Kumar; Deswal, Renu

2012-11-01

Nitric oxide (NO) is an important signaling molecule having varied physiological and regulatory roles in biological systems. The fact that nitric oxide synthase (NOS) is responsible for NO generation in animals, prompted major search for a similar enzyme in plants. Arginine dependent NOS like activity (BjNOSla) was detected in Brassica juncea seedlings using oxyhemoglobin and citrulline assays. BjNOSla showed 25% activation by NADPH (0.4 mM) and 40% by calcium (0.4 mM) but the activity was flavin mononucleotide (FMN), flavin dinucleotide (FAD) and calmodulin (CaM) independent. Pharmacological approach using mammalian NOS inhibitors, NBT (300 μM) and l-NAME (5 mM), showed significant inhibition (100% and 67% respectively) supporting that the BjNOSla operates via the oxidative pathway. Most of the BjNOSla activity (80%) was confined to shoot while root showed only 20% activity. Localization studies by NADPH-diaphorase and DAF-2DA staining showed the presence of BjNOSla in guard cells. Kinetic analysis showed positive cooperativity with calcium as reflected by a decreased K(m) (∼13%) and almost two fold increase in V(max). PMA (438 nM), a kinase activator, activated BjNOSla ∼1.9 fold while its inactive analog 4αPDD was ineffective. Calcium and PMA activated the enzyme to ∼3 folds. Interestingly, 1,2-DG6 (2.5 μM) and PS (1 μM) with calcium activated the enzyme activity to ∼7 fold. A significant inhibition of BjNOSla by PKC inhibitors-staurosporine (∼90%) and calphostin-C (∼40%), further supports involvement of PKC-like kinase. The activity was also enhanced by abiotic stress conditions (7-46%). All these findings suggest that BjNOSla generates NO via oxidative pathway and is probably regulated by phosphorylation. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

Science.gov (United States)

Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

2017-02-01

Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua

Science.gov (United States)

Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing

2016-01-01

Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840

Isolation and characterization of three new monoterpene synthases from Artemisia annua

Directory of Open Access Journals (Sweden)

Ju-Xin eRuan

2016-05-01

Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.

Genome-wide analysis of the Solanum tuberosum (potato) trehalose-6-phosphate synthase (TPS) gene family: evolution and differential expression during development and stress.

Science.gov (United States)

Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang

2017-12-01

Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.

Eukaryotic beta-alanine synthases are functionally related but have a high degree of structural diversity

DEFF Research Database (Denmark)

Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure

2001-01-01

no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...

Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstps1, a key gene in the production of the sesquiterpene aroma compound valencene.

Science.gov (United States)

Sharon-Asa, Liat; Shalit, Moshe; Frydman, Ahuva; Bar, Einat; Holland, Doron; Or, Etti; Lavi, Uri; Lewinsohn, Efraim; Eyal, Yoram

2003-12-01

Citrus fruits possess unique aromas rarely found in other fruit species. While fruit flavor is composed of complex combinations of soluble and volatile compounds, several low-abundance sesquiterpenes, such as valencene, nootkatone, alpha-sinensal, and beta-sinensal, stand out in citrus as important flavor and aroma compounds. The profile of terpenoid volatiles in various citrus species and their importance as aroma compounds have been studied in detail, but much is still lacking in our understanding of the physiological, biochemical, and genetic regulation of their production. Here, we report on the isolation, functional expression, and developmental regulation of Cstps1, a sesquiterpene synthase-encoding gene, involved in citrus aroma formation. The recombinant enzyme encoded by Cstps1 was shown to convert farnesyl diphosphate to a single sesquiterpene product identified as valencene by gas chromatography-mass spectrometry (GC-MS). Phylogenetic analysis of plant terpene synthase genes localized Cstps1 to the group of angiosperm sesquiterpene synthases. Within this group, Cstps1 belongs to a subgroup of citrus sesquiterpene synthases. Cstps1 was found to be developmentally regulated: transcript was found to accumulate only towards fruit maturation, corresponding well with the timing of valencene accumulation in fruit. Although citrus fruits are non-climacteric, valencene accumulation and Cstps1 expression were found to be responsive to ethylene, providing further evidence for the role of ethylene in the final stages of citrus fruit ripening. Isolation of the gene encoding valencene synthase provides a tool for an in-depth study of the regulation of aroma compound biosynthesis in citrus and for metabolic engineering for fruit flavor characteristics.

Diversification of CYCLOIDEA-like genes in Dipsacaceae (Dipsacales: implications for the evolution of capitulum inflorescences

Directory of Open Access Journals (Sweden)

Carlson Sara E

2011-11-01

Full Text Available Abstract Background CYCLOIDEA (CYC-like genes have been implicated in the development of capitulum inflorescences (i.e. flowering heads in Asteraceae, where many small flowers (florets are packed tightly into an inflorescence that resembles a single flower. Several rounds of duplication of CYC-like genes have occurred in Asteraceae, and this is hypothesized to be correlated with the evolution of the capitulum, which in turn has been implicated in the evolutionary success of the group. We investigated the evolution of CYC-like genes in Dipsacaceae (Dipsacales, a plant clade in which capitulum inflorescences originated independently of Asteraceae. Two main inflorescence types are present in Dipsacaceae: (1 radiate species contain two kinds of floret within the flowering head (disk and ray, and (2 discoid species contain only disk florets. To test whether a dynamic pattern of gene duplication, similar to that documented in Asteraceae, is present in Dipsacaceae, and whether these patterns are correlated with different inflorescence types, we inferred a CYC-like gene phylogeny for Dipsacaceae based on representative species from the major lineages. Results We recovered within Dipsacaceae the three major forms of CYC-like genes that have been found in most core eudicots, and identified several additional duplications within each of these clades. We found that the number of CYC-like genes in Dipsacaceae is similar to that reported for members of Asteraceae and that the same gene lineages (CYC1-like and CYC2B-like genes have duplicated in a similar fashion independently in both groups. The number of CYC-like genes recovered for radiate versus discoid species differed, with discoid species having fewer copies of CYC1-like and CYC2B-like genes. Conclusions CYC-like genes have undergone extensive duplication in Dipsacaceae, with radiate species having more copies than discoid species, suggesting a potential role for these genes in the evolution of disk and

list of genes methylated by DRM

Indian Academy of Sciences (India)

... EXPRESSED DURING: 11 growth stages; Has 149 Blast hits to 146 proteins in 39 .... 333, AT1G24070, cellulose synthase-like A10 [Source:TAIR_LOCUS ...... 714, AT1G56600, galactinol synthase 2 [Source:TAIR_LOCUS;Acc:AT1G56600].

Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

Directory of Open Access Journals (Sweden)

Bhubalan, K.

2010-01-01

Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

Science.gov (United States)

Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

2012-07-15

Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

Energy Technology Data Exchange (ETDEWEB)

Liu, Pei-Yao [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Hsieh, Tsai-Yuan [Division of Gastroenterology, Department of Internal Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Liu, Shu-Ting; Chang, Yung-Lung [Department of Biochemistry, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Lin, Wei-Shiang [Division of Cardiology, Department of Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Wang, Wei-Ming, E-mail: ades0431@ms38.hinet.net [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Department of Dermatology, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Huang, Shih-Ming, E-mail: shihming@ndmctsgh.edu.tw [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Department of Biochemistry, National Defense Medical Center, Taipei 114, Taiwan, ROC (China)

2011-12-10

Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

Characterization and sequencing of the active site of 1-aminocyclopropane-1-carboxylate synthase

International Nuclear Information System (INIS)

Yip, Wing-Kin; Dong, Jian-Guo; Yang, S.F.; Kenny, J.W.; Thompson, G.A.

1990-01-01

The pyridoxal phosphate (PLP)-dependent 1-aminocyclopropane-1-carboxylic acid (ACC) synthase the key enzyme in ethylene biosynthesis, is inactivated by its substrate S-adenosylmethionine (AdoMet). Apple ACC synthase was purified with an immunoaffinity gel, and its active site was probed with NaB 3 H 4 or Ado[ 14 C]Met. Peptide sequencing of both 3 H- and 14 C-labeled peptides revealed a common dodecapeptide of Ser-Leu-Ser-Xaa-Asp-Leu-Gly-Leu-Pro-Gly-Phe-Arg, where Xaa was the modified, radioactive residue in each case. Acid hydrolysis of the 3 H-labeled enzyme released radioactive N-pyridoxyllysine, indicating that the active-site peptide contained lysine at position 4. Mass spectrometry of the 14 C-labeled peptide indicated a protonated molecular ion at m/z 1390.6, from which the mass of Xaa was calculated to be 229, a number that is equivalent to the mass of a lysine residue alkylated by the 2-aminobutyrate portion of AdoMet, as we previously proposed. These results indicate that the same active-site lysine binds the PLP and convalently links to the 2-aminobutyrate portion of AdoMet during inactivation. The active site of tomato ACC synthase was probed in the same manner with Ado [ 14 C]Met. Sequencing of the tomato active-site peptide revealed two highly conserved dodecapeptides; the minor peptide possessed a sequence identical to that of the apple enzyme, whereas the major peptide differed from the minor peptide in that methionine replaced leucine at position 6

Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

Energy Technology Data Exchange (ETDEWEB)

Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

1995-08-28

Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

Isolation of developing secondary xylem specific cellulose synthase ...

Indian Academy of Sciences (India)

The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

Bifunctional effects of fucoidan on the expression of inducible nitric oxide synthase

International Nuclear Information System (INIS)

Yang, Jin Won; Yoon, Se Young; Oh, Soo Jin; Kim, Sang Kyum; Kang, Keon Wook

2006-01-01

Algal fucoidan is a marine sulfated polysaccharide with a wide variety of biological activities including anti-thrombotic and anti-inflammatory effects. This study evaluated the effect of fucoidan on the expression of inducible nitric oxide synthase (iNOS) in a macrophage cell line, RAW264.7. Low concentration range of fucoidan (10 μg/ml) increased the basal expression level of iNOS in quiescent macrophages. However, we found for the first time that fucoidan inhibited the release of nitric oxide (NO) in RAW264.7 cells stimulated with lipopolysaccharide (LPS). Western blot analysis revealed that fucoidan suppressed the LPS-induced expression of the inducible nitric oxide synthase (iNOS) gene. Moreover, the activation of both nuclear factor-κB (NF-κB) and activator protein 1 (AP-1) are key steps in the transcriptional activation of the iNOS gene. Here, it was revealed that fucoidan selectively suppressed AP-1 activation, and that the activation of AP-1 appears to be essential for the induction of iNOS in activated macrophages. This inhibitory effect on AP-1 activation by fucoidan might be associated with its NO blocking and anti-inflammatory effects

Cell-Specific Expression of Homospermidine Synthase, the Entry Enzyme of the Pyrrolizidine Alkaloid Pathway in Senecio vernalis, in Comparison with Its Ancestor, Deoxyhypusine Synthase1

Science.gov (United States)

Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich

2002-01-01

Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485

Spatial regulation of a common precursor from two distinct genes generates metabolite diversity

Energy Technology Data Exchange (ETDEWEB)

Guo, Chun-Jun; Sun, Wei-Wen; Bruno, Kenneth S.; Oakley, Berl R.; Keller, Nancy P.; Wang, Clay C.

2015-07-13

In secondary metabolite biosynthesis, core synthetic genes such as polyketide synthase genes or non-ribosomal peptide synthase genes usually encode proteins that generate various backbone precursors. These precursors are modified by other tailoring enzymes to yield a large variety of different secondary metabolites. The number of core synthesis genes in a given species correlates, therefore, with the number of types of secondary metabolites the organism can produce. In our study, heterologous expression of all the A. terreus NRPS-like genes showed that two NRPS-like proteins, encoded by atmelA and apvA, release the same natural product, aspulvinone E. More interestingly, further experiments revealed that the aspulvinone E produced by two different genes accumulates in different fungal compartments. And this spatial control of aspulvinone E production is likely to be regulated by their own specific promoters. Comparative genomics indicates that atmelA and apvA might share a same ancestral gene and the gene apvA is inserted in a highly conserved region in Aspergillus species that contains genes coding for life-essential proteins. The study also identified one trans-prenyltransferase AbpB which is capable of prenylating two different substrates aspulvinones and butyrolactones. In total, our study shows the first example in which the locally distribution of the same natural product could lead to its incorporation into different SM pathways.

Dinucleotide repeat polymorphism in Fms-like tyrosine kinase-1 (Flt-1 gene is not associated with preeclampsia

Directory of Open Access Journals (Sweden)

Park So-Yeon

2008-07-01

Full Text Available Abstract Background Preeclampsia is a major cause of maternal and perinatal mortality and morbidity. The etiology of preeclampsia remains unclear. Recently, it was shown that misregulation of fms-like tyrosine kinase-1 (Flt-1 in the peripheral blood mononuclear cells of pregnant women results in over-expression of the soluble splice variant of Flt-1, sFlt-1, producing an additional (extra-placental source of sFlt-1 that can contribute to the etiology of preeclampsia. The aim of this study was to investigate the relationship between preeclampsia and a dinucleotide (threonine-glycine; TGn repeat polymorphism in the 3' non-coding region of the Flt-1 gene. Methods The number of the d(TGn repeats was analyzed in 170 patients with preeclampsia and in 202 normotensive pregnancies. The region containing the dinucleotide repeat polymorphism of the Flt-1 gene was amplified by polymerase chain reaction (PCR from the DNA samples and was analyzed by direct PCR sequencing. Results We found 10 alleles of the dinucleotide repeat polymorphism and designated these as allele*12 (A1 through allele*23 (A12 according to the number of the TG repeats, from 12 to 23. The frequency of the 14-repeat allele (A3 was most abundant (63.82% in preeclampsia and 69.06% in controls, followed by the 21-repeat allele (A10; 28.53% in preeclampsia and 23.76% in controls. There was no significant difference in the allele frequency between patients with preeclampsia and normal controls. The most common genotype in preeclamptic and normotensive pregnancies was heterozygous (TG14/(TG21 (41.76% and homozygous (TG14/(TG14 (45.05%, respectively. However, the genotype frequencies were not significantly different between preeclamptic patients and controls. Conclusion This is the first study to characterize the dinucleotide repeat polymorphism of the Flt-1 gene in patients with preeclampsia. We found no differences in the allele or genotype frequencies between patients with preeclampsia and

Oestrogen regulates the expression of cathepsin E-A-like gene ...

Indian Academy of Sciences (India)

Hang Zheng

2018-02-28

Feb 28, 2018 ... 1College of Animal Science and Veterinary Medicine, Henan Agricultural .... evaluated the expression regulation mechanism of the gene ... C with ad libitum water and food. ... embryonic liver following the method previously described .... Cloning and sequence analysis of chicken cathepsin E-A-like gene.

Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

Directory of Open Access Journals (Sweden)

Bin Tang

2018-01-01

Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

Constitutive expression of the K-domain of a Vaccinium corymbosum SOC1-like (VcSOC1-K) MADS-box gene is sufficient to promote flowering in tobacco.

Science.gov (United States)

Song, Guo-qing; Walworth, Aaron; Zhao, Dongyan; Hildebrandt, Britton; Leasia, Michael

2013-11-01

The K-domain of a blueberry-derived SOC1 -like gene promotes flowering in tobacco without negatively impacting yield, demonstrating potential for manipulation of flowering time in horticultural crops. The SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) and SOC1-likes, belonging to the MIKC(c) (type II) MADS-box gene subfamily, are major floral activators and integrators of plant flowering. Both MADS-domains and K (Keratin)-domains are highly conserved in MIKC(c)-type MADS proteins. While there are many reports on overexpression of intact MIKC(c)-type MADS-box genes, few studies have been conducted to investigate the effects of the K-domains. In this report, a 474-bp K-domain of Vaccinium SOC1-like (VcSOC1-K) was cloned from the cDNA library of the northern highbush blueberry (Vaccinium corymbosum L.). Functional analysis of the VcSOC1-K was conducted by ectopically expressing of 35S:VcSOC1-K in tobacco. Reverse transcription PCR confirmed expression of the VcSOC1-K in T0 plants. Phenotypically, T1 transgenic plants (10 T1 plants/event) flowered sooner after seeding, and were shorter with fewer leaves at the time of flowering, than nontransgenic plants; but seed pod production of transgenic plants was not significantly affected. These results demonstrate that overexpression of the K-domain of a MIKC(c)-type MADS-box gene alone is sufficient to promote early flowering and more importantly without affecting seed production.

Isolation and characterization of an oxidosqualene cyclase gene encoding a β-amyrin synthase involved in Polygala tenuifolia Willd. saponin biosynthesis.

Science.gov (United States)

Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae

2014-03-01

Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.

Isolation and identification of a thermophilic strain producing trehalose synthase from geothermal water in China.

Science.gov (United States)

Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun

2008-08-01

A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.

Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells.

Science.gov (United States)

Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J

2015-05-01

The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Glucose-Modulated Mitochondria Adaptation in Tumor Cells: A Focus on ATP Synthase and Inhibitor Factor 1

Directory of Open Access Journals (Sweden)

Irene Mavelli

2012-02-01

Full Text Available Warburg’s hypothesis has been challenged by a number of studies showing that oxidative phosphorylation is repressed in some tumors, rather than being inactive per se. Thus, treatments able to shift energy metabolism by activating mitochondrial pathways have been suggested as an intriguing basis for the optimization of antitumor strategies. In this study, HepG2 hepatocarcinoma cells were cultivated with different metabolic substrates under conditions mimicking “positive” (activation/biogenesis or “negative” (silencing mitochondrial adaptation. In addition to the expected up-regulation of mitochondrial biogenesis, glucose deprivation caused an increase in phosphorylating respiration and a rise in the expression levels of the ATP synthase β subunit and Inhibitor Factor 1 (IF1. Hyperglycemia, on the other hand, led to a markedly decreased level of the transcriptional coactivator PGC-α suggesting down-regulation of mitochondrial biogenesis, although no change in mitochondrial mass and no impairment of phosphorylating respiration were observed. Moreover, a reduction in mitochondrial networking and in ATP synthase dimer stability was produced. No effect on β-ATP synthase expression was elicited. Notably, hyperglycemia caused an increase in IF1 expression levels, but it did not alter the amount of IF1 associated with ATP synthase. These results point to a new role of IF1 in relation to high glucose utilization by tumor cells, in addition to its well known effect upon mitochondrial ATP synthase regulation.

Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

Science.gov (United States)

Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

2015-08-01

Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

Science.gov (United States)

Yang, Ji; Gu, Hongya; Yang, Ziheng

2004-01-01

Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

Glycogen Phosphorylase and Glycogen Synthase: Gene Cloning and Expression Analysis Reveal Their Role in Trehalose Metabolism in the Brown Planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

Science.gov (United States)

Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin

2017-01-01

RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.