
Sample records for synthase ii gene

  1. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza


    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  2. Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

    Directory of Open Access Journals (Sweden)

    Khalil Zaynali


    Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.

  3. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)


    Dec 26, 2014 ... RESEARCH ARTICLE. Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. MANISHA PATNAIK1,5, PALLABI PATI1, SURENDRA N. SWAIN2, MANOJ K.

  4. Production of dammarane-type sapogenins in rice by expressing the dammarenediol-II synthase gene from Panax ginseng C.A. Mey. (United States)

    Huang, Zhiwei; Lin, Juncheng; Cheng, Zuxin; Xu, Ming; Huang, Xinying; Yang, Zhijian; Zheng, Jingui


    Ginsenosides are the main active ingredients in Chinese medicinal ginseng; 2,3-oxidosqualene is a precursor metabolite to ginsenosides that is present in rice. Because rice lacks a key rate-limiting enzyme (dammarenediol-II synthase, DS), rice cannot synthesize dammarane-type ginsenosides. In this study, the ginseng (Panax ginseng CA Mey.) DS gene (GenBank: AB265170.1) was transformed into rice using agrobacterium, and 64 rice transgenic plants were produced. The Transfer-DNA (T-DNA) insertion sites in homozygous lines of the T2 generation were determined by using high-efficiency thermal asymmetric interlaced PCR (hiTAIL-PCR) and differed in all tested lines. One to two copies of the T-DNA were present in each transformant, and real-time PCR and Western blotting showed that the transformed DS gene could be transcribed and highly expressed. High performance liquid chromatography (HPLC) analysis showed that the dammarane-type sapogenin 20(S)-protopanaxadiol (PPD) content was 0.35-0.59 mg/g dw and the dammarane-type sapogenin 20(S)-protopanaxatriol (PPT) content was 0.23-0.43 mg/g dw in the transgenic rice. LC/MS analysis confirmed production of PPD and PPT. These results indicate that a new "ginseng rice" germplasm containing dammarane-type sapogenins has been successfully developed by transforming the ginseng DS gene into rice. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  5. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne


    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  6. Expression of Deinococcus geothermalis trehalose synthase gene ...

    African Journals Online (AJOL)

    A novel trehalose synthase gene from Deinococcus geothermalis (DSMZ 11300) containing 1692 bp reading-frame encoding 564 amino acids was amplified using polymerase chain reaction (PCR). The gene was ligated into pET30Ek/LIC vector and expressed after isopropyl β-D-thiogalactopyranoside induction in ...

  7. Tobacco streak virus (strain dahlia) suppresses post-transcriptional gene silencing of flavone synthase II in black dahlia cultivars and causes a drastic flower color change. (United States)

    Deguchi, Ayumi; Tatsuzawa, Fumi; Hosokawa, Munetaka; Doi, Motoaki; Ohno, Sho


    Tobacco streak virus suppressed post-transcriptional gene silencing and caused a flower color change in black dahlias, which supported the role of cyanidin-based anthocyanins for black flower appearance. Black flower color of dahlia (Dahlia variabilis) has been attributed, in part, to the high accumulation of cyanidin-based anthocyanins that occurs when flavone synthesis is reduced because of post-transcriptional gene silencing (PTGS) of flavone synthase II (DvFNS). There are also purple-flowering plants that have emerged from a black cultivar 'Kokucho'. We report that the purple color is not caused by a mutation, as previously thought, but by infection with tobacco streak virus (TSVdahlia), which suppresses the PTGS of DvFNS. When TSVdahlia was eliminated from the purple-flowering 'Kokucho' by leaf primordia-free shoot apical meristem culture, the resulting flowers were black. TSVdahlia-infected purple flowers had lower numbers of siRNAs to DvFNS than black flowers, suggesting that TSVdahlia has a silencing suppressor. The graft inoculation of other black cultivars with TSVdahlia altered their flower color drastically except for 'Fidalgo Blacky', a very deep black cultivar with the highest amount of cyanidin-based anthocyanins. The flowers of all six TSVdahlia-infected cultivars accumulated increased amounts of flavones and reduced amounts of cyanidin-based anthocyanins. 'Fidalgo Blacky' remained black despite the change in pigment accumulation, and the amounts of cyanidin-based anthocyanins in its TSVdahlia-infected plants were still higher than those of other cultivars. We propose that black flower color in dahlia is controlled by two different mechanisms that increase the amount of cyanidin-based anthocyanins: DvFNS PTGS-dependent and -independent mechanisms. If both mechanisms occur simultaneously, the flower color will be blacker than if only a single mechanism is active.

  8. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  9. Relationship between endothelial nitric oxide synthase gene ...

    African Journals Online (AJOL)

    Introduction: Endothelial nitric oxide synthase (eNOS), the enzyme in charge of nitric oxide production, plays a crucial role in vascular biology. However, the impact of single nucleotide polymorphisms (SNPs) affecting the gene encoding for eNOS (eNOS) on coronary artery diseases remains under debate and no data were ...

  10. PKMiner: a database for exploring type II polyketide synthases

    Directory of Open Access Journals (Sweden)

    Kim Jinki


    Full Text Available Abstract Background Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyketide chemotypes in various actinobacterial genomes will thus enable the discovery or synthesis of novel polyketides in the most plausible microorganisms. Description We performed a comprehensive computational analysis of type II PKSs and their gene clusters in actinobacterial genomes. By identifying type II PKS subclasses from the sequence analysis of 280 known type II PKSs, we developed highly accurate domain classifiers for these subclasses and derived prediction rules for aromatic polyketide chemotypes generated by different combinations of type II PKS domains. Using 319 available actinobacterial genomes, we predicted 231 type II PKSs from 40 PKS gene clusters in 25 actinobacterial genomes, and polyketide chemotypes corresponding to 22 novel PKS gene clusters in 16 genomes. These results showed that the microorganisms capable of producing aromatic polyketides are specifically distributed within a certain suborder of Actinomycetales such as Catenulisporineae, Frankineae, Micrococcineae, Micromonosporineae, Pseudonocardineae, Streptomycineae, and Streptosporangineae. Conclusions We could identify the novel candidates of type II PKS gene clusters and their polyketide chemotypes in actinobacterial genomes by comprehensive analysis of type II PKSs and prediction of aromatic polyketides. The genome analysis results indicated that the specific suborders in actinomycetes could be used as prolific taxa for polyketide synthesis. The chemotype-prediction rules with

  11. PKMiner: a database for exploring type II polyketide synthases. (United States)

    Kim, Jinki; Yi, Gwan-Su


    Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs) in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyketide chemotypes in various actinobacterial genomes will thus enable the discovery or synthesis of novel polyketides in the most plausible microorganisms. We performed a comprehensive computational analysis of type II PKSs and their gene clusters in actinobacterial genomes. By identifying type II PKS subclasses from the sequence analysis of 280 known type II PKSs, we developed highly accurate domain classifiers for these subclasses and derived prediction rules for aromatic polyketide chemotypes generated by different combinations of type II PKS domains. Using 319 available actinobacterial genomes, we predicted 231 type II PKSs from 40 PKS gene clusters in 25 actinobacterial genomes, and polyketide chemotypes corresponding to 22 novel PKS gene clusters in 16 genomes. These results showed that the microorganisms capable of producing aromatic polyketides are specifically distributed within a certain suborder of Actinomycetales such as Catenulisporineae, Frankineae, Micrococcineae, Micromonosporineae, Pseudonocardineae, Streptomycineae, and Streptosporangineae. We could identify the novel candidates of type II PKS gene clusters and their polyketide chemotypes in actinobacterial genomes by comprehensive analysis of type II PKSs and prediction of aromatic polyketides. The genome analysis results indicated that the specific suborders in actinomycetes could be used as prolific taxa for polyketide synthesis. The chemotype-prediction rules with the suggested type II PKS modules derived using this resource

  12. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)



    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  13. Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.

  14. Divinyl ether synthase gene and protein, and uses thereof (United States)

    Howe, Gregg A [East Lansing, MI; Itoh, Aya [Tsuruoka, JP


    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  15. PKMiner: a database for exploring type II polyketide synthases


    Kim Jinki; Yi Gwan-Su


    Abstract Background Bacterial aromatic polyketides are a pharmacologically important group of natural products synthesized by type II polyketide synthases (type II PKSs) in actinobacteria. Isolation of novel aromatic polyketides from microbial sources is currently impeded because of the lack of knowledge about prolific taxa for polyketide synthesis and the difficulties in finding and optimizing target microorganisms. Comprehensive analysis of type II PKSs and the prediction of possible polyke...

  16. Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

    DEFF Research Database (Denmark)

    Christensen, Caspar Elo; Kragelund, Birthe Brandt; Von Wettstein-Knowles, Penny


    Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

  17. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    This study was undertaken to investigate the association of aldosterone synthase C-344T, angiotensin II type I receptor A1166C and 11- hydroxysteroid dehydrogenase type 2 G534A polymorphisms with essential hypertension in the population of Odisha, India. A total of 246 hypertensive subjects (males, 159; females, ...

  18. Glutamate synthase: An archaeal horizontal gene transfer?

    Indian Academy of Sciences (India)

    (GOGAT) which is a key enzyme in ammonia assimilation in bacteria, algae and plants. It catalyzes the reductive transamidation of amido nitrogen from glutamine to 2-oxoglutarate to form two molecules of glutamate (Temple et al 1998). Glutamate synthases differ according to their molecular weights, subunit compositions, ...

  19. Impaired ATP synthase assembly associated with a mutation in the human ATP synthase subunit 6 gene.

    NARCIS (Netherlands)

    Nijtmans, L.G.J.; Henderson, N.S.; Attardi, G.; Holt, L.J.


    Mutations in human mitochondrial DNA are a well recognized cause of disease. A mutation at nucleotide position 8993 of human mitochondrial DNA, located within the gene for ATP synthase subunit 6, is associated with the neurological muscle weakness, ataxia, and retinitis pigmentosa (NARP) syndrome.

  20. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.


    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  1. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    Background: Previous studies indicated an association between endothelial nitric oxide synthase (eNOS) activity and maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated with recurrent spontaneous abortions (RSAs). Aim: The aim was to investigate ...

  2. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it ...

  3. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk. (United States)

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You


    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  4. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi. (United States)

    Karuppayil, S M; Peng, M; Mendoza, L; Levins, T A; Szaniszlo, P J


    Primers having designs based on highly conserved stretches in the deduced amino acid sequences of chitin synthase (CHS) genes were used in PCR reactions to amplify 600 bp and 366 bp products from the genomic DNA of three major causal agents of chromoblastomycosis. Cloning and sequencing of the PCR products of one of these fungi, Fonsecaea pedrosoi, identified three CHS sequences designated as FpCHS1, FpCHS2 and FpCHS3. FpCHS1 and FpCHS2 were homologous to regions of CHS1 and CHS2 of Saccharomyces cerevisiae, and their derived amino acid sequences fell into chitin synthase classes I and II, respectively. FpCHS3 was homologous to a region of the CAL1/CSD2 gene of S. cerevisiae, which codes for the chitin synthase three (Chs3) enzyme in that fungus. Phylogenetic trees constructed using the deduced amino acid sequences of PCR-amplified CHS products from many fungi clustered F. pedrosoi with other dematiaceous fungi, providing new molecular evidence for the genetic relatedness of these organisms. The identification of these CHS genes in F. pedrosoi will facilitate future studies of the functional roles of chitin synthases in the unique in vivo dimorphism exhibited by chromoblastomycotic fungi.

  5. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)



    May 24, 2010 ... NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained from the ... (Serrano et al., 2004),. Behcet's disease (Karasneh et al., 2005), diabetes (Monti ... EDTA-treated peripheral venous blood using the salting-out method. (Miller et al., 1988).

  6. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)



    Apr 6, 2009 ... necessary to map the ginkgolide pathway at the level of molecular biology. Ginkgolides belong to plant diterpenoids just like the famous anti-tumor ..... A new isopentenyl diphosphate isomerase gene from sweet cloning, characterization and color complementation. Biologia. 63(2): 221-. 226. Liao ZH, Chen ...

  7. Class II recombinant phosphoribosyl diphosphate synthase from spinach

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B


    to other PRPP synthases the activity of spinach PRPP synthase isozyme 3 is independent of P(i), and the enzyme is inhibited by ribonucleoside diphosphates in a purely competitive manner, which indicates a lack of allosteric inhibition by these compounds. In addition spinach PRPP synthase isozyme 3 shows...

  8. Cryptic polyketide synthase genes in non-pathogenic Clostridium SPP.

    Directory of Open Access Journals (Sweden)

    Swantje Behnken

    Full Text Available Modular type I polyketide synthases (PKS produce a vast array of bacterial metabolites with highly diverse biological functions. Notably, all known polyketides were isolated from aerobic bacteria, and yet no example has been reported for strict anaerobes. In this study we explored the diversity and distribution of PKS genes in the genus Clostridium. In addition to comparative genomic analyses combined with predictions of modular type I polyketide synthase (PKS gene clusters in sequenced genomes of Clostridium spp., a representative selection of other species inhabiting a variety of ecological niches was investigated by PCR screening for PKS genes. Our data reveal that all studied pathogenic Clostridium spp. are devoid of putative PKS genes. In stark contrast, cryptic PKS genes are widespread in genomes of non-pathogenic Clostridium species. According to phylogenetic analyses, the Clostridium PKS genes have unusual and diverse origins. However, reverse transcription quantitative PCR demonstrates that these genes are silent under standard cultivation conditions, explaining why the related metabolites have been overlooked until now. This study presents clostridia as a putative source for novel bioactive polyketides.

  9. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others


    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  10. The multifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum. Its gene structure relative to that of other polyketide synthases. (United States)

    Beck, J; Ripka, S; Siegner, A; Schiltz, E; Schweizer, E


    6-Methylsalicylic acid synthase (MSAS) from Penicillium patulum is a homomultimer of a single, multifunctional protein subunit. The enzyme is induced, at the transcriptional level, during the end of the logarithmic growth phase. After approximately 150-fold purification, a homogeneous enzyme preparation was obtained exhibiting, upon SDS gel electrophoresis, a subunit molecular mass of 188 kDa. By immunological screening of a genomic P. patulum DNA expression library, the MSAS gene together with its flanking sequences was isolated; 7131 base pairs of the cloned genomic DNA were sequenced. Within this sequence the MSAS gene was identified as a 5322-bp-long open reading frame coding for a protein of 1774 amino acids and 190,731 Da molecular mass. Transcriptional initiation and termination sites were determined both by primer extension studies and from cDNA sequences specially prepared for the 5' and 3' portions of the gene. The same cDNA sequences revealed the presence of a 69-bp intron within the N-terminal part of the MSAS gene. The intron contains the canonical GT and AG dinucleotides at its 5'- and 3'-splice junctions. An internal TACTGAC sequence, resembling the TACTAAC consensus element of Saccharomyces cerevisiae introns is suggested to represent the branch point of the lariat splicing intermediate. When compared to other known polyketide synthases, distinct amino acid sequence similarities of limited lengths were observed with some, though not all, of them. A comparatively low degree of similarity was detected to the yeast and Penicillium FAS or to the plant chalcone and resveratrol synthases. In contrast, a significantly higher sequence similarity was found between MSAS and the rat fatty acid synthase, especially at their transacylase, 2-oxoacyl reductase, 2-oxoacyl synthase and acyl carrier protein domains. Besides several dissimilar, interspersed regions probably coding for MSAS- and FAS-specific functions, the sequential order of the similar domains was

  11. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes. (United States)

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si


    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed actinomycetes to produce bioactive molecules.

  12. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  13. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis. (United States)

    Noar, Roslyn D; Daub, Margaret E


    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  14. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus. (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T


    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  15. Reactivation of methionine synthase from Thermotoga maritima (TM0268) requires the downstream gene product TM0269. (United States)

    Huang, Sha; Romanchuk, Gail; Pattridge, Katherine; Lesley, Scott A; Wilson, Ian A; Matthews, Rowena G; Ludwig, Martha


    The crystal structure of the Thermotoga maritima gene product TM0269, determined as part of genome-wide structural coverage of T. maritima by the Joint Center for Structural Genomics, revealed structural homology with the fourth module of the cobalamin-dependent methionine synthase (MetH) from Escherichia coli, despite the lack of significant sequence homology. The gene specifying TM0269 lies in close proximity to another gene, TM0268, which shows sequence homology with the first three modules of E. coli MetH. The fourth module of E. coli MetH is required for reductive remethylation of the cob(II)alamin form of the cofactor and binds the methyl donor for this reactivation, S-adenosylmethionine (AdoMet). Measurements of the rates of methionine formation in the presence and absence of TM0269 and AdoMet demonstrate that both TM0269 and AdoMet are required for reactivation of the inactive cob(II)alamin form of TM0268. These activity measurements confirm the structure-based assignment of the function of the TM0269 gene product. In the presence of TM0269, AdoMet, and reductants, the measured activity of T. maritima MetH is maximal near 80 degrees C, where the specific activity of the purified protein is approximately 15% of that of E. coli methionine synthase (MetH) at 37 degrees C. Comparisons of the structures and sequences of TM0269 and the reactivation domain of E. coli MetH suggest that AdoMet may be bound somewhat differently by the homologous proteins. However, the conformation of a hairpin that is critical for cobalamin binding in E. coli MetH, which constitutes an essential structural element, is retained in the T. maritima reactivation protein despite striking divergence of the sequences.

  16. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family (United States)

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura


    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  17. Plasticity and evolution of (+)-3-carene synthase and (-)-sabinene synthase functions of a sitka spruce monoterpene synthase gene family associated with weevil resistance. (United States)

    Roach, Christopher R; Hall, Dawn E; Zerbe, Philipp; Bohlmann, Jörg


    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (-)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (-)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (-)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan


    of a functional cdd gene encoding cytidine deaminase. A characterization of the enzyme revealed similar properties as found for CTP synthases from other organisms. However, unlike the majority of CTP synthases the lactococcal enzyme can convert dUTP to dCTP, although a half saturation concentration of 0.6 m...

  19. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6). (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine


    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Leyva et al. 1995), UV treatments and blue light (Hartmann et al. 1998; Wade et al. 2001; Zhou et al. 2007), elicitor treatments such as salicylic acid and. Keywords. chalcone synthase; real-time PCR; silymarin; anthocyanin; Silybum marianum.

  1. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang


    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  2. Characterization of a 1-aminocyclopropane-1-carboxylate synthase gene from loblolly pine (Pinus taeda L.). (United States)

    Barnes, J R; Lorenz, W W; Dean, J F D


    1-Aminocyclopropane-1-carboxylate (ACC) synthase catalyzes what is typically the rate-limiting step in the biosynthesis of ethylene, a gaseous plant growth regulator that plays numerous roles in the growth and development of higher plants. Although ACC synthase genes have been characterized from a wide variety of angiosperm plant species, no ACC synthase genes have been described previously for gymnosperms. Evidence suggests that ethylene helps to regulate wood formation in trees, and may also signal for the metabolic shifts that lead to compression wood formation on the undersides of branches and leaning stems in gymnosperm trees. Since compression wood is an inferior feedstock for the manufacturing of most wood products, a better understanding of the factors influencing its formation could lead to substantial economic benefits. This study describes the isolation and characterization of a putative ACC synthase gene, PtaACS1, from loblolly pine (Pinus taeda L.), an important commercial forest tree species. Also described is an apparent splice variant of PtaACS1 (PtaACS1s) that is missing 138 bp from the 5' end of the transcript, including bases that encode a conserved amino acid residue considered critical for ACC synthase activity. The two sequences share interesting homologies with a group of plant aminotransferases, in addition to ACC synthases, but structural models and the conservation of critical catalytic amino acid residues strongly support PtaACS1 as encoding an active ACC synthase. The two transcripts were differentially expressed in various tissues of loblolly pine, as well as in response to perturbations of pine seedling stems. Transcript levels of this ACC synthase gene increased rapidly in response to bending stress but returned to near starting levels within 30 min. It remains unclear to what extent bending-induced expression of this gene product plays a role in compression wood formation.

  3. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.


    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  4. Molecular characterization of a transient expression gene encoding for 1-aminocyclopropane-1-carboxylate synthase in cotton (Gossypium hirsutum L.). (United States)

    Wang, Xia; Zhang, Ying; Zhang, Jiedao; Cheng, Cheng; Guo, Xingqi


    Ethylene performs an important function in plant growth and development. 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), the key enzyme involved in ethylene biosynthesis, has been the focus of most ethylene studies. Here, a cotton ACS gene referred to as Gossypium hirsutum ACS1 (GhACS1), was isolated. The full-length cDNA of GhACS1 encodes for a 476-amino acid protein which harbors seven conserved regions, 11 invariant amino acid residues, and the PLP binding active site, all of which characterize ACC synthases. Alignment analysis showed that GhACS1 shared a high degree of identity with other known ACC synthases from different species. Two introns were detected in the genomic DNA sequence, and the results of Southern blot analysis suggested that there might be a multi-gene family encoding for ACC synthase in cotton. From the phylogenetic tree constructed with 24 different kinds of ACC synthases, we determined that GhACS1 falls into group II, and was closely associated with the wound-inducible ACS of citrus. The analysis of the 5' flanking region of GhACS1 revealed a group of putative cis-acting elements. The results of expression analysis showed that GhACS1 displayed its transient expression nature after wounding, abscisic acid (ABA), and CuCl(2) treatments. These results indicate that GhACS1, which was transiently expressed in response to certain stimuli, may be involved in the production of ethylene for the transmission of stress signals.

  5. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    coumaroyl-CoA with three acetyl-CoA units, followed by folding, and initial cyclization; all catalyzed by a single enzyme, chalcone synthase (CHS). Further ring closure catalyzed by chalcone isomerase (CHI) yields naringenin. Coupling follows a ...

  6. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)


    Mar 4, 2015 ... Abstract. Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are poten- tially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag ...

  7. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE


    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  8. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.


    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  9. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana. (United States)

    Hemleben, V; Frey, M; Rall, S; Koch, M; Kittel, M; Kreuzaler, F; Ragg, H; Fautz, E; Hahlbrock, K


    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  10. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina


    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutat...

  11. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis of 3-methyl...

  12. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants. (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako


    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  13. Cloning of the Nocardia corallina polyhydroxyalkanoate synthase gene and production of poly-(3-hydroxybutyrate-co-3-hydroxyhexanoate) and poly-(3-hydroxyvalerate-co-3-hydroxyheptanoate). (United States)

    Hall, B; Baldwin, J; Rhie, H G; Dennis, D


    The polyhydroxyalkanoate (PHA) synthase gene (phaCNc) from Nocardia corallina was identified in a lambda library on a 6-kb BamHI fragment. A 2.8-kb XhoII subfragment was found to contain the intact PHA synthase. This 2.8-kb fragment was subjected to DNA sequencing and was found to contain the coding region for the PHA synthase and a small downstream open reading frame of unknown function. On the basis of DNA sequence, phaCNc is closest in homology to the PHA synthases (phaCPaI and phaCPaII) of Pseudomonas aeruginosa (approximately 41% identity and 55% similarity). The 2.8-kb XhoII fragment containing phaCNc was subcloned into broad host range mobilizable plasmids and transferred into Escherichia coli, Klebsiella aerogenes (both containing a plasmid bearing phaA and phaB from Ralstonia eutropha), and PHA-negative strains of R. eutropha and Pseudomonas putida. The recombinant strains were grown on various carbon sources and the resulting polymers were analyzed. In these strains, the PHA synthase from N. corallina was able to mediate the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) containing high levels of 3-hydroxyhexanoate when grown on hexanoate and larger even-chain fatty acids and poly(3-hydroxyvalerate-co-3-hydroxyheptanoate) containing high levels of 3-hydroxyheptanoate when grown on heptanoate or larger odd-chain fatty acids.

  14. Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily. (United States)

    Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg


    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

  15. Identification and functional analysis of the geranylgeranyl pyrophosphate synthase gene (crtE) and phytoene synthase gene (crtB) for carotenoid biosynthesis in Euglena gracilis. (United States)

    Kato, Shota; Takaichi, Shinichi; Ishikawa, Takahiro; Asahina, Masashi; Takahashi, Senji; Shinomura, Tomoko


    Euglena gracilis, a unicellular phytoflagellate within Euglenida, has attracted much attention as a potential feedstock for renewable energy production. In outdoor open-pond cultivation for biofuel production, excess direct sunlight can inhibit photosynthesis in this alga and decrease its productivity. Carotenoids play important roles in light harvesting during photosynthesis and offer photoprotection for certain non-photosynthetic and photosynthetic organisms including cyanobacteria, algae, and higher plants. Although, Euglenida contains β-carotene and xanthophylls (such as zeaxanthin, diatoxanthin, diadinoxanthin and 9'-cis neoxanthin), the pathway of carotenoid biosynthesis has not been elucidated. To clarify the carotenoid biosynthetic pathway in E. gracilis, we searched for the putative E. gracilis geranylgeranyl pyrophosphate (GGPP) synthase gene (crtE) and phytoene synthase gene (crtB) by tblastn searches from RNA-seq data and obtained their cDNAs. Complementation experiments in Escherichia coli with carotenoid biosynthetic genes of Pantoea ananatis showed that E. gracilis crtE (EgcrtE) and EgcrtB cDNAs encode GGPP synthase and phytoene synthase, respectively. Phylogenetic analyses indicated that the predicted proteins of EgcrtE and EgcrtB belong to a clade distinct from a group of GGPP synthase and phytoene synthase proteins, respectively, of algae and higher plants. In addition, we investigated the effects of light stress on the expression of crtE and crtB in E. gracilis. Continuous illumination at 460 or 920 μmol m(-2) s(-1) at 25 °C decreased the E. gracilis cell concentration by 28-40 % and 13-91 %, respectively, relative to the control light intensity (55 μmol m(-2) s(-1)). When grown under continuous light at 920 μmol m(-2) s(-1), the algal cells turned reddish-orange and showed a 1.3-fold increase in the crtB expression. In contrast, EgcrtE expression was not significantly affected by the light-stress treatments examined. We identified genes

  16. Association of a Soybean Raffinose Synthase Gene with Low Raffinose and Stachyose Seed Phenotype

    Directory of Open Access Journals (Sweden)

    Emily C. Dierking


    Full Text Available Oligosaccharides are an important component of soybean [ (L. Merr.] meal in terms of metabolizable energy for monogastric animals. Sucrose, raffinose, and stachyose are the three main oligosaccharides present in soybean meal. Of the three, only sucrose is nutritionally useful. When raffinose and stachyose are fermented by microbes present in the gut, the results are flatulence and discomfort, which ultimately lead to poor weight gain. The long term objective of this research is ultimately to increase the nutritional value of soybean meal by elevating the metabolizable energy at the expense of raffinose and stachyose through the manipulation of soybean raffinose synthase, the key enzyme for raffinose and stachyose biosynthesis. The objectives of this work were to develop molecular genetic information about soybean raffinose synthases and to evaluate the candidate raffinose synthase genes in a soybean germplasm accession (PI 200508 that contains low levels of raffinose and stachyose. Our results indicate the soybean genome contains at least two expressed genes similar to other characterized raffinose synthases. A novel allele of one of these putative soybean raffinose synthase genes was discovered from the PI 200508 that completely associates with the low raffinose and stachyose phenotype. Molecular marker assays specific for the PI 200508 allele were developed to allow direct selection for the low raffinose and low stachyose phenotype.

  17. Frequent epigenetic silencing of the folate-metabolising gene cystathionine-beta-synthase in gastrointestinal cancer.

    Directory of Open Access Journals (Sweden)

    Hong Zhao

    Full Text Available Both gastric and colorectal cancers (CRC are the most frequently occurring malignancies worldwide with the overall survival of these patients remains unsatisfied. Identification of tumor suppressor genes (TSG silenced by promoter CpG methylation uncovers mechanisms of tumorigenesis and identifies new epigenetic biomarkers for early cancer detection and prognosis assessment. Cystathionine-beta-synthase (CBS functions in the folate metabolism pathway, which is intricately linked to methylation of genomic DNA. Dysregulation of DNA methylation contributes substantially to cancer development.To identify potential TSGs silenced by aberrant promoter methylation in CRC, we analyzed tumor and adjacent tissues from CRC cases using the Illumina Human Methylation45 BeadChip. We identified hypermethylation of the CBS gene in CRC samples, compared to adjacent tissues. Methylation and decreased mRNA expression of CBS were detected in most CRC cell lines by methylation-specific PCR and semiquantitative RT-PCR, as well as in gastric cancer. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin A reversed methylation and restored CBS mRNA expression indicating a direct effect. Aberrant methylation was further detected in 31% of primary CRCs (29 of 96 and 55% of gastric tumors (11 of 20. In contrast, methylation was seldom found in normal tissues adjacent to the tumor. CBS methylation was associated with KRAS mutations in primary CRCs (P = 0.04, by χ(2-test. However, no association was found between CBS methylation or KRAS mutations with cancer relapse/metastasis in Stage II CRC patients.A novel finding from this study is that the folate metabolism enzyme CBS mRNA levels are frequently downregulated through CpG methylation of the CBS gene in gastric cancer and CRC, suggesting that CBS functions as a tumor suppressor gene. These findings warrant further study of CBS as an epigenetic biomarker for molecular diagnosis of gastrointestinal cancers.

  18. Prognostic significance of numeric aberrations of genes for thymidylate synthase, thymidine phosphorylase and dihydrofolate reductase in colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Søren Astrup; Vainer, B.; Witton, C.J.


    ) in colorectal cancer, and to evaluate its prognostic significance following adjuvant chemotherapy, since these enzymes are closely related to efficacy of 5-fluorouracil (5FU). PATIENTS AND METHODS: Consecutive patients (n = 314), who were completely resected for colorectal cancer stages II-IV and adjuvantly......BACKGROUND: Most human cancer cells have structural aberrations of chromosomal regions leading to loss or gain of gene specific alleles. This study aimed to assess the range of gene copies per nucleus of thymidylate synthase (TYMS), thymidine phosphorylase (TP) and dihydrofolate reductase (DHFR...... the median were compared. Also TYMS expression, assessed by immunohistochemistry, was associated with TYMS copies per nucleus. RESULTS: The number of gene copies per nucleus were 1.7 (0.7-2.8), 1.8 (0.9-3.1) and 1.8 (1.1-2.7) median (range) for TYMS, TP and DHFR, respectively. TYMS expression was directly...

  19. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf


    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  20. Heterologous expression of dammarenediol synthase gene in an engineered Saccharomyces cerevisiae. (United States)

    Liang, Y-L; Zhao, S-J; Xu, L-X; Zhang, X-Y


    Dammarenediol production by an engineered yeast Saccharomyces cerevisiae was investigated. A dammarenediol-producing engineered yeast was constructed by heterologous expression of the dammarenediol synthase gene from Panax ginseng hairy roots through RT-PCR. Fermentation was carried out in a 5-L GRJY-bioreactor with an inoculum size of 1% v/v at 30°C. Dammarenediol detection was performed with silica gel chromatography and HPLC. Determination of dammarenediol synthase activity subcellular distribution was carried out by surveying the enzyme activity in microsomes, lipid particles and total yeast homogenate. When cultured under aerobic conditions, the engineered yeast could produce dammarenediol up to 250μgl(-1). However, when an anaerobic shift strategy was employed, dammarenediol accumulated at a level as twice as that under aerobic condition. The dammarenediol synthase and dammarenediol were mainly localized in lipid particles. Dammarenediol could be heterologously produced in engineered yeast. The heterologously expressed dammarenediol synthase is mainly localized in lipid particles. Anaerobic shift strategy could enhance the dammarenediol level in the engineered yeast. This study showed that the high-value plant product dammarenediol could be produced by heterologous expression of the according gene in yeast. Furthermore, the anaerobic shift strategy could be potentially applied in oxidosqualene-derived compounds production in yeast. Here, the information about subcellular distribution of heterologously expressed dammarenediol synthase in the engineered yeast was also provided. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  1. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang


    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  2. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  3. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  4. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    ... our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways ...

  5. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes. (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique


    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  6. Cloning and expression analysis of an anthocyanidin synthase gene ...

    Indian Academy of Sciences (India)

    Expression of ANS in leaves, embryo and seed coat was analysed, which provided a ... taneously amplify the 666-bp fragment of actin gene. The. ANS gene expression in leaves, 15 days after pollination ... ANS expression with shading treatment was evaluated by semiquantitive RT-PCR using B. carinata variety 3H008-6.

  7. Production of taxadiene from cultured ginseng roots transformed with taxadiene synthase gene

    Directory of Open Access Journals (Sweden)

    Mijeong Cha1, Sang Hee Shim1, Sung Hong Kim2, Ok Tae Kim3, Se-Weon Lee4, Suk-Yoon Kwon5 & Kwang-Hyun Baek1,*


    Full Text Available Paclitaxel is produced by various species of yew trees and hasbeen extensively used to treat tumors. In our research, ataxadiene synthase (TS gene from Taxus brevifolia was used totransform the roots of cultured ginseng (Panax ginseng C.A.Meyer to produce taxadiene, the unique skeletal precursor totaxol. The TS gene was successfully introduced into theginseng genome, and the de novo formation of taxadiene wasidentified by mass spectroscopy profiling. Without any changein phenotypes or growth difference in a TS-transgenic ginsengline, the transgenic TSS3-2 line accumulated 9.1 μg taxadieneper gram of dry weight. In response to the treatment of methyljasmonate for 3 or 6 days, the accumulation was 14.6 and15.9 μg per g of dry weight, respectively. This is the first reportof the production of taxadiene by engineering ginseng rootswith a taxadiene synthase gene.

  8. Wild-type phosphoribosylpyrophosphate synthase (PRS from Mycobacterium tuberculosis: a bacterial class II PRS?

    Directory of Open Access Journals (Sweden)

    Ardala Breda

    Full Text Available The 5-phospho-α-D-ribose 1-diphosphate (PRPP metabolite plays essential roles in several biosynthetic pathways, including histidine, tryptophan, nucleotides, and, in mycobacteria, cell wall precursors. PRPP is synthesized from α-D-ribose 5-phosphate (R5P and ATP by the Mycobacterium tuberculosis prsA gene product, phosphoribosylpyrophosphate synthase (MtPRS. Here, we report amplification, cloning, expression and purification of wild-type MtPRS. Glutaraldehyde cross-linking results suggest that MtPRS predominates as a hexamer, presenting varied oligomeric states due to distinct ligand binding. MtPRS activity measurements were carried out by a novel coupled continuous spectrophotometric assay. MtPRS enzyme activity could be detected in the absence of P(i. ADP, GDP and UMP inhibit MtPRS activity. Steady-state kinetics results indicate that MtPRS has broad substrate specificity, being able to accept ATP, GTP, CTP, and UTP as diphosphoryl group donors. Fluorescence spectroscopy data suggest that the enzyme mechanism for purine diphosphoryl donors follows a random order of substrate addition, and for pyrimidine diphosphoryl donors follows an ordered mechanism of substrate addition in which R5P binds first to free enzyme. An ordered mechanism for product dissociation is followed by MtPRS, in which PRPP is the first product to be released followed by the nucleoside monophosphate products to yield free enzyme for the next round of catalysis. The broad specificity for diphosphoryl group donors and detection of enzyme activity in the absence of P(i would suggest that MtPRS belongs to Class II PRS proteins. On the other hand, the hexameric quaternary structure and allosteric ADP inhibition would place MtPRS in Class I PRSs. Further data are needed to classify MtPRS as belonging to a particular family of PRS proteins. The data here presented should help augment our understanding of MtPRS mode of action. Current efforts are toward experimental structure

  9. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes. (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique


    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  10. Functional replacement of the Saccharomyces cerevisiae fatty acid synthase with a bacterial type II system allows flexible product profiles. (United States)

    Fernandez-Moya, Ruben; Leber, Christopher; Cardenas, Javier; Da Silva, Nancy A


    The native yeast type I fatty acid synthase (FAS) is a complex, rigid enzyme, and challenging to engineer for the production of medium- or short-chain fatty acids. Introduction of a type II FAS is a promising alternative as it allows expression control for each discrete enzyme and the addition of heterologous thioesterases. In this study, the native Saccharomyces cerevisiae FAS was functionally replaced by the Escherichia coli type II FAS (eFAS) system. The E. coli acpS + acpP (together), fabB, fabD, fabG, fabH, fabI, fabZ, and tesA were expressed in individual S. cerevisiae strains, and enzyme activity was confirmed by in vitro activity assays. Eight genes were then integrated into the yeast genome, while tesA or an alternate thioesterase gene, fatB from Ricinus communis or TEII from Rattus novergicus, was expressed from a multi-copy plasmid. Native FAS activity was eliminated by knocking out the yeast FAS2 gene. The strains expressing only the eFAS as de novo fatty acid source grew without fatty acid supplementation demonstrating that this type II FAS is able to functionally replace the native yeast FAS. The engineered strain expressing the R. communis fatB thioesterase increased total fatty acid titer 1.7-fold and shifted the fatty acid profile towards C14 production, increasing it from <1% in the native strain to more than 30% of total fatty acids, and reducing C18 production from 39% to 8%. © 2015 Wiley Periodicals, Inc.

  11. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients. (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh


    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  12. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP. (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica


    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  13. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf


    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  14. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp ...

  15. Cloning and expression pattern of chitin synthase (CHS) gene in ...

    African Journals Online (AJOL)



    Aug 16, 2010 ... This study provided an important information for further research on development of RNA interference. (RNAi) technology to control E. ... transcriptional gene silencing; RNAi, RNA interference; RACE, rapid amplification of cDNA .... Alignment showed that the alternately spliced. cDNA sequence of CHS-A in ...

  16. The geranylgeranyl pyrophosphate synthase gene from Ginkgo biloba

    African Journals Online (AJOL)

    polypeptide. Comparative analysis showed that GbGGDPS had a high similarity to other plant GGDPSs. Bioinformatic analysis showed that GbGGDPS was an intron-free gene and its deduced polypeptide contained all the five conserved domains and functional aspartate-rich motifs of the polyprenyltransferases.

  17. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)


    Mar 4, 2015 ... Jimai 22 were used as an experimental model to analyse the expression patterns of wheat TPS genes .... the Bioanalyzer 2100 algorithm (Agilent Technologies, Palo. Alto, USA); high quality (RNA integrity ... software (Premier Biosoft International, Palo Alto, USA). Sequences and other information of the ...

  18. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina


    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  19. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Directory of Open Access Journals (Sweden)

    Anam eYousaf


    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.


    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella


    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  1. Identification of Sporothrix schenckii based on sequences of the chitin synthase 1 gene. (United States)

    Kano, R; Nakamura, Y; Watanabe, S; Tsujimoto, H; Hasegawa, A


    Sporothrix schenckii is pathogenic to human and animals. To detect S. schenckii in the tissue, we designed specific oligonucleotide primers based on the chitin synthase gene. Amplification products were selectively obtained from S. schenckii DNA. Polymerase chain reaction analysis with the primer pair S2-R2 was able to detect 10 pg genomic DNA of S. schenckii with ethidium bromide staining. This detection system will be useful as a microbiological tool for the diagnosis of human and animal sporotrichosis.

  2. Improved pestalotiollide B production by deleting competing polyketide synthase genes in Pestalotiopsis microspora. (United States)

    Chen, Longfei; Li, Yingying; Zhang, Qian; Wang, Dan; Akhberdi, Oren; Wei, Dongsheng; Pan, Jiao; Zhu, Xudong


    Pestalotiollide B, an analog of dibenzodioxocinones which are inhibitors of cholesterol ester transfer proteins, is produced by Pestalotiopsis microspora NK17. To increase the production of pestalotiollide B, we attempted to eliminate competing polyketide products by deleting the genes responsible for their biosynthesis. We successfully deleted 41 out of 48 putative polyketide synthases (PKSs) in the genome of NK17. Nine of the 41 PKS deleted strains had significant increased production of pestalotiollide B (P polyketides.

  3. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification. (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata


    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  4. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  5. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.


    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M


    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  6. Acyl carrier protein (ACP) inhibition and other differences between b-ketoacyl synthase (KAS) I and II

    DEFF Research Database (Denmark)

    McGuire, Kirsten Arnvig; McGuire, J.N.; Wettstein-Knowles, Penny von


    Escherichia coli b-ketoacyl synthases (KAS) I and II carry out the elongation steps in fatty acid synthesis. Analyses using the cross-linker BS3 [bis(sulphosuccinimidyl) suberate] and surface-enhanced laser desorption/ionization–time-of-flight MS disclosed only monomeric and dimeric forms of KAS ...

  7. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.). (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq


    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su


    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  9. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases. (United States)

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E


    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  10. The phytochelatin synthase gene in date palm (Phoenix dactylifera L.): Phylogeny, evolution and expression. (United States)

    Zayneb, Chaâbene; Imen, Rekik Hakim; Walid, Kriaa; Grubb, C Douglas; Bassem, Khemakhem; Franck, Vandenbulcke; Hafedh, Mejdoub; Amine, Elleuch


    We studied date palm phytochelatin synthase type I (PdPCS1), which catalyzes the cytosolic synthesis of phytochelatins (PCs), a heavy metal binding protein, in plant cells. The gene encoding PdPCS1 (Pdpcs) consists of 8 exons and 7 introns and encodes a protein of 528 amino acids. PCs gene history was studied using Notung phylogeny. During evolution, gene loss from several lineages was predicted including Proteobacteria, Bilateria and Brassicaceae. In addition, eleven gene duplication events appeared toward interior nodes of the reconciled tree and four gene duplication events appeared toward the external nodes. These latter sequences belong to species with a second copy of PCs suggesting that this gene evolved through subfunctionalization. Pdpcs1 gene expression was measured in seedling hypocotyls exposed to Cd, Cu and Cr using quantitative real-time polymerase chain reaction (qPCR). A Pdpcs1 overexpression was evidenced in P. dactylifera seedlings exposed to metals suggesting that 1-the Pdpcs1 gene is functional, 2-there is an implication of the enzyme in metal detoxification mechanisms. Additionally, the structure of PdPCS1 was predicted using its homologue from Nostoc (cyanobacterium, NsPCS) as a template in Discovery studio and PyMol software. These analyses allowed us to identify the phytochelatin synthase type I enzyme in date palm (PdPCS1) via recognition of key consensus amino acids involved in the catalytic mechanism, and to propose a hypothetical binding and catalytic site for an additional substrate binding cavity. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Quick guide to polyketide synthase and nonribosomal synthetase genes in Fusarium

    DEFF Research Database (Denmark)

    Hansen, Jørgen T.; Sørensen, Jens L.; Giese, Henriette


    for future polyketide synthases (PKSs) and nonribosomal peptides synthetases (NRPSs) nomenclature assignment and classification. Sequence similarities of the adenylation and ketosynthase domain sequences were used to group the identified NRPS and PKS genes. We present the current state of knowledge of PKS......Fusarium species produce a plethora of bioactive polyketides and nonribosomal peptides that give rise to health problems in animals and may have drug development potential. Using the genome sequences for Fusarium graminearum, F. oxysporum, F. solani and F. verticillioides we developed a framework...

  12. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh


    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  13. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk


    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  14. Characterization of Squalene synthase gene from Chlorophytum borivilianum (Sant. and Fernand.). (United States)

    Kalra, Shikha; Kumar, Sunil; Lakhanpal, Neha; Kaur, Jagdeep; Singh, Kashmir


    Saponins are important group of secondary metabolites known for their pharmacological properties. Chlorophytum borivilianum contains high amount of saponins and is thus, recognized as an important medicinal plant with aphrodisiac properties. Though the plant is well known for its pharmaceutical properties, there is meager information available about the genes and enzymes responsible for biosynthesis of saponins from this plant. Squalene synthase (SqS) is the key enzyme of saponin biosynthesis pathway and here, we report cloning and characterization of SqS gene from C. borivilianum. A full-length CbSqS cDNA consisting of 1,760 bp was cloned which contained an open reading frame (ORF) of 1,233 bp, encoding a protein of 411 amino acids. Analysis of deduced amino acid sequence of CbSqS predicted the presence of conserved isoprenoid family domain and catalytic sites. Phylogenetic analysis revealed that CbSqS is closer to Glycine max and monocotyledonous plants. 3D structure prediction using various programs showed CbSqS structure to be similar to SqS from other species. C-terminus truncated recombinant squalene synthase (TruncCbSqS) was expressed in E. coli M15 cells with optimum expression induced with 1 mM IPTG at 37 °C. The gene expression level was analyzed through semi-quantitative RT-PCR and was found to be higher in leaves as compared to the roots.

  15. Genome and transcriptome-wide analyses of cellulose synthase gene superfamily in soybean. (United States)

    Nawaz, Muhammad Amjad; Rehman, Hafiz Mamoon; Baloch, Faheem Shehzad; Ijaz, Babar; Ali, Muhammad Amjad; Khan, Iqrar Ahmad; Lee, Jeong Dong; Chung, Gyuhwa; Yang, Seung Hwan


    The plant cellulose synthase gene superfamily belongs to the category of type-2 glycosyltransferases, and is involved in cellulose and hemicellulose biosynthesis. These enzymes are vital for maintaining cell-wall structural integrity throughout plant life. Here, we identified 78 putative cellulose synthases (CS) in the soybean genome. Phylogenetic analysis against 40 reference Arabidopsis CS genes clustered soybean CSs into seven major groups (CESA, CSL A, B, C, D, E and G), located on 19 chromosomes (except chromosome 18). Soybean CS expansion occurred in 66 duplication events. Additionally, we identified 95 simple sequence repeat makers related to 44 CSs. We next performed digital expression analysis using publically available datasets to understand potential CS functions in soybean. We found that CSs were highly expressed during soybean seed development, a pattern confirmed with an Affymatrix soybean IVT array and validated with RNA-seq profiles. Within CS groups, CESAs had higher relative expression than CSLs. Soybean CS models were designed based on maximum average RPKM values. Gene co-expression networks were developed to explore which CSs could work together in soybean. Finally, RT-PCR analysis confirmed the expression of 15 selected CSs during all four seed developmental stages. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Transcriptional modulation of squalene synthase genes in barley treated with PGPR (United States)

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel


    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  17. Clinical aspects of endothelial NO-synthase gene polymorphism in professional sportsmen (literature review

    Directory of Open Access Journals (Sweden)

    S. N. Malakhova


    Full Text Available The article deals the questions of properties and biological role of nitric oxide molecule, which is characterized with vasodilating, stress limiting and neurotransmitter properties, and participates in reactions of oxidative stress, glutamate and calcium cascade and inflammation. Researches of the relationship of endothelial NO-synthase and the risk of cardiovascular, ischemic and respiratory diseases in population of untrained persons and athletes continue. The aim of this study was to establish, according to the literature, the present state of the influence of endothelial NO-synthase gene polymorphism on the formation of the physical qualities of strength, endurance and speed in professional athletes, its changes and influence on functional state of athlete. At the present stage of development of medical genetics it is proved, that the implementation of the action of each individual isoform of the enzyme NO-synthase is caused by the presence of polymorphism. The most studied are the T-786С polymorphism of the eNOS gene promoter, G894T (Glu298Asp polymorphism of the 7th exon, 4a/b–4th intron of eNOS, but their influence is not definitively proven, and is caused by the presence of homo- or heterozygotes. Genetic researches among professional athletes prove the significant role of nitric oxide system in enhancing of physical working capacity, but do not allow evaluating the characteristics of this effect, taking into account multi-directional training process and the level of sports qualification, as well as predicting future professional success and the preservation of the proper functioning of the cardiovascular, respiratory and other body systems. Conclusions. Thus, contemporary researches allow stating that oxide synthesis has a leading role in the functioning of the organism, and in particular athletes, but do not allow assessing its effects on the body of athletes of different sports qualification. It is proved that polymorphism of the

  18. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.


    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  19. Campylobacter jejuni fatty acid synthase II: Structural and functional analysis of [beta]-hydroxyacyl-ACP dehydratase (FabZ)

    Energy Technology Data Exchange (ETDEWEB)

    Kirkpatrick, Andrew S.; Yokoyama, Takeshi; Choi, Kyoung-Jae; Yeo, Hye-Jeong; (Houston)


    Fatty acid biosynthesis is crucial for all living cells. In contrast to higher organisms, bacteria use a type II fatty acid synthase (FAS II) composed of a series of individual proteins, making FAS II enzymes excellent targets for antibiotics discovery. The {beta}-hydroxyacyl-ACP dehydratase (FabZ) catalyzes an essential step in the FAS II pathway. Here, we report the structure of Campylobacter jejuni FabZ (CjFabZ), showing a hexamer both in crystals and solution, with each protomer adopting the characteristic hot dog fold. Together with biochemical analysis of CjFabZ, we define the first functional FAS II enzyme from this pathogen, and provide a framework for investigation on roles of FAS II in C. jejuni virulence

  20. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes (United States)

    Wang, Guoliang; Zhao, Ge; Feng, Yanbin; Xuan, Jinsong; Sun, Jianwei; Guo, Baotai; Jiang, Guoyong; Weng, Manli; Yao, Jianting; Wang, Bin; Duan, Delin; Liu, Tao


    The full-length cDNA sequence (3219 base pairs) of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS) was isolated by RACE-PCR and deposited in GenBank (NCBI) with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5), whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB). Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI). All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94%) and in amino acid composition (>96%). Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes. PMID:20714424

  1. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase. (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo


    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  2. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang


    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  3. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species. (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing


    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.). (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui


    In higher plants, sucrose synthase (Sus, EC is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  5. Studies of gene expression and activity of hexokinase, phosphofructokinase and glycogen synthase in human skeletal muscle in states of altered insulin-stimulated glucose metabolism

    DEFF Research Database (Denmark)

    Vestergaard, H


    of the review is to discuss our present knowledge of the activities and gene expression of hexokinase II (HKII), phosphofructokinase (PFK) and glycogen synthase (GS) in human skeletal muscle in states of altered insulin-stimulated glucose metabolism. My own experimental studies have comprised patients...... been reported to increase the basal concentration of muscle GS mRNA in NIDDM patients to a level similar to that seen in control subjects although insulin-stimulated glucose disposal rates remain reduced in NIDDM patients. In the insulin resistant states examined so far, basal and insulin...

  6. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum). (United States)

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin


    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way.

  7. Two residues determine the product profile of the class II diterpene synthases TPS14 and TPS21 of Tripterygium wilfordii

    DEFF Research Database (Denmark)

    Hansen, Nikolaj Lervad; Nissen, Jakob N.; Hamberger, Björn Robert


    The medicinal plant Tripterygium wilfordii (Celastraceae) contains a pair of class II diterpene synthases (diTPS) of specialized labdane-type metabolism that, despite remarkably close homology, form strikingly different products. TwTPS21 catalyzes bicyclization of the linear C20 precursor...... to the understanding of structure-function relation in plant class II diTPSs and complements previous mutational studies of Arabidopsis ent-copalyl diphosphate synthase with additional examples from the specialized metabolism of T. wilfordii.......-directed mutagenesis, we generated a panel of six variants, where one, or both positions were exchanged between the enzymes. In coupled heterologous assays with a corresponding class I diTPS, TwTPS2, complete product interchange was observed in variants with both reciprocal mutations, while substitutions of either...

  8. Substitution of Two Active-Site Residues Alters C9-Hydroxylation in a Class II Diterpene Synthase. (United States)

    Mafu, Sibongile; Fischer, Emil; Addison, J Bennett; Riberio Barbosana, Isabel; Zerbe, Philipp


    Diterpenes form a vast and diverse class of natural products of both ecological and economic importance. Class II diterpene synthase (diTPS) enzymes control the committed biosynthetic reactions underlying diterpene chemical diversity. Homology modelling with site-directed mutagenesis identified two active-site residues in the horehound (Marrubium vulgare) class II diTPS peregrinol diphosphate synthase (MvCPS1); residue substitutions abolished the unique MvCPS1-catalysed water-capture reaction at C9 and redirected enzyme activity toward formation of an alternative product, halima-5(10),13-dienyl diphosphate. These findings contributed new insight into the steric interactions that govern diTPS-catalysed regiospecific oxygenation reactions and highlight the feasibility of diTPS engineering to provide a broader spectrum of bioactive diterpene natural products. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Induction of Malate Synthase Gene Expression in Senescent and Detached Organs of Cucumber. (United States)

    Graham, IA; Leaver, CJ; Smith, SM


    Expression of the malate synthase (MS) gene is activated in cotyledons of cucumber seedlings during postgerminative growth and then repressed as the cotyledons become photosynthetic. MS gene expression is subsequently reactivated in the cotyledons as they senesce a few weeks later. In situ hybridization revealed that MS RNA is distributed throughout the organ during postgerminative growth and senescence, showing that the same cells express the gene at different stages of development. MS RNA also appears in senescing leaves and petals of cucumber plants. In addition, we found that MS RNA appears in mature expanded leaves and roots when they are removed from the plant and incubated in darkness for several days, thus providing a potential experimental system for the manipulation of MS gene expression. Leaves from transgenic Nicotiana plumbaginifolia containing the cucumber MS promoter fused to the [beta]-glucuronidase (GUS) reporter gene accumulated GUS activity when detached, demonstrating an activation of transcription from the MS promoter following leaf excision. These results are discussed in terms of the metabolic regulation of MS gene expression. PMID:12297649

  10. Functional Characterization of Nine Norway Spruce TPS Genes and Evolution of Gymnosperm Terpene Synthases of the TPS-d Subfamily1[w (United States)

    Martin, Diane M.; Fäldt, Jenny; Bohlmann, Jörg


    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (−)-limonene synthase, (−)-α/β-pinene synthase, and (−)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-α-farnesene synthase, and E-α-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed. PMID:15310829

  11. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    Directory of Open Access Journals (Sweden)

    Chen Aiqun


    Full Text Available Abstract Background In plants, sucrose synthase (Sus is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7 identified from diploid fiber cotton (Gossypium arboreum. Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development.

  12. Structural and functional characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42. (United States)

    Chen, Xiao-Hua; Vater, Joachim; Piel, Jörn; Franke, Peter; Scholz, Romy; Schneider, Kathrin; Koumoutsi, Alexandra; Hitzeroth, Gabriele; Grammel, Nicolas; Strittmatter, Axel W; Gottschalk, Gerhard; Süssmuth, Roderich D; Borriss, Rainer


    Although bacterial polyketides are of considerable biomedical interest, the molecular biology of polyketide biosynthesis in Bacillus spp., one of the richest bacterial sources of bioactive natural products, remains largely unexplored. Here we assign for the first time complete polyketide synthase (PKS) gene clusters to Bacillus antibiotics. Three giant modular PKS systems of the trans-acyltransferase type were identified in Bacillus amyloliquefaciens FZB 42. One of them, pks1, is an ortholog of the pksX operon with a previously unknown function in the sequenced model strain Bacillus subtilis 168, while the pks2 and pks3 clusters are novel gene clusters. Cassette mutagenesis combined with advanced mass spectrometric techniques such as matrix-assisted laser desorption ionization-time of flight mass spectrometry and liquid chromatography-electrospray ionization mass spectrometry revealed that the pks1 (bae) and pks3 (dif) gene clusters encode the biosynthesis of the polyene antibiotics bacillaene and difficidin or oxydifficidin, respectively. In addition, B. subtilis OKB105 (pheA sfp(0)), a transformant of the B. subtilis 168 derivative JH642, was shown to produce bacillaene, demonstrating that the pksX gene cluster directs the synthesis of that polyketide. The GenBank accession numbers for gene clusters pks1(bae), pks2, and pks3(dif) are AJ 634060.2, AJ 6340601.2, and AJ 6340602.2, respectively.

  13. Positive selection and functional divergence of farnesyl pyrophosphate synthase genes in plants. (United States)

    Qian, Jieying; Liu, Yong; Chao, Naixia; Ma, Chengtong; Chen, Qicong; Sun, Jian; Wu, Yaosheng


    Farnesyl pyrophosphate synthase (FPS) belongs to the short-chain prenyltransferase family, and it performs a conserved and essential role in the terpenoid biosynthesis pathway. However, its classification, evolutionary history, and the forces driving the evolution of FPS genes in plants remain poorly understood. Phylogeny and positive selection analysis was used to identify the evolutionary forces that led to the functional divergence of FPS in plants, and recombinant detection was undertaken using the Genetic Algorithm for Recombination Detection (GARD) method. The dataset included 68 FPS variation pattern sequences (2 gymnosperms, 10 monocotyledons, 54 dicotyledons, and 2 outgroups). This study revealed that the FPS gene was under positive selection in plants. No recombinant within the FPS gene was found. Therefore, it was inferred that the positive selection of FPS had not been influenced by a recombinant episode. The positively selected sites were mainly located in the catalytic center and functional areas, which indicated that the 98S and 234D were important positively selected sites for plant FPS in the terpenoid biosynthesis pathway. They were located in the FPS conserved domain of the catalytic site. We inferred that the diversification of FPS genes was associated with functional divergence and could be driven by positive selection. It was clear that protein sequence evolution via positive selection was able to drive adaptive diversification in plant FPS proteins. This study provides information on the classification and positive selection of plant FPS genes, and the results could be useful for further research on the regulation of triterpenoid biosynthesis.

  14. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi. (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei


    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene. (United States)

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia


    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii. Copyright © 2014. Published by Elsevier Inc.

  16. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.


    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  17. Enhanced thermotolerance for ethanol fermentation of Saccharomyces cerevisiae strain by overexpression of the gene coding for trehalose-6-phosphate synthase. (United States)

    An, Ming-Zhe; Tang, Yue-Qin; Mitsumasu, Kanako; Liu, Ze-Shen; Shigeru, Morimura; Kenji, Kida


    The effect of overexpression of the trehalose-6-phosphate (T6P) synthase gene (TPS1) on ethanol fermentation of Saccharomyces cerevisiae has been studied at 30 and 38°C. The activity of T6P synthase and the accumulation of trehalose during ethanol fermentation were significantly improved by overexpression of TPS1, and especially at 38°C. Ethanol produced by transformants with and without TPS1 gene overexpression at 38°C was approx. 60 and 37 g/l, respectively. The fermentation efficiency of transformants with TPS1 gene overexpression at 38°C was similar to that at 30°C. The critical growth temperature was increased from 36 to 42°C by TPS1 gene overexpression. These results indicated that overexpression of the TPS1 gene had a beneficial effect on the fermentation capacity of the title yeast strain at high temperatures.

  18. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming


    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  19. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S


    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  20. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    Energy Technology Data Exchange (ETDEWEB)

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. (Vanderbilt Univ., Nashville, TN (United States))


    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.


    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo


    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  2. Identification of a novel hedycaryol synthase gene isolated from Camellia brevistyla flowers and floral scent of Camellia cultivars. (United States)

    Hattan, Jun-ichiro; Shindo, Kazutoshi; Ito, Tomoko; Shibuya, Yurica; Watanabe, Arisa; Tagaki, Chie; Ohno, Fumina; Sasaki, Tetsuya; Ishii, Jun; Kondo, Akihiko; Misawa, Norihiko


    A novel terpene synthase (Tps) gene isolated from Camellia brevistyla was identified as hedycaryol synthase, which was shown to be expressed specifically in flowers. Camellia plants are very popular because they bloom in winter when other plants seldom flower. Many ornamental cultivars of Camellia have been bred mainly in Japan, although the fragrance of their flowers has not been studied extensively. We analyzed floral scents of several Camellia cultivars by gas chromatography-mass spectrometry (GC-MS) and found that Camellia brevistyla produced various sesquiterpenes in addition to monoterpenes, whereas Camellia japonica and its cross-lines produced only monoterpenes, including linalool as the main product. From a flower of C. brevistyla, we isolated one cDNA encoding a terpene synthase (TPS) comprised of 554 amino acids, which was phylogenetically positioned to a sole gene clade. The cDNA, designated CbTps1, was expressed in mevalonate-pathway-engineered Escherichia coli, which carried the Streptomyces mevalonate-pathway gene cluster in addition to the acetoacetate-CoA ligase gene. A terpene product was purified from recombinant E. coli cultured with lithium acetoacetate, and analyzed by (1)H-nulcear magnetic resonance spectroscopy ((1)H-NMR) and GC-MS. It was shown that a sesquiterpene hedycaryol was produced, because (1)H-NMR signals of the purified product were very broad, and elemol, a thermal rearrangement product from hedycaryol, was identified by GC-MS analysis. Spectroscopic data of elemol were also determined. These results indicated that the CbTps1 gene encodes hedycaryol synthase. Expression analysis of CbTps1 showed that it was expressed specifically in flowers, and hedycaryol is likely to be one of the terpenes that attract insects for pollination of C. brevistyla. A linalool synthase gene, which was isolated from a flower of Camellia saluenensis, is also described.

  3. Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR

    NARCIS (Netherlands)

    Olawole, O.; Jacobsen, E.; Vincken, J.P.; Visser, R.G.F.


    Two transgenic potato lines, csr2–1 and csr4–8 that contained two different antisense cellulose synthase (CesA) genes, csr2 and csr4, respectively were crossed. The aim, amongst others, was to investigate the possibility of generating double transformants to validate a hypothetical presence of the

  4. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Directory of Open Access Journals (Sweden)

    Bin Tang


    Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

  5. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications (United States)

    Tang, Bin; Wang, Su; Wang, Shi-Gui; Wang, Hui-Juan; Zhang, Jia-Yong; Cui, Shuai-Ying


    The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP) pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects. PMID:29445344

  6. Gene therapy of transplant arteriopathy by liposome-mediated transfection of endothelial nitric oxide synthase. (United States)

    Iwata, A; Sai, S; Moore, M; Nyhuis, J; de Fries-Hallstrand, R; Quetingco, G C; Allen, M D


    Transplant arteriopathy is the major factor limiting long-term survival after cardiac transplantation. We have previously demonstrated that liposome-mediated gene delivery of endothelial nitric oxide synthase (eNOS) to donor hearts reduces ischemia-reperfusion injury by blocking NFkappaB activation, adhesion molecule expression, and leukocyte infiltration. In this study, we used gene transfer of eNOS in a rabbit carotid transplant model to see whether these same effects would similarly ameliorate transplant arteriopathy. Liposomes complexed to the gene encoding eNOS were injected into donor carotid arterial segments that were transplanted orthotopically into recipient carotid arteries (n = 10). Controls included transplanted carotids transfected with liposomes complexed to empty plasmids (no functional gene) (n = 4) and transplanted carotids treated with saline (n = 6). Transplanted arteries were harvested for processing at 21 days. Intima/media (I/M) area ratios were calculated by computerized image analysis. Infiltrating T-lymphocytes and macrophages, and expression of VCAM-1 and ICAM-1 were quantified on immunocytochemistry. The I/M ratio was significantly reduced in eNOS-transfected arteries compared with arteries transfected with empty plasmids and saline-treated controls. Compared to transplanted control arteries, eNOS-transfected arteries demonstrated significantly reduced T-cell infiltration into the intima and significantly reduced macrophage infiltration into the media. Cell surface expression of VCAM-1 and ICAM-1 were both reduced in eNOS-transfected arteries. ENOS gene delivery can suppress neointimal lesion formation and T-lymphocyte and macrophage infiltration in transplanted arteries, associated with a reduction in relevant adhesion molecule expression. Thus, gene therapy with eNOS may not only reduce ischemia-reperfusion injury but may also ameliorate transplant arteriopathy in transplanted hearts.

  7. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang


    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  8. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.


    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  9. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang


    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  10. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  11. The polyketide synthase gene pks4 of Trichoderma reesei provides pigmentation and stress resistance. (United States)

    Atanasova, Lea; Knox, Benjamin P; Kubicek, Christian P; Druzhinina, Irina S; Baker, Scott E


    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi.

  12. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide. (United States)

    Jain, Parul; Tar'an, Bunyamin


    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  13. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit. (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang


    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  14. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.). (United States)

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan


    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase ( Ans ) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans +5 . The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans / ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans +5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  15. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L..

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Rafique


    Full Text Available Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (Anne. A 5-bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect i.e. nonsense-mRNA mediated decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  16. Regulation of acetate metabolism in Corynebacterium glutamicum: transcriptional control of the isocitrate lyase and malate synthase genes. (United States)

    Wendisch, V F; Spies, M; Reinscheid, D J; Schnicke, S; Sahm, H; Eikmanns, B J


    In the amino-acid-producing microorganism Corynebacterium glutamicum, the specific activities of the acetate-activating enzymes acetate kinase and phosphotransacetylase and those of the glyoxylate cycle enzymes isocitrate lyase and malate synthase were found to be high when the cells were grown on acetate (0.8, 2.9, 2.1, and 1.8 U/mg protein, respectively). When the cells were grown on glucose or on other carbon sources such as lactate, succinate, or glutamate, the specific activities were two- to fourfold (acetate kinase and phosphotransacetylase) and 45- to 100-fold (isocitrate lyase and malate synthase) lower, indicating that the synthesis of the four enzymes is regulated by acetate in the growth medium. A comparative Northern (RNA) analysis of the C. glutamicum isocitrate lyase and malate synthase genes (aceA and aceB) and transcriptional cat fusion experiments revealed that aceA and aceB are transcribed as 1.6- and 2.7-kb monocistronic messages, respectively, and that the regulation of isocitrate lyase and malate synthase synthesis is exerted at the level of transcription from the respective promoters. Surprisingly, C. glutamicum mutants defective in either acetate kinase or phosphotransacetylase showed low specific activities of the other three enzymes (phosphotransacetylase, isocitrate lyase, and malate synthase or acetate kinase, isocitrate lyase, and malate synthase, respectively) irrespective of the presence or absence of acetate in the medium. This result and a correlation of a high intracellular acetyl coenzyme A concentration with high specific activities of isocitrate lyase, malate synthase, acetate kinase, and phosphotransacetylase suggest that acetyl coenzyme A or a derivative thereof may be a physiological trigger for the genetic regulation of enzymes involved in acetate metabolism of C. glutamicum.

  17. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis


    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo


    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focuse...

  18. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C


    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...

  19. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes (United States)

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.


    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  20. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  1. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)


    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  2. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat


    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  3. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)


    pathway for improving oil quality and increasing oil content of peanut through biotechnology-based approaches. Fatty acid biosynthesis is catalysed by two types of fatty acid synthase (FAS). Type I FAS, as found in vertebrates, yeast and some bacteria, contains all the active sites on one or two multidomain polypeptides.

  4. [Antibacterial activity of Porphyra spp. epiphytic bacteria and polyketide synthase I gene screening]. (United States)

    Fang, Wenya; Yang, Rui; Zhu, Peng; Shan, Yuanyuan; Yan, Xiaojun


    Based on the antibacterial analysis, we screened Polyketide synthase (PKS I) gene from the epiphytic bacteria of Porphyra spp., in order to obtain the PKS I positive strains and detect the potential connection between the PKS pathway and the antibacterial mechanisms. A total of 31 bacteria with broad-spectrum antibacterial activity were screened by agar-screening methods. The 16S rDNA and the Ketosynthase gene were amplified from the genome DNA of these bacteria, which were cloned into pMD19-T vector for sequencing analysis. Porphyra spp. epiphytic bacteria showed broad-spectrum antibacterial activity. Three PKS I positive epiphytic bacteria were obtained from Wenzhou rotten Porphyra spp. samples which had high antibacterial activity. The BLAST results indicated that the Ketosynthase fragments of PKS I from the strains of WPhG3, WPySwl and WPySw2 shared highest similarity (98%, 99%, 98%) to the strains of Bacillus subtilis subsp. Subtilis str. 168 (NP_389602), Bacillus subtilis (ABR19776) and Aspergillus carbonarius (AAZ99721), respectively. Furthermore, the phylogenetic analysis based on 16S rDNA sequences indicated that they belonged to the genus of Bacillus. The flora of Porphyra spp. epiphytic bacteria was complex, which regulated the phycosphere in many ways. The PKS I pathway might be a performance of antibacterial function of Bacillus from Wenzhou rotten samples.

  5. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email:; Gu, Ji-Dong [The University of Hong Kong (China)], email:


    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  6. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González


    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  7. Diversifying selection on flavanone 3-hydroxylase and isoflavone synthase genes in cultivated soybean and its wild progenitors.

    Directory of Open Access Journals (Sweden)

    Hao Cheng

    Full Text Available Soybean isoflavone synthase (IFS and flavanone 3-hydroxylase (F3H are two key enzymes catalyzing the biosynthesis of isoflavonoids and flavonoids, both of which play diverse roles in stress responses. However, little is known about the evolutionary pattern of these genes in cultivated soybean and its wild progenitors. Herein, we investigated the nucleotide polymorphisms in Isoflavone synthase (IFS1, IFS2 and Flavanone 3-hydroxylase (F3H2 genes from 33 soybean accessions, including 17 cultivars (Glycine max and 16 their wild progenitors (Glycine soja. Our data showed that the target genes shared the levels of nucleotide polymorphism with three reference genes involved in plant-microbe interactions, but possessed a much higher nucleotide polymorphism than other reference genes. Moreover, no significant genetic differentiation was found between cultivated soybean and its wild relatives in three target genes, despite of considering bottleneck and founder effect during domestication. These results indicate that IFS and F3H genes could have experienced gene introgressions or diversifying selection events during domestication process. Especially, F3H2 gene appears to evolve under positive selection and enjoy a faster evolutionary rate than IFS1 and IFS2 genes.

  8. [Cloning and prokaryotic expression of Rhodoblastus acidophilus 5-aminolevlinate synthase gene]. (United States)

    Zhang, De-yong; Cheng, Fei-xue; Cheng, Ju-e; Zhang, Zhan-hong; Liu, Yong


    5-aminolevulinic acid (ALA) is formed by the enzyme ALA synthase (ALAS). However, the fidelity of ALAS gene among species is low. The ALAS gene of photosynthetic bacteria Rhodoblastus acidophilus was cloned from its genomic DNA by conventional PCR and Veterette PCR and further sequenced. The identity of ALAS gene among photosynthetic bacteria species is from 64.0% to 95.1% according to phylogenic analysis. Furthermore, the ALAS gene was subcloned into an expression vector pQE30. For the overproduction of ALA, the recombinant ALAS was overexpressed in Escherichia coli strains JM109, M15 and BL21 (DE3), respectively. The expected 44kD protein was detected by SDS-PAGE in three E. coli strains after IPTG induction and further purified by affinity purification on Ni-NTA. The conditions including strain, medium, substrate of ALA synthesize (glycine and succinic acid), and ALA dehydratase inhibitor (levulinic acid) were optimized for attainning the maximum yield of ALA in E. coli. The ALA production was established on E. coli M15, medium 1 supplied with 100mmol/L glycine and 50mmol/L succinic acid, and 40mmol/L levulinic acid. The activity of ALAS was up to 333U/min x mg of protein. Meanwhile, the output of ALA was reached to 5.379g/L, which is the highest yield of ALA up to date by biofermentation. ALA has a variety of agricultural applications not only as an herbicide, insecticide, and growth promoting factor, but also based on its ability to confer salt and cold temperature tolerance in plants. Our recombinant bacteria are of great potential in the production of ALA. Our results offer an easy and simple ALA mass production method and may stimulate the application of ALA in agriculture.

  9. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.


    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  10. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat. (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi


    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  11. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  12. The terpene synthase gene family in Tripterygium wilfordii harbors a labdane-type diterpene synthase among the monoterpene synthase TPS-b subfamily

    DEFF Research Database (Denmark)

    Hansen, Nikolaj Lervad; Heskes, Allison Maree; Hamberger, Britta


    Tripterygium wilfordii (Celastraceae) is a medicinal plant with anti-inflammatory and immunosuppressive properties. Identification of a vast array of unusual sesquiterpenoids, diterpenoids and triterpenoids in T. wilfordii has spurred investigations of their pharmacological properties. The tri...... in the formation of four C-20 diphosphate intermediates, precursors of both generalized and specialized metabolism and a novel scaffold for Celastraceae. Functional pairs of the class I and II enzymes resulted in formation of three scaffolds, accounting for some of the terpenoid diversity found in T. wilfordii...

  13. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  14. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase. (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J


    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  15. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance. (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A


    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  16. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  17. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera. (United States)

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S


    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  18. Carotenoid content and expression of phytoene synthase and phytoene desaturase genes in bitter melon (Momordica charantia). (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Park, Nam Il; Lee, Sook Young; Park, Sang Un


    Momordica charantia, a tropical plant, produces a fruit that has a β-carotene concentration five times higher than that of carrot. To elucidate the molecular basis of β-carotene accumulation in M. charantia, the gene expression levels of phytoene synthase (McPSY) and phytoene desaturase (McPDS) were determined. These levels were particularly high in the flowers of M. charantia. During fruit maturation, the expression levels of McPSY and McPDS decreased during the mid-stages but increased in the fully mature fruit. In addition, carotenoids accumulated as the peel changed from green to orange. Thus, McPSY and McPDS expression correlated with carotenoid accumulation during fruit maturation. Principal component analysis (PCA) also was used to evaluate the differences among the profiles of seven carotenoids identified in the fruit at several maturation stages. Riper fruits had higher carotenoid concentrations than less ripe fruits. Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  19. Metagenomic Survey of Potential Symbiotic Bacteria and Polyketide Synthase Genes in an Indonesian Marine Sponge

    Directory of Open Access Journals (Sweden)

    Nia M. Kurnia


    Full Text Available There has been emerging evidence that the bacteria associated with marine sponges are the key producers of many complex bioactive compounds. The as-yet uncultured candidate bacterial genus “Candidatus Entotheonella” of the marine sponge Theonella swinhoei from Japan have recently been recognized as the source of numerous pharmacologically relevant polyketides and modified peptides, as previously reported by the Piel group (Wilson et al. 2014. This work reported the presence of “Candidatus Entotheonella sp.” in the highly complex microbiome of an Indonesian marine sponge from Kapoposang Island, South Sulawesi. We further identified the Kapoposang sponge specimen used in this work as Rhabdastrella sp. based on the integrated morphological, histological, and cytochrome oxidase subunit I (COI gene analyses. To detect the polyketide biosynthetic machinery called type I polyketide synthase (PKS in this Indonesian Rhabdastrella sp., we amplified and cloned the ketosynthase-encoding DNA regions of approximately 700 bp from the uncultured sponge's microbiome. Further sequencing and analysis of several randomly chosen clones indicated that all of them are mostly likely involved in the biosynthesis of methyl-branched fatty acids. However, employing a PKS-targeting primer designed in this work led to the isolation of four positive clones. BlastX search and subsequent phylogenetic analysis showed that one of the positive clones, designed as RGK32, displayed high homology with ketosynthase domains of many type I PKS systems and may belong to the subclass cis-AT PKS group.

  20. Expression of monoamine transporters, nitric oxide synthase 3 and neurotrophin genes in antidepressant-stimulated astrocytes

    Directory of Open Access Journals (Sweden)

    Sarah eKittel-Schneider


    Full Text Available Background: There is increasing evidence that glial cells play a role in the pathomechanisms of mood disorders and the mode of action of antidepressant drugs. Methods: To examine whether there is a direct effect on the expression of different genes encoding proteins that have been implicated in the pathophysiology of affective disorders, primary astrocyte cell cultures from rats were treated with two different antidepressant drugs, imipramine and escitalopram, and the mRNA expression of brain derived neurotrophic factor (Bdnf, serotonin transporter (5Htt, dopamine transporter (Dat and endothelial nitric oxide synthase (Nos3 was examined. Results: Stimulation of astroglial cell culture with imipramine, a tricyclic antidepressant, lead to a significant increase of the Bdnf mRNA level whereas treatment with escitalopram did not. In contrast, 5Htt was not differentially expressed after antidepressant treatment. Finally, neither Dat nor Nos3 mRNA expression was detected in cultured astrocytes. Conclusions: These data provide further evidence for a role of astroglial cells in the molecular mechanisms of action of antidepressants.

  1. Identification and characterization of a novel trehalose synthase gene derived from saline-alkali soil metagenomes.

    Directory of Open Access Journals (Sweden)

    Ling Jiang

    Full Text Available A novel trehalose synthase (TreS gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn(2+ and Hg(2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficiency (Kcat/K m for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%, making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis.

  2. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia. (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D


    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  3. Mitochondrial ATP synthase deficiency due to a mutation in the ATP5E gene for the F1 e subunit

    Czech Academy of Sciences Publication Activity Database

    Mayr, J. A.; Havlíčková, Vendula; Zimmermann, F.; Magler, I.; Kaplanová, Vilma; Ješina, Pavel; Pecinová, Alena; Nůsková, Hana; Koch, J.; Sperl, W.; Houštěk, Josef


    Roč. 19, č. 17 (2010), s. 3430-3439 ISSN 0964-6906 R&D Projects: GA MZd(CZ) NS9759; GA MŠk(CZ) 1M0520 Grant - others:Univerzita Karlova(CZ) 97807 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP-synthase * ATP5E * disease Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 8.058, year: 2010

  4. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan


    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  5. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  6. Identification and characterization of genetic variation in the folylpolyglutamate synthase gene. (United States)

    Leil, Tarek A; Endo, Chiaki; Adjei, Araba A; Dy, Grace K; Salavaggione, Oreste E; Reid, Joel R; Ames, Matthew M; Adjei, Alex A


    Folylpolyglutamate synthase (FPGS) catalyzes the polyglutamation of folic acid, methotrexate, and pemetrexed to produce highly active metabolites. To characterize genetic variation in the FPGS gene, FPGS, have resequenced the gene in four different ethnic populations. Thirty-four single nucleotide polymorphisms were identified including five nonsynonymous coding single nucleotide polymorphisms that altered the FPGS protein sequence: F13L and V22I polymorphisms in the mitochondrial isoform of FPGS, and R466/424C, A489/447V, and S499/457F polymorphisms, which exist in both the mitochondrial and cytosolic isoforms. When expressed in AuxB1 cells, the A447V cytosolic variant was functionally similar to the wild-type cytosolic (WT Cyt) allozyme, whereas the R424C and S457F cytosolic variants were reduced by approximately 2-fold in protein expression compared with WT Cyt (P glutamate was reduced by 12.3-fold (R424C, P < 0.01) and 6.2-fold (S457F, P < 0.01), whereas the intrinsic clearance of methotrexate was reduced by 4.2-fold (R424C, P < 0.05) and 5.4-fold (S457F, P < 0.05) in these two cytosolic variants when compared with the WT Cyt isoform. Additionally, the in vitro enzyme velocity at saturating pemetrexed concentrations was reduced by 1.6-fold (R424C, P < 0.05) and 2.6-fold (S457F, P < 0.01) compared with WT Cyt. AuxB1 cells harboring these same cytosolic variant allozymes displayed significant increases in the EC(50) for folic acid and in the IC(50) values for both methotrexate and pemetrexed relative to the WT Cyt form of FPGS. These observations suggest that genetic variations in FPGS may alter the efficacy of antifolate therapy in cancer patients.

  7. Endothelial Nitric Oxide Synthase Gene Variation Associated With Chronic Kidney Disease After Liver Transplant (United States)

    Bambha, Kiran; Kim, W. Ray; Rosen, Charles B.; Pedersen, Rachel A.; Rys, Cynthia; Kolbert, Christopher P.; Cunningham, Julie M.; Therneau, Terry M.


    OBJECTIVE: To identify single nucleotide polymorphisms (SNPs) associated with risk of developing chronic kidney disease (CKD), a prevalent comorbidity, after liver transplant (LT). PATIENTS AND METHODS: This study consists of a cohort of adult (≥18 years) primary-LT recipients who had normal renal function before LT and who survived 1 year or more after LT at a high-volume US LT program between January 1, 1990, and December 31, 2000. Patients with adequate renal function (estimated glomerular filtration rate, ≥40 mL/min per 1.73 m2 during follow-up; n=308) and patients with incident CKD (estimated glomerular filtration rate, <40 mL/min per 1.73 m2 after LT; n=92) were identified. To investigate the association of 6 candidate genes with post-LT CKD, we selected SNPs that have been associated with renal function in the literature. Hazard ratios were estimated using Cox regression, adjusted for potential confounding variables. RESULTS: The variant allele (298Asp) of the Glu298Asp SNP in the endothelial nitric oxide synthase gene (NOS3) was significantly associated with CKD after LT (P=.05; adjusted for multiple comparisons). The 5-year incidence of CKD was 70% among patients homozygous for the NOS3 variant allele (298Asp) compared with 42% among those not homozygous for the NOS3 variant allele. Specifically, homozygosity for the NOS3 variant allele conferred a 2.5-fold increased risk of developing CKD after LT (P=.005, adjusted for confounding variables). CONCLUSION: Homozygosity for the variant allele of NOS3 (298Asp) is associated with CKD after LT and may be useful for identifying recipients at higher risk of post-LT CKD. PMID:20810793

  8. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.


    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  9. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.


    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  10. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  11. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production. (United States)

    Oberding, Lisa K; Gieg, Lisa M


    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  12. Linalool and linalool nerolidol synthases in roses, several genes for little scent. (United States)

    Magnard, Jean-Louis; Bony, Aurélie Rius; Bettini, Fabienne; Campanaro, Ausilia; Blerot, Bernard; Baudino, Sylvie; Jullien, Frédéric


    Roses are widely appreciated for the appearance of their flowers and for their fragrance. This latter character results from the combination of different odorant molecules among which monoterpenes are often prevalent constituents. In this study, we report the cloning and characterization of three rose monoterpene synthases. In vitro functional characterization of these enzymes showed that one is a (-)-(3R)-linalool synthase whereas the others have a dual (+)-(3S)-linalool nerolidol synthase activity. However, given that the characterized rose cultivars were only able to produce the (-)-(3R)-linalool stereoisomer, the linalool nerolidol synthases are probably not active in planta. Furthermore, these three enzymes were also characterized by a weak expression level as assessed by RT-qPCR and by the low abundance of the corresponding sequences in an EST library. This characteristic is likely to explain why linalool is generally a minor constituent in rose flowers' scents. On this basis, we propose that in roses the monoterpene biosynthesis effort is focused on the production of acyclic monoterpenes derived from geraniol through the recently characterized Nudix biosynthesis pathway, at the expense of conventional monoterpene biosynthesis via terpene synthases such as linalool or linalool nerolidol synthases. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  13. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz


    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  14. Application of an optimized electroporation procedure for replacement of the polyhydroxyalkanoate synthase I gene in Nocardia corallina. (United States)

    Valentin, H E; Dennis, D


    To develop a system for gene replacement in Nocardia corallina, a protocol for electroporation was optimized by systematic alterations of growth conditions, field strength, time constant and the electroporation buffer. Transformation efficiencies of 0.5 x 10(6) - 3 x 10(6) transformants/microgram plasmid DNA were obtained routinely. The gene encoding the polyhydroxyalkanoate (PHA) synthase I of N. corallina was cloned and interrupted by insertion of a kanamycin-resistance gene. The resulting plasmid was introduced into N. corallina by electroporation to inactivate the wild-type gene by homologous recombination. Kanamycin-resistant clones were screened by Southern hybridization for the absence of the wild-type gene and analyzed for PHA accumulation.

  15. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae. (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo


    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)


    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  17. How complex an intron may be? The example of the first intron of the CTP synthase gene of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Roberto Piergentili


    Full Text Available In eukaryotes, maturation of primary transcripts into mature messenger RNAs involves the elimination of parts of the gene called ‘introns’. The biological significance of introns is not yet completely understood. It has been demonstrated that introns may contain other genes, or regulatory sequences that may be involved in transcriptional control, or also being involved in alternative splicing mechanisms. However, these functions explain the role of only a small number of them, and it is very difficult to formulate any generalization. The CTP synthase gene of Drosophila melanogaster is characterized by the presence of a long first intron (approximately 7.2 kilobases whose role is currently unknown. In the present report we analyzed in silico the content of this intron, and found that it contains at least three interesting sub-sequences. Two of them are homologous to the CTP synthase itself and to a putative nucleotide pyrophosphatase, respectively. The third is a short stretch of DNA able to fold into a thermodynamically stable hairpin and showing homology with other 19 sequences from 21 genes inside the D. melanogaster genome. These findings suggest a complex yet very accurate way of controlling gene expression inside the fruit fly.

  18. Conservation and divergence of Starch Synthase III genes of monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Bhavya Priyadarshini Mishra

    Full Text Available Starch Synthase (SS plays an important role in extending the α-1,4 glucan chains during starch biosynthesis by catalyzing the transfer of the glucosyl moiety from ADP-glucose to the non-reducing end of a pre-existing glucan chain. SS has five distinct isoforms of which SSIII is involved in the formation of longer glucan chain length. Here we report identification and detailed characterization of 'true' orthologs of the well-characterized maize SSIII (ZmSSIII, among six monocots and two dicot species. ZmSSIII orthologs have nucleotide sequence similarity ranging from 56-81%. Variation in gene size among various orthologs ranged from 5.49 kb in Arabidopsis to 11.62 kb in Brachypodium and the variation was mainly due to intron size and indels present in the exons 1 and 3. Number of exons and introns were highly conserved among all orthologs however. While the intron number was conserved, intron phase showed variation at group, genera and species level except for intron 1 and 5. Several species, genera, and class specific cis-acting regulatory elements were identified in the promoter region. The predicted protein size of the SSIII orthologs ranged from 1094 amino acid (aa in Arabidopsis to 1688 aa in Brachypodium with sequence identity ranging from 60%-89%. The N-terminal region of the protein was highly variable whereas the C-terminal region containing the Glycosyltransferase domain was conserved with >80% sequence similarity among the orthologs. In addition to confirming the known motifs, eleven novel motifs possibly providing species, genera and group specific functions, were identified in the three carbohydrate binding domains. Despite of significant sequence variation among orthologs, most of the motifs and their relative distances are highly conserved among the orthologs. The 3-D structure of catalytic region of SSIII orthologs superimposed with higher confidence confirming the presence of similar binding sites with five unidentified

  19. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle. (United States)

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep


    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  20. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea]. (United States)

    Kaluzhnaya, O V; Itskovich, V B


    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites.

  1. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.


    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  2. of endothelial nitric oxide synthase gene and serum level of vascular ...

    African Journals Online (AJOL)


    Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

  3. A single arabidopsis gene encodes two differentially targeted geranylgeranyl diphosphate synthase isoforms

    NARCIS (Netherlands)

    Águila Ruiz-Sola, M.; Barja, M.V.; Manzano, David; Llorente, Briardo; Schipper, Bert; Beekwilder, Jules; Rodriguez-Concepcion, Manuel


    A wide diversity of isoprenoids is produced in different plant compartments. Most groups of isoprenoids synthesized in plastids, and some produced elsewhere in the plant cell derive from geranylgeranyl diphosphate (GGPP) synthesized by GGPP synthase (GGPPS) enzymes. In Arabidopsis (Arabidopsis

  4. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hansen, K.; Szabo, Peter


    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3....

  5. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.


    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  6. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome. (United States)

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele


    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. AtCSLD3, a cellulose synthase-like gene important for root hair growth in arabidopsis. (United States)

    Wang, X; Cnops, G; Vanderhaeghen, R; De Block, S; Van Montagu, M; Van Lijsebettens, M


    A member of the cellulose synthase-like (subfamily D) gene family of Arabidopsis, AtCSLD3, has been identified by T-DNA tagging. The analysis of the corresponding mutant, csld3-1, showed that the AtCSLD3 gene plays a role in root hair growth in plants. Root hairs grow in phases: First a bulge is formed and then the root hair elongates by polarized growth, the so-called "tip growth." In the mutant, root hairs were initiated at the correct position and grew into a bulge, but their elongation was severely reduced. The tips of the csld3-1 root hairs easily leaked cytoplasm, indicating that the tensile strength of the cell wall had changed at the site of the tip. Based on the mutant phenotype and the functional conservation between CSLD3 and the genuine cellulose synthase proteins, we hypothesized that the CSLD3 protein is essential for the synthesis of polymers for the fast-growing primary cell wall at the root hair tip. The distinct mutant phenotype and the ubiquitous expression pattern indicate that the CSLD3 gene product is only limiting at the zone of the root hair tip, suggesting particular physical properties of the cell wall at this specific site of the root hair cell.

  8. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples. (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona


    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  9. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan


    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  10. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)


    High-Tech Research Center, Shandong Academy of Agricultural Sciences, Key Laboratory for Genetic Improvement of. Crop, Animal and ... The cultivated peanut is a valuable source of dietary oil and ranks fifth among the world oil crops. Plant fatty .... the protocol of Stratagene s pBluescript II cDNA library construction kit.

  11. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.


    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  12. An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles (United States)

    Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

  13. Cloning and characterization of cellulose synthase-like gene, PtrCSLD2 from developing xylem of aspen trees. (United States)

    Samuga, Anita; Joshi, Chandrashekhar P.


    Genetic improvement of cell wall polymer synthesis in forest trees is one of the major goals of forest biotechnology that could possibly impact their end product utilization. Identification of genes involved in cell wall polymer biogenesis is essential for achieving this goal. Among various candidate cell wall-related genes, cellulose synthase-like D (CSLD) genes are intriguing due to their hitherto unknown functions in cell wall polymer synthesis but strong structural similarity with cellulose synthases (CesAs) involved in cellulose deposition. Little is known about CSLD genes from trees. In the present article PtrCSLD2, a first CSLD gene from an economically important tree, aspen (Populus tremuloides) is reported. PtrCSLD2 cDNA was isolated from an aspen xylem cDNA library and encodes a protein that shares 90% similarity with Arabidopsis AtCSLD3 protein involved in root hair tip growth. It is possible that xylem fibers that also grow by intrusive tip growth may need expression of PtrCSLD2 for controlling the length of xylem fibers, a wood quality trait of great economical importance. PtrCSLD2 protein has a N-terminal cysteine-rich putative zinc-binding domain; eight transmembrane domains; alternating conserved and hypervariable domains; and a processive glycosyltransferases signature, D, D, D, QXXRW; all similar to aspen CesA proteins. However, PtrCSLD2 shares only 43-48% overall identity with the known aspen CesAs suggesting its distinct functional role in cell wall polymer synthesis perhaps other than cellulose biosynthesis. Based on Southern analysis, the aspen CSLD gene family consists of at least three genes and this gene copy estimate is supported by phylogenetic analysis of available CSLDs from plants. Moreover, gene expression studies using RT-PCR and in situ mRNA hybridization showed that PtrCSLD2 is expressed at a low level in all aspen tissues examined with a slightly higher expression level in secondary cell wall-enriched aspen xylem as compared to

  14. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.


    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  15. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)


    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  16. Evolution of floral scent in Clarkia: novel patterns of S-linalool synthase gene expression in the C. breweri flower. (United States)

    Dudareva, N; Cseke, L; Blanc, V M; Pichersky, E


    Flowers of Clarkia breweri, an annual plant from the coastal range of California, emit a strong sweet scent of which S-linalool, an acyclic monoterpene, is a major component. Chromosomal, chemical, and morphological data, and the species' geographic distribution, suggest that C. breweri evolved from an extant nonscented species, C. concinna. A cDNA of Lis, the gene encoding S-linalool synthase, was isolated from C. breweri. We show that in C. breweri, Lis is highly expressed in cells of the transmitting tract of the stigma and style and in the epidermal cells of petals, as well as in stamens, whereas in the nonscented C. concinna, Lis is expressed only in the stigma and at a relatively low level. In both species, changes in protein levels parallel changes in mRNA levels, and changes in enzyme activity levels parallel changes in protein levels. The results indicate that in C. breweri, the expression of Lis has been upregulated and its range enlarged to include cells not expressing this gene in C. concinna. These results show how scent can evolve in a relatively simple way without the evolution of highly specialized "scent glands" and other specialized structures. Lis encodes a protein that is structurally related to the family of proteins termed terpene synthases. The protein encoded by Lis is the first member of this family found to catalyze the formation of an acyclic monoterpene. PMID:8768373

  17. Endothelial nitric oxide synthase gene polymorphisms (G894T) in diabetes mellitus in Egypt


    El-baz1 ; Farouk2; Tag Eldin2; Ezat2


    Objective: Diabetic nephropathy (DN) is one of the major microvascular complications of diabetes. Genetic predisposition has been implicated in DN. The eNOS protein synthesizes nitric oxide constitutively via a reaction including the conversion of L-arginine to L-citrulline, which involves the transfer of five electrons provided by nicotinamide adenine dinucleotide phosphate The aim of this study is to evaluate the association of G894T polymorphisms of endothelial nitric oxide synthase(eNOS) ...

  18. Environmental Stability of Seed Carbohydrate Profiles in Soybeans Containing Different Alleles of the Raffinose Synthase 2 (RS2) Gene. (United States)

    Bilyeu, Kristin D; Wiebold, William J


    Soybean [Glycine max (L.) Merr.] is important for the high protein meal used for livestock feed formulations. Carbohydrates contribute positively or negatively to the potential metabolizable energy in soybean meal. The positive carbohydrate present in soybean meal consists primarily of sucrose, whereas the negative carbohydrate components are the raffinose family of oligosaccharides (RFOs), raffinose and stachyose. Increasing sucrose and decreasing raffinose and stachyose are critical targets to improve soybean. In three recently characterized lines, variant alleles of the soybean raffinose synthase 2 (RS2) gene were associated with increased sucrose and decreased RFOs. The objective of this research was to compare the environmental stability of seed carbohydrates in soybean lines containing wild-type or variant alleles of RS2 utilizing a field location study and a date of planting study. The results define the carbohydrate variation in distinct regional and temporal environments using soybean lines with different alleles of the RS2 gene.

  19. Constitutive nitric oxide synthase gene polymorphisms and house dust mite respiratory allergy in an Algerian patient group. (United States)

    Djidjik, R; Ghaffor, M; Brun, M; Gharnaout, M; Salah, S S; Boukouaci, W; Djidjik, H; Benyounes, A; Koumaravelou, K; Krishnamoorthy, R; Abbadi, M C; Charron, D; Tamouza, R


    Genetic polymorphisms in neuronal nitric oxide synthase (NOS1) and calmodulin-dependent endothelial NOS (NOS3) genes are known to influence the course of allergic respiratory disorders. We investigated the role of NOS1 -84 G-->A and NOS3 -786 T-->C, 894 G-->T and 27 base pair (bp) repeat polymorphisms in 125 patients suffering from asthma and/or rhinitis and monosensitized against Dermatophagoides pteronyssinus (Dpter) and 111 controls from Algeria. We found a higher frequency of the -786 C NOS3 allele in patients than in controls [corrected P value (Pc) = 0.04], especially in female cases (Pc = 0.02) and that the 'ab' genotype of the 27-bp polymorphism was significantly associated with specific immunoglobulin E production against Dpter (P = 0.006). This study brings further support for the participation of NOS3 gene polymorphism in the pathogenesis of respiratory allergic disorders.

  20. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan


    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  1. Diversification of the monoterpene synthase gene family (TPSb) in Protium, a highly diverse genus of tropical trees. (United States)

    Zapata, Felipe; Fine, Paul V A


    Plant monoterpenes are a diverse class of secondary metabolites mediating biotic and abiotic interactions with direct effects on plant fitness. To evaluate the hypothesis that monoterpene diversity is related to functional diversification after gene duplication, we reconstructed the evolutionary history of monoterpene synthases (TPSb)--the genes underlying monoterpene synthesis--in Protium, a taxonomically and chemically diverse genus of tropical trees. We isolated multiple copies of TPSb genes from chemically divergent Protium species, reconstructed the phylogeny of this gene family, used maximum-likelihood estimation of selection coefficients, and inferred residues evolving under positive selection. We found evidence for one ancient and multiple more recent duplication events giving rise to three, and potentially five, copies of TPSb genes currently present in Protium. There was evidence for adaptive evolution in one copy with a positively selected residue likely involved in protein folding and product specificity. All other copies were inferred to be evolving under a combination of stabilizing and/or relaxed selection. Although gene copy number is consistent with the extensive phenotypic diversity in monoterpenes shown in Protium, selection analyses suggest that not all copies are undergoing divergent selection consistent with a coevolutionary arms race with enemies, but instead may be under stabilizing and relaxed selection consistent with signaling or physiological stress functionality. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Structural and functional analysis of two di-domain aromatase/cyclases from type II polyketide synthases. (United States)

    Caldara-Festin, Grace; Jackson, David R; Barajas, Jesus F; Valentic, Timothy R; Patel, Avinash B; Aguilar, Stephanie; Nguyen, MyChi; Vo, Michael; Khanna, Avinash; Sasaki, Eita; Liu, Hung-Wen; Tsai, Shiou-Chuan


    Aromatic polyketides make up a large class of natural products with diverse bioactivity. During biosynthesis, linear poly-β-ketone intermediates are regiospecifically cyclized, yielding molecules with defined cyclization patterns that are crucial for polyketide bioactivity. The aromatase/cyclases (ARO/CYCs) are responsible for regiospecific cyclization of bacterial polyketides. The two most common cyclization patterns are C7-C12 and C9-C14 cyclizations. We have previously characterized three monodomain ARO/CYCs: ZhuI, TcmN, and WhiE. The last remaining uncharacterized class of ARO/CYCs is the di-domain ARO/CYCs, which catalyze C7-C12 cyclization and/or aromatization. Di-domain ARO/CYCs can further be separated into two subclasses: "nonreducing" ARO/CYCs, which act on nonreduced poly-β-ketones, and "reducing" ARO/CYCs, which act on cyclized C9 reduced poly-β-ketones. For years, the functional role of each domain in cyclization and aromatization for di-domain ARO/CYCs has remained a mystery. Here we present what is to our knowledge the first structural and functional analysis, along with an in-depth comparison, of the nonreducing (StfQ) and reducing (BexL) di-domain ARO/CYCs. This work completes the structural and functional characterization of mono- and di-domain ARO/CYCs in bacterial type II polyketide synthases and lays the groundwork for engineered biosynthesis of new bioactive polyketides.

  3. Evolutionary Insights Based on SNP Haplotypes of Red Pericarp, Grain Size and Starch Synthase Genes in Wild and Cultivated Rice

    Directory of Open Access Journals (Sweden)

    Nisha Singh


    Full Text Available The origin and domestication of rice has been a subject of considerable debate in the post-genomic era. Rice varieties have been categorized based on isozyme and DNA markers into two broad cultivar groups, Indica and Japonica. Among other well-known cultivar groups Aus varieties are closer to Indica and Aromatic varieties including Basmati are closer to Japonica, while deep-water rice varieties share kinship to both Indica and Japonica cultivar groups. Here, we analyzed haplotype networks and phylogenetic relationships in a diverse set of genotypes including Indian Oryza nivara/Oryza rufipogon wild rice accessions and representative varieties of four rice cultivar groups based on pericarp color (Rc, grain size (GS3 and eight different starch synthase genes (GBSSI, SSSI, SSIIa, SSIIb, SSIIIa, SSIIIb, SSIVa, and SSIVb. Aus cultivars appear to have the most ancient origin as they shared the maximum number of haplotypes with the wild rice populations, while Indica, Japonica and Aromatic cultivar groups showed varying phylogenetic origins of these genes. Starch synthase genes showed higher variability in cultivated rice than wild rice populations, suggesting diversified selection during and after domestication. O. nivara/O. rufipogon wild rice accessions belonging to different sub-populations shared common haplotypes for all the 10 genes analyzed. Our results support polyphyletic origin of cultivated rice with a complex pattern of migration of domestication alleles from wild to different rice cultivar groups. The findings provide novel insights into evolutionary and domestication history of rice and will help utilization of wild rice germplasm for genetic improvement of rice cultivars.

  4. Evolutionary Insights Based on SNP Haplotypes of Red Pericarp, Grain Size and Starch Synthase Genes in Wild and Cultivated Rice. (United States)

    Singh, Nisha; Singh, Balwant; Rai, Vandna; Sidhu, Sukhjeet; Singh, Ashok K; Singh, Nagendra K


    The origin and domestication of rice has been a subject of considerable debate in the post-genomic era. Rice varieties have been categorized based on isozyme and DNA markers into two broad cultivar groups, Indica and Japonica. Among other well-known cultivar groups Aus varieties are closer to Indica and Aromatic varieties including Basmati are closer to Japonica, while deep-water rice varieties share kinship to both Indica and Japonica cultivar groups. Here, we analyzed haplotype networks and phylogenetic relationships in a diverse set of genotypes including Indian Oryza nivara/Oryza rufipogon wild rice accessions and representative varieties of four rice cultivar groups based on pericarp color ( Rc ), grain size ( GS3 ) and eight different starch synthase genes ( GBSSI, SSSI, SSIIa, SSIIb, SSIIIa, SSIIIb, SSIVa , and SSIVb ). Aus cultivars appear to have the most ancient origin as they shared the maximum number of haplotypes with the wild rice populations, while Indica, Japonica and Aromatic cultivar groups showed varying phylogenetic origins of these genes. Starch synthase genes showed higher variability in cultivated rice than wild rice populations, suggesting diversified selection during and after domestication. O. nivara/O. rufipogon wild rice accessions belonging to different sub-populations shared common haplotypes for all the 10 genes analyzed. Our results support polyphyletic origin of cultivated rice with a complex pattern of migration of domestication alleles from wild to different rice cultivar groups. The findings provide novel insights into evolutionary and domestication history of rice and will help utilization of wild rice germplasm for genetic improvement of rice cultivars.

  5. Cloning and functional characterization of a gene for capsanthin-capsorubin synthase from tiger lily (Lilium lancifolium Thunb. 'Splendens'). (United States)

    Jeknić, Zoran; Morré, Jeffrey T; Jeknić, Stevan; Jevremović, Sladana; Subotić, Angelina; Chen, Tony H H


    The orange color of tiger lily (Lolium lancifolium 'Splendens') flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription-PCR (RT-PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species.

  6. Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.). (United States)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder


    Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

  7. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T


    in insect cells, and each CslA protein catalyzed mannan and glucomannan synthase reactions in vitro. Microarray mining and quantitative real-time reverse transcription-polymerase chain reaction analysis demonstrated that transcripts of Arabidopsis and loblolly pine (Pinus taeda) CslA genes display tissue...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  8. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer. (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling


    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  9. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer (United States)


    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  10. Organisation and functions of class II genes and molecules

    NARCIS (Netherlands)

    Beck, S.; Belich, M.; Gruneberg, U.; Jackson, A.; Kelly, A.; Sanseau, P.; Sanderson, F.; Trowsdale, J.; van Ham, M.


    The class II region of the human MHC contains all of the known class II genes: as well as antigen processing components and only one gene not obviously associated with the immune system, RING3. As an approach to understanding linkage disequilibrium and recombination in relation to polymorphism of

  11. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review

    Directory of Open Access Journals (Sweden)

    S.N. Koval


    Full Text Available Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL, enzyme aldosterone synthase (AS, which takes a direct part in the formation of this hormone, as well as gene polymorphisms of AS, which have not only molecular genetic, but also differential diagnostic and therapeutic significance for secondary forms of arterial hypertension, abdominal obesity (AO, metabolic syndrome (MS, adrenal pathology and other endocrine disorders. AL is a steroid (mineralocorticoid hormone of the adrenal cortex, which is synthesized from cholesterol (CH, mainly in the glomerular zone of the adrenal glands, is released under the action of angiotensin II (A II and potassium ions (K+. AL acti­vity is mediated through the corresponding mineralocorticoid receptors (MKR. The particular importance in AH and MS development belongs to AL activation and MKR density in adipocytes, this phenomenon is accompanied by increased expression of pro-inflammatory cytokines, leptin, an adipogenic effect, and the inhibition of MCR activity is accompanied by increased production of adiponectin, which is more pronounced in patients with AH. Aldosterone synthase, a mitochondrial human enzyme encoded by the CYP11B2 gene (cytochrome P450, family 11, subfamily B, polypeptide 2 is located on the 8th chromosome. AS belongs to the superfamily of cytochrome P450 and regulates the synthesis of AL hormone. The CYP11B2 gene encodes the key enzyme for the synthesis of AL 18-hydroxylase. In scientific papers, single nucleotide polymorphism (SNP of AS gene is often studied, such as 5312T, Intron 2, Lys-173/Arg; T-344C, 3097 C/A. 227 SNP of the AS gene were identified in different

  12. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua


    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  13. Alfalfa Cellulose Synthase Gene Expression under Abiotic Stress: A Hitchhiker’s Guide to RT-qPCR Normalization (United States)

    Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois


    Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

  14. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo


    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  15. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera). (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi


    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  16. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ajl yemi


    Dec 19, 2011 ... but it was relatively lower in other three tissues. In addition, the atpA gene was successfully expressed in Escherichia coli. Key words: Sweet potato, atpA gene, gene expression, digital gene expression profiling, quantitative analysis. INTRODUCTION. Sweet potato (Ipomoea batatas L. Lam) is the seventh.

  17. The Rice Terpene Synthase Gene OsTPS19 Functions as an (S)-Limonene Synthase in planta and its Overexpression Leads to Enhanced Resistance to the Blast Fungus Magnaporthe oryzae. (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng


    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defense mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defense gene. Here, we report the functional characterization of OsTPS19, which is upregulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defense against M. oryzae, at least partly, by inhibiting spore germination. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  18. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    Directory of Open Access Journals (Sweden)

    Takashi Kadono


    Full Text Available Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase.

  19. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum (United States)

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao


    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  20. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    International Nuclear Information System (INIS)

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar


    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd 2+ and Cu 2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd 2+ and Cu 2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu 2+ ) in A. germinans leaves

  1. Molecular typing using polymorphisms of the polyketide synthase gene (PKS1) of strains in Japan morphologically identified as Fonsecaea pedrosoi. (United States)

    Ushigami, Tsuyoshi; Anzawa, Kazushi; Mochizuki, Takashi


    Fonsecaea pedrosoi sensu lato is a major causative agent of dematiaceous fungal infection in Japan. Recent sequence analysis of the internal transcribed spacer (ITS) regions of the ribosomal RNA gene has shown that this species can be separated into three species: F. pedrosoi sensu stricto, F. monophora and F. nubica. The cell walls of dematiaceous fungi including the genus Fonsecaea contain melanin, which is important for their virulence. Polyketide synthase (PKS1) is an enzyme required for melanin synthesis. This study analyzed the phylogeny of strains of F. pedrosoi sensu lato isolated in Japan by sequencing the PKS1 gene and ITS regions and identifying molecular polymorphism. Sixty strains morphologically identified as F. pedrosoi isolated worldwide, including 37 strains isolated in Japan, were analyzed. ITS regions of the ribosomal RNA gene and part of the PKS1 gene region were amplified, yielding sequences of approximately 600 and 450 bp, respectively. Polymerase chain reaction products were sequenced, and cluster analysis was performed. The proposed phylogenetic tree based on PKS1 sequences closely matched that based on the ITS regions. Sequencing of both regions showed that the isolates from Japan belonged to the clade of F. monophora. Molecular variations of these Japanese strains were evaluated by assessing both ITS and PKS1 sequences. The 37 isolates could be divided into at least seven molecular subtypes. The combination of these two molecular markers provides a most robust method for intraspecies subtyping and further epidemiological study of F. monophora. © 2016 Japanese Dermatological Association.

  2. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper. (United States)

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar


    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd2+ and Cu2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd2+ and Cu2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu2+) in A. germinans leaves.

  3. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail:


    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  4. [Double-antisense ACC oxidase and ACC synthase fusion gene introduced into tomato by Agrobacterium-mediated transformation and analysis the ethylene production of transgenic plants]. (United States)

    Xiong, Ai Sheng; Yao, Quan Hong; Li, Xian; Fan, Hui Qin; Peng, Ri He


    The tomato fruit-specific promoter 2A11 was amplified from tomato genomic DNA using PCR techniques. Total RNA was isolated from ripen fruit of tomato, then ACC oxidase gene and ACC synthase gene were obtained using reverse-transcription polymerase chain reaction. The fusion encoding ACC oxidase and ACC synthase gene was obtained through ACC oxidase gene and ACC synthase gene ligation. The fusion gene was then inserted into a plant binary vector pYPX145 in an inverted orientation. Finally, the binary plant expression vector pOSACC was constructed in which the double-antisense fusion gene was controlled by fruit-specific 2A11 promoter. By using hypocotyls and cotyledon petioles as explants, the unit of double-antisense fusion gene was successfully introduced into tomato (Lycopersicon esculentum Mill) cultivar "Hezuo 903" by Agrobacterium tumefaciens-mediated transformation. 105 transgenic plants were obtained through 200 mg/L kanamycin selection and GUS assay. Two lines of DR-1 and DR-2 were obtained through selecting the characteristics of prolonged shelf life and agriculture. The transgenic plants showed the characteristics of prolonged shelf life over 50 d. The amount of ethylene released from DR-1 and DR-2 fruits were reduced significantly to about 9.5% of that released by non-transformed controls.

  5. Allele specific CAPS marker development and characterization of chalcone synthase gene in Indian mulberry (Morus spp., family Moraceae). (United States)

    Arora, Vivek; Ghosh, M K; Pal, Soumili; Gangopadhyay, Gaurab


    Chalcone synthase (CHS) is an essential enzyme in the phenylpropanoid pathway that catalyzes the first step in flavonoid biosynthesis in plants under diverse environmental stress. We have used CHS as a candidate gene in mulberry and developed Single Nucleotide Polymorphism (SNP) based co-dominant Cleaved Amplified Polymorphic Sequence (CAPS) marker associated with the CHS locus. The segregation pattern of the marker was studied in an F1 population derived from a hybridization program between two mulberry genotypes showing polymorphism for the CHS locus. Differential CHS activity of the recombinants has been correlated with the segregation pattern of the marker. Homology modelling and docking studies are performed for both the identified CHS alleles and correlated with respective CHS activity. Phenotyping of Powdery Mildew infected F1 population indicated a probable association with the CAPS marker.

  6. Allele specific CAPS marker development and characterization of chalcone synthase gene in Indian mulberry (Morus spp., family Moraceae.

    Directory of Open Access Journals (Sweden)

    Vivek Arora

    Full Text Available Chalcone synthase (CHS is an essential enzyme in the phenylpropanoid pathway that catalyzes the first step in flavonoid biosynthesis in plants under diverse environmental stress. We have used CHS as a candidate gene in mulberry and developed Single Nucleotide Polymorphism (SNP based co-dominant Cleaved Amplified Polymorphic Sequence (CAPS marker associated with the CHS locus. The segregation pattern of the marker was studied in an F1 population derived from a hybridization program between two mulberry genotypes showing polymorphism for the CHS locus. Differential CHS activity of the recombinants has been correlated with the segregation pattern of the marker. Homology modelling and docking studies are performed for both the identified CHS alleles and correlated with respective CHS activity. Phenotyping of Powdery Mildew infected F1 population indicated a probable association with the CAPS marker.

  7. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon. (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong


    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  8. Overexpression of the Anthocyanidin Synthase Gene in Strawberry Enhances Antioxidant Capacity and Cytotoxic Effects on Human Hepatic Cancer Cells. (United States)

    Giampieri, Francesca; Gasparrini, Massimiliano; Forbes-Hernandez, Tamara Y; Mazzoni, Luca; Capocasa, Franco; Sabbadini, Silvia; Alvarez-Suarez, Josè M; Afrin, Sadia; Rosati, Carlo; Pandolfini, Tiziana; Molesini, Barbara; Sánchez-Sevilla, José F; Amaya, Iraida; Mezzetti, Bruno; Battino, Maurizio


    Food fortification through the increase and/or modulation of bioactive compounds has become a major goal for preventing several diseases, including cancer. Here, strawberry lines of cv. Calypso transformed with a construct containing an anthocyanidin synthase (ANS) gene were produced to study the effects on anthocyanin biosynthesis, metabolism, and transcriptome. Three strawberry ANS transgenic lines (ANS L5, ANS L15, and ANS L18) were analyzed for phytochemical composition and total antioxidant capacity (TAC), and their fruit extracts were assessed for cytotoxic effects on hepatocellular carcinoma. ANS L18 fruits had the highest levels of total phenolics and flavonoids, while those of ANS L15 had the highest anthocyanin concentration; TAC positively correlated with total polyphenol content. Fruit transcriptome was also specifically affected in the polyphenol biosynthesis and in other related metabolic pathways. Fruit extracts of all lines exerted cytotoxic effects in a dose/time-dependent manner, increasing cellular apoptosis and free radical levels and impairing mitochondrial functionality.

  9. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils. (United States)

    Irmisch, Sandra; Krause, Sandra T; Kunert, Grit; Gershenzon, Jonathan; Degenhardt, Jörg; Köllner, Tobias G


    The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS), the key enzymes in constructing terpene carbon skeletons. Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita). Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (-)-(E)-β-caryophyllene (MrTPS1), (+)-germacrene A (MrTPS3), (E)-β-ocimene (MrTPS4) and (-)-germacrene D (MrTPS5). A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (-)-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+)-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  10. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    Directory of Open Access Journals (Sweden)

    Irmisch Sandra


    Full Text Available Abstract Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS, the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita. Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−-(E-β-caryophyllene (MrTPS1, (+-germacrene A (MrTPS3, (E-β-ocimene (MrTPS4 and (−-germacrene D (MrTPS5. A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  11. Enhanced cadmium resistance and accumulation in Pseudomonas putida KT2440 expressing the phytochelatin synthase gene of Schizosaccharomyces pombe. (United States)

    Yong, X; Chen, Y; Liu, W; Xu, L; Zhou, J; Wang, S; Chen, P; Ouyang, P; Zheng, T


    Phytochelatins (PCs) are cysteine-rich peptides with high binding affinity for toxic metals. Expressing the PC synthase gene (PCS) in plant growth-promoting bacteria may enhance its metal resistance and accumulation, consequently increasing phytoremediation efficiency in heavy metal pollution. In this study, PCS from Schizosaccharomyces pombe was cloned and expressed in Pseudomonas putida KT2440, which was confirmed by real-time RT-PCR through an increase in SpPCS mRNA expression level when induced by 20 μmol of CdCl2 in the transformed Ps. putida cells. The recombined strain KT2440-SpPCS exhibited enhanced Cd, Ag and Hg resistance. Compared with the original strain, KT2440-SpPCS also displayed a threefold to fivefold increase in Cd accumulation (14·32 μmol g(-1) to 17·38 μmol g(-1) ; dry weight) when grown in 30 and 50 μmol CdCl2 , along with an increase in nonprotein thiols. Further experiments showed significantly enhanced germination rates and growth of wheat seeds in 0·1 mmol to 1·0 mmol Cd when inoculated with KT2440-SpPCS. This study shows potential use of Ps. putida KT2440-SpPCS in plants to construct a symbiotic system for an enhanced phytoremediation of heavy metal-contaminated environments. The symbiotic system of using plant growth-promoting bacteria Pseudomonas putida to express phytochelatin synthase gene of Schizosaccharomyces pombe together in plants resulted in high heavy metal resistance and high accumulation capacity, suggesting potential enhancement in phytoremediation of heavy metal-contaminated environments. © 2013 The Society for Applied Microbiology.

  12. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H


    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  13. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus


    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides...... in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western...

  14. Functional gene-guided discovery of type II polyketides from culturable actinomycetes associated with soft coral Scleronephthya sp.

    Directory of Open Access Journals (Sweden)

    Wei Sun

    Full Text Available Compared with the actinomycetes in stone corals, the phylogenetic diversity of soft coral-associated culturable actinomycetes is essentially unexplored. Meanwhile, the knowledge of the natural products from coral-associated actinomycetes is very limited. In this study, thirty-two strains were isolated from the tissue of the soft coral Scleronephthya sp. in the East China Sea, which were grouped into eight genera by 16S rDNA phylogenetic analysis: Micromonospora, Gordonia, Mycobacterium, Nocardioides, Streptomyces, Cellulomonas, Dietzia and Rhodococcus. 6 Micromonospora strains and 4 Streptomyces strains were found to be with the potential for producing aromatic polyketides based on the analysis of KS(α (ketoacyl-synthase gene in the PKS II (type II polyketides synthase gene cluster. Among the 6 Micromonospora strains, angucycline cyclase gene was amplified in 2 strains (A5-1 and A6-2, suggesting their potential in synthesizing angucyclines e.g. jadomycin. Under the guidance of functional gene prediction, one jadomycin B analogue (7b, 13-dihydro-7-O-methyl jadomycin B was detected in the fermentation broth of Micromonospora sp. strain A5-1. This study highlights the phylogenetically diverse culturable actinomycetes associated with the tissue of soft coral Scleronephthya sp. and the potential of coral-derived actinomycetes especially Micromonospora in producing aromatic polyketides.

  15. Functional Gene-Guided Discovery of Type II Polyketides from Culturable Actinomycetes Associated with Soft Coral Scleronephthya sp (United States)

    Sun, Wei; Peng, Chongsheng; Zhao, Yunyu; Li, Zhiyong


    Compared with the actinomycetes in stone corals, the phylogenetic diversity of soft coral-associated culturable actinomycetes is essentially unexplored. Meanwhile, the knowledge of the natural products from coral-associated actinomycetes is very limited. In this study, thirty-two strains were isolated from the tissue of the soft coral Scleronephthya sp. in the East China Sea, which were grouped into eight genera by 16S rDNA phylogenetic analysis: Micromonospora, Gordonia, Mycobacterium, Nocardioides, Streptomyces, Cellulomonas, Dietzia and Rhodococcus. 6 Micromonospora strains and 4 Streptomyces strains were found to be with the potential for producing aromatic polyketides based on the analysis of KSα (ketoacyl-synthase) gene in the PKS II (type II polyketides synthase) gene cluster. Among the 6 Micromonospora strains, angucycline cyclase gene was amplified in 2 strains (A5-1 and A6-2), suggesting their potential in synthesizing angucyclines e.g. jadomycin. Under the guidance of functional gene prediction, one jadomycin B analogue (7b, 13-dihydro-7-O-methyl jadomycin B) was detected in the fermentation broth of Micromonospora sp. strain A5-1. This study highlights the phylogenetically diverse culturable actinomycetes associated with the tissue of soft coral Scleronephthya sp. and the potential of coral-derived actinomycetes especially Micromonospora in producing aromatic polyketides. PMID:22880121

  16. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.


    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  17. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Burke, Charles Cullen (Moscow, ID); Gershenzon, Jonathan (Jena, DE)


    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  18. Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L. (United States)

    Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang


    The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. Isolation and characterization of drought-related trehalose 6-phosphate-synthase gene from cultivated cotton (Gossypium hirsutum L.). (United States)

    Kosmas, Sotirios A; Argyrokastritis, Alexandros; Loukas, Michael G; Eliopoulos, Elias; Tsakas, Spyros; Kaltsikes, Pantouses J


    Due to the important role of cotton drought-tolerant varieties and the reported involvement in this trait of trehalose-6-phosphate-synthase, the respective gene (TPS) was isolated and characterized from cultivated cotton, Gossypium hirsutum (ZETA 2 cultivar), using a chromosome-walking technique. TPS has three exons comprising the coding region. Southern blot analysis indicated that the Gossypium genomes (A and D) contain a single copy of TPS per genome. In addition, the expression of this gene was studied in different plant tissues. Plants of the Australian cotton variety Siokra L23, known for its drought tolerance, were subjected to drought stress (using PEG 6,000 solution, for 4 h during the dark period of the day and for four consecutive days); leaves, stems and roots were collected after the end of the stress period. Total extracted RNA was examined for the presence of transcripts, in the above-mentioned tissues of stressed and well-watered plants, by reverse transcription-polymerase chain reaction (RT-PCR). The expression levels, determined semi-quantitatively, indicated that the gene was expressed in all plant tissues under both water availability conditions. However, increased expression levels of TPS were observed mainly in stressed leaves and roots compared to those of the well-watered control. This finding is in agreement with the fact that TPS participates in trehalose biosynthesis, known for its participation in stress signal transduction in higher plants.

  20. Negative feedback regulation of lipopolysaccharide-induced inducible nitric oxide synthase gene expression by heme oxygenase-1 induction in macrophages. (United States)

    Ashino, Takashi; Yamanaka, Rieko; Yamamoto, Masayuki; Shimokawa, Hiroaki; Sekikawa, Kenji; Iwakura, Yoichiro; Shioda, Seiji; Numazawa, Satoshi; Yoshida, Takemi


    Heme oxygenase-1 (HO-1) is induced under infectious diseases in macrophages. We performed experiments using various gene deficient mouse-derived macrophages to determine a detailed induction mechanism of HO-1 by lipopolysaccharide (LPS) and the functional role of HO-1 induction in macrophages. LPS (1 microg/mL) maximally induced inducible nitric oxide synthase (iNOS) and HO-1 mRNAs in wild-type (WT) macrophages at 6h and 12h after treatment, respectively, and liberated tumor necrosis factor alpha (TNFalpha) from WT macrophages. LPS also induced iNOS and HO-1 in TNFalpha(-/-) macrophages, but not in iNOS(-/-) macrophages. Interestingly, although LPS strongly induced iNOS, it failed to induce HO-1 almost completely in nuclear-factor erythroid 2-related factor 2 (Nrf2)(-/-) macrophages. The LPS-induced iNOS gene expression was suppressed by pretreatment with HO-1 inducers, hemin and Co-protoporphyrin (CoPP), but not with HO-1 inhibitor, Sn-protoporphyrin in WT macrophages. In the Nrf2(-/-) macrophages, the ability of CoPP to induce HO-1 and its inhibitory effect on the LPS-induced iNOS gene expression were lower than seen in WT macrophages. The present findings suggest that HO-1 is induced via NO-induced nuclear translocation of Nrf2, and the enzymatic function of HO-1 inhibits the overproduction of NO in macrophages.

  1. Mutational analysis of Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in the interior division of Sabah, Malaysia. (United States)

    Lau, Tiek Ying; Sylvi, Mersumpin; William, Timothy


    The sulphadoxine/pyrimethamine (SDX/PYR) combination had been chosen to treat uncomplicated falciparum malaria in Malaysia for more than 30 years. Non-silent mutations in dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes are responsible for the resistance to pyrimethamine and sulphadoxine, respectively. This study reports the mutational analysis of pfdhfr and pfdhps in single Plasmodium falciparum infection isolates from the interior division of Sabah, Malaysian Borneo. A total of 22 P. falciparum single infection isolates collected from two districts of the interior division of Sabah from February to November 2010 were recruited for the mutational study of pfdhfr and pfdhps. Both genes were amplified by nested PCR prior to DNA sequencing and mutational analysis. A total of three pfdhfr and four pfdhps alleles were identified. The most prevalent pfdhfr allele is ANRNL (86%) involving triple mutation at position 108(S to N), 59(C to R) and 164(I to L). In pfdhps, two novel alleles, SGTGA (73%) and AAKAA (5%) were identified. Alleles involving triple mutation in both pfdhfr (ANRNL) and pfdhps (SGTGA), which were absent in Sabah in a study conducted about 15 years ago, are now prevalent. High prevalence of mutations in SDX/PYR associated drug resistance genes are reported in this study. This mutational study of pfdhps and pfdhfr indicating that SDX/PYR should be discontinued in this region.

  2. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

    Directory of Open Access Journals (Sweden)

    Linda Koshy


    Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

  3. VaCPK20 gene overexpression significantly increased resveratrol content and expression of stilbene synthase genes in cell cultures of Vitis amurensis Rupr. (United States)

    Aleynova-Shumakova, O A; Dubrovina, A S; Manyakhin, A Y; Karetin, Y A; Kiselev, K V


    Resveratrol, a naturally occurring plant phenol, has been reported to exhibit a wide range of valuable biological and pharmacological properties. In the present investigation, we show that transformation of a Vitis amurensis Rupr. cell suspension with the gene VaCPK20 for a calcium-dependent protein kinase (CDPK) under the control of double CaMV 35S promoter increased resveratrol production in five independently transformed cell lines in 9-68 times compared with control cells. The VaCPK20-transformed calli were capable of producing 0.04-0.42 % dry wt. of resveratrol, while the control calli produced up to 0.008 % dry wt. of resveratrol Also, we characterized expression of stilbene synthase (STS) genes in the five VaCPK20-transgenic cell lines of V. amurensis. In all VaCPK20-transgenic cell lines, expression of VaSTS7 increased; while expression of VaSTS1 decreased. We suggest that transformation of V. amurensis calli with the VaCPK20 gene induced resveratrol accumulation via enhancement of expression of the VaSTS7 gene involved in resveratrol biosynthesis. The obtained data first demonstrate that overexpression of a CDPK gene resulted in increased accumulation of a stilbenoid phytoalexine in transgenic plant cells. We propose that the VaCPK20 gene could play an important role in the regulation of resveratrol biosynthesis in grape cells.

  4. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile


    Shuiyuan Cheng; Xiaohui Wang; Feng Xu; Qiangwen Chen; Tingting Tao; Jing Lei; Weiwei Zhang; Yongling Liao; Jie Chang; Xingxiang Li


    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was c...

  5. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P


    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter r...... in the GLUT4 cDNA was a silent polymorphism at codon 130. Southern blotting of both gene loci did not detect any major abnormalities.(ABSTRACT TRUNCATED AT 250 WORDS)...

  6. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal


    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  7. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)


    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  8. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ajl yemi


    Dec 19, 2011 ... Full Length Research Paper. Cloning and characterization of ATP ... that atpA gene from sweet potato has high homology with the other plant chloroplast atpA. The transcript levels of the atpA gene in ..... from spinach chloroplasts primary structure deduced from the cloned. cDNA sequence. FEBS J. 232: ...

  9. Isolation of 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey. (United States)

    Yang, G H; Liu, J P


    A full-length cDNA of a 1-aminocyclopropane-1-carboxylate synthase (ACS) family member from Oncidium, named OnACS1 (GenBank accession No. JQ822087) was cloned and characterized by reverse transcription polymerase chain reaction and rapid amplification of cDNA ends technology. The full-length cDNA was 1586 bp, including a 1308-bp open reading frame, a 105-bp 5' untranslated region (UTR), and 173-bp 3' UTR, encoding 436 amino acids. The deduced amino acid sequence of OnACS1 shares 85, 84, and 83% homology with ACS proteins of Cattleya bicolor, Dendrobium crumenatum, and Phalaenopsis hybrid, respectively. Prokaryotic expression and sodium dodecyl sulfate polyacrylamide gel electrophoresis showed that a specific band was produced and was consistent with the predicted protein size. A tissue-specific manner of OnACS1 expression was observed, and it was predominantly expressed in the gynostemium. The OnACS1 expression in the sepals and gynandria was upregulated by 1% ethephon treatment.

  10. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar


    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  11. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  12. In silico identification and analysis of phytoene synthase genes in plants. (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J


    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  13. DNA polymorphism of HLA class II genes in alopecia areata

    DEFF Research Database (Denmark)

    Morling, N; Frentz, G; Fugger, L


    We investigated the DNA restriction polymorphism (RFLP) of the Major Histocompatibility Complex (MHC) class II genes: HLA-DQA, -DQB, -DPA, and -DPB in 20 Danish patients with alopecia areata (AA) and in healthy Danes. The frequency in AA of the DQB1*0301 and DQw7 associated DQB Bgl/II 4.2 kb...

  14. DNA polymorphism of HLA class II genes in alopecia areata

    DEFF Research Database (Denmark)

    Morling, N; Frentz, G; Fugger, L


    We investigated the DNA restriction polymorphism (RFLP) of the Major Histocompatibility Complex (MHC) class II genes: HLA-DQA, -DQB, -DPA, and -DPB in 20 Danish patients with alopecia areata (AA) and in healthy Danes. The frequency in AA of the DQB1*0301 and DQw7 associated DQB Bgl/II 4.2 kb frag...

  15. Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin. (United States)

    Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan


    Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.

  16. Monogalactosyldiacylglycerol: An abundant galactosyllipid of Cirsium brevicaule A. GRAY leaves inhibits the expression of gene encoding fatty acid synthase. (United States)

    Inafuku, Masashi; Takara, Kensaku; Taira, Naoyuki; Nugara, Ruwani N; Kamiyama, Yasuo; Oku, Hirosuke


    The leaves of Cirsium brevicaule A. GRAY (CL) significantly decreased hepatic lipid accumulation and the expression of fatty acid synthase gene (FASN) in mice. We aimed to purify and identify the active compound(s) from CL and determine the inhibitory mechanism of expression of FASN. We purified monogalactosyldiacylglycerol (MGDG) from extracts of CL (CL-MGDG) and showed that it was the active CL component through analyses of its effects on the expression of genes of human breast cancer cell line, SKBR-3. The content and fatty acid composition of CL-MGDG are distinctly different from those of other vegetable-derived MGDGs. Treatment of SKBR-3 cells with MGDG decreased the level of FASN mRNA as well as the levels of mRNA encoding other protein involved in lipogenesis. Further, MGDG treatments significantly inhibited luciferase activities of constructs containing liver X receptor response element in FASN promoter region without altering the levels of mRNA encoding transcription factors. MGDG and the FASN inhibitor C75 decreased the viabilities of SKBR-3 cells in a concentration-dependent manner. CL-MGDG more potently inhibited cell viability than a commercial MGDG preparation. CL represents a good source of glycoglycerolipids with potential as functional ingredients of food. Copyright © 2016 Elsevier GmbH. All rights reserved.

  17. Molecular cloning and expression profiling of a chalcone synthase gene from hairy root cultures of Scutellaria viscidula Bunge

    Directory of Open Access Journals (Sweden)

    Wei Lei


    Full Text Available A cDNA encoding chalcone synthase (CHS, the key enzyme in flavonoid biosynthesis, was isolated from hairy root cultures of Scutellaria viscidula Bunge by rapid amplification of cDNA ends (RACE. The full-length cDNA of S. viscidula CHS, designated as Svchs (GenBank accession no. EU386767, was 1649 bp with a 1170 bp open reading frame (ORF that corresponded to a deduced protein of 390 amino acid residues, a calculated molecular mass of 42.56 kDa and a theoretical isoelectric point (pI of 5.79. Multiple sequence alignments showed that SvCHS shared high homology with CHS from other plants. Functional analysis in silico indicated that SvCHS was a hydrophilic protein most likely associated with intermediate metabolism. The active sites of the malonyl-CoA binding motif, coumaroyl pocket and cyclization pocket in CHS of Medicago sativa were also found in SvCHS. Molecular modeling indicated that the secondary structure of SvCHS contained mainly α-helixes and random coils. Phylogenetic analysis showed that SvCHS was most closely related to CHS from Scutellaria baicalensis. In agreement with its function as an elicitor-responsive gene, the expression of Svchs was induced and coordinated by methyl jasmonate. To our knowledge, this is the first report to describe the isolation and expression of a gene from S. viscidula.

  18. A novel mutation in the glycogen synthase 2 gene in a child with glycogen storage disease type 0 (United States)


    Background Glycogen storage disease type 0 is an autosomal recessive disease presenting in infancy or early childhood and characterized by ketotic hypoglycemia after prolonged fasting and postprandial hyperglycemia and hyperlactatemia. Sixteen different mutations have been identified to date in the gene which encodes hepatic glycogen synthase, resulting in reduction of glycogen storage in the liver. Case Presentation Biochemical evaluation as well as direct sequencing of exons and exon-intron boundary regions of the GYS2 gene were performed in a patient presenting fasting hypoglycemia and postprandial hyperglycemia and her parents. The patient was found to be compound heterozygous for one previously reported nonsense mutation (c.736 C>T; R243X) and a novel frameshift mutation (966_967delGA/insC) which introduces a stop codon 21 aminoacids downstream from the site of the mutation that presumably leads to loss of 51% of the COOH-terminal part of the protein. The glycemia and lactatemia of the parents after an oral glucose tolerance test were evaluated to investigate a possible impact of the carrier status on the metabolic profile. The mother, who presented a positive family history of type 2 diabetes, was classified as glucose intolerant and the father, who did not exhibit metabolic changes after the glucose overload, had an antecedent history of hypoglycemia after moderate alcohol ingestion. Conclusion The current results expand the spectrum of known mutations in GYS2 and suggest that haploinsufficiency could explain metabolic abnormalities in heterozygous carriers in presence of predisposing conditions. PMID:20051115

  19. RNAi-mediated down-regulation of a melanin polyketide synthase (pks1) gene in the fungus Slafractonia leguminicola. (United States)

    Alhawatema, Mohammad S; Gebril, Sayed; Cook, Daniel; Creamer, Rebecca


    The fungus Slafractonia leguminicola, the causal agent of blackpatch disease of legumes produces two mycotoxins slaframine and swainsonine, causing slobbers' symptoms and locoism of grazing animals, respectively. The genetics of this important fungus is poorly understood. This work aimed to develop a genetic transformation system and evaluate the efficacy of RNA interference (RNAi) in S. leguminicola. In this study, S. leguminicola was transformed using a PEG-mediated method with a fungal construct that carries a hygromycin resistance cassette. To assess the use of RNAi, a silencing construct pSilentPKS1-AS was constructed which includes inverted repeat transgenes of the polyketide synthase gene (pks1) that is involved in melanin biosynthesis. Transformation of S. leguminicola with the IRT pks1 vector decreased pks1 transcripts levels 82-92% in knockdown mutants when compared with the wild type and was accompanied with a reduction in melanin and swainsonine production. These results demonstrate that RNAi can be a useful tool for studying gene function in S. leguminicola.


    Directory of Open Access Journals (Sweden)

    Petyunina O. V.


    Full Text Available Aldosterone plays an important role in the development of reparative and reactive fibrosis and cardiac remodeling (CR after myocardial infarction. The objective of the study is to investigate the structural and functional parameters of the myocardium, heart rate variability (HRV, exercise intolerance, levels of sST2 in association with polymorphism of CYP11B2 gene of aldosterone-synthase in ST-myocardial infarction (STEMI patients during a 6-months follow-up period. 85 STEMI patients were enrolled: 68 (80 % male and 17 (20 % female, mean age was 58,94 ± 10,16 years. Examinations were performed twice: during 1–3 days after PCI with infarct-related artery stenting and included clinical assessment, ultrasound diagnostic, immunofermentative blood analyses (sST2, polymerase chain reaction in real time (polymorphism –T344C of the CYP11B2 gene. After 6-months of observation, 57 patients were reexamined – clinical assessment, ultrasound diagnostic, HRV were performed. CYP11B2 TT-genotype in 6 months after STEMI is associated with a maladaptive character of after infarction remodeling.

  1. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits. (United States)

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun


    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  2. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene. (United States)

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay


    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  3. Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

    Directory of Open Access Journals (Sweden)

    Michelle F. Valentine


    Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

  4. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content. (United States)

    Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C


    Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

  5. Prevalence of endothelial nitric oxide synthase (eNOS) gene exon 7 Glu298Asp variant in North Eastern India (United States)

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish


    Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032

  6. Mitochondrial 3-hydroxy-3-methylglutaryl coenzyme A synthase and carnitine palmitoyltransferase II as potential control sites for ketogenesis during mitochondrion and peroxisome proliferation. (United States)

    Madsen, L; Garras, A; Asins, G; Serra, D; Hegardt, F G; Berge, R K


    3-Thia fatty acids are potent hypolipidemic fatty acid derivatives and mitochondrion and peroxisome proliferators. Administration of 3-thia fatty acids to rats was followed by significantly increased levels of plasma ketone bodies, whereas the levels of plasma non-esterified fatty acids decreased. The hepatic mRNA levels of fatty acid binding protein and formation of acid-soluble products, using both palmitoyl-CoA and palmitoyl-L-carnitine as substrates, were increased. Hepatic mitochondrial carnitine palmitoyltransferase (CPT) -II and 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase activities, immunodetectable proteins, and mRNA levels increased in parallel. In contrast, the mitochondrial CPT-I mRNA levels were unchanged and CPT-I enzyme activity was slightly reduced in the liver. The CoA ester of the monocarboxylic 3-thia fatty acid, tetradecylthioacetic acid, which accumulates in the liver after administration, inhibited the CPT-I activity in vitro, but not that of CPT-II. Acetoacetyl-CoA thiolase and HMG-CoA lyase activities involved in ketogenesis were increased, whereas the citrate synthase activity was decreased. The present data suggest that 3-thia fatty acids increase both the transport of fatty acids into the mitochondria and the capacity of the beta-oxidation process. Under these conditions, the regulation of ketogenesis may be shifted to step(s) beyond CPT-I. This opens the possibility that mitochondrial HMG-CoA synthase and CPT-II retain some control of ketone body formation.

  7. Analysis of carbon source-regulated gene expression by the upstream region of the Candida tropicalis malate synthase gene in Saccharomyces cerevisiae. (United States)

    Umemura, K; Atomi, H; Izuta, M; Kanai, T; Takeshita, S; Ueda, M; Tanaka, A


    We investigated the regulation of expression of a gene encoding malate synthase (MS) of an n-alkane-utilizable yeast Candida tropicalis in the yeast Saccharomyces cerevisiae, where its expression is highly induced by acetate. By comparing levels of gene expression in cells grown on glucose, acetate, lactate, and oleic acid, we found that the increase in gene expression was due to a glucose repression-derepression mechanism. In order to obtain information concerning the regulation of the gene expression, a fusion gene which consists of the 5'-upstream region of MS-2 (UPR-MS-2) and the lacZ gene (encoding Escherichia coli beta-galactosidase), was introduced into S. cerevisiae, and beta-galactosidase activities were measured with cells grown on glucose or acetate. Deletion analysis of UPR-MS-2 revealed that the region between -777 and -448 (against the translation initiation codon) enhanced the level of gene expression in both glucose- and acetate-grown cells. In this region, sequences which resemble binding sites of Rap1p/Grf1p/Tufp, a global transcription activator, were found at seven locations and one was found for another pleiotropic activator Abf1p. The result also suggested the presence of multiple upstream repression sequences (URSs), which function specifically in glucose-grown cells, in the region between -368 and -126. In the repressing region, there were three tandem C(A/T)CTCCC sequences and also a putative binding site of Mig1p, a transcriptional repressor which mediates glucose repression of several other genes. When MIG1 gene of S. cerevisiae was disrupted, the expression of the UPR-MS-2-lacZ gene in glucose-grown cells increased approx. 10-fold. Furthermore, the effect of deletion of a putative Mig1p binding site was abolished in the MIG1-disrupted strain, suggesting Mig1p binds to this site and brings about glucose repression. When the SNF1 gene was disrupted, the high level gene expression observed in acetate-grown cells bearing UPR-MS-2 was

  8. Malate synthase gene expression during fruit ripening of Cavendish banana (Musa acuminata cv. Williams). (United States)

    Pua, Eng-Chong; Chandramouli, Sumana; Han, Ping; Liu, Pei


    Malate synthase (MS) is a key enzyme responsible for malic acid synthesis in the glyoxylate cycle, which functions to convert stored lipids to carbohydrates, by catalysing the glyoxylate condensation reaction with acetyl-CoA in the peroxisome. In this study, the cloning of an MS cDNA, designated MaMS-1, from the banana fruit is reported. MaMS-1 was 1801 bp in length encoding a single polypeptide of 556 amino acid residues. Sequence analysis revealed that MaMS-1 possessed the conserved catalytic domain and a putative peroxisomal targeting signal SK(I/L) at the carboxyl terminal. MaMS-1 also shared an extensive sequence homology (79-81.3%) with other plant MS homologues. Southern analysis indicated that MS might be present as multiple members in the banana genome. In Northern analysis, MaMS-1 was expressed specifically in ripening fruit tissue and transcripts were not detected in other organs such as roots, pseudostem, leaves, ovary, male flower, and in fruit at different stages of development. However, the transcript abundance in fruit was affected by stage of ripening, during which transcript was barely detectable at the early stage of ripening (FG and TY), but the level increased markedly in MG and in other fruits at advanced ripening stages. Furthermore, MaMS-1 expression in FG fruit could be stimulated by treatment with 1 microl l(-1) exogenous ethylene, but the stimulatory effect was abolished by the application of an ethylene inhibitor, norbornadiene. Results of this study clearly show that MS expression in banana fruit is temporally regulated during ripening and is ethylene-inducible.

  9. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips. (United States)

    Yang, Ting; Stoopen, Geert; Thoen, Manus; Wiegers, Gerrie; Jongsma, Maarten A


    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western flower thrips (WFT, Frankliniella occidentalis) showed, initially during the first 15 min of WFT release, that FaNES1 plants were significantly preferred. This gradually reversed into significant preference for the control, however, at 20-28 h after WFT release. The initial preference was shown to be based on the linalool odour of FaNES1 plants by olfactory dual-choice assays using paper discs emitting pure linalool at similar rates as leaf discs. The reversal of preference into deterrence could be explained by the initial nonvolatile composition of the FaNES1 plants, as methanolic extracts were less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  10. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    International Nuclear Information System (INIS)

    Soliman, S.E.T.; Zaater, M.K.


    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  11. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers. (United States)

    Manzanilla, Vincent; Bruneau, Anne


    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Expression Profiles of the Trehalose-6-Phosphate Synthase Gene Associated With Thermal Stress in Ostrinia furnacalis (Lepidoptera: Crambidae) (United States)

    Jin, Tingting; Gao, Yulin; He, Kanglai


    Abstract Trehalose is the major blood sugar in insects. Physiological significance of this compound has been extensively reported. Trehalose-6-phosphate synthase (TPS) is an important enzyme in the trehalose biosynthesis pathway. Full-length cDNAs of TPS (Of tps) and its alternative splicing isoform (Of tps_isoformI) were cloned from the Asian corn borer (ACB), Ostrinia furnacalis (Guenée; Lepidoptera: Crambidae) larvae. The Of tps and Of tps_isoformI transcripts were 2913 and 1689 bp long, contained 2529 and 1293 bp open reading frames encoding proteins of 842 and 430 amino acids with a molecular mass of 94.4 and 48.6 kDa, respectively. Transcriptional profiling and response to thermal stress of Of tps gene were determined by quantitative real-time PCR showing that the Of tps was predominantly expressed in the larval fat body, significantly enhanced during molting and transformation; and thermal stress also induced Of tps expression. Gene structure analysis is indicating that one TPS domain and one trehalose-6-phosphate phosphatase (TPP) domain were located at the N- and C-termini of Of        TPS, respectively, while only the TPS domain was detected in OfTPS_isoformI. Three-dimensional modeling and heterologous expression were developed to predict the putative functions of OfTPS and Of   TPS_isoformI. We infer that the expression of Of tps gene is thermally induced and might be crucial for larvae survival.

  13. Characterization of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS) gene from Ginkgo biloba. (United States)

    Kim, Sang-Min; Kim, Soo-Un


    Diterpene trilactone ginkgolides, one of the major constituents of Ginkgo biloba extract, have shown interesting bioactivities including platelet-activating factor antagonistic activity. 1-Hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS), converting 2-C-methyl-d-erythritol-2,4-cyclodiphosphate into 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate, is the penultimate enzyme of the seven-step 2-C-methyl-d-erythritol 4-phosphate pathway that supplies building blocks for plant isoprenoids of plastid origin such as ginkgolides and carotenoids. Here, we report on the isolation and characterization of the full-length cDNA encoding HDS (GbHDS, GenBank accession number: DQ251630) from G. biloba. Full-length cDNA of GbHDS, 2,763 bp long, contained an ORF of 2,226 bp encoding a protein composed of 741 amino acids. The theoretical molecular weight and pI of the deduced mature GbHDS of 679 amino acid residues are 75.6 kDa and 5.5, respectively. From 2 weeks after initiation of the culture onward, transcription level of this gene in the ginkgo embryo roots increased to about two times higher than that in the leaves. GbHDS was predicted to possess chloroplast transit peptide of 62 amino acid residues, suggesting its putative localization in the plastids. The transient gene expression in Arabidopsis protoplasts confirmed that the transit peptide was capable of delivering the GbHDS protein from the cytosol into the chloroplasts. The isolation and characterization of GbHDS gene enabled us to further understand the role of GbHDS in the terpenoid biosynthesis in G. biloba.

  14. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Olga Y. Yurkevich


    Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  15. Cloning and characterization of homeologous cellulose synthase catalytic subunit 2 genes from allotetraploid cotton (Gossypium hirsutum L.). (United States)

    Kim, Hee Jin; Triplett, Barbara A; Zhang, Hong-Bin; Lee, Mi-Kyung; Hinchliffe, Doug J; Li, Ping; Fang, David D


    Cellulose synthase catalytic subunits (CesAs) are the catalytic sites within a multisubunit complex for cellulose biosynthesis in plants. CesAs have been extensively studied in diploid plants, but are not well characterized in polyploid plants. Gossypium hirsutum is an allotetraploid cotton species producing over 90% of the world's cotton fibers. Although G. hirsutum CesAs (GhCesAs) are responsible for cellulose production in cotton fiber, very limited numbers of GhCesA genes have been identified. Here, we report isolating and characterizing a pair of homeologous CesA2 genes and their full-length cDNAs from allotetraploid cotton. The GhCesA2-A(T) gene from the A-subgenome and GhCesA2-D(T) gene from the D-subgenome were screened from a G. hirsutum BAC library. These genes shared 92% sequence similarity throughout the entire sequence. The coding sequences were nearly identical, and the deduced amino acid sequences from GhCesA2-A(T) (1,039 amino acids) and GhCesA2-D(T) (1,040 amino acids) were identical except four amino acids, whereas the noncoding sequences showed divergence. Sequence analyses showed that all exons of GhCesA2-A(T) contained consensus splice donor dinucleotides, but one exon in GhCesA2-D(T) contained nonconsensus splice donor dinucleotides. Although the nonconsensus splice donor dinucleotides were previously suggested to be involved in alternative splice or pseudogenization, our results showed that a majority of GhCesA2-A(T) and GhCesA2-D(T) transcripts consisted of functional and full-length transcripts with little evidence for alternative mRNA isoforms in developing cotton fibers. Expression analyses showed that GhCesA2-A(T) and GhCesA2-D(T) shared common temporal and spatial expression patterns, and they were highly and preferentially expressed during the cellulose biosynthesis stage in developing cotton fibers. The observations of higher expression levels of both GhCesA2-A(T) and GhCesA2-D(T) in developing fibers of one near-isogenic line (NIL

  16. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

  17. Novel description of aldosterone synthase CYP11B2 -344 T>C gene ...

    African Journals Online (AJOL)

    This is a report on population genetics of -344 T>C polymorphism in Amerindians for the first time. The aim was to establish the frequency of this polymorphism present in the 5' promoter region of the CYP11B2 gene in Amerindian (Mayans, Mixtecos, and Teenek) and Mestizo populations from Mexico. It has been associated ...

  18. Use of octaketide synthases to produce kermesic acid and flavokermesic acid

    DEFF Research Database (Denmark)


    A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

  19. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars. (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika


    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  20. Haplotype analysis of the germacrene A synthase gene and association with cynaropicrin content and biological activities in Cynara cardunculus. (United States)

    Ferro, Ana Margarida; Ramos, Patrícia; Guerra, Ângela; Parreira, Paula; Brás, Teresa; Guerreiro, Olinda; Jerónimo, Eliana; Capel, Carmen; Capel, Juan; Yuste-Lisbona, Fernando J; Duarte, Maria F; Lozano, Rafael; Oliveira, M Margarida; Gonçalves, Sónia


    Cynara cardunculus: L. represents a natural source of terpenic compounds, with the predominant molecule being cynaropicrin. Cynaropicrin is gaining interest since it has been correlated to anti-hyperlipidaemia, antispasmodic and cytotoxicity activity against leukocyte cancer cells. The objective of this work was to screen a collection of C. cardunculus, from different origins, for new allelic variants in germacrene A synthase (GAS) gene involved in the cynaropicrin biosynthesis and correlate them with improved cynaropicrin content and biological activities. Using high-resolution melting, nine haplotypes were identified. The putative impact of the identified allelic variants in GAS protein was evaluated by bioinformatic tools and polymorphisms that putatively lead to protein conformational changes were described. Additionally, cynaropicrin and main pentacyclic triterpenes contents, and antithrombin, antimicrobial and antiproliferative activities were also determined in C. cardunculus leaf lipophilic-derived extracts. In this work we identified allelic variants with putative impact on GAS protein, which are significantly associated with cynaropicrin content and antiproliferative activity. The results obtained suggest that the identified polymorphisms should be explored as putative genetic markers correlated with biological properties in Cynara cardunculus.

  1. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity† (United States)

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos


    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  2. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family (United States)

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.


    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  3. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review)


    Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.


    Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...

  4. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M


    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  5. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women. (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J


    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  6. A novel mutation in the glycogen synthase 2 gene in a child with glycogen storage disease type 0

    Directory of Open Access Journals (Sweden)

    Pereira Maria


    Full Text Available Abstract Background Glycogen storage disease type 0 is an autosomal recessive disease presenting in infancy or early childhood and characterized by ketotic hypoglycemia after prolonged fasting and postprandial hyperglycemia and hyperlactatemia. Sixteen different mutations have been identified to date in the gene which encodes hepatic glycogen synthase, resulting in reduction of glycogen storage in the liver. Case Presentation Biochemical evaluation as well as direct sequencing of exons and exon-intron boundary regions of the GYS2 gene were performed in a patient presenting fasting hypoglycemia and postprandial hyperglycemia and her parents. The patient was found to be compound heterozygous for one previously reported nonsense mutation (c.736 C>T; R243X and a novel frameshift mutation (966_967delGA/insC which introduces a stop codon 21 aminoacids downstream from the site of the mutation that presumably leads to loss of 51% of the COOH-terminal part of the protein. The glycemia and lactatemia of the parents after an oral glucose tolerance test were evaluated to investigate a possible impact of the carrier status on the metabolic profile. The mother, who presented a positive family history of type 2 diabetes, was classified as glucose intolerant and the father, who did not exhibit metabolic changes after the glucose overload, had an antecedent history of hypoglycemia after moderate alcohol ingestion. Conclusion The current results expand the spectrum of known mutations in GYS2 and suggest that haploinsufficiency could explain metabolic abnormalities in heterozygous carriers in presence of predisposing conditions.

  7. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  8. Characterization of the Granule-Bound Starch Synthase I Gene in Chenopodium

    Directory of Open Access Journals (Sweden)

    Douglass C. Brown


    Full Text Available L. is a relatively under-studied genus that includes the cultivated seed crop quinoa ( Willd.. Quinoa is an allotetraploid (2 = 4 = 36, AABB genomes that is cultivated by subsistence farmers and commercial growers in the Andean regions of South America. Approximately 60% of a quinoa seed is starch, a glucose polymer that is an important carbohydrate energy source in the human diet. Seed starch is normally composed of amylose and amylopectin in a 1:3 ratio. The accumulation of the amylose fraction of starch is controlled by a single dominant gene in quinoa, . We report the sequencing and characterization of the gene in 18 accessions of , including Andean quinoa and the related Mesoamerican chenopod domesticate, subsp. Saff. Two distinct homeologs ( and were identified in the tetraploid accessions, and 19 different alleles were identified, including three null mutants—one in an accession of quinoa and two in a waxy landrace of subsp. . Expression analysis of the null mutants revealed that and were both strongly expressed late in seed development. sequences were used to analyze the phylogenetic relationships between quinoa and other members of the genus. This study and the discovery of null-mutants will assist in the development of new crops with novel starches.

  9. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan


    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  10. The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom. (United States)

    Chen, Feng; Tholl, Dorothea; Bohlmann, Jörg; Pichersky, Eran


    Some plant terpenes such as sterols and carotenes are part of primary metabolism and found essentially in all plants. However, the majority of the terpenes found in plants are classified as 'secondary' compounds, those chemicals whose synthesis has evolved in plants as a result of selection for increased fitness via better adaptation to the local ecological niche of each species. Thousands of such terpenes have been found in the plant kingdom, but each species is capable of synthesizing only a small fraction of this total. In plants, a family of terpene synthases (TPSs) is responsible for the synthesis of the various terpene molecules from two isomeric 5-carbon precursor 'building blocks', leading to 5-carbon isoprene, 10-carbon monoterpenes, 15-carbon sesquiterpenes and 20-carbon diterpenes. The bryophyte Physcomitrella patens has a single TPS gene, copalyl synthase/kaurene synthase (CPS/KS), encoding a bifunctional enzyme producing ent-kaurene, which is a precursor of gibberellins. The genome of the lycophyte Selaginella moellendorffii contains 18 TPS genes, and the genomes of some model angiosperms and gymnosperms contain 40-152 TPS genes, not all of them functional and most of the functional ones having lost activity in either the CPS- or KS-type domains. TPS genes are generally divided into seven clades, with some plant lineages having a majority of their TPS genes in one or two clades, indicating lineage-specific expansion of specific types of genes. Evolutionary plasticity is evident in the TPS family, with closely related enzymes differing in their product profiles, subcellular localization, or the in planta substrates they use. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  11. Simultaneous post-transcriptional gene silencing of two different chalcone synthase genes resulting in pure white flowers in the octoploid dahlia. (United States)

    Ohno, Sho; Hosokawa, Munetaka; Kojima, Misa; Kitamura, Yoshikuni; Hoshino, Atsushi; Tatsuzawa, Fumi; Doi, Motoaki; Yazawa, Susumu


    Garden dahlias (Dahlia variabilis) are autoallooctoploids with redundant genes producing wide color variations in flowers. There are no pure white dahlia cultivars, despite its long breeding history. However, the white areas of bicolor flower petals appear to be pure white. The objective of this experiment was to elucidate the mechanism by which the pure white color is expressed in the petals of some bicolor cultivars. A pigment analysis showed that no flavonoid derivatives were detected in the white areas of petals in a star-type cultivar 'Yuino' and the two seedling cultivars 'OriW1' and 'OriW2' borne from a red-white bicolor cultivar, 'Orihime', indicating that their white areas are pure white. Semi-quantitative RT-PCR showed that in the pure white areas, transcripts of two chalcone synthases (CHS), DvCHS1 and DvCHS2 which share 69% nucleotide similarity with each other, were barely detected. Premature mRNA of DvCHS1 and DvCHS2 were detected, indicating that these two CHS genes are silenced post-transcriptionally. RNA gel blot analysis revealed that small interfering RNAs (siRNAs) derived from CHSs were produced in these pure white areas. By high-throughput sequence analysis of small RNAs in the pure white areas with no mismatch acceptance, small RNAs were mapped to two alleles of DvCHS1 and two alleles of DvCHS2 expressed in 'Yuino' petals. Therefore, we concluded that simultaneous siRNA-mediated post-transcriptional gene silencing of redundant CHS genes results in the appearance of pure white color in dahlias.

  12. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P


    regions and regions of importance for translation, as well as coding sequences of the two genes, were studied using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The genetic analyses were performed in subgroups of 52 Caucasian NIDDM patients and 25 age-matched healthy......To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  13. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular damage in hypertensive subjects: an Italian case-control study

    Directory of Open Access Journals (Sweden)

    Pizzo Federica


    Full Text Available Abstract Background Nitric oxide (NO synthesized by endothelial nitric oxide synthase (eNOS plays an important role in regulation of endothelial function and in the control of blood pressure. However, the results from some studies on the association between three clinically relevant eNOS gene polymorphisms (G894T, T786C and intron 4b/a and essential hypertension are unclear. We designed a case-control study to evaluate the influence of eNOS polymorphisms on target organ damage in 127 hypertensives and 67 normotensives. Clinical evaluation, biochemical parameters, Urinary Albumin Excretion (UAE and echocardiogram were performed to characterize target organ damage. eNOS polymorphism were recognized by PCR method. Results The distribution of eNOS genotypes was similar in hypertensives and normotensives but 4aa was present in the 2.5% of hypertensives and completely absent in normotensives. Subjects with 4bb, G894T, and T786C genotypes showed an increased prevalence of target organ damage. Moreover prevalence of G894T and introne 4 variants was significantly higher in hypertensives than in normotensives both with cardiovascular damage. Logistic regression analysis didn't show any association between eNOS polymorphisms, Body Mass Index (BMI, hypertension, gender and cardiovascular damage. Only the age (OR 1.11; IC 95% 1.06–1.18 was predictive of cardiovascular damage in our population. Conclusion Our results seem to indicate a lack of association with eNOS variants and cardiovascular damage onset.

  14. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS) Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants. (United States)

    Fang, Jia; Nan, Peng; Gu, Zongying; Ge, Xiaochun; Feng, Yu-Qi; Lu, Bao-Rong


    Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T 2 and T 3 Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium ( CP4 ). For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid) content in transgene-present, transgene-absent, empty vector (EV), and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T 2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T 3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  15. Endothelial nitric oxide synthase gene polymorphisms and risk of erectile dysfunction: An updated meta-analysis of genetic association studies. (United States)

    Yao, Han-Xin; Ma, Fu-Zhe; Tan, Yu-Ying; Liu, Ling-Yun


    Endothelial nitric oxide synthase (eNOS) polymorphisms have been implicated as risk factors for erectile dysfunction (ED), but the results of genetic association studies are inconclusive. We performed a meta-analysis of published studies investigating the association between ED and three eNOS polymorphisms, intron 4 VNTR, G894T and T786C in humans. The PubMed, Web of Science, CNKI and Google Scholar databases were searched for relevant studies published up to November 2017. Association studies with case-control design were included. For each study with genotype information we calculated odds ratios (OR) and 95% confidence intervals (CI). The search identified 13 eligible studies. The G894T and T786C polymorphisms showed a significant association with ED risk in Caucasians (GT + TT versus GG for G894T: OR = 2.13, 95% CI = 1.08-4.19; CC versus CT + TT for T786C: OR = 3.29, 95% CI = 2.30-4.72) and Asians (GT + TT versus GG for G894T: OR = 2.08, 95% CI = 1.53-2.84; CC + CT versus TT for T786C: OR = 3.13, 95% CI = 1.35-7.25). In addition, the intron 4 VNTR polymorphism was associated with ED risk only among Caucasian subjects (aa versus bb + ab: OR = 2.38, 95% CI = 1.15-4.93). We found no evidence of publication bias. The robustness of overall analyses was ensured in sensitivity analyses excluding studies deviating from Hardy-Weinberg equilibrium. Our findings suggest that common genetic polymorphisms in the eNOS gene contribute to risk of ED, presumably by effects on eNOS activity and NO availability. Copyright © 2018. Published by Elsevier Ltd.

  16. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants

    Directory of Open Access Journals (Sweden)

    Jia Fang


    Full Text Available Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T2 and T3Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium (CP4. For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid content in transgene-present, transgene-absent, empty vector (EV, and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  17. Type II thioesterase gene (ECO-orf27) from Amycolatopsis orientalis influences production of the polyketide antibiotic, ECO-0501 (LW01). (United States)

    Shen, Yang; Huang, He; Zhu, Li; Luo, Minyu; Chen, Daijie


    ECO-orf27 associated with the cluster of ECO-0501 (LW01) from Amycolatopsis orientalis is deduced to encode a type II thioesterase. Disruption of ECO-orf27 reduced LW01 production by 95 %. Complementation of the disrupted mutant with intact ECO-orf27 restored the production of LW01 suggesting that ECO-orf27 is crucial for LW01 biosynthesis. ECO-TE I, the gene encoding type I thioesterase from LW01 polyketide synthases, cannot complement ECO-orf27 deficient mutant distinguishing ECO-orf27 from type I thioesterase gene. Type II thioesterase gene pikAV from Streptomyces venezuelae could complement ECO-orf27 in A. orientalis indicating that the two genes are equivalent in their function. Overexpression of ECO-orf27 resulted in a 20 % increase in LW01 production providing an alternative approach for yield improvement.

  18. Impact of the Xba1-polymorphism of the human muscle glycogen synthase gene on parameters of the insulin resistance syndrome in a Danish twin population

    DEFF Research Database (Denmark)

    Fenger, M; Poulsen, P; Beck-Nielsen, H


    : The Xba1-polymorphism of the human muscle glycogen synthase gene is correlated to insulin resistance and to diastolic blood pressure. The polymorphism does not involve any known transcription factor or any structural change in GYS1, and these correlations are therefore most probably caused by linkage......AIMS: To establish the impact on the insulin resistance syndrome of the intron 14 Xba1-polymorphism in human muscle glycogen synthase (GYS1). METHODS: Parameters related to the insulin resistance syndrome were measured in 244 monozygotic twins and 322 dizygotic twins with or without impaired...... and the remainder had the genotype A1A2. No A2A2-genotypes were detected. In 11 genotypic discordant dizygotic twin pairs the insulin resistance was significantly increased in the twins carrying the A1A2 genotype regardless of sex (HOMA index 1.81 (A1A1) vs. 2.57 (A1A2), P

  19. The signal peptidase II (lsp) gene of Bacillus subtilis

    NARCIS (Netherlands)

    Pragai, Z; Tjalsma, H; Bolhuis, A; vanDijl, JM; Venema, G; Bron, S

    The gene encoding the type II signal peptidase (SPase III) of Bacillus subtilis was isolated by screening a genomic DNA library of this bacterium for the ability of increase the levels of globomycin resistance in Escherichia coli, and to complement the growth deficiency at the non-permissive

  20. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani


    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  1. Lipoplex gene transfer of inducible nitric oxide synthase inhibits the reactive intimal hyperplasia after expanded polytetrafluoroethylene bypass grafting. (United States)

    Pfeiffer, Tomas; Wallich, Martina; Sandmann, Wilhelm; Schrader, Jürgen; Gödecke, Axel


    Intimal hyperplasia (IH) is most commonly the cause of graft occlusion in infrainguinal bypass grafting for arterial occlusive disease. We investigated the influence of nitric oxide on the IH of the arterial vessel wall at the region of prosthetic bypass anastomoses. Experiments were performed in 10 Foxhound dogs. We used a technique of inducible nitric oxide synthase (iNOS) overexpression by a non-virus-mediated, liposome-based iNOS gene transfer. The plasmid pSCMV-iNOS, which drives the expression of iNOS under control of the cytomegalovirus promoter, was complexed with cationic liposomes (lipoplexes). Segments of both carotid arteries were pretreated by intramural injection of a lipoplex solution by using an infiltrator balloon catheter (Infiltrator Drug Delivery Balloon System). In each dog, iNOS was administered at one side, and a control vector (pSCMV2) was administered at the contralateral side. Carotid arteries were ligated, and bypass grafts (expanded polytetrafluoroethylene, 6-mm, ring enforced) were implanted on both sides. The proximal and distal anastomoses (end-to-side fashion; running nonabsorbable sutures) were placed in the pretreated regions. After 6 months, the prostheses were excised, and the intimal thicknesses of 50 cross sections (orcein staining) of each anastomosis were measured planimetrically. The average reduction of the neointima thickness of the iNOS side in proximal anastomoses at the prosthetic wall, suture region, and arterial wall was 43%, 52%, and 81%, respectively. In distal anastomoses, the average reduction was 40%, 47%, and 52%, respectively. All differences of neointima thickness between the iNOS and control sides were statistically significant (Wilcoxon test; P < or = .05). Inducible NOS expression is an efficient approach for inhibition of IH. In contrast to earlier studies, which investigated the efficacy of gene therapeutic NOS expression at 3 to 4 weeks after intervention, the novelty of our findings is that a single

  2. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    Energy Technology Data Exchange (ETDEWEB)

    Kirimura, Kohtaro, E-mail:; Watanabe, Shotaro; Kobayashi, Keiichi


    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  3. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny


    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 ...

  4. Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase.

    Directory of Open Access Journals (Sweden)

    Carole H Sellem


    Full Text Available Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO of the ATP synthase drive the rotation of a ring of 8-15 c-subunits, which induces conformational changes in the catalytic part (F1 of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary cells while Atp9-5 is expressed in the cells at the extremity (apex of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before.

  5. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae (United States)

    Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.


    The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

  6. Gene expression profiles in stages II and III colon cancers

    DEFF Research Database (Denmark)

    Thorsteinsson, Morten; Kirkeby, Lene T; Hansen, Raino


    were retrieved from the Gene Expression Omnibus (GEO) (n¿=¿111) in addition to a Danish data set (n¿=¿37). All patients had stages II and III colon cancers. A Prediction Analysis of Microarray classifier, based on the 128-gene signature and the original training set of stage I (n¿=¿65) and stage IV (n......¿=¿76) colon cancers, was reproduced. The stages II and III colon cancers were subsequently classified as either stage I-like (good prognosis) or stage IV-like (poor prognosis) and assessed by the 36 months cumulative incidence of relapse. RESULTS: In the GEO data set, results were reproducible in stage...... correctly predicted as stage IV-like, and the remaining patients were predicted as stage I-like and unclassifiable, respectively. Stage II patients could not be stratified. CONCLUSIONS: The 128-gene signature showed reproducibility in stage III colon cancer, but could not predict recurrence in stage II...

  7. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J


    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth......Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate...

  8. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)


    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  9. Suppression of the phytoene synthase gene (EgcrtB) alters carotenoid content and intracellular structure of Euglena gracilis. (United States)

    Kato, Shota; Soshino, Mika; Takaichi, Shinichi; Ishikawa, Takahiro; Nagata, Noriko; Asahina, Masashi; Shinomura, Tomoko


    Photosynthetic organisms utilize carotenoids for photoprotection as well as light harvesting. Our previous study revealed that high-intensity light increases the expression of the gene for phytoene synthase (EgcrtB) in Euglena gracilis (a unicellular phytoflagellate), the encoded enzyme catalyzes the first committed step of the carotenoid biosynthesis pathway. To examine carotenoid synthesis of E. gracilis in response to light stress, we analyzed carotenoid species and content in cells grown under various light intensities. In addition, we investigated the effect of suppressing EgcrtB with RNA interference (RNAi) on growth and carotenoid content. After cultivation for 7 days under continuous light at 920 μmol m -2  s -1 , β-carotene, diadinoxanthin (Ddx), and diatoxanthin (Dtx) content in cells was significantly increased compared with standard light intensity (55 μmol m -2  s -1 ). The high-intensity light (920 μmol m -2  s -1 ) increased the pool size of diadinoxanthin cycle pigments (i.e., Ddx + Dtx) by 1.2-fold and the Dtx/Ddx ratio from 0.05 (control) to 0.09. In contrast, the higher-intensity light treatment caused a 58% decrease in chlorophyll (a + b) content and diminished the number of thylakoid membranes in chloroplasts by approximately half compared with control cells, suggesting that the high-intensity light-induced accumulation of carotenoids is associated with an increase in both the number and size of lipid globules in chloroplasts and the cytoplasm. Transient suppression of EgcrtB in this alga by RNAi resulted in significant decreases in cell number, chlorophyll, and total major carotenoid content by 82, 82 and 86%, respectively, relative to non-electroporated cells. Furthermore, suppression of EgcrtB decreased the number of chloroplasts and thylakoid membranes and increased the Dtx/Ddx ratio by 1.6-fold under continuous illumination even at the standard light intensity, indicating that blocking carotenoid synthesis increased the

  10. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper


    BACKGROUND: Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential...

  11. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J


    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...

  12. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.) (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  13. Expression in Arabidopsis of a strawberry linalool synthase gene under the control of the inducible potato P12 promoter

    NARCIS (Netherlands)

    Yang, L.; Mercke, P.; Loon, van J.J.A.; Fang, Zhiyuan; Dicke, M.; Jongsma, M.A.


    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FaNES1 linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The

  14. Chrysanthemum expressing a linalool synthase gene ‘smells good’, but ‘tastes bad’to western flower thrips

    NARCIS (Netherlands)

    Ting Yang, Ting; Stoopen, G.M.; Thoen, H.P.M.; Wiegers, G.L.; Jongsma, M.A.


    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the

  15. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.


    obtained for csmA indicated that it had high similarity to class V chitin synthases. chsB and csmA disruption strains and a strain in which chsB transcription was controlled were constructed using the nitrite reductase (niiA) promoter. The strains were examined during hyphal growth by Northern analysis...

  16. Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays. (United States)

    Martin, Diane M; Aubourg, Sébastien; Schouwey, Marina B; Daviet, Laurent; Schalk, Michel; Toub, Omid; Lund, Steven T; Bohlmann, Jörg


    Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS) were predicted by in silico analysis of the grapevine (Vitis vinifera) genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information about gene structure and phylogeny for the entire currently

  17. Construction of a genomic DNA library with a TA vector and its application in cloning of the phytoene synthase gene from the cyanobacterium Spirulina platensis M-135 (United States)

    Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima


    An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.

  18. Characterization of splice variants of the genes encoding human mitochondrial HMG-CoA lyase and HMG-CoA synthase, the main enzymes of the ketogenesis pathway. (United States)

    Puisac, Beatriz; Ramos, Mónica; Arnedo, María; Menao, Sebastián; Gil-Rodríguez, María Concepción; Teresa-Rodrigo, María Esperanza; Pié, Angeles; de Karam, Juan Carlos; Wesselink, Jan-Jaap; Giménez, Ignacio; Ramos, Feliciano J; Casals, Nuria; Gómez-Puertas, Paulino; Hegardt, Fausto G; Pié, Juan


    The genes HMGCS2 and HMGCL encode the two main enzymes for ketone-body synthesis, mitochondrial HMG-CoA synthase and HMG-CoA lyase. Here, we identify and describe possible splice variants of these genes in human tissues. We detected an alternative transcript of HMGCS2 carrying a deletion of exon 4, and two alternative transcripts of HMGCL with deletions of exons 5 and 6, and exons 5, 6 and 7, respectively. All splice variants maintained the reading frame. However, Western blot studies and overexpression measurements in eukaryotic or prokaryotic cell models did not reveal HL or mHS protein variants. Both genes showed a similar distribution of the inactive variants in different tissues. Surprisingly, the highest percentages were found in tissues where almost no ketone bodies are synthesized: heart, skeletal muscle and brain. Our results suggest that alternative splicing might coordinately block the two main enzymes of ketogenesis in specific human tissues.

  19. Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants. (United States)

    Sanmiya, K; Iwasaki, T; Matsuoka, M; Miyao, M; Yamamoto, N


    A cDNA encoding farnesyl diphosphate synthase (FPPS), a key enzyme in isoprenoid biosynthesis, was isolated from a cDNA library constructed from mRNA that had been prepared from etiolated rice (Oriza sativa L. variety Nipponbare) seedlings after three hours of illumination by a subtraction method. The putative polypeptide deduced from the 1289 bp nucleotide sequence consisted of 353 amino acids and had a molecular mass of 40 676 Da. The predicted amino acid sequence exhibited high homology to those of FPPS from Arabidopsis (73% to type 1, 72% to type 2) and white lupin (74%). Southern blot analysis showed that the rice genome might contain only one gene for FPPS. The highest level of expression of the gene was demonstrated in leaves by RNA blot analysis. Moreover, light, in particular blue light, effectively enhanced expression of the gene.

  20. Chalcone synthase family genes have redundant roles in anthocyanin biosynthesis and in response to blue/UV-A light in turnip (Brassica rapa; Brassicaceae). (United States)

    Zhou, Bo; Wang, Yu; Zhan, Yaguang; Li, Yuhua; Kawabata, Saneyuki


    The epidermis of Brassica rapa (turnip) cv. Tsuda contains light-induced anthocyanins, visible signs of activity of chalcone synthase (CHS), a key anthocyanin biosynthetic enzyme, which is encoded by the CHS gene family. To elucidate the regulation of this light-induced pigmentation, we isolated Brassica rapa CHS1-CHS6 (BrCHS1-CHS6) and characterized their cis-elements and expression patterns. Epidermises of light-exposed swollen hypocotyls (ESHS) were harvested to analyze transcription levels of BrCHS genes by real-time PCR. Different promoters for the genes were inserted into tobacco to examine pCHS-GUS activity by histochemistry. Yeast-one-hybridization was used to detect binding activity of BrCHS motifs to transcription factors. Transcript levels of BrCHS1, -4, and -5 and anthocyanin-biosynthesis-related genes F3H, DFR, and ANS were high, while those of BrCHS2, -3, and -6 were almost undetectable in pigmented ESHS. However, in leaves, CHS5, F3H, and ANS expression was higher than in nonpigmented ESHS, but transcription of DFR was not detected. In the analysis of BrCHS1 and BrCHS3 promoter activity, GUS activity was strong in pigmented flowers of BrPCHS1-GUS-transformed tobacco plants, but nearly absent in BrPCHS3-GUS-transformed plants. Transcript levels of regulators, BrMYB75 and BrTT8, were strongly associated with the anthocyanin content and were light-induced. Coregulated cis-elements were found in promoters of BrCHS1,-4, and -5, and BrMYB75 and BrTT8 had high binding activities to the BrCHS Unit 1 motif. The chalcone synthase gene family encodes a redundant set of light-responsive, tissue-specific genes that are expressed at different levels and are involved in flavonoid biosynthesis in Tsuda turnip.

  1. Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene. (United States)

    Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji


    We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  2. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne


    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  3. Effects of point mutations in Plasmodium falciparum dihydrofolate reductase and dihydropterate synthase genes on clinical outcomes and in vitro susceptibility to sulfadoxine and pyrimethamine.

    Directory of Open Access Journals (Sweden)

    David J Bacon


    Full Text Available Sulfadoxine-pyrimethamine was a common first line drug therapy to treat uncomplicated falciparum malaria, but increasing therapeutic failures associated with the development of significant levels of resistance worldwide has prompted change to alternative treatment regimes in many national malaria control programs. METHODOLOGY AND FINDING: We conducted an in vivo therapeutic efficacy trial of sulfadoxine-pyrimethamine at two locations in the Peruvian Amazon enrolling 99 patients of which, 86 patients completed the protocol specified 28 day follow up. Our objective was to correlate the presence of polymorphisms in P. falciparum dihydrofolate reductase and dihydropteroate synthase to in vitro parasite susceptibility to sulfadoxine and pyrimethamine and to in vivo treatment outcomes. Inhibitory concentration 50 values of isolates increased with numbers of mutations (single [108N], sextuplet [BR/51I/108N/164L and 437G/581G] and septuplet (BR/51I/108N/164L and 437G/540E/581G with geometric means of 76 nM (35-166 nM, 582 nM (49-6890- nM and 4909 (3575-6741 nM nM for sulfadoxine and 33 nM (22-51 nM, 81 nM (19-345 nM, and 215 nM (176-262 nM for pyrimethamine. A single mutation present in the isolate obtained at the time of enrollment from either dihydrofolate reductase (164L or dihydropteroate synthase (540E predicted treatment failure as well as any other single gene alone or in combination. Patients with the dihydrofolate reductase 164L mutation were 3.6 times as likely to be treatment failures [failures 85.4% (164L vs 23.7% (I164; relative risk = 3.61; 95% CI: 2.14 - 6.64] while patients with the dihydropteroate synthase 540E were 2.6 times as likely to fail treatment (96.7% (540E vs 37.5% (K540; relative risk = 2.58; 95% CI: 1.88 - 3.73. Patients with both dihydrofolate reductase 164L and dihydropteroate synthase 540E mutations were 4.1 times as likely to be treatment failures [96.7% vs 23.7%; RR = 4.08; 95% CI: 2.45 - 7.46] compared to patients

  4. International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice. (United States)

    Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing


    One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.

  5. Bioengineering of the plant culture of Capsicum frutescens with vanillin synthase gene for the production of vanillin


    Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan


    Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...

  6. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe


    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  7. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, H.; Galili, G.; Sørensen, K.


    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...... as observed in T0 seeds. It is concluded that the aspartate family pathway may be genetically engineered by the introduction of genes coding for feed-back-insensitive enzymes, preferentially giving elevated levels of lysine and methionine....

  8. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model (United States)

    Ishida, Hiroshi; Ray, Radharaman; Amnuaysirikul, Jack; Ishida, Keiko; Ray, Prabhati


    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of NO on wound healing inhibited by SM in NHEKs. The effect of the iNOS gene transfer on iNOS protein expression and NO generation were monitored by Western blot and flow cytometry, respectively. Wound healing with or without the iNOS gene transfer after SM exposure was assessed by light and confocal microscopy. The iNOS gene transfer via adenovirus resulted in overexpression of the iNOS and an increase in NO production regardless of SM exposure in the NHEK model. The gene transfer was also effective in overcoming the inhibition of wound healing due to SM exposure leading to the promotion of wound closure. The findings in this study suggest that the iNOS gene transfer is a promising therapeutic strategy for SM-induced skin injury. PMID:23762631

  9. Alteration of flower color in Iris germanica L. 'Fire Bride' through ectopic expression of phytoene synthase gene (crtB) from Pantoea agglomerans. (United States)

    Jeknić, Zoran; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H H


    Genetic modulation of the carotenogenesis in I. germanica 'Fire Bride' by ectopic expression of a crtB gene causes several flower parts to develop novel orange and pink colors. Flower color in tall bearded irises (Iris germanica L.) is determined by two distinct biochemical pathways; the carotenoid pathway, which imparts yellow, orange and pink hues and the anthocyanin pathway, which produces blue, violet and maroon flowers. Red-flowered I. germanica do not exist in nature and conventional breeding methods have thus far failed to produce them. With a goal of developing iris cultivars with red flowers, we transformed a pink iris I. germanica, 'Fire Bride', with a bacterial phytoene synthase gene (crtB) from Pantoea agglomerans under the control of the promoter region of a gene for capsanthin-capsorubin synthase from Lilium lancifolium (Llccs). This approach aimed to increase the flux of metabolites into the carotenoid biosynthetic pathway and lead to elevated levels of lycopene and darker pink or red flowers. Iris callus tissue ectopically expressing the crtB gene exhibited a color change from yellow to pink-orange and red, due to accumulation of lycopene. Transgenic iris plants, regenerated from the crtB-transgenic calli, showed prominent color changes in the ovaries (green to orange), flower stalk (green to orange), and anthers (white to pink), while the standards and falls showed no significant differences in color when compared to control plants. HPLC and UHPLC analysis confirmed that the color changes were primarily due to the accumulation of lycopene. In this study, we showed that ectopic expression of a crtB can be used to successfully alter the color of certain flower parts in I. germanica 'Fire Bride' and produce new flower traits.

  10. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’) (United States)

    Chen, Tony H.H.


    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription–PCR (RT–PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography–tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species. PMID:23008421

  11. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine. (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping


    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  12. Chiral hydroxylation at the mononuclear nonheme Fe(II center of 4-(S hydroxymandelate synthase--a structure-activity relationship analysis.

    Directory of Open Access Journals (Sweden)

    Cristiana M L Di Giuro

    Full Text Available (S-Hydroxymandelate synthase (Hms is a nonheme Fe(II dependent dioxygenase that catalyzes the oxidation of 4-hydroxyphenylpyruvate to (S-4-hydroxymandelate by molecular oxygen. In this work, the substrate promiscuity of Hms is characterized in order to assess its potential for the biosynthesis of chiral α-hydroxy acids. Enzyme kinetic analyses, the characterization of product spectra, quantitative structure activity relationship (QSAR analyses and in silico docking studies are used to characterize the impact of substrate properties on particular steps of catalysis. Hms is found to accept a range of α-oxo acids, whereby the presence of an aromatic substituent is crucial for efficient substrate turnover. A hydrophobic substrate binding pocket is identified as the likely determinant of substrate specificity. Upon introduction of a steric barrier, which is suspected to obstruct the accommodation of the aromatic ring in the hydrophobic pocket during the final hydroxylation step, the racemization of product is obtained. A steady state kinetic analysis reveals that the turnover number of Hms strongly correlates with substrate hydrophobicity. The analysis of product spectra demonstrates high regioselectivity of oxygenation and a strong coupling efficiency of C-C bond cleavage and subsequent hydroxylation for the tested substrates. Based on these findings the structural basis of enantioselectivity and enzymatic activity is discussed.

  13. Association of endothelial nitric oxide synthase gene polymorphism with the risk of Henoch-Schönlein purpura/Henoch-Schönlein purpura nephritis. (United States)

    Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei


    Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.

  14. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae). (United States)

    Xiong, Ke-Cai; Wang, Jia; Li, Jia-Hao; Deng, Yu-Qing; Pu, Po; Fan, Huan; Liu, Ying-Hong


    Trehalose is the major blood sugar in insects, which plays a crucial role as an instant source of energy and the starting substrate for chitin biosynthesis. In insects, trehalose is synthesized by catalysis of an important enzyme, trehalose-6-phosphate synthase (TPS). In the present study, a trehalose-6-phosphate synthase gene from Bactrocera minax (BmTPS) was cloned and characterized. BmTPS contained an open reading frame of 2445 nucleotides encoding a protein of 814 amino acids with a predicted molecular weight of 92.05kDa. BmTPS was detectable in all developmental stages of Bactrocera minax and expressed higher in the final- (third-) instar larvae. Tissue-specific expression patterns of BmTPS showed that it was mainly expressed in the fat body. The 20-hydroxyecdysone (20E) induced the expression of BmTPS and three genes in the chitin biosynthesis pathway. Moreover, injection of double-stranded RNA into third-instar larvae successfully silenced the transcription of BmTPS in B. minax, and thereby decreased the activity of TPS and trehalose content. Additionally, silencing of BmTPS inhibited the expression of three key genes in the chitin biosynthesis pathway and exhibited 52% death and abnormal phenotypes. The findings demonstrate that BmTPS is indispensable for larval-pupal metamorphosis. Besides, the establishment of RNAi experimental system in B. minax would lay a solid foundation for further investigation of molecular biology and physiology of this pest. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Disruption of the Bcchs3a chitin synthase gene in Botrytis cinerea is responsible for altered adhesion and overstimulation of host plant immunity. (United States)

    Arbelet, Delphine; Malfatti, Pierrette; Simond-Côte, Elizabeth; Fontaine, Thierry; Desquilbet, Loïc; Expert, Dominique; Kunz, Caroline; Soulié, Marie-Christine


    The fungal cell wall is a dynamic structure that protects the cell from different environmental stresses suggesting that wall synthesizing enzymes are of great importance for fungal virulence. Previously, we reported the isolation and characterization of a mutant in class III chitin synthase, Bcchs3a, in the phytopathogenic fungus Botrytis cinerea. We demonstrated that virulence of this mutant is severely impaired. Here, we describe the virulence phenotype of the cell-wall mutant Bcchs3a on the model plant Arabidopsis thaliana and analyze its virulence properties, using a variety of A. thaliana mutants. We found that mutant Bcchs3a is virulent on pad2 and pad3 mutant leaves defective in camalexin. Mutant Bcchs3a was not more susceptible towards camalexin than the wild-type strain but induced phytoalexin accumulation at the infection site on Col-0 plants. Moreover, this increase in camalexin was correlated with overexpression of the PAD3 gene observed as early as 18 h postinoculation. The infection process of the mutant mycelium was always delayed by 48 h, even on pad3 plants, probably because of lack of mycelium adhesion. No loss in virulence was found when Bcchs3a conidia were used as the inoculum source. Collectively, these data led us to assign a critical role to the BcCHS3a chitin synthase isoform, both in fungal virulence and plant defense response.

  16. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Kang-Kang Xu


    Full Text Available Chitin synthase (CHS, a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2 was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  17. Sequence analysis and structure prediction of type II Pseudomonas sp. USM 4–55 PHA synthase and an insight into its catalytic mechanism

    Directory of Open Access Journals (Sweden)

    Ahmad Khairudin Nurul


    Full Text Available Abstract Background Polyhydroxyalkanoates (PHA, are biodegradable polyesters derived from many microorganisms such as the pseudomonads. These polyesters are in great demand especially in the packaging industries, the medical line as well as the paint industries. The enzyme responsible in catalyzing the formation of PHA is PHA synthase. Due to the limited structural information, its functional properties including catalysis are lacking. Therefore, this study seeks to investigate the structural properties as well as its catalytic mechanism by predicting the three-dimensional (3D model of the Type II Pseudomonas sp. USM 4–55 PHA synthase 1 (PhaC1P.sp USM 4–55. Results Sequence analysis demonstrated that PhaC1P.sp USM 4–55 lacked similarity with all known structures in databases. PSI-BLAST and HMM Superfamily analyses demonstrated that this enzyme belongs to the alpha/beta hydrolase fold family. Threading approach revealed that the most suitable template to use was the human gastric lipase (PDB ID: 1HLG. The superimposition of the predicted PhaC1P.sp USM 4–55 model with 1HLG covering 86.2% of the backbone atoms showed an RMSD of 1.15 Å. The catalytic residues comprising of Cys296, Asp451 and His479 were found to be conserved and located adjacent to each other. In addition to this, an extension to the catalytic mechanism was also proposed whereby two tetrahedral intermediates were believed to form during the PHA biosynthesis. These transition state intermediates were further postulated to be stabilized by the formation of oxyanion holes. Based on the sequence analysis and the deduced model, Ser297 was postulated to contribute to the formation of the oxyanion hole. Conclusion The 3D model of the core region of PhaC1P.sp USM 4–55 from residue 267 to residue 484 was developed using computational techniques and the locations of the catalytic residues were identified. Results from this study for the first time highlighted Ser297 potentially

  18. Structure and expression profile of the sucrose synthase gene family in the rubber tree: indicative of roles in stress response and sucrose utilization in the laticifers. (United States)

    Xiao, Xiaohu; Tang, Chaorong; Fang, Yongjun; Yang, Meng; Zhou, Binhui; Qi, Jiyan; Zhang, Yi


    Sucrose synthase (Sus, EC is widely recognized as a key enzyme in sucrose metabolism in plants. However, nothing is known about this gene family in Hevea brasiliensis (para rubber tree). Here, we identified six Sus genes in H. brasiliensis that comprise the entire Sus family in this species. Analysis of the gene structure and phylogeny of the Sus genes demonstrates evolutionary conservation in the Sus families across Hevea and other plant species. The expression of Sus genes was investigated via Solexa sequencing and quantitative PCR in various tissues, at various phases of leaf development, and under abiotic stresses and ethylene treatment. The Sus genes exhibited distinct but partially redundant expression profiles. Each tissue has one abundant Sus isoform, with HbSus3, 4 and 5 being the predominant isoforms in latex (cytoplasm of rubber-producing laticifers), bark and root, respectively. HbSus1 and 6 were barely expressed in any tissue examined. In mature leaves (source), all HbSus genes were expressed at low levels, but HbSus3 and 4 were abundantly expressed in immature leaves (sink). Low temperature and drought treatments conspicuously induced HbSus5 expression in root and leaf, suggesting a role in stress responses. HbSus2 and 3 transcripts were decreased by ethylene treatment, consistent with the reduced sucrose-synthesizing activity of Sus enzymes in the latex in response to ethylene stimulation. Our results are beneficial to further determination of functions for the Sus genes in Hevea trees, especially roles in regulating latex regeneration. © 2013 FEBS.

  19. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    Directory of Open Access Journals (Sweden)

    Toub Omid


    Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information

  20. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    International Nuclear Information System (INIS)

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand


    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

  1. A soluble starch synthase I gene, IbSSI, alters the content, composition, granule size and structure of starch in transgenic sweet potato. (United States)

    Wang, Yannan; Li, Yan; Zhang, Huan; Zhai, Hong; Liu, Qingchang; He, Shaozhen


    Soluble starch synthase I (SSI) is a key enzyme in the biosynthesis of plant amylopectin. In this study, the gene named IbSSI, was cloned from sweet potato, an important starch crop. A high expression level of IbSSI was detected in the leaves and storage roots of the sweet potato. Its overexpression significantly increased the content and granule size of starch and the proportion of amylopectin by up-regulating starch biosynthetic genes in the transgenic plants compared with wild-type plants (WT) and RNA interference plants. The frequency of chains with degree of polymerization (DP) 5-8 decreased in the amylopectin fraction of starch, whereas the proportion of chains with DP 9-25 increased in the IbSSI-overexpressing plants compared with WT plants. Further analysis demonstrated that IbSSI was responsible for the synthesis of chains with DP ranging from 9 to 17, which represents a different chain length spectrum in vivo from its counterparts in rice and wheat. These findings suggest that the IbSSI gene plays important roles in determining the content, composition, granule size and structure of starch in sweet potato. This gene may be utilized to improve the content and quality of starch in sweet potato and other plants.

  2. Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells. (United States)

    Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J


    The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts. (United States)

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso


    Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. © 2013 The Authors. Environmental Microbiology Reports published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  4. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞ (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook


    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  5. Arabidopsis thaliana sucrose phosphate synthase (sps) genes are expressed differentially in organs and tissues, and their transcription is regulated by osmotic stress. (United States)

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel


    Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Ambient pH controls glycogen levels by regulating glycogen synthase gene expression in Neurospora crassa. New insights into the pH signaling pathway. (United States)

    Cupertino, Fernanda Barbosa; Freitas, Fernanda Zanolli; de Paula, Renato Magalhães; Bertolini, Maria Célia


    Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn) in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacC(KO) strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8). These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa.

  7. Ambient pH controls glycogen levels by regulating glycogen synthase gene expression in Neurospora crassa. New insights into the pH signaling pathway.

    Directory of Open Access Journals (Sweden)

    Fernanda Barbosa Cupertino

    Full Text Available Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacC(KO strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8. These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa.

  8. Haplotype association and synergistic effect of human aldosterone synthase (CYP11B2) gene polymorphisms causing susceptibility to essential hypertension in Indian patients. (United States)

    Vamsi, Uppuluri Mohana; Swapna, Nagalingam; Padma, Gunda; Vishnupriya, Satti; Padma, Tirunilai

    Aldosterone synthase (CYP11B2) is a key enzyme involved in the terminal steps of aldosterone biosynthesis. Genetic variability in CYP11B2 gene has been associated with heterogeneous aldosterone production, which can affect sodium homeostasis and thereby regulation of blood pressure. Hence, the present study was aimed to explore the single-locus variations, haplotype and epistasis patterns of CYP11B2 (C-344T, intron-2 gene conversion and Lys173Arg) gene polymorphisms, and the risk contributed by them to the development of essential hypertension (EHT). A total of 279 hypertensive patients and 200 normotensive controls were enrolled in this study. C-344T and Lys173Arg polymorphisms of CYP11B2 gene were genotyped by PCR-RFLP method and intron-2 gene conversion (IC) polymorphism by allele-specific PCR analysis. Single-locus analysis revealed significant association of CYP11B2 C-344T and Lys173Arg polymorphisms with EHT (p < 0.05). Considering the sexes, Lys173 allele was found to be at risk for hypertension in males (OR 1.40; 95% CI = 1.01-1.96). Unphased haplotype analysis revealed H1 (T-Conv-Lys; p = 0.0017) to have significant risk for EHT, while haplotype H4 (T-Wt-Arg) had a significant protective effect. Multifactor dimensionality reduction (MDR) interaction analysis found the overall best model with C-344T and IC polymorphisms exhibiting strong synergistic effect. The present study revealed a strong synergistic effect of CYP11B2 C-344T and IC polymorphisms causing susceptibility to EHT and haplotype H1 (-344T-Conv-Lys173) as the risk-conferring factor for hypertension predisposition.

  9. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases. (United States)

    Diler, S B; Öden, A


    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  10. miR-71 and miR-263 Jointly Regulate Target Genes Chitin synthase and Chitinase to Control Locust Molting. (United States)

    Yang, Meiling; Wang, Yanli; Jiang, Feng; Song, Tianqi; Wang, Huimin; Liu, Qing; Zhang, Jie; Zhang, Jianzhen; Kang, Le


    Chitin synthase and chitinase play crucial roles in chitin biosynthesis and degradation during insect molting. Silencing of Dicer-1 results in reduced levels of mature miRNAs and severely blocks molting in the migratory locust. However, the regulatory mechanism of miRNAs in the molting process of locusts has remained elusive. In this study, we found that in chitin metabolism, two crucial enzymes, chitin synthase (CHS) and chitinase (CHT) were regulated by miR-71 and miR-263 during nymph molting. The coding sequence of CHS1 and the 3'-untranslated region of CHT10 contain functional binding sites for miR-71 and miR-263, respectively. miR-71/miR-263 displayed cellular co-localization with their target genes in epidermal cells and directly interacted with CHS1 and CHT10 in the locust integument, respectively. Injections of miR-71 and miR-263 agomirs suppressed the expression of CHS1 and CHT10, which consequently altered chitin production of new and old cuticles and resulted in a molting-defective phenotype in locusts. Unexpectedly, reduced expression of miR-71 and miR-263 increased CHS1 and CHT10 mRNA expression and led to molting defects similar to those induced by miRNA delivery. This study reveals a novel function and balancing modulation pattern of two miRNAs in chitin biosynthesis and degradation, and it provides insight into the underlying molecular mechanisms of the molting process in locusts.

  11. Analysis of cellulose synthase genes from domesticated apple identifies collinear genes WDR53 and CesA8A: partial co-expression, bicistronic mRNA, and alternative splicing of CESA8A. (United States)

    Guerriero, Gea; Spadiut, Oliver; Kerschbamer, Christine; Giorno, Filomena; Baric, Sanja; Ezcurra, Inés


    Cellulose synthase (CesA) genes constitute a complex multigene family with six major phylogenetic clades in angiosperms. The recently sequenced genome of domestic apple, Malus×domestica, was mined for CesA genes, by blasting full-length cellulose synthase protein (CESA) sequences annotated in the apple genome against protein databases from the plant models Arabidopsis thaliana and Populus trichocarpa. Thirteen genes belonging to the six angiosperm CesA clades and coding for proteins with conserved residues typical of processive glycosyltransferases from family 2 were detected. Based on their phylogenetic relationship to Arabidopsis CESAs, as well as expression patterns, a nomenclature is proposed to facilitate further studies. Examination of their genomic organization revealed that MdCesA8-A is closely linked and co-oriented with WDR53, a gene coding for a WD40 repeat protein. The WDR53 and CesA8 genes display conserved collinearity in dicots and are partially co-expressed in the apple xylem. Interestingly, the presence of a bicistronic WDR53-CesA8A transcript was detected in phytoplasma-infected phloem tissues of apple. The bicistronic transcript contains a spliced intergenic sequence that is predicted to fold into hairpin structures typical of internal ribosome entry sites, suggesting its potential cap-independent translation. Surprisingly, the CesA8A cistron is alternatively spliced and lacks the zinc-binding domain. The possible roles of WDR53 and the alternatively spliced CESA8 variant during cellulose biosynthesis in M.×domestica are discussed.

  12. Endogenous post-transcriptional gene silencing of flavone synthase resulting in high accumulation of anthocyanins in black dahlia cultivars. (United States)

    Deguchi, Ayumi; Ohno, Sho; Hosokawa, Munetaka; Tatsuzawa, Fumi; Doi, Motoaki


    Black color in flowers is a highly attractive trait in the floricultural industry, but its underlying mechanisms are largely unknown. This study was performed to identify the bases of the high accumulation of anthocyanidins in black cultivars and to determine whether the high accumulation of total anthocyanidins alone leads to the black appearance. Our approach was to compare black dahlia (Dahlia variabilis) cultivars with purple cultivars and a purple flowering mutant of a black cultivar, using pigment and molecular analyses. Black cultivars characteristically exhibited low lightness, high petal accumulation of cyanidin and total anthocyanidins without flavones, and marked suppression of flavone synthase (DvFNS) expression. A comparative study using black and purple cultivars revealed that neither the absence of flavones nor high accumulation of total anthocyanidins is solely sufficient for black appearance, but that cyanidin content in petals is also an important factor in the phenotype. A study comparing the black cultivar 'Kokucho' and its purple mutant showed that suppression of DvFNS abolishes the competition between anthocyanidin and flavone synthesis and leads to accumulation of cyanidin and total anthocyanidins that produce a black appearance. Surprisingly, in black cultivars the suppression of DvFNS occurred in a post-transcriptional manner, as determined by small RNA mapping.

  13. Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using real-time PCR

    International Nuclear Information System (INIS)

    Atoui, A.; Mathieu, F.; Lebrihi, A.


    Aspergillus carbonarius is an ochratoxin producing fungus that has been considered to be responsible of the ochratoxin A (OTA) contamination in grapes and wine. In order to monitor and quantify A. carbonarius, a specific primer pair Ac12RL O TAF/Ac12RL O TAR has been designed from the acyltransferase (AT) domain of the polyketide synthase sequence Ac12RL3 to amplify 141 bp PCR product. Among the mycotoxigenic fungi tested, only A. carbonarius gave a positive result. This specific primer pair was also successfully employed in real-time PCR conjugated with SYBR Green I dye for the direct quantification of this fungus in grape samples. A positive correlation (R2 = 0.81) was found between A. carbonarius DNA content and OTA concentration in 72 grape samples, allowing for the estimation of the potential risk from OTA contamination. Consequently, this work offers a quick alternative to conventional methods of OTA quantification and mycological detection and quantification of A. carbonarius in grapes. (author)

  14. Forest tent caterpillars (Malacosoma disstria) induce local and systemic diurnal emissions of terpenoid volatiles in hybrid poplar (Populus trichocarpa x deltoides): cDNA cloning, functional characterization, and patterns of gene expression of (-)-germacrene D synthase, PtdTPS1. (United States)

    Arimura, Gen-Ichiro; Huber, Dezene P W; Bohlmann, Jörg


    Feeding forest tent caterpillars (FTCs) induced local and systemic diurnal emissions of (-)-germacrene D, along with (E)-beta-ocimene, linalool, (E)-4,8-dimethyl-1,3,7-nonatriene (DMNT), benzene cyanide, and (E,E)-alpha-farnesene, from leaves of hybrid poplar. FTC feeding induced substantially higher levels of volatiles in local and systemic leaves than did mechanical wounding. A full-length poplar sesquiterpene synthase cDNA (PtdTPS1) was isolated and functionally identified as (-)-germacrene D synthase. Expression of PtdTPS1, expression of genes of early, intermediate and late steps in terpenoid biosynthesis, and expression of a lipoxygenase gene (PtdLOX1) were analyzed in local FTC-infested and systemic leaves. Transcript levels of PtdTPS1 and PtdLOX1 were strongly increased in response to herbivory. PtdTPS1 was also induced by mechanical wounding or by methyl jasmonate (MeJA) treatment. FTC feeding did not affect transcript levels of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), 1-deoxy-d-xylulose 5-phosphate reductoisomerase (DXR), and isoprene synthase (IPS). Two other TPS genes, PtdTPS2 and PtTPS3, and farnesyl diphosphate synthase were only very transiently induced. These results illustrate differential expression of terpenoid pathway genes in response to insect feeding and a key function of (-)-germacrene D synthase PtdTPS1 for herbivore-induced local and systemic volatile emissions in hybrid poplar. FTC-induced transcripts of PtdTPS1 followed diurnal rhythm. Spatial patterns of FTC-induced PtdTPS1 transcript accumulation revealed acropetal but not basipetal direction of the systemic response. Implications for tritrophic poplar-FTC-predator/parasitoid interactions are discussed.

  15. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile. (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang


    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  16. Distinct UV-B and UV-A/blue light signal transduction pathways induce chalcone synthase gene expression in Arabidopsis cells

    International Nuclear Information System (INIS)

    Christie, J.M.; Jenkins, G.I.


    UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species

  17. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis. (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du


    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  18. Functional and Evolutionary Characterization of a UDP-Xylose Synthase Gene from the Plant Pathogen Xylella fastidiosa, Involved in the Synthesis of Bacterial Lipopolysaccharide. (United States)

    Alencar, Valquíria Campos; Jabes, Daniela Leite; Menegidio, Fabiano Bezerra; Sassaki, Guilherme Lanzi; de Souza, Lucas Rodrigo; Puzer, Luciano; Meneghetti, Maria Cecília Zorél; Lima, Marcelo Andrade; Tersariol, Ivarne Luis Dos Santos; de Oliveira, Regina Costa; Nunes, Luiz R


    Xylella fastidiosa is a plant-infecting bacillus, responsible for many important crop diseases, such as Pierce's disease of vineyards, citrus variegated chlorosis, and coffee leaf scorch (CLS), among others. Recent genomic comparisons involving two CLS-related strains, belonging to X. fastidiosa subsp. pauca, revealed that one of them carries a frameshift mutation that inactivates a gene encoding an oxidoreductase of the short-chain dehydrogenase/reductase (SDR) superfamily, which may play important roles in determining structural variations in bacterial glycans and glycoconjugates. However, the exact nature of this SDR has been a matter of controversy, as different annotations of X. fastidiosa genomes have implicated it in distinct reactions. To confirm the nature of this mutated SDR, a comparative analysis was initially performed, suggesting that it belongs to a subgroup of SDR decarboxylases, representing a UDP-xylose synthase (Uxs). Functional assays, using a recombinant derivative of this enzyme, confirmed its nature as XfUxs, and carbohydrate composition analyses, performed with lipopolysaccharide (LPS) molecules obtained from different strains, indicate that inactivation of the X. fastidiosa uxs gene affects the LPS structure among CLS-related X. fastidiosa strains. Finally, a comparative sequence analysis suggests that this mutation is likely to result in a morphological and evolutionary hallmark that differentiates two subgroups of CLS-related strains, which may influence interactions between these bacteria and their plant and/or insect hosts.

  19. Chitinase-like (CTL and cellulose synthase (CESA gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L. bast fibers.

    Directory of Open Access Journals (Sweden)

    Natalia Mokshina

    Full Text Available Plant chitinases (EC and chitinase-like (CTL proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs, belonging to glycoside hydrolase family 19 (GH19. Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21 that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8 was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2 that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type cellulosic walls.

  20. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin. (United States)

    Kumar-Roiné, Shilpa; Matsui, Mariko; Chinain, Mireille; Laurent, Dominique; Pauillac, Serge


    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was quantified via Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR). P-CTX-1B caused a concentration- and time-dependent induction of iNOS in RAW 264.7 cells but not in Neuro-2a cells. NO production was evidenced by increased nitrite levels in the 10 microM range after 48 h of RAW 264.7 cells exposure to LPS and P-CTX-1B (0.05 microg/ml and 6 nM, respectively). The expression of iNOS mRNA peaked at 8h for LPS then gradually decreased to low level at 48 h. In contrast, a sustained level was recorded with P-CTX-1B in the 8-48 h time interval. The addition of N(omega)-nitro-L-arginine methyl ester (L-NAME), a stereoselective NOS inhibitor, strongly diminished NO formation but had no effect on iNOS mRNA synthesis. The implication of NO in CFP paves the way for new therapies for both western and traditional medicines.

  1. A cII-dependent promoter is located within the Q gene of bacteriophage lambda.


    Hoopes, B C; McClure, W R


    We have found a cII-dependent promoter, PaQ, within the Q gene of bacteriophage lambda. Transcription experiments and abortive initiation assays performed in vitro showed that the promoter strength and the cII affinity of PaQ were comparable to the other cII-dependent lambda promoters, PE and PI. The location and leftward direction of PaQ suggests a possible role in the delay of lambda late-gene expression by cII protein, a phenomenon that has been called cII-dependent inhibition. We have con...

  2. Identification and characterization of the human type II collagen gene (COL2A1).


    Cheah, Kathryn; Stoker, N.G.; Griffin, J.R.; Grosveld, Frank; Solomon, E.


    textabstractThe gene contained in the human cosmid clone CosHcol1, previously designated an alpha 1(I) collagen-like gene, has now been identified. CosHcol1 hybridizes strongly to a single 5.9-kilobase mRNA species present only in tissue in which type II collagen is expressed. DNA sequence analysis shows that this clone is highly homologous to the chicken alpha 1(II) collagen gene. These data together suggest that CosHcol1 contains the human alpha 1(II) collagen gene COL2A1. The clone appears...

  3. Regulated gene expression in cultured type II cells of adult human lung


    Ballard, Philip L.; Lee, Jae W.; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R.; Fischer, Horst; Illek, Beate; Gonzales, Linda W.; Kolla, Venkatadri; Matthay, Michael A.


    Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at ∼95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days...

  4. 4G/5G variant of plasminogen activator inhibitor-1 gene and severe pregnancy-induced hypertension: subgroup analyses of variants of angiotensinogen and endothelial nitric oxide synthase. (United States)

    Kobashi, Gen; Ohta, Kaori; Yamada, Hideto; Hata, Akira; Minakami, Hisanori; Sakuragi, Noriaki; Tamashiro, Hiko; Fujimoto, Seiichiro


    Pregnancy-induced hypertension (PIH) is a common cause of perinatal mortality. It is believed to result from the interaction of several factors, including those related to the blood coagulation system. We performed genotyping and subgroup analyses to determine if the 4G/5G genotypes of the plasminogen activator inhibitor-1 gene (PAI-1) play a role in the pathogenesis of PIH, and to evaluate possible interactions of the PAI-1 polymorphisms with those of the angiotensinogen gene (AGT) and the endothelial nitric oxide synthase gene (NOS3). An association study of PAI-1 polymorphism, and subgroup analyses of common variants of AGT and NOS3, among 128 patients with PIH and 376 healthy pregnant controls. No significant differences were found between the cases and controls in the frequencies of allele 4G or the 4G/4G genotype. In subgroup analyses, after adjustment for multiple comparison, a significant association with the AGT TT genotype was found among women with the PAI-1 4G/4G genotype, and an association with the NOS3 GA+AA genotype was found among women with the 5G/5G or 4G/5G genotypes. Our findings suggest that there are at least 2 pathways in the pathogenesis of severe PIH. However, with respect to early prediction and prevention of severe PIH, although the PAI-1 4G/4G genotype alone was not a risk factor for severe PIH, the fact that PAI-1 genotypes are associated with varying risks for severe PIH suggests that PAI-1 genotyping of pregnant women, in combination with other tests, may be useful in the development of individualized measures that may prevent severe PIH.

  5. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin. (United States)

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova


    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  6. A multilevel prediction of physiological response to challenge: Interactions among child maltreatment, neighborhood crime, endothelial nitric oxide synthase gene (eNOS), and GABA(A) receptor subunit alpha-6 gene (GABRA6). (United States)

    Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante


    Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.

  7. Implications of secondary structure prediction and amino acid sequence comparison of class I and class II phosphoribosyl diphosphate synthases on catalysis, regulation, and quaternary structure

    DEFF Research Database (Denmark)

    Krath, B N; Hove-Jensen, B


    Spinach 5-phospho-D-ribosyl alpha-1-diphosphate (PRPP) synthase isozyme 4 was synthesized in Escherichia coli and purified to near homogeneity. The activity of the enzyme is independent of P(i); it is inhibited by ADP in a competitive manner, indicating a lack of an allosteric site; and it accepts...

  8. Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases. (United States)

    Cheng, Jiujun; Charles, Trevor C


    Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

  9. Elevated gene expression in chalcone synthase enzyme suggests an increased production of flavonoids in skin and synchronized red cell cultures of North American native grape berries. (United States)

    Davis, Gina; Ananga, Anthony; Krastanova, Stoyanka; Sutton, Safira; Ochieng, Joel W; Leong, Stephen; Tsolova, Violetka


    Anthocyanins are antioxidants and are among the natural products synthesized via the flavonoid biosynthesis pathway. Anthocyanins have been recommended for dietary intake in the prevention of cardiovascular diseases, cancer, and age-related conditions such as Alzheimer's disease or dementia. With an increasingly aging population in many parts of the world, strategies for the commercial production of in vitro synchronized red cell cultures as natural antioxidants will be a significant contribution to human medicine. Red pigmented fruits such as grapes (Vitis sp.) are a major source of bioavailable anthocyanins and other polyphenols. Since the level of antioxidants varies among cultivars, this study is the first one that phytochemically and genetically characterizes native grape cultivars of North America to determine the optimal cultivar and berry cells for the production of anthocyanins as antioxidants. Using real-time PCR and bioinformatics approaches, we tested for the transcript expression of the chalcone synthase (CHS) gene, an enzyme involved in the flavonoid and anthocyanin biosynthesis pathway, in different parts of physiologically mature grape berries and in vitro synchronized red cells. A low level of expression was recorded in berry flesh, compared with an elevated expression in berry skins and in vitro synchronized red cells, suggesting increased production of flavonoids in skin and cell cultures. This preliminary study demonstrates the potential of functional genomics in natural products research as well as in systematic studies of North American native grapes, specifically in muscadine (Vitis rotundifolia).

  10. Association of Glu298Asp Polymorphism of Endothelial NO Synthase Gene with Metabolic Syndrome Development: a Pilot Study. (United States)

    Fattakhov, N S; Skuratovskaya, D A; Vasilenko, M A; Kirienkova, E V; Zatolokin, P A; Mironyuk, N I; Litvinova, L S


    We studied association of single nucleotide polymorphism Glu298Asp (rs1799983) of the NOS3 gene with the risk of metabolic syndrome in the Slavic population. Blood samples were obtained from 128 patients with metabolic syndrome and 100 healthy individuals. Polymorphism Glu298Asp of the NOS3 gene was genotyped by allele-specific PCR. Allele Asp (OR=1.95, 95%CI 1.29-2.95, p=0.007) and genotype Asp/Asp (OR=2.56, 95%CI 0.98-6.72, p=0.04) were associated with the risk of metabolic syndrome in Slavic population. Patients with metabolic syndrome carrying genotype Asp/Asp had higher serum endothelin-1 level in comparison with Glu/Asp and Glu/Glu carriers.

  11. Angiotensin II type 1 receptor (A1166C) gene polymorphism in ...

    African Journals Online (AJOL)

    Abstract. Background: Genetic variability in the genes of different components of renin-angiotensin system (RAS) is likely to contribute for its heterogenous association in renal diseased patients. Among the candidate genes of RAS, angiotensin II type 1 receptor gene polymorphism (AT1R A1166C) seems to be particularly ...

  12. Angiotensin II type 1 receptor (A1166C) gene polymorphism in ...

    African Journals Online (AJOL)

    H. El-banawy


    Jan 5, 2015 ... Abstract Background: Genetic variability in the genes of different components of renin-angioten- sin system (RAS) is likely to contribute for its heterogenous association in renal diseased patients. Among the candidate genes of RAS, angiotensin II type 1 receptor gene polymorphism (AT1R. A1166C) seems ...

  13. Novel Structural and Functional Motifs in cellulose synthase (CesA Genes of Bread Wheat (Triticum aestivum, L..

    Directory of Open Access Journals (Sweden)

    Simerjeet Kaur

    Full Text Available Cellulose is the primary determinant of mechanical strength in plant tissues. Late-season lodging is inversely related to the amount of cellulose in a unit length of the stem. Wheat is the most widely grown of all the crops globally, yet information on its CesA gene family is limited. We have identified 22 CesA genes from bread wheat, which include homoeologs from each of the three genomes, and named them as TaCesAXA, TaCesAXB or TaCesAXD, where X denotes the gene number and the last suffix stands for the respective genome. Sequence analyses of the CESA proteins from wheat and their orthologs from barley, maize, rice, and several dicot species (Arabidopsis, beet, cotton, poplar, potato, rose gum and soybean revealed motifs unique to monocots (Poales or dicots. Novel structural motifs CQIC and SVICEXWFA were identified, which distinguished the CESAs involved in the formation of primary and secondary cell wall (PCW and SCW in all the species. We also identified several new motifs specific to monocots or dicots. The conserved motifs identified in this study possibly play functional roles specific to PCW or SCW formation. The new insights from this study advance our knowledge about the structure, function and evolution of the CesA family in plants in general and wheat in particular. This information will be useful in improving culm strength to reduce lodging or alter wall composition to improve biofuel production.

  14. The Aspergillus flavus Spermidine Synthase (spds Gene, Is Required for Normal Development, Aflatoxin Production, and Pathogenesis During Infection of Maize Kernels

    Directory of Open Access Journals (Sweden)

    Rajtilak Majumdar


    Full Text Available Aspergillus flavus is a soil-borne saprophyte and an opportunistic pathogen of both humans and plants. This fungus not only causes disease in important food and feed crops such as maize, peanut, cottonseed, and tree nuts but also produces the toxic and carcinogenic secondary metabolites (SMs known as aflatoxins. Polyamines (PAs are ubiquitous polycations that influence normal growth, development, and stress responses in living organisms and have been shown to play a significant role in fungal pathogenesis. Biosynthesis of spermidine (Spd is critical for cell growth as it is required for hypusination-mediated activation of eukaryotic translation initiation factor 5A (eIF5A, and other biochemical functions. The tri-amine Spd is synthesized from the diamine putrescine (Put by the enzyme spermidine synthase (Spds. Inactivation of spds resulted in a total loss of growth and sporulation in vitro which could be partially restored by addition of exogenous Spd. Complementation of the Δspds mutant with a wild type (WT A. flavus spds gene restored the WT phenotype. In WT A. flavus, exogenous supply of Spd (in vitro significantly increased the production of sclerotia and SMs. Infection of maize kernels with the Δspds mutant resulted in a significant reduction in fungal growth, sporulation, and aflatoxin production compared to controls. Quantitative PCR of Δspds mutant infected seeds showed down-regulation of aflatoxin biosynthetic genes in the mutant compared to WT A. flavus infected seeds. Expression analyses of PA metabolism/transport genes during A. flavus-maize interaction showed significant increase in the expression of arginine decarboxylase (Adc and S-adenosylmethionine decarboxylase (Samdc genes in the maize host and PA uptake transporters in the fungus. The results presented here demonstrate that Spd biosynthesis is critical for normal development and pathogenesis of A. flavus and pre-treatment of a Δspds mutant with Spd or Spd uptake from the

  15. Deep sequencing uncovers commonality in small RNA profiles between transgene-induced and naturally occurring RNA silencing of chalcone synthase-A gene in petunia (United States)


    Background Introduction of a transgene that transcribes RNA homologous to an endogenous gene in the plant genome can induce silencing of both genes, a phenomenon termed cosuppression. Cosuppression was first discovered in transgenic petunia plants transformed with the CHS-A gene encoding chalcone synthase, in which nonpigmented sectors in flowers or completely white flowers are produced. Some of the flower-color patterns observed in transgenic petunias having CHS-A cosuppression resemble those in existing nontransgenic varieties. Although the mechanism by which white sectors are generated in nontransgenic petunia is known to be due to RNA silencing of the CHS-A gene as in cosuppression, whether the same trigger(s) and/or pattern of RNA degradation are involved in these phenomena has not been known. Here, we addressed this question using deep-sequencing and bioinformatic analyses of small RNAs. Results We analyzed short interfering RNAs (siRNAs) produced in nonpigmented sectors of petal tissues in transgenic petunia plants that have CHS-A cosuppression and a nontransgenic petunia variety Red Star, that has naturally occurring CHS-A RNA silencing. In both silencing systems, 21-nt and 22-nt siRNAs were the most and the second-most abundant size classes, respectively. CHS-A siRNA production was confined to exon 2, indicating that RNA degradation through the RNA silencing pathway occurred in this exon. Common siRNAs were detected in cosuppression and naturally occurring RNA silencing, and their ranks based on the number of siRNAs in these plants were correlated with each other. Noticeably, highly abundant siRNAs were common in these systems. Phased siRNAs were detected in multiple phases at multiple sites, and some of the ends of the regions that produced phased siRNAs were conserved. Conclusions The features of siRNA production found to be common to cosuppression and naturally occurring silencing of the CHS-A gene indicate mechanistic similarities between these

  16. Histone Acetylation and the Regulation of Major Histocompatibility Class II Gene Expression. (United States)

    Suzuki, K; Luo, Y

    Major histocompatibility complex (MHC) class II molecules are essential for processing and presenting exogenous pathogen antigens to activate CD4 + T cells. Given their central role in adaptive immune responses, MHC class II genes are tightly regulated in a tissue- and activation-specific manner. The regulation of MHC class II gene expression involves various transcription factors that interact with conserved proximal cis-acting regulatory promoter elements, as well as MHC class II transactivator that interacts with a variety of chromatin remodeling machineries. Recent studies also identified distal regulatory elements within MHC class II gene locus that provide enormous insight into the long-range coordination of MHC class II gene expression. Novel therapeutic modalities that can modify MHC class II genes at the epigenetic level are emerging and are currently in preclinical and clinical trials. This review will focus on the role of chromatin remodeling, particularly remodeling that involves histone acetylation, in the constitutive and inducible regulation of MHC class II gene expression. © 2017 Elsevier Inc. All rights reserved.

  17. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng


    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  18. Expression of the aldehyde oxidase 3, ent-copalyl diphosphate synthase, and VIVIPAROUS 1 genes in wheat cultivars differing in their susceptibility to pre-harvest sprouting

    Directory of Open Access Journals (Sweden)

    Magdalena Simlat


    Full Text Available The quality of wheat grains is often negatively affected by pre-harvest sprouting (PHS, a complex trait with a poorly understood genetic background. In this study two wheat cultivars differing in their susceptibility to PHS were used to investigate expression of three genes: AAO3, CPS3 and VP1. AAO3 is coding for aldehyde oxidase 3, an enzyme involved in the synthesis of abscisic acid. CPS3 codes for ent-copalyl diphosphate synthase which belongs to the pathway of gibberellic acid synthesis. The product of VP1 (VIVIPAROUS 1 is a transcription factor which controls expression of the former two genes. The study was carried out using both developing and sprouting-induced grains. In Piko, a wheat cultivar susceptible to PHS, accumulation of the AAO3 transcript was significantly decreased, during the last stages of grain development, in comparison to Sława, a cultivar tolerant to PHS. In case of the CPS3 and VP1 transcripts, the differences between cultivars were especially evident from 17th to 31st day after pollination. In turn, after induction of sprouting within spikes, accumulation of the AAO3 and VP1 mRNA in the Sława grains was lower in comparison to that observed in the Piko grains. Moreover, accumulation of the CPS3 transcript was significantly higher for Piko than for Sława, both in sprouting and non-sprouting grains. According to our knowledge this report provides the first description of the AAO3 and CPS3 expression in the context of PHS, and in the future it would be valuable to correlate this information with the data on the accumulation of ABA and GA3.

  19. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn


    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  20. Expression and regulation of pear 1-aminocyclopropane-1-carboxylic acid synthase gene (PpACS1a) during fruit ripening, under salicylic acid and indole-3-acetic acid treatment, and in diseased fruit. (United States)

    Shi, Hai-Yan; Zhang, Yu-Xing


    In plants, the level of ethylene is determined by the activity of the key enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS). A gene encoding an ACC synthase protein was isolated from pear (Pyrus pyrifolia). This gene designated PpACS1a (GenBank accession no. KC632526) was 1488 bp in length with an open reading frame (ORF) encoding a protein of 495 amino acids that shared high similarity with other pear ACC synthase proteins. The PpACS1a was grouped into type-1 subfamily of plant ACS based on its conserved domain and phylogenetic status. Real-time quantitative PCR indicated that PpACS1a was differentially expressed in pear tissues and predominantly expressed in anthers. The expression signal of PpACS1a was also detected in fruit and leaves, but no signal was detected in shoots and petals. Furthermore, the PpACS1a expression was regulated during fruit ripening. In addition, the PpACS1a gene expression was regulated by salicylic acid (SA) and indole-3-acetic acid (IAA) in fruit. Moreover, the expression of the PpACS1a was up-regulated in diseased pear fruit. These results indicated that PpACS1a might be involved in fruit ripening and response to SA, IAA and disease.

  1. Genome based analysis of type-I polyketide synthase and nonribosomal peptide synthetase gene clusters in seven strains of five representative Nocardia species. (United States)

    Komaki, Hisayuki; Ichikawa, Natsuko; Hosoyama, Akira; Takahashi-Nakaguchi, Azusa; Matsuzawa, Tetsuhiro; Suzuki, Ken-ichiro; Fujita, Nobuyuki; Gonoi, Tohru


    Actinobacteria of the genus Nocardia usually live in soil or water and play saprophytic roles, but they also opportunistically infect the respiratory system, skin, and other organs of humans and animals. Primarily because of the clinical importance of the strains, some Nocardia genomes have been sequenced, and genome sequences have accumulated. Genome sizes of Nocardia strains are similar to those of Streptomyces strains, the producers of most antibiotics. In the present work, we compared secondary metabolite biosynthesis gene clusters of type-I polyketide synthase (PKS-I) and nonribosomal peptide synthetase (NRPS) among genomes of representative Nocardia species/strains based on domain organization and amino acid sequence homology. Draft genome sequences of Nocardia asteroides NBRC 15531(T), Nocardia otitidiscaviarum IFM 11049, Nocardia brasiliensis NBRC 14402(T), and N. brasiliensis IFM 10847 were read and compared with published complete genome sequences of Nocardia farcinica IFM 10152, Nocardia cyriacigeorgica GUH-2, and N. brasiliensis HUJEG-1. Genome sizes are as follows: N. farcinica, 6.0 Mb; N. cyriacigeorgica, 6.2 Mb; N. asteroides, 7.0 Mb; N. otitidiscaviarum, 7.8 Mb; and N. brasiliensis, 8.9 - 9.4 Mb. Predicted numbers of PKS-I, NRPS, and PKS-I/NRPS hybrid clusters ranged between 4-11, 7-13, and 1-6, respectively, depending on strains, and tended to increase with increasing genome size. Domain and module structures of representative or unique clusters are discussed in the text. We conclude the following: 1) genomes of Nocardia strains carry as many PKS-I and NRPS gene clusters as those of Streptomyces strains, 2) the number of PKS-I and NRPS gene clusters in Nocardia strains varies substantially depending on species, and N. brasiliensis strains carry the largest numbers of clusters among the species studied, 3) the seven Nocardia strains studied in the present work have seven common PKS-I and/or NRPS clusters, some of whose products are yet to be studied

  2. Transcriptome sequencing of three Pseudo-nitzschia species reveals comparable gene sets and the presence of Nitric Oxide Synthase genes in diatoms. (United States)

    Di Dato, Valeria; Musacchia, Francesco; Petrosino, Giuseppe; Patil, Shrikant; Montresor, Marina; Sanges, Remo; Ferrante, Maria Immacolata


    Diatoms are among the most diverse eukaryotic microorganisms on Earth, they are responsible for a large fraction of primary production in the oceans and can be found in different habitats. Pseudo-nitzschia are marine planktonic diatoms responsible for blooms in coastal and oceanic waters. We analyzed the transcriptome of three species, Pseudo-nitzschia arenysensis, Pseudo-nitzschia delicatissima and Pseudo-nitzschia multistriata, with different levels of genetic relatedness. These species have a worldwide distribution and the last one produces the neurotoxin domoic acid. We were able to annotate about 80% of the sequences in each transcriptome and the analysis of the relative functional annotations allowed comparison of the main metabolic pathways, pathways involved in the biosynthesis of isoprenoids (MAV and MEP pathways), and pathways putatively involved in domoic acid synthesis. The search for homologous transcripts among the target species and other congeneric species resulted in the discovery of a sequence annotated as Nitric Oxide Synthase (NOS), found uniquely in Pseudo-nitzschia multistriata. The predicted protein product contained all the domains of the canonical metazoan sequence. Putative NOS sequences were found in other available diatom datasets, supporting a role for nitric oxide as signaling molecule in this group of microalgae.

  3. Analysis of T-786C and 4a/b endothelial nitric oxide synthase gene polymorphisms in retinopathy of prematurity

    Directory of Open Access Journals (Sweden)

    Pantelić Jelica R.


    Full Text Available Retinopathy of prematurity (ROP is a vascular proliferative disorder of retina, that causes visual impairment in premature children. Beside well known risk factors such as short gestational age, low birth weight and early oxygen exposure, genetic susceptibility is considered as a risk factor for development of the disease. The aim of our study was to explore the association of T-786C and 4a/b eNOS gene polymorphisms with the development of severe ROP. Study included 174 preterm infants, 84 with ROP and 90 as a control group. No differences have been observed in genotypes and alleles distributions of eNOS T-786C and eNOS 4a/b polymorphisms between two analyzed groups. There was significant difference in female infants by dominant model for 4a/b genotypes (4bb/4ba+4aa. Namely, female infants in ROP group were more frequently carriers of 4ba and 4aa genotypes than female infants in control group (p=0.037. Analysis of association between 4a/b eNOS polymorphism and ROP among preterm infants have not shown statistically significant association (p=0.288. Gestational age values by recessive model (4bb+4ba/4aa were significantly lower in infants with 4aa genotype (t=2.034 p=0.044. Almost all detected 4aa genotypes were present in the group of infants with gestational age under 30 weeks (p=0.032, but multivariate linear regression analysis does not show association of 4a/b genotypes with gestational age of premature infants. According to results of the present study T-786C and 4a/b polymorphisms of the eNOS gene may not be the risk factors for the manifestation of severe ROP in Serbian infants. [Projekat Ministarstva nauke Republike Srbije, br. 175091

  4. Angiotensin II modulates interleukin-1β-induced inflammatory gene expression in vascular smooth muscle cells via interfering with ERK-NF-κB crosstalk

    International Nuclear Information System (INIS)

    Xu, Shanqin; Zhi, Hui; Hou, Xiuyun; Jiang, Bingbing


    Highlights: → We examine how angiotensin II modulates ERK-NF-κB crosstalk and gene expression. → Angiotensin II suppresses IL-1β-induced prolonged ERK and NF-κB activation. → ERK-RSK1 signaling is required for IL-1β-induced prolonged NF-κB activation. → Angiotensin II modulates NF-κB responsive genes via regulating ERK-NF-κB crosstalk. → ERK-NF-κB crosstalk is a novel mechanism regulating inflammatory gene expression. -- Abstract: Angiotensin II is implicated in cardiovascular diseases, which is associated with a role in increasing vascular inflammation. The present study investigated how angiotensin II modulates vascular inflammatory signaling and expression of inducible nitric oxide synthase (iNOS) and vascular cell adhesion molecule (VCAM)-1. In cultured rat aortic vascular smooth muscle cells (VSMCs), angiotensin II suppressed interleukin-1β-induced prolonged phosphorylation of extracellular signal-regulated kinase (ERK) and ribosomal S6 kinase (RSK)-1, and nuclear translocation of nuclear factor (NF)-κB, leading to decreased iNOS but enhanced VCAM-1 expression, associated with an up-regulation of mitogen-activated protein kinase phosphatase-1 expression. Knock-down of RSK1 selectively down regulated interleukin-1β-induced iNOS expression without influencing VCAM-1 expression. In vivo experiments showed that interleukin-1β, iNOS, and VCAM-1 expression were detectable in the aortic arches of both wild-type and apolipoprotein E-deficient (ApoE -/- ) mice. VCAM-1 and iNOS expression were higher in ApoE -/- than in wild type mouse aortic arches. Angiotensin II infusion (3.2 mg/kg/day, for 6 days, via subcutaneous osmotic pump) in ApoE -/- mice enhanced endothelial and adventitial VCAM-1 and iNOS expression, but reduced medial smooth muscle iNOS expression associated with reduced phosphorylation of ERK and RSK-1. These results indicate that angiotensin II can differentially modulate inflammatory gene expression in aortic smooth muscle cells

  5. Angiotensin II modulates interleukin-1{beta}-induced inflammatory gene expression in vascular smooth muscle cells via interfering with ERK-NF-{kappa}B crosstalk

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Shanqin [Vascular Biology Unit, Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, MA (United States); Zhi, Hui [Cardiovascular Division, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Hou, Xiuyun [Vascular Biology Unit, Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, MA (United States); Jiang, Bingbing, E-mail: [Vascular Biology Unit, Whitaker Cardiovascular Institute, Boston University School of Medicine, Boston, MA (United States); Cardiovascular Division, Department of Medicine, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States)


    Highlights: {yields} We examine how angiotensin II modulates ERK-NF-{kappa}B crosstalk and gene expression. {yields} Angiotensin II suppresses IL-1{beta}-induced prolonged ERK and NF-{kappa}B activation. {yields} ERK-RSK1 signaling is required for IL-1{beta}-induced prolonged NF-{kappa}B activation. {yields} Angiotensin II modulates NF-{kappa}B responsive genes via regulating ERK-NF-{kappa}B crosstalk. {yields} ERK-NF-{kappa}B crosstalk is a novel mechanism regulating inflammatory gene expression. -- Abstract: Angiotensin II is implicated in cardiovascular diseases, which is associated with a role in increasing vascular inflammation. The present study investigated how angiotensin II modulates vascular inflammatory signaling and expression of inducible nitric oxide synthase (iNOS) and vascular cell adhesion molecule (VCAM)-1. In cultured rat aortic vascular smooth muscle cells (VSMCs), angiotensin II suppressed interleukin-1{beta}-induced prolonged phosphorylation of extracellular signal-regulated kinase (ERK) and ribosomal S6 kinase (RSK)-1, and nuclear translocation of nuclear factor (NF)-{kappa}B, leading to decreased iNOS but enhanced VCAM-1 expression, associated with an up-regulation of mitogen-activated protein kinase phosphatase-1 expression. Knock-down of RSK1 selectively down regulated interleukin-1{beta}-induced iNOS expression without influencing VCAM-1 expression. In vivo experiments showed that interleukin-1{beta}, iNOS, and VCAM-1 expression were detectable in the aortic arches of both wild-type and apolipoprotein E-deficient (ApoE{sup -/-}) mice. VCAM-1 and iNOS expression were higher in ApoE{sup -/-} than in wild type mouse aortic arches. Angiotensin II infusion (3.2 mg/kg/day, for 6 days, via subcutaneous osmotic pump) in ApoE{sup -/-} mice enhanced endothelial and adventitial VCAM-1 and iNOS expression, but reduced medial smooth muscle iNOS expression associated with reduced phosphorylation of ERK and RSK-1. These results indicate that angiotensin

  6. Structure and Chromosomal Organization of Yeast Genes Regulated by Topoisomerase II. (United States)

    Joshi, Ricky S; Nikolaou, Christoforos; Roca, Joaquim


    Cellular DNA topoisomerases (topo I and topo II) are highly conserved enzymes that regulate the topology of DNA during normal genome transactions, such as DNA transcription and replication. In budding yeast, topo I is dispensable whereas topo II is essential, suggesting fundamental and exclusive roles for topo II, which might include the functions of the topo IIa and topo IIb isoforms found in mammalian cells. In this review, we discuss major findings of the structure and chromosomal organization of genes regulated by topo II in budding yeast. Experimental data was derived from short (10 min) and long term (120 min) responses to topo II inactivation in top-2 ts mutants. First, we discuss how short term responses reveal a subset of yeast genes that are regulated by topo II depending on their promoter architecture. These short term responses also uncovered topo II regulation of transcription across multi-gene clusters, plausibly by common DNA topology management. Finally, we examine the effects of deactivated topo II on the elongation of RNA transcripts. Each study provides an insight into the particular chromatin structure that interacts with the activity of topo II. These findings are of notable clinical interest as numerous anti-cancer therapies interfere with topo II activity.

  7. Determination of the Nucleotide Sequences of Heat Shock Operon groESL and the Citrate Synthase Gene (gltA) of Anaplasma (Ehrlichia) platys for Phylogenetic and Diagnostic Studies (United States)

    Inokuma, Hisashi; Fujii, Kaori; Okuda, Masaru; Onishi, Takafumi; Beaufils, Jean-Pierre; Raoult, Didier; Brouqui, Philippe


    The 1,670-bp nucleotide sequence of the heat shock operon groESL and the 1,236-bp sequence of the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys were determined. The topology of the groEL- and gltA-based phylogenetic tree was similar to that derived from 16S rRNA gene analyses with distances. Both groESL- and gltA-based PCRs specific to A. platys were also developed based upon the alignment data. PMID:12204973

  8. Effect modification by delta-aminolevulinic acid dehydratase, vitamin D receptor, and nitric oxide synthase gene polymorphisms on associations between patella lead and renal function in lead workers. (United States)

    Weaver, Virginia M; Lee, Byung-Kook; Todd, Andrew C; Ahn, Kyu-Dong; Shi, Weiping; Jaar, Bernard G; Kelsey, Karl T; Lustberg, Mark E; Silbergeld, Ellen K; Parsons, Patrick J; Wen, Jiayu; Schwartz, Brian S


    Genetic polymorphisms that affect lead toxicokinetics or toxicodynamics may be important modifiers of risk for adverse outcomes in lead-exposed populations. We recently reported associations between higher patella lead, which is hypothesized to represent a lead pool that is both bioavailable and cumulative, and adverse renal outcomes in current and former Korean lead workers. In the present study, we assessed effect modification by polymorphisms in the genes encoding for delta-aminolevulinic acid dehydratase (ALAD), the vitamin D receptor (VDR), and endothelial nitric oxide synthase on those associations. Similar analyses were conducted with three other lead biomarkers. Renal function was assessed via blood urea nitrogen, serum creatinine, measured and calculated creatinine clearances, urinary N-acetyl-beta-D-glucosaminidase, and retinol-binding protein. Mean (SD) blood, patella, tibia, and dimercaptosuccinic acid-chelatable lead values were 30.9 (16.7) microg/dl, 75.1 (101.1)and 33.6 (43.4) microg Pb/g bone mineral, and 0.63 (0.75) microg Pb/mg creatinine, respectively, in 647 lead workers. Little evidence of effect modification by genotype on associations between patella lead and renal outcomes was observed. The VDR polymorphism did modify associations between the other lead biomarkers and the serum creatinine and calculated creatinine clearance. Higher lead dose was associated with worse renal function in participants with the variant B allele. Models in two groups, dichotomized by median age, showed that this effect was present in the younger half of the population. Limited evidence of effect modification by ALAD genotype was observed; higher blood lead levels were associated with higher calculated creatinine clearance among participants with the ALAD(1-2) genotype. In conclusion, VDR and/or ALAD genotypes modified associations between all the lead biomarkers, except patella lead, and the renal outcomes.

  9. Single nucleotide polymorphisms in a cellulose synthase gene (PtoCesA3) are associated with growth and wood properties in Populus tomentosa. (United States)

    Xu, Baohua; Tian, Jiaxing; Du, Qingzhang; Gong, Chenrui; Pan, Wei; Zhang, Deqiang


    In plants, the composition and organization of the cell wall determine cell shape, enable cell expansion, and affect the properties of woody tissues. Cellulose synthase (CesA) genes encode the enzymes involved in the synthesis of cellulose which is the major component of plant primary and secondary cell walls. Here, we isolated a full-length PtoCesA3 cDNA from the stem cambium tissue of Populus tomentosa. Tissue-specific expression profiling showed that PtoCesA3 is highly expressed during primary cell wall formation. Estimation of single nucleotide polymorphism (SNP) diversity and linkage disequilibrium (LD) revealed that PtoCesA3 harbors high SNP diversity (π(T) = 0.00995 and θ(w) = 0.0102) and low LD (r(2) ≥ 0.1, within 1,280 bp). Association analysis in a P. tomentosa association population (460 individuals) showed that seven SNPs (false discovery rate Q wood properties, explaining 4.09-7.02% of the phenotypic variance. All significant marker-trait associations were validated in at least one of the three smaller subsets (climatic regions) while five associations were repeated in the linkage population. Variation in RNA transcript abundance among genotypic classes of significant loci was also confirmed in the association or linkage populations. Identification of PtoCesA3 and examining its allelic polymorphisms using association studies open an avenue to understand the mechanism of cellulose synthesis in the primary cell wall and its effects on the properties of woody tissues.

  10. Boosting isoprene production via heterologous expression of the Kudzu isoprene synthase gene (kIspS) into Bacillus spp. cell factory. (United States)

    Gomaa, Lamis; Loscar, Michael E; Zein, Haggag S; Abdel-Ghaffar, Nahed; Abdelhadi, Abdelhadi A; Abdelaal, Ali S; Abdallah, Naglaa A


    Isoprene represents a key building block for the production of valuable materials such as latex, synthetic rubber or pharmaceutical precursors and serves as basis for advanced biofuel production. To enhance the production of the volatile natural hydrocarbon isoprene, released by plants, animals and bacteria, the Kudzu isoprene synthase (kIspS) gene has been heterologously expressed in Bacillus subtilis DSM 402 and Bacillus licheniformis DSM 13 using the pHT01 vector. As control, the heterologous expression of KIspS in E. coli BL21 (DE3) with the pET28b vector was used. Isoprene production was analyzed using Gas Chromatography Flame Ionization Detector. The highest isoprene production was observed by recombinant B. subtilis harboring the pHT01-kIspS plasmid which produced 1434.3 μg/L (1275 µg/L/OD) isoprene. This is threefold higher than the wild type which produced 388 μg/L (370 μg/L/OD) isoprene, when both incubated at 30 °C for 48 h and induced with 0.1 mM IPTG. Additionally, recombinant B. subtilis produced fivefold higher than the recombinant B. licheniformis, which produced 437.2 μg/L (249 μg/L/OD) isoprene when incubated at 37 °C for 48 h induced with 0.1 mM IPTG. This is the first report of optimized isoprene production in B. licheniformis. However, recombinant B. licheniformis showed less isoprene production. Therefore, recombinant B. subtilis is considered as a versatile host for heterologous production of isoprene.

  11. Differential transcriptional regulation of banana sucrose phosphate synthase gene in response to ethylene, auxin, wounding, low temperature and different photoperiods during fruit ripening and functional analysis of banana SPS gene promoter. (United States)

    Roy Choudhury, Swarup; Roy, Sujit; Das, Ranjan; Sengupta, Dibyendu N


    Sucrose phosphate synthase (SPS) (EC is the key regulatory component in sucrose formation in banana (Musa acuminata subgroup Cavendish, cv Giant governor) fruit during ripening. This report illustrates differential transcriptional responses of banana SPS gene following ethylene, auxin, wounding, low temperature and different photoperiods during ripening in banana fruit. Whereas ethylene strongly stimulated SPS transcript accumulation, auxin and cold treatment only marginally increased the abundance of SPS mRNA level, while wounding negatively regulated SPS gene expression. Conversely, SPS transcript level was distinctly increased by constant exposure to white light. Protein level, enzymatic activity of SPS and sucrose synthesis were substantially increased by ethylene and increased exposure to white light conditions as compared to other treatments. To further study the transcriptional regulation of SPS in banana fruit, the promoter region of SPS gene was cloned and some cis-acting regulatory elements such as a reverse GCC-box ERE, two ARE motifs (TGTCTC), one LTRE (CCGAA), a GAGA-box (GAGA...) and a GATA-box LRE (GATAAG) were identified along with the TATA and CAAT-box. DNA-protein interaction studies using these cis-elements indicated a highly specific cis-trans interaction in the banana nuclear extract. Furthermore, we specifically studied the light responsive characteristics of GATA-box containing synthetic as well as native banana SPS promoter. Transient expression assays using banana SPS promoter have also indicated the functional importance of the SPS promoter in regulating gene expression. Together, these results provide insights into the transcriptional regulation of banana SPS gene in response to phytohormones and other environmental factors during fruit ripening.

  12. The joint effect of the endothelin receptor B gene (EDNRB polymorphism rs10507875 and nitric oxide synthase 3 gene (NOS3 polymorphism rs869109213 in Slovenian patients with type 2 diabetes mellitus and diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Dejan Bregar


    Full Text Available Increasing evidence suggests that endothelin and nitric oxide synthase genes and their products exert biological effects on the vasculature via the nitric oxide or endothelin pathway. The aim of the study was to evaluate the association of rs10507875 and rs869109213 (alone or in interaction with diabetic retinopathy (DR in subjects with type 2 diabetes mellitus (T2DM. We genotyped the single nucleotide polymorphism rs10507875 of the endothelin receptor B gene (EDNRB and variable number tandem repeats rs869109213 of the nitric oxide synthase 3 gene (NOS3 in 270 Slovenian patients with DR and T2DM and 256 controls with T2DM without clinical signs of DR. The genotyping was performed using either real-time polymerase chain reaction (PCR or standard PCR. We found a significant association between the genotypes of NOS3 rs869109213 polymorphism and the risk of DR in the co-dominant model (4a4b genotype; 1.99-fold increased risk [1.09-3.65]; 95% confidence interval [CI]; p = 0.02, co-dominant model (4a4a genotype; 4.16-fold increased risk [1.03-16.74]; 95% CI; p = 0.04, and dominant model (4a4a and 4a4b genotypes; 2.22-fold increased risk [1.26-3.92]; 95% CI; p = 0.01 compared to the 4b4b genotype. Moreover, the joint effect of the two polymorphisms on DR risk was greater than the individual effect of each polymorphism in the analyzed genetic models. Additionally, adjusted odds ratio showed an increased risk in dominant × dominant (4.15-fold [1.40-12.26]; 95% CI; p = 0.01 and recessive × dominant (2.24-fold [1.25-4.01]; 95% CI; p = 0.02 genotype combinations of the two polymorphisms. In conclusion, our results indicate that NOS3 rs869109213 polymorphism alone or in a combination with EDNRB rs10507875 polymorphism may be associated with DR in Slovenian patients with T2DM.

  13. Methylation affects transposition and splicing of a large CACTA transposon from a MYB transcription factor regulating anthocyanin synthase genes in soybean seed coats.

    Directory of Open Access Journals (Sweden)

    Gracia Zabala

    Full Text Available We determined the molecular basis of three soybean lines that vary in seed coat color at the R locus which is thought to encode a MYB transcription factor. RM55-r(m is homozygous for a mutable allele (r(m that specifies black and brown striped seeds; RM30-R* is a stable black revertant isoline derived from the mutable line; and RM38-r has brown seed coats due to a recessive r allele shown to translate a truncated MYB protein. Using long range PCR, 454 sequencing of amplicons, and whole genome re-sequencing, we determined that the variegated RM55-r(m line had a 13 kb CACTA subfamily transposon insertion (designated TgmR* at a position 110 bp from the beginning of Intron2 of the R locus, Glyma09g36983. Although the MYB encoded by R was expressed at only very low levels in older seed coats of the black revertant RM30-R* line, it upregulated expression of anthocyanidin synthase genes (ANS2, ANS3 to promote the synthesis of anthocyanins. Surprisingly, the RM30-R* revertant also carried the 13 kb TgmR* insertion in Intron2. Using RNA-Seq, we showed that intron splicing was accurate, albeit at lower levels, despite the presence of the 13 kb TgmR* element. As determined by whole genome methylation sequencing, we demonstrate that the TgmR* sequence was relatively more methylated in RM30-R* than in the mutable RM55-r(m progenitor line. The stabilized and more methylated RM30-R* revertant line apparently lacks effective binding of a transposae to its subterminal repeats, thus allowing intron splicing to proceed resulting in sufficient MYB protein to stimulate anthocyanin production and thus black seed coats. In this regard, the TgmR* element in soybean resembles McClintock's Spm-suppressible and change-of-state alleles of maize. This comparison explains the opposite effects of the TgmR* element on intron splicing of the MYB gene in which it resides depending on the methylation state of the element.

  14. The Effect of Artemisia fragrans Willd: Essential Oil on Inducible Nitric Oxide Synthase Gene Expression and Nitric Oxide Production in Lipopolysaccharide-stimulated Murine Macrophage Cell Line. (United States)

    Farghadan, Maryam; Ghafoori, Hosein; Vakhshiteh, Faezeh; Shahzadeh Fazeli, Seyed Abolhassan; Farzaneh, Parvaneh; Kokhaei, Parviz


    The genus Artemisia is estimated to comprise over 800 species with anti-cancer, anti-fungal, anti-oxidant and anti-inflammatory properties. Artemisia fragrans (A. fragrans), a species that belongs to genus Artemisia, is rich in monoterpenes and sesquiterpenes derivatives. Due to anti-inflammatory properties of monoterpenes and sesquiterpenes, we aimed to investigate the effect of A. fragrans essential oil on mRNA expression of inducible nitric oxide synthase (iNOS) gene and nitric oxide (NO) production in Lipopolysaccharide (LPS) -stimulated RAW264.7 cell line. NO, which is synthesized by iNOS, is the main macrophage-derived inflammatory mediator. The oil obtained from the A. fragrans was prepared from aerial parts of the plant. Chemical composition of essential oil was analyzed by gas chromatography-mass spectrometry (GC/MS).The cytotoxicity of various concentrations of essential oil was evaluated by mitochondrial reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) test assay. The effect of different doses (1.75-7 mg/mL) of A. fragrans oil on mRNA expression of iNOS gene and NO production in LPS-stimulated RAW 264.7 cells was assessed by real-time PCR method and Griess reagent, respectively. In GC/MS analyses of A. fragrans oil, 32 compounds were identified. The main components of the oil were camphor and 1, 8-cineole. The results demonstrated that the essential oil of A. fragrans (1.75- 7 mg/mL), in a dose-dependent manner, inhibits mRNA expression of iNOS induced by LPS in the RAW264.7 cells without cytotoxic effect even at higher doses. The results of iNOS were consistent with the results of NO production. Our preliminary results suggest the possible anti-inflammatory effect of A. fragrans. Further studies are needed to determine the full pharmacokinetics of A. fragrans activity in vivo.

  15. Real-time PCR of the mammalian hydroxymethylbilane synthase (HMBS) gene for analysis of flea (Ctenocephalides felis) feeding patterns on dogs. (United States)

    Wang, Chengming; Mount, Jane; Butler, Jamie; Gao, Dongya; Jung, Euisun; Blagburn, Byron L; Kaltenboeck, Bernhard


    Precise data on quantitative kinetics of blood feeding of fleas, particularly immediately after contact with the host, are essential for understanding dynamics of flea-borne disease transmission and for evaluating flea control strategies. Standard methods used are inadequate for studies that simulate early events after real-life flea access to the host. Here, we developed a novel quantitative polymerase chain reaction targeting mammalian DNA within fleas to quantify blood consumption with high sensitivity and specificity. We used primers and fluorescent probes that amplify the hydroxymethylbilane synthase (HMBS) gene, an evolutionary divergent gene that is unlikely to be detected in insects by mammalian-specific primers and probes. To validate this assay, fleas were placed on dogs, allowed to distribute in the hair, and removed at specific time points with single-use combs. Fleas were then immediately homogenized by vigorous shaking with ceramic beads in guanidinium-based DNA preservation buffer for DNA extraction. The specificity of this assay was ascertained by amplification of canine, feline and equine blood with differential product melting temperatures (Tm), and lack of amplification of bovine and porcine blood and of adult fleas reared from larvae fed with bovine blood. Sensitivity of the assay was established by limiting dilution and detection of single copies of HMBS DNA equivalent to 0.043 nL blood. Application of the assay indicated that after 15 minutes on a dog, male and female fleas had ingested low, but similar amounts of approximately 1.1. nL blood. Saturation uptake of 118 and 100 nL blood per flea was found at 30 and 60 min on the dog, respectively. The HMBS PCR method developed here offers the advantages of both exquisite sensitivity and specificity that make it superior to other approaches for quantification of blood ingested by fleas. The capability to detect minute quantities of blood in single fleas, particularly immediately after colonization

  16. Real-time PCR of the mammalian hydroxymethylbilane synthase (HMBS gene for analysis of flea (Ctenocephalides felis feeding patterns on dogs

    Directory of Open Access Journals (Sweden)

    Wang Chengming


    Full Text Available Abstract Background Precise data on quantitative kinetics of blood feeding of fleas, particularly immediately after contact with the host, are essential for understanding dynamics of flea-borne disease transmission and for evaluating flea control strategies. Standard methods used are inadequate for studies that simulate early events after real-life flea access to the host. Methods Here, we developed a novel quantitative polymerase chain reaction targeting mammalian DNA within fleas to quantify blood consumption with high sensitivity and specificity. We used primers and fluorescent probes that amplify the hydroxymethylbilane synthase (HMBS gene, an evolutionary divergent gene that is unlikely to be detected in insects by mammalian-specific primers and probes. To validate this assay, fleas were placed on dogs, allowed to distribute in the hair, and removed at specific time points with single-use combs. Fleas were then immediately homogenized by vigorous shaking with ceramic beads in guanidinium-based DNA preservation buffer for DNA extraction. Results The specificity of this assay was ascertained by amplification of canine, feline and equine blood with differential product melting temperatures (Tm, and lack of amplification of bovine and porcine blood and of adult fleas reared from larvae fed with bovine blood. Sensitivity of the assay was established by limiting dilution and detection of single copies of HMBS DNA equivalent to 0.043 nL blood. Application of the assay indicated that after 15 minutes on a dog, male and female fleas had ingested low, but similar amounts of approximately 1.1. nL blood. Saturation uptake of 118 and 100 nL blood per flea was found at 30 and 60 min on the dog, respectively. Conclusions The HMBS PCR method developed here offers the advantages of both exquisite sensitivity and specificity that make it superior to other approaches for quantification of blood ingested by fleas. The capability to detect minute quantities of

  17. Identification and characterization of the human type II collagen gene (COL2A1).

    NARCIS (Netherlands)

    K.S.E. Cheah (Kathryn); N.G. Stoker; J.R. Griffin; F.G. Grosveld (Frank); E. Solomon


    textabstractThe gene contained in the human cosmid clone CosHcol1, previously designated an alpha 1(I) collagen-like gene, has now been identified. CosHcol1 hybridizes strongly to a single 5.9-kilobase mRNA species present only in tissue in which type II collagen is expressed. DNA sequence analysis

  18. Expression of chalcone synthase genes in coleoptiles and primary leaves of Secale cereale L. after induction by UV radiation: evidence for a UV-protective role of the coleoptile

    International Nuclear Information System (INIS)

    Haussühl, K.; Rohde, W.; Weissenböck, G.


    Four chalcone synthase (CHS; EC clones from rye were isolated and characterized. Two of these clones were used for analysis of CHS gene activities in response to ultraviolet and visible radiation in the coleoptile and the primary leaf of the rye seedling. The time-dependence of CHS gene activation and the spatial distribution of CHS were studied by investigation of enzyme activities and CHS mRNA levels, including in situ RNA hybridization. In the primary leaf strong induction of CHS gene activity was localized in the epidermal layers and only marginally found in the mesophyll. The coleoptile showed an even higher response to UV irradiation, but CHS gene activity was evenly distributed throughout the tissues. It is suggested that, in addition to its function as a mechanical protection for the primary leaf during seed germination and seedling emergence through the soil, the coleoptile may also protect the emerging seedling from harmful radiation

  19. Regulated gene expression in cultured type II cells of adult human lung. (United States)

    Ballard, Philip L; Lee, Jae W; Fang, Xiaohui; Chapin, Cheryl; Allen, Lennell; Segal, Mark R; Fischer, Horst; Illek, Beate; Gonzales, Linda W; Kolla, Venkatadri; Matthay, Michael A


    Alveolar type II cells have multiple functions, including surfactant production and fluid clearance, which are critical for lung function. Differentiation of type II cells occurs in cultured fetal lung epithelial cells treated with dexamethasone plus cAMP and isobutylmethylxanthine (DCI) and involves increased expression of 388 genes. In this study, type II cells of human adult lung were isolated at approximately 95% purity, and gene expression was determined (Affymetrix) before and after culturing 5 days on collagen-coated dishes with or without DCI for the final 3 days. In freshly isolated cells, highly expressed genes included SFTPA/B/C, SCGB1A, IL8, CXCL2, and SFN in addition to ubiquitously expressed genes. Transcript abundance was correlated between fetal and adult cells (r = 0.88), with a subset of 187 genes primarily related to inflammation and immunity that were expressed >10-fold higher in adult cells. During control culture, expression increased for 8.1% of expressed genes and decreased for approximately 4% including 118 immune response and 10 surfactant-related genes. DCI treatment promoted lamellar body production and increased expression of approximately 3% of probed genes by > or =1.5-fold; 40% of these were also induced in fetal cells. Highly induced genes (> or =10-fold) included PGC, ZBTB16, DUOX1, PLUNC, CIT, and CRTAC1. Twenty-five induced genes, including six genes related to surfactant (SFTPA/B/C, PGC, CEBPD, and ADFP), also had decreased expression during control culture and thus are candidates for hormonal regulation in vivo. Our results further define the adult human type II cell molecular phenotype and demonstrate that a subset of genes remains hormone responsive in cultured adult cells.

  20. Nodule-enhanced expression of a sucrose phosphate synthase gene member (MsSPSA) has a role in carbon and nitrogen metabolism in the nodules of alfalfa (Medicago sativa L.). (United States)

    Aleman, Lorenzo; Ortega, Jose Luis; Martinez-Grimes, Martha; Seger, Mark; Holguin, Francisco Omar; Uribe, Diana J; Garcia-Ibilcieta, David; Sengupta-Gopalan, Champa


    Sucrose phosphate synthase (SPS) catalyzes the first step in the synthesis of sucrose in photosynthetic tissues. We characterized the expression of three different isoforms of SPS belonging to two different SPS gene families in alfalfa (Medicago sativa L.), a previously identified SPS (MsSPSA) and two novel isoforms belonging to class B (MsSPSB and MsSPSB3). While MsSPSA showed nodule-enhanced expression, both MsSPSB genes exhibited leaf-enhanced expression. Alfalfa leaf and nodule SPS enzymes showed differences in chromatographic and electrophoretic migration and differences in V (max) and allosteric regulation. The root nodules in legume plants are a strong sink for photosynthates with its need for ATP, reducing power and carbon skeletons for dinitrogen fixation and ammonia assimilation. The expression of genes encoding SPS and other key enzymes in sucrose metabolism, sucrose phosphate phosphatase and sucrose synthase, was analyzed in the leaves and nodules of plants inoculated with Sinorhizobium meliloti. Based on the expression pattern of these genes, the properties of the SPS isoforms and the concentration of starch and soluble sugars in nodules induced by a wild type and a nitrogen fixation deficient strain, we propose that SPS has an important role in the control of carbon flux into different metabolic pathways in the symbiotic nodules.

  1. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.


    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  2. Functional plasticity of paralogous diterpene synthases involved in conifer defense


    Keeling, Christopher I.; Weisshaar, Sabrina; Lin, Roy P. C.; Bohlmann, Jörg


    The diversity of terpenoid compounds produced by plants plays an important role in mediating various plant–herbivore, plant–pollinator, and plant–pathogen interactions. This diversity has resulted from gene duplication and neofunctionalization of the enzymes that synthesize and subsequently modify terpenes. Two diterpene synthases in Norway spruce (Picea abies), isopimaradiene synthase and levopimaradiene/abietadiene synthase, provide the hydrocarbon precursors for most of the diterpene resin...

  3. Contrasting evolutionary histories of MHC class I and class II loci in grouse—Effects of selection and gene conversion (United States)

    Minias, Piotr; Bateson, Zachary W.; Whittingham, Linda A.; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O.


    Genes of the major histocompatibility complex (MHC) encode receptor molecules that are responsible for recognition of intracellular and extracellular pathogens (class I and class II genes, respectively) in vertebrates. Given the different roles of class I and II MHC genes, one might expect the strength of selection to differ between these two classes. Different selective pressures may also promote different rates of gene conversion at each class. Despite these predictions, surprisingly few studies have looked at differences between class I and II genes in terms of both selection and gene conversion. Here, we investigated the molecular evolution of MHC class I and II genes in five closely related species of prairie grouse (Centrocercus and Tympanuchus) that possess one class I and two class II loci. We found striking differences in the strength of balancing selection acting on MHC class I versus class II genes. More than half of the putative antigen-binding sites (ABS) of class II were under positive or episodic diversifying selection, compared with only 10% at class I. We also found that gene conversion had a stronger role in shaping the evolution of MHC class II than class I. Overall, the combination of strong positive (balancing) selection and frequent gene conversion has maintained higher diversity of MHC class II than class I in prairie grouse. This is one of the first studies clearly demonstrating that macroevolutionary mechanisms can act differently on genes involved in the immune response against intracellular and extracellular pathogens.

  4. Riboflavin induces Metarhizium spp. to produce conidia with elevated tolerance to UV-B, and upregulates photolyases, laccases and polyketide synthases genes. (United States)

    Pereira-Junior, Ronaldo A; Huarte-Bonnet, Carla; Paixão, Flávia R S; Roberts, Donald W; Luz, Christian; Pedrini, Nicolás; Fernandes, Éverton K K


    The effect of nutritional supplementation of two Metarhizium species with riboflavin (Rb) during production of conidia was (a) evaluated on conidial tolerance (based on germination) to UV-B radiation and (b) on conidial expression following UV-B irradiation, of enzymes known to be active in photoreactivation, viz., photolyase (Phr), laccase (Lcc) and polyketide synthase (Pks). Metarhizium acridum (ARSEF 324) and Metarhizium robertsii (ARSEF 2575) were grown either on (a) potato dextrose agar medium (PDA), (b) PDA supplemented with 1% yeast extract (PDAY), (c) PDA supplemented with Rb (PDA+Rb), or (d) PDAY supplemented with Rb (PDAY+Rb). Resulting conidia were exposed to 866.7 mW m -2 of UV-B Quaite-weighted irradiance to total doses of 3.9 kJ m -2 or 6.24 kJ m -2 . Some conidia also were exposed to 16 klux of white light after being irradiated, or not, with UV-B to investigate the role of possible photoreactivation. Relative germination of conidia produced on PDA+Rb (regardless Rb concentration) or on PDAY and exposed to UV-B was higher compared to conidia cultivated on PDA without Rb supplement, or to conidia suspended in Rb solution immediately prior to UV-B exposure. The expression of MaLac3 and MaPks2 for M. acridum, as well as MrPhr2, MrLac1, MrLac2 and MrLac3 for M. robertsii was higher when the isolates were cultivated on PDA+Rb and exposed to UV-B followed by exposure to white light, or exposed to white light only. Rb in culture medium increase the UV-B tolerance of M. robertsii and M. acridum conidia, and which may be related to increased expression of photolyase, laccase and pks genes in these conidia. The enhanced UV-B tolerance of Metarhizium spp. conidia produced on Rb-enriched media may improve the effectiveness of these fungi in biological control programs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  5. A maize landrace that emits defense volatiles in response to herbivore eggs possesses a strongly inducible terpene synthase gene. (United States)

    Tamiru, Amanuel; Bruce, Toby J A; Richter, Annett; Woodcock, Christine M; Midega, Charles A O; Degenhardt, Jörg; Kelemu, Segenet; Pickett, John A; Khan, Zeyaur R


    Maize ( Zea mays ) emits volatile terpenes in response to insect feeding and egg deposition to defend itself against harmful pests. However, maize cultivars differ strongly in their ability to produce the defense signal. To further understand the agroecological role and underlying genetic mechanisms for variation in terpene emission among maize cultivars, we studied the production of an important signaling component ( E )-caryophyllene in a South American maize landrace Braz1006 possessing stemborer Chilo partellus egg inducible defense trait, in comparison with the European maize line Delprim and North American inbred line B73. The ( E) - caryophyllene production level and transcript abundance of TPS23, terpene synthase responsible for ( E) - caryophyllene formation, were compared between Braz1006, Delprim, and B73 after mimicked herbivory. Braz1006-TPS23 was heterologously expressed in E. coli , and amino acid sequences were determined. Furthermore, electrophysiological and behavioral responses of a key parasitic wasp Cotesia sesamiae to C .  partellus egg-induced Braz1006 volatiles were determined using coupled gas chromatography electroantennography and olfactometer bioassay studies. After elicitor treatment, Braz1006 released eightfold higher ( E) -caryophyllene than Delprim, whereas no ( E) -caryophyllene was detected in B73. The superior (E)- caryophyllene production by Braz1006 was positively correlated with high transcript levels of TPS23 in the landrace compared to Delprim. TPS23 alleles from Braz1006 showed dissimilarities at different sequence positions with Delprim and B73 and encodes an active enzyme. Cotesia sesamiae was attracted to egg-induced volatiles from Braz1006 and synthetic (E)- caryophyllene. The variation in ( E) -caryophyllene emission between Braz1006 and Delprim is positively correlated with induced levels of TPS23 transcripts. The enhanced TPS23 activity and corresponding ( E) -caryophyllene production by the maize landrace could be

  6. Gene targeting in embryonic stem cells, II: conditional technologies (United States)

    Genome modification via transgenesis has allowed researchers to link genotype and phenotype as an alternative approach to the characterization of random mutations through evolution. The synergy of technologies from the fields of embryonic stem (ES) cells, gene knockouts, and protein-mediated recombi...

  7. Investigation of a 6-MSA Synthase Gene Cluster in Aspergillus aculeatus Reveals 6-MSA-derived Aculinic Acid, Aculins A-B and Epi-Aculin A

    DEFF Research Database (Denmark)

    Petersen, Lene Maj; Holm, Dorte Koefoed; Gotfredsen, Charlotte Held


    . In this study we identified a 6-methylsalicylic acid (6-MSA) synthase from A. aculeatus, and verified its functionality by episomal expression in A. aculeatus and heterologous expression in A. nidulans. Feeding studies with fully 13C-labeled 6-MSA revealed that 6-MSA is incorporated into aculinic acid, which...

  8. DNA alkylating agents alleviate silencing of class II transactivator gene expression in L1210 lymphoma cells. (United States)

    Murphy, Shawn P; Holtz, Renae; Lewandowski, Nicole; Tomasi, Thomas B; Fuji, Hiroshi


    MHC class II (Ia) Ag expression is inversely correlated with tumorigenicity and directly correlated with immunogenicity in clones of the mouse L1210 lymphoma (1 ). Understanding the mechanisms by which class II Ag expression is regulated in L1210 lymphoma may facilitate the development of immunotherapeutic approaches for the treatment of some types of lymphoma and leukemia. This study demonstrates that the variation in MHC class II Ag expression among clones of L1210 lymphoma is due to differences in the expression of the class II transactivator (CIITA). Analysis of stable hybrids suggests that CIITA expression is repressed by a dominant mechanism in class II-negative L1210 clones. DNA-alkylating agents such as ethyl methanesulfonate and the chemotherapeutic drug melphalan activate CIITA and class II expression in class II negative L1210 cells, and this effect appears to be restricted to transformed cell lines derived from the early stages of B cell ontogeny. Transient transfection assays demonstrated that the CIITA type III promoter is active in class II(-) L1210 cells, despite the fact that the endogenous gene is not expressed, which suggests that these cells have all of the transacting factors necessary for CIITA transcription. An inverse correlation between methylation of the CIITA transcriptional regulatory region and CIITA expression was observed among L1210 clones. Furthermore, 5-azacytidine treatment activated CIITA expression in class II-negative L1210 cells. Collectively, our results suggest that 1) CIITA gene expression is repressed in class II(-) L1210 cells by methylation of the CIITA upstream regulatory region, and 2) treatment with DNA-alkylating agents overcomes methylation-based silencing of the CIITA gene in L1210 cells.

  9. [Correlation between epigenetic alterations in the insulin growth factor-II gene and hepatocellular carcinoma]. (United States)

    Dong, Zhi-zhen; Yao, Deng-fu; Wu, Wei; Qiu, Li-wei; Yao, Ning-hua; Yan, Xiao-di; Yu, Dan-dan; Chen, Jie


    To investigate whether epigenetic alterations in the insulin-like growth factor-II (IGF-II) gene that cause differential transcription or expression are correlated with onset and severity of hepatocellular carcinoma (HCC). Patient-matched specimens of HCC, paracancerous, and non-cancerous tissues were collected from 40 primary liver cancer patients. Epigenetic alterations in the promoter (P3) sequence of the IGF-II gene were analyzed by methylation-specific PCR (MSP) and IGF-II transcription was measured by RT-PCR. IGF-II protein expression and clinicopathological features were assessed by immunohistochemistry and microscopic observation. The rate of IGF-II P3 methylation was significantly lower in HCC tissues (0%) than in paracancerous tissues (vs. 47.5%; x2 = 24.918, P less than 0.001) and non-cancerous tissues (vs. 100%; x2 = 80.000, P less than 0.001). IGF-II mRNA expression was significantly higher in HCC tissues (100%) than in paracancerous tissues (vs. 52.5%; x2 = 24.918, P less than 0.001) and non-cancerous tissues (vs. 0%; x2 = 80.000, P less than 0.001). IGF-II protein expression was significantly higher in HCC tissues (82.5%) than in paracancerous tissues (vs. 45.0%; x2 = 12.170, P less than 0.001) and non-cancerous tissues (vs. 0%; x2 = 56.170, P less than 0.001). IGF-II overexpression in HCC was significantly associated with degree of differentiation, extent of infiltrated serosa, size of tumor, and HBV-positive infection status. Epigenetic alterations in the IGF-II gene regulate its transcription and expression and are closely associated with HCC development and progression.

  10. DNA sequence of the Peromyscus leucopus MHC class II gene Aa (MhcPeleAa)

    Energy Technology Data Exchange (ETDEWEB)

    Crew, M.D.; Bates, L.M. [Univ. of Arkansas for Medical Sciences, Little Rock, AR (United States)


    The genus Peromyscus has been extensively studied by populations biologists and ecologists for over eighty years, with P. leucopus (the white-footed mouse) being one of the most intensively investigated species. Polymorphic major histocompatibility complex (MHC) genes have proven useful in population genetic studies and might be helpful in understanding the population dynamics of Peromyscus species which are ubiquitously distributed over North and Central America. Polymorphism of P. leucopus MHC (MhcPele) class II genes was evident by restriction fragment length polymorphism (RFLP) analyses using human and mouse probes and Pele class II loci exhibited degrees of polymorphism similar to H2 class II genes (A-like>E-like). 8 refs., 2 figs.

  11. Interaction between alcohol dehydrogenase II gene, alcohol consumption, and risk for breast cancer


    St?rmer, T; Wang-Gohrke, S; Arndt, V; Boeing, H; Kong, X; Kreienberg, R; Brenner, H


    MaeIII Restriction Fragment Length Polymorphism in exon 3 of the alcohol dehydrogenase II was assessed in serum from 467 randomly selected German women and 278 women with invasive breast cancer to evaluate the interaction between a polymorphism of the alcohol dehydrogenase II gene, alcohol consumption and risk for breast cancer. In both groups, usual consumption of different alcoholic beverages was asked for using semiquantitative food frequency questionnaires. We used multivariable logistic ...

  12. Angiotensin-II type 1 receptor gene polymorphism and diabetic microangiopathy

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P


    the relationship between the A1166-->C polymorphism in the angiotensin-II type 1 receptor gene in patients with insulin dependent diabetes mellitus (IDDM) and diabetic nephropathy (121 men, 77 women, age 41 +/- 10 years, diabetes duration 27 +/- 8 years) and in IDDM patients with normoalbuminuria (116 men, 74...... with proliferative retinopathy and without diabetic retinopathy was found either: 77 (50%) / 66 (42%) / 13 (8%) vs. 42 (63%) / 22 (33%) / 3 (4%) had AA/AC/CC genotypes, respectively. CONCLUSIONS: The A1166-->C polymorphism in the angiotensin-II type 1 receptor gene does not contribute to the genetic susceptibility...

  13. Epigenetic regulation of HLA class II genes and their role in autoimmune diseases.


    Čepek, Pavel


    Abstract Background: Type 1 diabetes (T1D) is a multifactorial autoimmune disease. Its incidence in Europe is continuously rising. The highest T1D risk is associated with HLA (human leukocyte antigen) class II genes. HLA class II molecules play a key role in regulation of immune response. They contribute to the selection of T cell repertoire by presenting antigenic peptides to the CD4+ T lymphocytes. HLA class II expression is controlled by regulatory module that is situated 150 - 300 base pa...

  14. Virus-Induced Gene Silencing-Based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato. (United States)

    Zhang, Huijuan; Hong, Yongbo; Huang, Lei; Liu, Shixia; Tian, Limei; Dai, Yi; Cao, Zhongye; Huang, Lihong; Li, Dayong; Song, Fengming


    Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development, and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs, and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs, and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst) DC3000 as well as to defense signaling hormones (e.g., salicylic acid, jasmonic acid, and a precursor of ethylene). Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4, or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7, or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7, and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.

  15. Virus-induced Gene Silencing-based Functional Analyses Revealed the Involvement of Several Putative Trehalose-6-Phosphate Synthase/Phosphatase Genes in Disease Resistance against Botrytis cinerea and Pseudomonas syringae pv. tomato DC3000 in Tomato

    Directory of Open Access Journals (Sweden)

    Huijuan Zhang


    Full Text Available Trehalose and its metabolism have been demonstrated to play important roles in control of plant growth, development and stress responses. However, direct genetic evidence supporting the functions of trehalose and its metabolism in defense response against pathogens is lacking. In the present study, genome-wide characterization of putative trehalose-related genes identified 11 SlTPSs for trehalose-6-phosphate synthase, 8 SlTPPs for trehalose-6-phosphate phosphatase and one SlTRE1 for trehalase in tomato genome. Nine SlTPSs, 4 SlTPPs and SlTRE1 were selected for functional analyses to explore their involvement in tomato disease resistance. Some selected SlTPSs, SlTPPs and SlTRE1 responded with distinct expression induction patterns to Botrytis cinerea and Pseudomonas syringae pv. tomato (Pst DC3000 as well as to defense signaling hormones (e.g. salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-mediated silencing of SlTPS3, SlTPS4 or SlTPS7 led to deregulation of ROS accumulation and attenuated the expression of defense-related genes upon pathogen infection and thus deteriorated the resistance against B. cinerea or Pst DC3000. By contrast, silencing of SlTPS5 or SlTPP2 led to an increased expression of the defense-related genes upon pathogen infection and conferred an increased resistance against Pst DC3000. Silencing of SlTPS3, SlTPS4, SlTPS5, SlTPS7 or SlTPP2 affected trehalose level in tomato plants with or without infection of B. cinerea or Pst DC3000. These results demonstrate that SlTPS3, SlTPS4, SlTPS5, SlTPS7 and SlTPP2 play roles in resistance against B. cinerea and Pst DC3000, implying the importance of trehalose and tis metabolism in regulation of defense response against pathogens in tomato.

  16. SVMRFE based approach for prediction of most discriminatory gene target for type II diabetes

    Directory of Open Access Journals (Sweden)

    Atul Kumar


    Full Text Available Type II diabetes is a chronic condition that affects the way our body metabolizes sugar. The body's important source of fuel is now becoming a chronic disease all over the world. It is now very necessary to identify the new potential targets for the drugs which not only control the disease but also can treat it. Support vector machines are the classifier which has a potential to make a classification of the discriminatory genes and non-discriminatory genes. SVMRFE a modification of SVM ranks the genes based on their discriminatory power and eliminate the genes which are not involved in causing the disease. A gene regulatory network has been formed with the top ranked coding genes to identify their role in causing diabetes. To further validate the results pathway study was performed to identify the involvement of the coding genes in type II diabetes. The genes obtained from this study showed a significant involvement in causing the disease, which may be used as a potential drug target.

  17. The human HLA class II alpha chain gene DZ alpha is distinct from genes in the DP, DQ and DR subregions.


    Trowsdale, J; Kelly, A


    A new human HLA class II alpha gene DZ alpha was sequenced. The structure and organisation of the gene was similar to other alpha chain genes except for a particularly small intron (95 bp) after the exon encoding the alpha 2 domain, and the position of the stop codon, which was on a different exon to that encoding the cytoplasmic portion of the molecule. Comparison of the DZ alpha sequence with other class II genes showed that the gene is about as distantly related to alpha chain genes in the...

  18. Prognostic significance of gene amplification of ACTN4 in stage I and II oral tongue cancer. (United States)

    Kakuya, T; Mori, T; Yoshimoto, S; Watabe, Y; Miura, N; Shoji, H; Onidani, K; Shibahara, T; Honda, K


    Despite complete resection of the early stage of oral tongue cancer by partial glossectomy, late cervical lymph node metastasis is frequently observed. Gene amplification of ACTN4 (protein name: actinin-4) is closely associated with the metastatic potential of various cancers. This retrospective study was performed to demonstrate the potential usefulness of ACTN4 gene amplification as a prognostic biomarker in patients with stage I/II oral tongue cancer. Fifty-four patients with stage I/II oral tongue cancer were enrolled retrospectively, in accordance with the reporting recommendations for tumour marker prognostic studies (REMARK) guidelines. The copy number of ACTN4 and the protein expression of actinin-4 were evaluated by fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC), respectively. The overall survival time of patients with gene amplification of ACTN4 was significantly shorter than that of patients without gene amplification (P=0.0010, log-rank test). Gene amplification of ACTN4 was a significant independent risk factor for death in patients with stage I/II oral tongue cancer (hazard ratio 6.08, 95% confidence interval 1.66-22.27). Gene amplification of ACTN4 is a potential prognostic biomarker for overall survival in oral tongue cancer. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Dynamic bookmarking of primary response genes by p300 and RNA polymerase II complexes. (United States)

    Byun, Jung S; Wong, Madeline M; Cui, Wenwu; Idelman, Gila; Li, Quentin; De Siervi, Adriana; Bilke, Sven; Haggerty, Cynthia M; Player, Audrey; Wang, Yong Hong; Thirman, Michael J; Kaberlein, Joseph J; Petrovas, Constantinos; Koup, Richard A; Longo, Dan; Ozato, Keiko; Gardner, Kevin


    Profiling the dynamic interaction of p300 with proximal promoters of human T cells identified a class of genes that rapidly coassemble p300 and RNA polymerase II (pol II) following mitogen stimulation. Several of these p300 targets are immediate early genes, including FOS, implicating a prominent role for p300 in the control of primary genetic responses. The recruitment of p300 and pol II rapidly transitions to the assembly of several elongation factors, including the positive transcriptional elongation factor (P-TEFb), the bromodomain-containing protein (BRD4), and the elongin-like eleven nineteen lysine-rich leukemia protein (ELL). However, transcription at many of these rapidly induced genes is transient, wherein swift departure of P-TEFb, BRD4, and ELL coincides with termination of transcriptional elongation. Unexpectedly, both p300 and pol II remain accumulated or "bookmarked" at the proximal promoter long after transcription has terminated, demarking a clear mechanistic separation between the recruitment and elongation phases of transcription in vivo. The bookmarked pol II is depleted of both serine-2 and serine-5 phosphorylation of its C-terminal domain and remains proximally positioned at the promoter for hours. Surprisingly, these p300/pol II bookmarked genes can be readily reactivated, and elongation factors can be reassembled by subsequent addition of nonmitogenic agents that, alone, have minimal effects on transcription in the absence of prior preconditioning by mitogen stimulation. These findings suggest that p300 is likely to play an important role in biological processes in which transcriptional bookmarking or preconditioning influences cellular growth and development through the dynamic priming of genes for response to rechallenge by secondary stimuli.

  20. Cloning and expression analysis of 1-deoxy-D-xylulose-5-phosphate synthase gene from the medicinal plant Conyza blinii H.Lév.


    SUN, Rong; LIU, Shan; GAO, Jing-Lei; TANG, Zi-Zhong; CHEN, Hui; LI, Cheng-Lei; WU, Qi


    Conyza blinii H.Lév. is a traditional Chinese medicinal plant that is distributed mainly in southwestern Sichuan and northern Yunnan. Its characteristic product is blinin, which has, among other properties, antigastric ulcer activity, and can serve as a quality-control standard for such medicine. The problem is that C. blinii only produces low yields of blinin. As a diterpene, blinin is likely formed by the methylerythritol phosphate pathway. While 1-deoxy-D-xylulose-5-phosphate synthase (DXS...

  1. One amino acid makes the difference: the formation of ent-kaurene and 16α-hydroxy-ent-kaurane by diterpene synthases in poplar. (United States)

    Irmisch, Sandra; Müller, Andrea T; Schmidt, Lydia; Günther, Jan; Gershenzon, Jonathan; Köllner, Tobias G


    Labdane-related diterpenoids form the largest group among the diterpenes. They fulfill important functions in primary metabolism as essential plant growth hormones and are known to function in secondary metabolism as, for example, phytoalexins. The biosynthesis of labdane-related diterpenes is mediated by the action of class II and class I diterpene synthases. Although terpene synthases have been well investigated in poplar, little is known about diterpene formation in this woody perennial plant species. The recently sequenced genome of Populus trichocarpa possesses two putative copalyl diphosphate synthase genes (CPS, class II) and two putative kaurene synthase genes (KS, class I), which most likely arose through a genome duplication and a recent tandem gene duplication, respectively. We showed that the CPS-like gene PtTPS17 encodes an ent-copalyl diphosphate synthase (ent-CPS), while the protein encoded by the putative CPS gene PtTPS18 showed no enzymatic activity. The putative kaurene synthases PtTPS19 and PtTPS20 both accepted ent-copalyl diphosphate (ent-CPP) as substrate. However, despite their high sequence similarity, they produced different diterpene products. While PtTPS19 formed exclusively ent-kaurene, PtTPS20 generated mainly the diterpene alcohol, 16α-hydroxy-ent-kaurane. Using homology-based structure modeling and site-directed mutagenesis, we demonstrated that one amino acid residue determines the different product specificity of PtTPS19 and PtTPS20. A reciprocal exchange of methionine 607 and threonine 607 in the active sites of PtTPS19 and PtTPS20, respectively, led to a complete interconversion of the enzyme product profiles. Gene expression analysis revealed that the diterpene synthase genes characterized showed organ-specific expression with the highest abundance of PtTPS17 and PtTPS20 transcripts in poplar roots. The poplar diterpene synthases PtTPS17, PtTPS19, and PtTPS20 contribute to the production of ent-kaurene and 16

  2. Association of polymorphisms in avian apoVLDL-II gene with body ...

    African Journals Online (AJOL)

    Association of polymorphisms in avian apoVLDL-II gene with body weight and abdominal fat weight. HH Musa, GH Chen ... Blood samples from the respective populations were taken for DNA extraction, and then slaughter for fat determination. Polymorphism was detected by PCR-RFLP and PCR-SSCP techniques.

  3. Prdm5 Regulates Collagen Gene Transcription by Association with RNA Polymerase II in Developing Bone

    DEFF Research Database (Denmark)

    Galli, Giorgio Giacomo; Honnens de Lichtenberg, Kristian; Carrara, Matteo


    and fibrillogenesis by binding inside the Col1a1 gene body and maintaining RNA polymerase II occupancy. In vivo, Prdm5 loss results in delayed ossification involving a pronounced impairment in the assembly of fibrillar collagens. Collectively, our results define a novel role for Prdm5 in sustaining...

  4. Normal HLA class I, II, and MICA gene distribution in uveal melanoma.

    NARCIS (Netherlands)

    Metzelaar-Blok, J.A.; Hurks, H.M.; Naipal, A.; Lange, P. de; Keunen, J.E.E.; Claas, F.; Doxiadis, I.I.; Jager, M.J.


    PURPOSE: The molecules of the HLA class I and II molecules as well as the MHC class I chain-related gene A (MICA), a polymorphic and stress-induced cell surface molecule, are involved in T-cell and natural killer-cell (NK-cell) mediated immune responses. In this study we looked for any genetic

  5. Prevalence of qnr, intI, and intII genes in extendedspectrum beta ...

    African Journals Online (AJOL)

    Purpose: To investigate the prevalence of qnr, intI, and intII genes in extended spectrum betalactamase (ESBL)-producing Escherichia coli isolated from clinical samples in Kerman, Iran. Methods: A total of 127 E. coli were collected from clinical samples in Kerman hospitals. The antibiotic susceptibility test was performed ...

  6. DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis

    DEFF Research Database (Denmark)

    Morling, N; Friis, J; Fugger, L


    We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...

  7. DNA polymorphism of HLA class II genes in primary biliary cirrhosis

    DEFF Research Database (Denmark)

    Morling, Niels; Dalhoff, K; Fugger, L


    We investigated the DNA restriction fragment length polymorphism of the major histocompatibility complex class II genes: HLA-DRB, -DQA, -DQB, DPA, -DPB, the serologically defined HLA-A, B, C, DR antigens, and the primed lymphocyte typing defined HLA-DP antigens in 23 Danish patients with primary ...

  8. Inflammatory bowel disease associations with HLA Class II genes

    Energy Technology Data Exchange (ETDEWEB)

    Castro, R. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); Yang, H.; Targan, S. [Roche Molecular Systems, Inc., Alameda, CA (United States)] [and others


    A PCR-SSOP assay has been used to analyze HLA-Class II DRB1 and DQB1 alleles in 378 Caucasians from a population in Southern California. The data has been analyzed separately for the Ashkenasi Jews and non-Jewish patients (n=286) and controls (n=92). Two common clinical forms of inflammatory bowel disease (IBD) have been studied: ulcerative colitis (UC) and Crohn`s disease (CD). In CD, we observed a susceptible effect with the rare DR1 allele - DRB*0103 [O.R.=4.56; 95% CI (0.96, 42.97); p=0.03]; a trend for an increase in DRB1*0103 was also observed in UC patients. A susceptible effect with DRB1*1502 [O.R.=5.20; 95% CI (1.10, 48.99); p=0.02] was observed in non-Jewish UC patients. This susceptible effect was restricted to UC ANCA-positive (antineutrophil cytoplasmic antibodies) patients. In addition, a significant association with DRB1*1101-DQB1*0301 [O.R.=9.46; 95% CI (1.30, 413.87); p=0.01] was seen with UC among non-Jewish patients: this haplotype was increased with CD among non-Jewish patients. Two protective haplotypes were detected among CD non-Jewish patients: DRB1*1301-DQB1*0603 [O.R.=0.34; 95% CI (0.09, 1.09); p=0.04], and DRB*0404-DQB1*0302 [O.R.=<0.08; 95% CI (0.0, 0.84); p=0.01]. When the same data were analyzed at the serology level, we observed a positive association in UC with DR2 [O.R.6.77; 95% CI (2.47, 22.95); p=2 x 10{sup -4}], and a positive association in CD with DR1 [O.R.=2.63; 95% CI (1.14, 6.62); p=0.01] consistent with previous reports. Thus, some IBD disease associations appear to be common to both UC and CD, while some are unique to one disease.

  9. Gene conversion in the CYP11B2 gene encoding P450c11AS is associated with, but does not cause, the syndrome of corticosterone methyloxidase II deficiency

    Energy Technology Data Exchange (ETDEWEB)

    Fardella, C.E.; Hum, D.W.; Rodriguez, H. [Univ. of California, San Francisco, CA (United States)]|[Univ. of Colorado, Denver, CO (United States)] [and others


    Cytochrome P450c11AS (aldosterone synthase) has 11{beta}hydroxylase, 18-hydroxylase, and 18-oxidase activities and is expressed solely in the adrenal zona glomerulosa. Corticosterone methyloxidase II (CMOII) deficiency denotes a rare disorder of adrenal steroidogenesis in which only the 18-oxidase activity of P450c11AS is disrupted, while the 11{beta}-hydroxylase and 18-hydroxylase activities persist. Such patients have elevated serum concentrations of corticosterone and 18-hydroxycorticosterone and very low or unmeasurable concentrations of aldosterone, often resulting in a clinical salt-losing crisis in infancy. We have sought mutations causing CMOII deficiency in outbred populations. In three of four unrelated P450c11AS alleles from two unrelated patients with CMOII deficiency, we found a gene conversion event in which exons 3 and 4 of the CYP11B2 gene encoding P450c11AS were changed to the sequence of the nearby CYP11B1 gene, which encodes the related enzyme P450c11{beta}. This conversion resulted in a mutant P450c11AS protein carrying three changes. We built seven vectors expressing P450c11AS carrying each mutation singly, each of the three possible pairs of mutations, and the triple mutation as found in the proband. The activities in steroidogenic MA-10 and JEG-3 cells were 10- to 20-fold higher. In these systems all of the mutants retained normal 18-oxidase activity, indicating that the detected gene conversion event is associated with but does not cause CMOII deficiency. None of the four CPY11B2 alleles in these two patients bore other identifiable mutations. These patients might have mutations in the promoters or other noncoding regions, or mutations in genes other than CYP11B2 may cause the syndrome of CMOII deficiency. 37 refs., 2 figs., 2 tabs.

  10. Regulation of major histocompatibility complex class II gene expression in trophoblast cells

    Directory of Open Access Journals (Sweden)

    Choi Jason C


    Full Text Available Abstract Trophoblast cells are unique because they are one of the few mammalian cell types that do not express major histocompatibility complex (MHC class II antigens, either constitutively or after exposure to IFN-γ. The absence of MHC class II antigen expression on trophoblast cells has been postulated to be one of the essential mechanisms by which the semi-allogeneic fetus evades immune rejection reactions by the maternal immune system. Consistent with this hypothesis, trophoblast cells from the placentas of women suffering from chronic inflammation of unknown etiology and spontaneous recurrent miscarriages have been reported to aberrantly express MHC class II antigens. The lack of MHC class II antigen expression on trophoblast cells is due to silencing of expression of the class II transactivator (CIITA, a transacting factor that is essential for constitutive and IFN-γ-inducible MHC class II gene transcription. Transfection of trophoblast cells with CIITA expression vectors activates both MHC class II and class Ia antigen expression, which confers on trophoblast cells both the ability to activate helper T cells, and sensitivity to lysis by cytotoxic T lymphocytes. Collectively, these studies strongly suggest that stringent silencing of CIITA (and therefore MHC class II gene expression in trophoblast cells is critical for the prevention of immune rejection responses against the fetus by the maternal immune system. The focus of this review is to summarize studies examining the novel mechanisms by which CIITA is silenced in trophoblast cells. The elucidation of the silencing of CIITA in trophoblast cells may shed light on how the semi-allogeneic fetus evades immune rejection by the maternal immune system during pregnancy.

  11. Inhibition of Nitric Oxide Synthesis and Gene Knockout of Neuronal Nitric Oxide Synthase Impaired Adaptation of Mouse Optokinetic Response Eye Movements


    Katoh, Akira; Kitazawa, Hiromasa; Itohara, Shigeyoshi; Nagao, Soichi


    Nitric oxide (NO) plays a key role in synaptic transmission efficiency in the central nervous system. To gain an insight on the role of NO in cerebellar functions, we, here, measured the dynamics of the horizontal optokinetic response (HOKR) and vestibulo-ocular reflex (HVOR), and the adaptation of HOKR in mice locally injected with NG-monomethyl-l-arginine (L-NMMA) that inhibits NO synthesis and in mice devoid of neuronal nitric oxide synthase (nNOS). Local application of L-NMMA into the cer...

  12. Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene

    International Nuclear Information System (INIS)

    Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.


    The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region

  13. Dentin phosphoprotein gene locus is not associated with dentinogenesis imperfecta types II and III

    Energy Technology Data Exchange (ETDEWEB)

    MacDougall, M.; Zeichner-David, M.; Davis, A.; Slavkin, H. (Univ. of Southern California, Los Angeles (United States)); Murray, J. (Univ. of Iowa, Iowa City (United States)); Crall, M. (Ohio State Univ., Columbus (United States))


    Dentinogenesis imperfecta (DGI) is an autosomal dominant inherited dental disease which affects dentin production and mineralization. Genetic linkage studies have been performed on several multigeneration informative kindreds. These studies determined linkage between DGI types II and III and group-specific component (vitamin D-binding protein). This gene locus has been localized to the long arm of human chromosome 4 in the region 4q11-q21. Although this disease has been mapped to chromosome 4, the defective gene product is yet to be determined. Biochemical studies have suggested abnormal levels of dentin phosphoprotein (DPP) associated with DGI type II. This highly acidic protein is the major noncollagenous component of dentin, being solely expressed by the ectomesenchymal derived odontoblast cells of the tooth. The purpose of the present study was to establish whether DPP is associated with DGI types II and III, by using molecular biology techniques. The results indicated that DPP is not localized to any region of human chromosome 4, thus suggesting that the DPP gene is not directly associated with DGI type II or DGI type III. The data do not exclude the possibility that other proteins associated with DPP posttranslational modifications might be responsible for this genetic disease.

  14. How the nucleus and mitochondria communicate in energy production during stress: nuclear MtATP6, an early-stress responsive gene, regulates the mitochondrial F₁F₀-ATP synthase complex. (United States)

    Moghadam, Ali Asghar; Ebrahimie, Eemaeil; Taghavi, Seyed Mohsen; Niazi, Ali; Babgohari, Mahbobeh Zamani; Deihimi, Tahereh; Djavaheri, Mohammad; Ramezani, Amin


    A small number of stress-responsive genes, such as those of the mitochondrial F1F0-ATP synthase complex, are encoded by both the nucleus and mitochondria. The regulatory mechanism of these joint products is mysterious. The expression of 6-kDa subunit (MtATP6), a relatively uncharacterized nucleus-encoded subunit of F0 part, was measured during salinity stress in salt-tolerant and salt-sensitive cultivated wheat genotypes, as well as in the wild wheat genotypes, Triticum and Aegilops using qRT-PCR. The MtATP6 expression was suddenly induced 3 h after NaCl treatment in all genotypes, indicating an early inducible stress-responsive behavior. Promoter analysis showed that the MtATP6 promoter includes cis-acting elements such as ABRE, MYC, MYB, GTLs, and W-boxes, suggesting a role for this gene in abscisic acid-mediated signaling, energy metabolism, and stress response. It seems that 6-kDa subunit, as an early response gene and nuclear regulatory factor, translocates to mitochondria and completes the F1F0-ATP synthase complex to enhance ATP production and maintain ion homeostasis under stress conditions. These communications between nucleus and mitochondria are required for inducing mitochondrial responses to stress pathways. Dual targeting of 6-kDa subunit may comprise as a mean of inter-organelle communication and save energy for the cell. Interestingly, MtATP6 showed higher and longer expression in the salt-tolerant wheat and the wild genotypes compared to the salt-sensitive genotype. Apparently, salt-sensitive genotypes have lower ATP production efficiency and weaker energy management than wild genotypes; a stress tolerance mechanism that has not been transferred to cultivated genotypes.

  15. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

    Directory of Open Access Journals (Sweden)

    Ritland Carol


    Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene

  16. Insulin gene polymorphisms in type 1 diabetes, Addison's disease and the polyglandular autoimmune syndrome type II

    Directory of Open Access Journals (Sweden)

    Hahner Stefanie


    Full Text Available Abstract Background Polymorphisms within the insulin gene can influence insulin expression in the pancreas and especially in the thymus, where self-antigens are processed, shaping the T cell repertoire into selftolerance, a process that protects from β-cell autoimmunity. Methods We investigated the role of the -2221Msp(C/T and -23HphI(A/T polymorphisms within the insulin gene in patients with a monoglandular autoimmune endocrine disease [patients with isolated type 1 diabetes (T1D, n = 317, Addison's disease (AD, n = 107 or Hashimoto's thyroiditis (HT, n = 61], those with a polyglandular autoimmune syndrome type II (combination of T1D and/or AD with HT or GD, n = 62 as well as in healthy controls (HC, n = 275. Results T1D patients carried significantly more often the homozygous genotype "CC" -2221Msp(C/T and "AA" -23HphI(A/T polymorphisms than the HC (78.5% vs. 66.2%, p = 0.0027 and 75.4% vs. 52.4%, p = 3.7 × 10-8, respectively. The distribution of insulin gene polymorphisms did not show significant differences between patients with AD, HT, or APS-II and HC. Conclusion We demonstrate that the allele "C" of the -2221Msp(C/T and "A" -23HphI(A/T insulin gene polymorphisms confer susceptibility to T1D but not to isolated AD, HT or as a part of the APS-II.

  17. Evolution of major histocompatibility complex class I and class II genes in the brown bear (United States)


    Background Major histocompatibility complex (MHC) proteins constitute an essential component of the vertebrate immune response, and are coded by the most polymorphic of the vertebrate genes. Here, we investigated sequence variation and evolution of MHC class I and class II DRB, DQA and DQB genes in the brown bear Ursus arctos to characterise the level of polymorphism, estimate the strength of positive selection acting on them, and assess the extent of gene orthology and trans-species polymorphism in Ursidae. Results We found 37 MHC class I, 16 MHC class II DRB, four DQB and two DQA alleles. We confirmed the expression of several loci: three MHC class I, two DRB, two DQB and one DQA. MHC class I also contained two clusters of non-expressed sequences. MHC class I and DRB allele frequencies differed between northern and southern populations of the Scandinavian brown bear. The rate of nonsynonymous substitutions (dN) exceeded the rate of synonymous substitutions (dS) at putative antigen binding sites of DRB and DQB loci and, marginally significantly, at MHC class I loci. Models of codon evolution supported positive selection at DRB and MHC class I loci. Both MHC class I and MHC class II sequences showed orthology to gene clusters found in the giant panda Ailuropoda melanoleuca. Conclusions Historical positive selection has acted on MHC class I, class II DRB and DQB, but not on the DQA locus. The signal of historical positive selection on the DRB locus was particularly strong, which may be a general feature of caniforms. The presence of MHC class I pseudogenes may indicate faster gene turnover in this class through the birth-and-death process. South–north population structure at MHC loci probably reflects origin of the populations from separate glacial refugia. PMID:23031405

  18. Evolution of major histocompatibility complex class I and class II genes in the brown bear

    Directory of Open Access Journals (Sweden)

    Kuduk Katarzyna


    Full Text Available Abstract Background Major histocompatibility complex (MHC proteins constitute an essential component of the vertebrate immune response, and are coded by the most polymorphic of the vertebrate genes. Here, we investigated sequence variation and evolution of MHC class I and class II DRB, DQA and DQB genes in the brown bear Ursus arctos to characterise the level of polymorphism, estimate the strength of positive selection acting on them, and assess the extent of gene orthology and trans-species polymorphism in Ursidae. Results We found 37 MHC class I, 16 MHC class II DRB, four DQB and two DQA alleles. We confirmed the expression of several loci: three MHC class I, two DRB, two DQB and one DQA. MHC class I also contained two clusters of non-expressed sequences. MHC class I and DRB allele frequencies differed between northern and southern populations of the Scandinavian brown bear. The rate of nonsynonymous substitutions (dN exceeded the rate of synonymous substitutions (dS at putative antigen binding sites of DRB and DQB loci and, marginally significantly, at MHC class I loci. Models of codon evolution supported positive selection at DRB and MHC class I loci. Both MHC class I and MHC class II sequences showed orthology to gene clusters found in the giant panda Ailuropoda melanoleuca. Conclusions Historical positive selection has acted on MHC class I, class II DRB and DQB, but not on the DQA locus. The signal of historical positive selection on the DRB locus was particularly strong, which may be a general feature of caniforms. The presence of MHC class I pseudogenes may indicate faster gene turnover in this class through the birth-and-death process. South–north population structure at MHC loci probably reflects origin of the populations from separate glacial refugia.

  19. Evolution of major histocompatibility complex class I and class II genes in the brown bear. (United States)

    Kuduk, Katarzyna; Babik, Wiesław; Bojarska, Katarzyna; Sliwińska, Ewa B; Kindberg, Jonas; Taberlet, Pierre; Swenson, Jon E; Radwan, Jacek


    Major histocompatibility complex (MHC) proteins constitute an essential component of the vertebrate immune response, and are coded by the most polymorphic of the vertebrate genes. Here, we investigated sequence variation and evolution of MHC class I and class II DRB, DQA and DQB genes in the brown bear Ursus arctos to characterise the level of polymorphism, estimate the strength of positive selection acting on them, and assess the extent of gene orthology and trans-species polymorphism in Ursidae. We found 37 MHC class I, 16 MHC class II DRB, four DQB and two DQA alleles. We confirmed the expression of several loci: three MHC class I, two DRB, two DQB and one DQA. MHC class I also contained two clusters of non-expressed sequences. MHC class I and DRB allele frequencies differed between northern and southern populations of the Scandinavian brown bear. The rate of nonsynonymous substitutions (dN) exceeded the rate of synonymous substitutions (dS) at putative antigen binding sites of DRB and DQB loci and, marginally significantly, at MHC class I loci. Models of codon evolution supported positive selection at DRB and MHC class I loci. Both MHC class I and MHC class II sequences showed orthology to gene clusters found in the giant panda Ailuropoda melanoleuca. Historical positive selection has acted on MHC class I, class II DRB and DQB, but not on the DQA locus. The signal of historical positive selection on the DRB locus was particularly strong, which may be a general feature of caniforms. The presence of MHC class I pseudogenes may indicate faster gene turnover in this class through the birth-and-death process. South-north population structure at MHC loci probably reflects origin of the populations from separate glacial refugia.

  20. Down-regulation of the glucan synthase-like 6 gene (HvGsl6) in barley leads to decreased callose accumulation and increased cell wall penetration by Blumeria graminis f. sp. hordei. (United States)

    Chowdhury, Jamil; Schober, Michael S; Shirley, Neil J; Singh, Rohan R; Jacobs, Andrew K; Douchkov, Dimitar; Schweizer, Patrick; Fincher, Geoffrey B; Burton, Rachel A; Little, Alan


    The recent characterization of the polysaccharide composition of papillae deposited at the barley cell wall during infection by the powdery mildew pathogen, Blumeria graminis f. sp. hordei (Bgh), has provided new targets for the generation of enhanced disease resistance. The role of callose in papilla-based penetration resistance of crop species is largely unknown because the genes involved in the observed callose accumulation have not been identified unequivocally. We have employed both comparative and functional genomics approaches to identify the functional orthologue of AtGsl5 in the barley genome. HvGsl6 (the barley glucan synthase-like 6 gene), which has the highest sequence identity to AtGsl5, is the only Bgh-induced gene among the HvGsls examined in this study. Through double-stranded RNA interference (dsRNAi)-mediated silencing of HvGsl6, we have shown that the down-regulation of HvGsl6 is associated with a lower accumulation of papillary and wound callose and a higher susceptibility to penetration of the papillae by Bgh, compared with control lines. The results indicate that the HvGsl6 gene is a functional orthologue of AtGsl5 and is involved in papillary callose accumulation in barley. The increased susceptibility of HvGsl6 dsRNAi transgenic lines to infection indicates that callose positively contributes to the barley fungal penetration resistance mechanism. © 2016 University of Adelaide. New Phytologist © 2016 New Phytologist Trust.

  1. Cloning, characterization, and regulation of the human type II IMP dehydrogenase gene

    Energy Technology Data Exchange (ETDEWEB)

    Glesne, D.A.; Huberman, E. [Argonne National Lab., IL (United States). Center for Mechanistic Biology and Biotechnology]|[Univ. of Chicago, IL (United States)


    Human type II inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC is the rate-limiting enzyme in de novo guanine nucleotide biosynthesis. Regulated IMPDH activity is associated with cellular proliferation, transformation, and differentiation. The authors cloned and sequenced the entire gene for type II IMPDH and here provide details regarding the organization of the gene and the characterization of its promoter. The gene spans approximately 5 kb and is disrupted by 12 introns. The transcriptional start sites were determined by S1 nuclease mapping to be somewhat heterogeneous but predominated at 102 and 85 nucleotides from the translational initiation codon. Through the use of heterologous gene constructs and transient transfection assays, a minimal promoter from {minus}206 to {minus}85 was defined. This promoter is TATA-less and contains several transcription factor motifs including four potential Sp 1 binding sites. The minimal promoter is GC-rich (69%) and resembles a CpG island. Through the use of gel mobility shift assays, nuclear proteins were shown to specifically interact with this minimal promoter. Stable transfectants were used to demonstrate that the down-regulation of IMPDH gene expression in response to reduced cellular proliferation occurs by a transcriptional mechanism.

  2. Characterization of the major histocompatibility complex class II genes in miiuy croaker.

    Directory of Open Access Journals (Sweden)

    Tianjun Xu

    Full Text Available Major histocompatibility complex (MHC has a central role in the adaptive immune system by presenting foreign peptide to the T-cell receptor. In order to study the molecular function and genomic characteristic of class II genes in teleost, the full lengths of MHC class IIA and IIB cDNA and genomic sequence were cloned from miiuy croaker (Miichthys miiuy. As in other teleost, four exons and three introns were identified in miiuy croaker class IIA gene; but the difference is that six exons and five introns were identified in the miiuy croaker class IIB gene. The deduced amino acid sequence of class IIA and class IIB had 26.3-85.7% and 11.0-88.8% identity with those of mammal and teleost, respectively. Real-time quantitative RT-PCR demonstrated that the MHC class IIA and IIB were ubiquitously expressed in ten normal tissues; expression levels of MHC genes were found first upregulated and then downregulated, and finally by a recovery to normal level throughout the pathogenic bacteria infection process. In addition, we report on the underlying mechanism that maintains sequences diversity among many fish species. A series of site-model tests implemented in the CODEML program revealed that positive Darwinian selection is likely the cause of the molecular evolution in the fish MHC class II genes.

  3. Major histocompatibility (MH) class II ß gene polymorphism influences disease resistance of common carp (Cyprinus carpio L.)

    NARCIS (Netherlands)

    Rakus, K.L.; Wiegertjes, G.F.; Jurecka, P.M.; Walker, P.D.; Pilarczyk, A.; Irnazarow, I.


    Genes of the major histocompatibility complex (MHC) are crucial elements of adaptive immunity. High polymorphism renders the MHC genes highly suitable for studies on association with disease resistance. In common carp (Cyprinus carpio L.), there are two paralogous groups of MH class II B genes,

  4. The roles of MHC class II genes and post-translational modification in celiac disease. (United States)

    Sollid, Ludvig M


    Our increasing understanding of the etiology of celiac disease, previously considered a simple food hypersensitivity disorder caused by an immune response to cereal gluten proteins, challenges established concepts of autoimmunity. HLA is a chief genetic determinant, and certain HLA-DQ allotypes predispose to the disease by presenting posttranslationally modified (deamidated) gluten peptides to CD4 + T cells. The deamidation of gluten peptides is mediated by transglutaminase 2. Strikingly, celiac disease patients generate highly disease-specific autoantibodies to the transglutaminase 2 enzyme. The dual role of transglutaminase 2 in celiac disease is hardly coincidental. This paper reviews the genetic mapping and involvement of MHC class II genes in disease pathogenesis, and discusses the evidence that MHC class II genes, via the involvement of transglutaminase 2, influence the generation of celiac disease-specific autoantibodies.

  5. Role of type II protein arginine methyltransferase 5 in the regulation of Circadian Per1 gene.

    Directory of Open Access Journals (Sweden)

    Jungtae Na

    Full Text Available Circadian clocks are the endogenous oscillators that regulate rhythmic physiological and behavioral changes to correspond to daily light-dark cycles. Molecular dissections have revealed that transcriptional feedback loops of the circadian clock genes drive the molecular oscillation, in which PER/CRY complexes inhibit the transcriptional activity of the CLOCK/BMAL1 heterodimer to constitute a negative feedback loop. In this study, we identified the type II protein arginine methyltransferase 5 (PRMT5 as an interacting molecule of CRY1. Although the Prmt5 gene was constitutively expressed, increased interaction of PRMT5 with CRY1 was observed when the Per1 gene was repressed both in synchronized mouse liver and NIH3T3 cells. Moreover, rhythmic recruitment of PRMT5 and CRY1 to the Per1 gene promoter was found to be associated with an increased level of histone H4R3 dimethylation and Per1 gene repression. Consistently, decreased histone H4R3 dimethylation and altered rhythmic Per1 gene expression were observed in Prmt5-depleted cells. Taken together, these findings provide an insight into the link between histone arginine methylation by PRMT5 and transcriptional regulation of the circadian Per1 gene.

  6. Adventitial gene transfer of catalase attenuates angiotensin II-induced vascular remodeling. (United States)

    Liu, Cun-Fei; Zhang, Jia; Shen, Kai; Gao, Ping-Jin; Wang, Hai-Ya; Jin, Xin; Meng, Chao; Fang, Ning-Yuan


    Vascular adventitia and adventitia‑derived reactive oxygen species (ROS) contribute to vascular remodeling following vascular injury. A previous ex vivo study in adventitial fibroblasts showed that catalase, one of most important anti‑oxide enzymes, was downregulated by angiotensin II (AngII). The aim of the present study was to investigate whether adventitial gene transfer of catalase affects AngII‑induced vascular remodeling in vivo. Adenoviruses co‑expressing catalase and enhanced green fluorescent protein (eGFP) or expressing eGFP only were applied to the adventitial surface of common carotid arteries of Sprague‑Dawley rats. Alzet minipumps administering AngII (0.75 mg/kg/day) were then implanted subcutaneously for 14 days. Systolic blood pressure and biological parameters of vascular remodeling were measured in each group. Adventitial fibroblasts were cultured and p38 mitogen‑activated protein kinase (MAPK) phosphorylation was measured using western blot analysis. The results showed that adventitial gene transfer of catalase had no effect on AngII‑induced systolic blood pressure elevation. However, catalase adenovirus transfection significantly inhibited AngII‑induced media hypertrophy compared with that of the control virus (Padventitial α‑smooth muscle actin expression. Furthermore, catalase transfection significantly inhibited the AngII‑induced increase in p38MAPK phosphorylation. In conclusion, the results of the present study demonstrated that adventitial gene transfer of catalase significantly attenuated AngII‑induced vascular remodeling in rats via inhibition of adventitial p38MAPK phosphorylation.

  7. Identification of 42 Genes Linked to Stage II Colorectal Cancer Metastatic Relapse

    Directory of Open Access Journals (Sweden)

    Rabeah A. Al-Temaimi


    Full Text Available Colorectal cancer (CRC is one of the leading causes of cancer mortality. Metastasis remains the primary cause of CRC death. Predicting the possibility of metastatic relapse in early-stage CRC is of paramount importance to target therapy for patients who really need it and spare those with low-potential of metastasis. Ninety-six stage II CRC cases were stratified using high-resolution array comparative genomic hybridization (aCGH data based on a predictive survival algorithm and supervised clustering. All genes included within the resultant copy number aberrations were each interrogated independently at mRNA level using CRC expression datasets available from public repositories, which included 1820 colon cancers, and 167 normal colon tissues. Reduced mRNA expression driven by copy number losses and increased expression driven by copy number gains revealed 42 altered transcripts (29 reduced and 13 increased transcripts associated with metastatic relapse, short disease-free or overall survival, and/or epithelial to mesenchymal transition (EMT. Resultant genes were classified based on gene ontology (GO, which identified four functional enrichment groups involved in growth regulation, genomic integrity, metabolism, and signal transduction pathways. The identified 42 genes may be useful for predicting metastatic relapse in stage II CRC. Further studies are necessary to validate these findings.

  8. Simultaneous substitution of Gly96 to Ala and Ala183 to Thr in 5-enolpyruvylshikimate-3-phosphate synthase gene of E. coli (k12) and transformation of rapeseed (Brassica napus L.) in order to make tolerance to glyphosate. (United States)

    Kahrizi, Danial; Salmanian, Ali Hatef; Afshari, Afsoon; Moieni, Ahmad; Mousavi, Amir


    Glyphosate is a non-selective broad-spectrum herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). This is a key enzyme in the aromatic amino acid biosynthesis pathway of microorganisms and plants. The manipulation of bacterial EPSPS gene in order to reduce its affinity for glyphosate, followed by its transfer to plants is one of the most effective approaches for the production of glyphosate-tolerant plants. In this study, we chose to focus on amino acid residues glycine96 and alanine183 of the E. coli (k12) EPSPS enzyme. These two amino acids are important residues for glyphosate binding. We used site directed mutagenesis (SDM) to induce point mutations in the E. coli EPSPS gene, in order to convert glycine96 to alanine (Gly96Ala) and alanine183 to threonine (Ala183Thr). After confirming the mutation by sequencing, the altered EPSPS gene was transferred to rapeseed (Brassica napus L.) via Agrobacterium-mediated transformation. The transformed explants were screened in shoot induction medium containing 25 mg L-1 kanamycin. Glyphosate tolerance was assayed in putative transgenic plants. Statistical analysis of data showed that there was a significant difference between the transgenic and control plants. It was observed that transgenic plants were resistant to glyphosate at a concentration of 10 mM whereas the non-transformed control plants were unable to survive 1 mM glyphosate. The presence and copy numbers of the transgene were confirmed with PCR and Southern blotting analysis, respectively.

  9. Polyketide synthase from Fusarium

    DEFF Research Database (Denmark)

    Kvesel, Kasper; Wimmer, Reinhard; Sørensen, Jens Laurids

    Fungi produce a wide array of secondary metabolites, with interesting bioactivities by help of a number of enzyme complexes. Polyketide synthases (PKS) are a class of multidomain enzymes, producing a class of secondary metabolites called polyketides1,2. Only few structures of PKS’s have been...

  10. Small RNAs were involved in homozygous state-associated silencing of a marker gene (Neomycin phosphotransferase II: nptII) in transgenic tomato plants. (United States)

    Deng, Lei; Pan, Yu; Chen, Xuqing; Chen, Guoping; Hu, Zongli


    Homozygous state-associated co-suppression is not a very common phenomenon. In our experiments, two transgenic plants 3A29 and 1195A were constructed by being transformed with the constructs pBIN-353A and pBIN119A containing nptII gene as a marker respectively. The homozygous progeny from these two independent transgenic lines 3A29 and 1195A, displayed kanamycin-sensitivity and produced a short main root without any lateral roots as untransformed control (wild-type) seedlings when germinated on kanamycin media. For the seedlings derived from putative hemizygous plants, the percentage of the seedlings showing normal growth on kanamycin media was about 50% and lower than the expected percentage (75%). Southern analysis of the genomic DNA confirmed that the homozygous and hemizygous plants derived from the same lines contained the same multiple nptII transgenes, which were located on the same site of chromosome. Northern analysis suggested that the marker nptII gene was expressed in the primary and the hemizygous transformants, but it was silenced in the homozygous transgenic plants. Further Northern analysis indicated that antisense and sense small nptII-derived RNAs were present in the transgenic plants and the blotting signal of nptII-derived small RNA was much higher in the homozygous transgenic plants than that of hemizygous transgenic plants. Additionally, read-through transcripts from the TRAMP gene to the nptII gene were detected. These results suggest that the read-through transcripts may be involved in homozygous state-associated silencing of the nptII transgene in transgenic tomato plants and a certain threshold level of the nptII-derived small RNAs is required for the homozygous state-associated co-suppression of the nptII transgene. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  11. A class II KNOX gene, KNOX4, controls seed physical dormancy. (United States)

    Chai, Maofeng; Zhou, Chuanen; Molina, Isabel; Fu, Chunxiang; Nakashima, Jin; Li, Guifen; Zhang, Wenzheng; Park, Jongjin; Tang, Yuhong; Jiang, Qingzhen; Wang, Zeng-Yu


    Physical dormancy of seed is an adaptive trait that widely exists in higher plants. This kind of dormancy is caused by a water-impermeable layer that blocks water and oxygen from the surrounding environment and keeps embryos in a viable status for a long time. Most of the work on hardseededness has focused on morphological structure and phenolic content of seed coat. The molecular mechanism underlying physical dormancy remains largely elusive. By screening a large number of Tnt1 retrotransposon-tagged Medicago truncatula lines, we identified nondormant seed mutants from this model legume species. Unlike wild-type hard seeds exhibiting physical dormancy, the mature mutant seeds imbibed water quickly and germinated easily, without the need for scarification. Microscopic observations of cross sections showed that the mutant phenotype was caused by a dysfunctional palisade cuticle layer in the seed coat. Chemical analysis found differences in lipid monomer composition between the wild-type and mutant seed coats. Genetic and molecular analyses revealed that a class II KNOTTED-like homeobox (KNOXII) gene, KNOX4, was responsible for the loss of physical dormancy in the seeds of the mutants. Microarray and chromatin immunoprecipitation analyses identified CYP86A, a gene associated with cutin biosynthesis, as one of the downstream target genes of KNOX4 This study elucidated a novel molecular mechanism of physical dormancy and revealed a new role of class II KNOX genes. Furthermore, KNOX4-like genes exist widely in seed plants but are lacking in nonseed species, indicating that KNOX4 may have diverged from the other KNOXII genes during the evolution of seed plants.

  12. IiSDD1, a gene responsive to autopolyploidy and environmental factors in Isatis indigotica. (United States)

    Xiao, Ying; Yu, Xiaojing; Chen, Junfeng; Di, Peng; Chen, Wansheng; Zhang, Lei


    In plants, stomata play a pivotal role in the regulation of gas exchange and are distributed throughout the aerial epidermis. SDD1, a gene isolated from Arabidopsis thaliana has been demonstrated to specialize in stomatal density and distribution. In our present study, a comprehensive survey of global gene expression performed by using an A. thaliana whole genome Affymetrix gene chip revealed SDD1 tends to be significantly lower in tetraploid Isatis indigotica than in diploid ones. To intensively investigate different SDD1 expression in response to polyploidy, a full-length cDNA clone (IiSDD1) encoding SDD1 was isolated from the traditional Chinese medicinal herb I. indigotica cDNA library. IiSDD1 shared a high level of identity with that from A. thaliana, containing some basic features of subtilases: D, H and S regions, as well as a substrate-binding site. Real-time quantitative PCR analysis indicated that IiSDD1 was constitutively expressed in all tested tissues, including roots, stems and leaves, both in tetraploid and diploid I. indigotica, and with the highest expression in leaves. In addition, IiSDD1 was also found to be down-regulated by signalling molecules for plant defence responses, such as abscisic acid (100 microM) and gibberellin (100 mg/L), as well as by environmental stresses including salt, darkness, coldness and drought. Our study, for the first time, indicates SDD1 participates not only in the defense/stress responsive pathways, but also probably involves in plants polyploidy evolution.

  13. Effects of an Antimutagenic 1,4-Dihydropyridine AV-153 on Expression of Nitric Oxide Synthases and DNA Repair-related Enzymes and Genes in Kidneys of Rats with a Streptozotocin Model of Diabetes Mellitus. (United States)

    Ošiņa, Kristīne; Rostoka, Evita; Isajevs, Sergejs; Sokolovska, Jelizaveta; Sjakste, Tatjana; Sjakste, Nikolajs


    Development of complications of diabetes mellitus (DM), including diabetic nephropathy, is a complex multi-stage process, dependent on many factors including the modification of nitric oxide (NO) production and an impaired DNA repair. The goal of this work was to study in vivo effects of 1,4-dihydropyridine AV-153, known as antimutagen and DNA binder, on the expression of several genes and proteins involved in NO metabolism and DNA repair in the kidneys of rats with a streptozotocin (STZ)-induced model of DM. Transcription intensity was monitored by means of real-time RT-PCR and the expression of proteins by immunohistochemistry. Development of DM significantly induced PARP1 protein expression, while AV-153 (0.5 mg/kg) administration decreased it. AV-153 increased the expression of Parp1 gene in the kidneys of both intact and diabetic animals. Expression of H2afx mRNA and γH2AX histone protein, a marker of DNA breakage, was not changed in diabetic animals, but AV-153 up-regulated the expression of the gene without any impact on the protein expression. Development of DM was followed by a significant increase in iNOS enzyme expression, while AV-153 down-regulated the enzyme expression up to normal levels. iNos gene expression was also found to be increased in diabetic animals, but unlike the protein, the expression of mRNA was found to be enhanced by AV-153 administration. Expression of both eNOS protein and eNos gene in the kidneys was down-regulated, and the administration of AV-153 normalized the expression level. The effects of the compound in the kidneys of diabetic animals appear to be beneficial, as a trend for the normalization of expression of NO synthases is observed. © 2016 Nordic Association for the Publication of BCPT (former Nordic Pharmacological Society).

  14. Engineered chloroplast dsRNA silences cytochrome p450 monooxygenase, V-ATPase and chitin synthase genes in the insect gut and disrupts Helicoverpa zea larval development and pupation. (United States)

    Jin, Shuangxia; Singh, Nameirakpam D; Li, Lebin; Zhang, Xianlong; Daniell, Henry


    In the past two decades, chloroplast genetic engineering has been advanced to achieve high-level protein accumulation but not for down-regulation of targeted genes. Therefore, in this report, lepidopteran chitin synthase (Chi), cytochrome P450 monooxygenase (P450) and V-ATPase dsRNAs were expressed via the chloroplast genome to study RNA interference (RNAi) of target genes in intended hosts. PCR and Southern blot analysis confirmed homoplasmy and site-specific integration of transgene cassettes into the chloroplast genomes. Northern blots and real-time qRT-PCR confirmed abundant processed and unprocessed dsRNA transcripts (up to 3.45 million copies of P450 dsRNAs/μg total RNA); the abundance of cleaved dsRNA was greater than the endogenous psbA transcript. Feeding of leaves expressing P450, Chi and V-ATPase dsRNA decreased transcription of the targeted gene to almost undetectable levels in the insect midgut, likely after further processing of dsRNA in their gut. Consequently, the net weight of larvae, growth and pupation rates were significantly reduced by chloroplast-derived dsRNAs. Taken together, successful expression of dsRNAs via the chloroplast genome for the first time opens the door to study RNA interference/processing within plastids. Most importantly, dsRNA expressed in chloroplasts can be utilized for gene inactivation to confer desired agronomic traits or for various biomedical applications, including down-regulation of dysfunctional genes in cancer or autoimmune disorders, after oral delivery of dsRNA bioencapsulated within plant cells. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  15. Genes e epilepsia II: expressão gênica diferencial Genes and epilepsy II: differential gene expression in epilepsy

    Directory of Open Access Journals (Sweden)

    Rodrigo N. Romcy-Pereira


    Full Text Available Nesta revisão, introduzimos abordagens investigativas, assim como discutimos os principais achados de expressão gênica diferencial em tecido epiléptico humano e em modelos experimentais. As alterações observadas no cérebro de indivíduos epilépticos sugerem que eventos moleculares específicos refletem diferentes expressões do quadro fisiopatológico. É possível que diferentes combinações da expressão de genes associados à morte celular, metabolismo de radicais livres, transmissão sináptica, resposta imune e de neurotrofinas reflitam propriedades características de diferentes populações neuronais e gliais, que determinam as distintas respostas de cada área cerebral. A compreensão dessas particularidades moleculares será muito importante para o desenvolvimento de uma estratégia de intervenção visando reduzir neurotoxicidade e disfunções sinápticas que ocorrem durante a epileptogênese e a fase crônica em pacientes epilépticos.We introduce some investigative appnacher and findings on differential gene expression in human epileptic time as well as in animal models of epilepsy. Molecular alterations observed in the epileptic brain suggest that they may disclose different psychopathological stages. It is possible that different gene expression combinations involved in cell death, reactive oxygen metabolism, synaptic transmission and immune response and of neurotrophins reflect distinct functional properties of different neuronal and glial populations, which determine specific brain region responses. Understanding the molecular patterns of gene expression following epileptogenic insults will be of great importance for the development of treatments aiming to reduce neurotoxicity and subtle synaptic dyfunctions present in the early stages as well as during the chronic phase of epilepsy.

  16. CDK9 inhibitors define elongation checkpoints at both ends of RNA polymerase II-transcribed genes. (United States)

    Laitem, Clélia; Zaborowska, Justyna; Isa, Nur F; Kufs, Johann; Dienstbier, Martin; Murphy, Shona


    Transcription through early-elongation checkpoints requires phosphorylation of negative transcription elongation factors (NTEFs) by the cyclin-dependent kinase (CDK) 9. Using CDK9 inhibitors and global run-on sequencing (GRO-seq), we have mapped CDK9 inhibitor-sensitive checkpoints genome wide in human cells. Our data indicate that early-elongation checkpoints are a general feature of RNA polymerase (pol) II-transcribed human genes and occur independently of polymerase stalling. Pol II that has negotiated the early-elongation checkpoint can elongate in the presence of inhibitors but, remarkably, terminates transcription prematurely close to the terminal polyadenylation (poly(A)) site. Our analysis has revealed an unexpected poly(A)-associated elongation checkpoint, which has major implications for the regulation of gene expression. Interestingly, the pattern of modification of the C-terminal domain of pol II terminated at this new checkpoint largely mirrors the pattern normally found downstream of the poly(A) site, thus suggesting common mechanisms of termination.

  17. Persistent Ehrlichia chaffeensis infection occurs in the absence of functional major histocompatibility complex class II genes (United States)

    Ganta, Roman Reddy; Wilkerson, Melinda J.; Cheng, Chuanmin; Rokey, Aaron M.; Chapes, Stephen K.


    Human monocytic ehrlichiosis is an emerging tick-borne disease caused by the rickettsia Ehrlichia chaffeensis. We investigated the impact of two genes that control macrophage and T-cell function on murine resistance to E. chaffeensis. Congenic pairs of wild-type and toll-like receptor 4 (tlr4)- or major histocompatibility complex class II (MHC-II)-deficient mice were used for these studies. Wild-type mice cleared the infection within 2 weeks, and the response included macrophage activation and the synthesis of E. chaffeensis-specific Th1-type immunoglobulin G response. The absence of a functional tlr4 gene depressed nitric oxide and interleukin 6 secretion by macrophages and resulted in short-term persistent infections for > or =30 days. In the absence of MHC-II alleles, E. chaffeensis infections persisted throughout the entire 3-month evaluation period. Together, these data suggest that macrophage activation and cell-mediated immunity, orchestrated by CD4(+) T cells, are critical for conferring resistance to E. chaffeensis.

  18. Virus-induced gene silencing of the two squalene synthase isoforms of apple tree (Malus × domestica L.) negatively impacts phytosterol biosynthesis, plastid pigmentation and leaf growth. (United States)

    Navarro Gallón, Sandra M; Elejalde-Palmett, Carolina; Daudu, Dimitri; Liesecke, Franziska; Jullien, Frédéric; Papon, Nicolas; Dugé de Bernonville, Thomas; Courdavault, Vincent; Lanoue, Arnaud; Oudin, Audrey; Glévarec, Gaëlle; Pichon, Olivier; Clastre, Marc; St-Pierre, Benoit; Atehortùa, Lucia; Yoshikawa, Nobuyuki; Giglioli-Guivarc'h, Nathalie; Besseau, Sébastien


    The use of a VIGS approach to silence the newly characterized apple tree SQS isoforms points out the biological function of phytosterols in plastid pigmentation and leaf development. Triterpenoids are beneficial health compounds highly accumulated in apple; however, their metabolic regulation is poorly understood. Squalene synthase (SQS) is a key branch point enzyme involved in both phytosterol and triterpene biosynthesis. In this study, two SQS isoforms were identified in apple tree genome. Both isoforms are located at the endoplasmic reticulum surface and were demonstrated to be functional SQS enzymes using an in vitro activity assay. MdSQS1 and MdSQS2 display specificities in their expression profiles with respect to plant organs and environmental constraints. This indicates a possible preferential involvement of each isoform in phytosterol and/or triterpene metabolic pathways as further argued using RNAseq meta-transcriptomic analyses. Finally, a virus-induced gene silencing (VIGS) approach was used to silence MdSQS1 and MdSQS2. The concomitant down-regulation of both MdSQS isoforms strongly affected phytosterol synthesis without alteration in triterpene accumulation, since triterpene-specific oxidosqualene synthases were found to be up-regulated to compensate metabolic flux reduction. Phytosterol deficiencies in silenced plants clearly disturbed chloroplast pigmentation and led to abnormal development impacting leaf division rather than elongation or differentiation. In conclusion, beyond the characterization of two SQS isoforms in apple tree, this work brings clues for a specific involvement of each isoform in phytosterol and triterpene pathways and emphasizes the biological function of phytosterols in development and chloroplast integrity. Our report also opens the door to metabolism studies in Malus domestica using the apple latent spherical virus-based VIGS method.

  19. The Nicotianamine Synthase Gene Is a Useful Candidate for Improving the Nutritional Qualities and Fe-Deficiency Tolerance of Various Crops

    Directory of Open Access Journals (Sweden)

    Tomoko Nozoye


    Full Text Available With the global population predicted to grow by at least 25% by the year 2050, the sustainable production of nutritious foods will be necessary for human health and the environment. Iron (Fe is an essential nutrient for both plants and humans. Fe is poorly soluble, especially at high pH levels, at which it is difficult for living organisms to accumulate sufficient Fe. In plants, Fe deficiency leads to low yield and poor nutritional quality, as it significantly affects chlorophyll synthesis. Fe deficiency is a worldwide agricultural problem that is especially serious in soils with a high pH, such as calcareous soils, which comprise approximately 30% of cultivated soils worldwide. Genetic improvements in crops that can tolerate Fe deficiency will be required to meet the demands for crop production and could ultimately contribute to the amelioration of global warming. Nicotianamine (NA is an Fe chelator in plants that is involved in metal translocation in the plant body. In mammals, NA inhibits angiotensin I-converting enzyme, which plays a key role in blood pressure control. It was recently shown that the enhancement of NA production using nicotianamine synthase is useful for increasing not only NA but also Fe and Zn levels in crops such as rice, soybean, and sweet potato. Additionally, these plants showed Fe-deficiency tolerance in calcareous soil. These results suggested that NAS overexpression simultaneously improves food quality and increases plant production. This review summarizes progress in generating crops overexpressing NAS.

  20. Efficient poly(3-hydroxypropionate) production from glycerol using Lactobacillus reuteri and recombinant Escherichia coli harboring L. reuteri propionaldehyde dehydrogenase and Chromobacterium sp. PHA synthase genes. (United States)

    Linares-Pastén, Javier A; Sabet-Azad, Ramin; Pessina, Laura; Sardari, Roya R R; Ibrahim, Mohammad H A; Hatti-Kaul, Rajni


    Poly(3-hydroxypropionate), P(3HP), is a polymer combining good biodegradability with favorable material properties. In the present study, a production system for P(3HP) was designed, comprising conversion of glycerol to 3-hydroxypropionaldehyde (3HPA) as equilibrium mixture with 3HPA-hydrate and -dimer in aqueous system (reuterin) using resting cells of native Lactobacillus reuteri in a first stage followed by transformation of the 3HPA to P(3HP) using recombinant Escherichia coli strain co-expressing highly active coenzyme A-acylating propionaldehyde dehydrogenase (PduP) from L. reuteri and polyhydroxyalkanoate synthase (PhaCcs) from Chromobacterium sp. P(3HP) content of up to 40% (w/w) cell dry weight was reached, and the yield with respect to the reuterin consumed by the cells was 78%. Short biotransformation period (4.5h), lack of additives or expensive cofactors, and use of a cheap medium for cultivation of the recombinant strain, provides a new efficient and potentially economical system for P(3HP) production. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Nitric Oxide Synthase in the Central Nervous System and Peripheral Organs of Stramonita haemastoma: Protein Distribution and Gene Expression in Response to Thermal Stress (United States)

    Toni, Mattia; De Angelis, Federica; Bonaccorsi di Patti, Maria Carmela; Cioni, Carla


    Nitric oxide (NO) is generated via the oxidation of l-arginine by the enzyme NO synthase (NOS) both in vertebrates and invertebrates. Three NOS isoforms, nNOS, iNOS and eNOS, are known in vertebrates, whereas a single NOS isoform is usually expressed in invertebrates, sharing structural and functional characteristics with nNOS or iNOS depending on the species. The present paper is focused on the constitutive Ca2+/calmodulin-dependent nNOS recently sequenced by our group in the neogastropod Stramonita haemastoma (ShNOS). In this paper we provide new data on cellular distribution of ShNOS in the CNS (pedal ganglion) and peripheral organs (osphradium, tentacle, eye and foot) obtained by WB, IF, CM and NADPHd. Results demonstrated that NOS-like proteins are widely expressed in sensory receptor elements, neurons and epithelial cells. The detailed study of NOS distribution in peripheral and central neurons suggested that NOS is both intracellular and presynaptically located. Present findings confirm that NO may have a key role in the central neuronal circuits of gastropods and in sensory perception. The physiological relevance of NOS enzymes in the same organs was suggested by thermal stress experiments demonstrating that the constitutive expression of ShNOS is modulated in a time- and organ-dependent manner in response to environmental stressors. PMID:26528988

  2. Nitric Oxide Synthase in the Central Nervous System and Peripheral Organs of Stramonita haemastoma: Protein Distribution and Gene Expression in Response to Thermal Stress

    Directory of Open Access Journals (Sweden)

    Mattia Toni


    Full Text Available Nitric oxide (NO is generated via the oxidation of l-arginine by the enzyme NO synthase (NOS both in vertebrates and invertebrates. Three NOS isoforms, nNOS, iNOS and eNOS, are known in vertebrates, whereas a single NOS isoform is usually expressed in invertebrates, sharing structural and functional characteristics with nNOS or iNOS depending on the species. The present paper is focused on the constitutive Ca2+/calmodulin-dependent nNOS recently sequenced by our group in the neogastropod Stramonita haemastoma (ShNOS. In this paper we provide new data on cellular distribution of ShNOS in the CNS (pedal ganglion and peripheral organs (osphradium, tentacle, eye and foot obtained by WB, IF, CM and NADPHd. Results demonstrated that NOS-like proteins are widely expressed in sensory receptor elements, neurons and epithelial cells. The detailed study of NOS distribution in peripheral and central neurons suggested that NOS is both intracellular and presynaptically located. Present findings confirm that NO may have a key role in the central neuronal circuits of gastropods and in sensory perception. The physiological relevance of NOS enzymes in the same organs was suggested by thermal stress experiments demonstrating that the constitutive expression of ShNOS is modulated in a time- and organ-dependent manner in response to environmental stressors.

  3. Angiotensin II type 1 receptor (A1166C gene polymorphism and essential hypertension in Egyptian population

    Directory of Open Access Journals (Sweden)

    Marium M. Shamaa


    Full Text Available The pathogenesis of essential hypertension (EH is affected by genetic and environmental factors. Mutations in hypertension-related genes can affect blood pressure (BP via alteration of salt and water reabsorption by the nephron. The genes of the renin-angiotensin system (RAS have been extensively studied because of the well documented role of this system in the control of BP. It has been previously shown that Angiotensin II type 1 receptor (ATR1 gene polymorphism could be associated with increased risk of EH. So, in the current study, we evaluated the frequency of ATR1 (A1166C polymorphism in relation to EH in a group of Egyptian population. The study population included 83 hypertensive patients and 60 age and sex matched healthy control subjects. Restriction fragment length polymorphism – Polymerase chain reaction (RFLP – PCR was used for the analysis of A1166C polymorphism of ATR1 genes in peripheral blood samples of all patients and controls. The results revealed that there was a positive risk of developing EH when having the T allele whether in homozygous or heterozygous state. From this work, it was concluded that there was an association between ATR1 (A1166C gene polymorphism and the risk of developing EH.

  4. Myocardial overexpression of Mecr, a gene of mitochondrial FAS II leads to cardiac dysfunction in mouse.

    Directory of Open Access Journals (Sweden)

    Zhijun Chen

    Full Text Available It has been recently recognized that mammalian mitochondria contain most, if not all, of the components of fatty acid synthesis type II (FAS II. Among the components identified is 2-enoyl thioester reductase/mitochondrial enoyl-CoA reductase (Etr1/Mecr, which catalyzes the NADPH-dependent reduction of trans-2-enoyl thioesters, generating saturated acyl-groups. Although the FAS type II pathway is highly conserved, its physiological role in fatty acid synthesis, which apparently occurs simultaneously with breakdown of fatty acids in the same subcellular compartment in mammals, has remained an enigma. To study the in vivo function of the mitochondrial FAS in mammals, with special reference to Mecr, we generated mice overexpressing Mecr under control of the mouse metallothionein-1 promoter. These Mecr transgenic mice developed cardiac abnormalities as demonstrated by echocardiography in vivo, heart perfusion ex vivo, and electron microscopy in situ. Moreover, the Mecr transgenic mice showed decreased performance in endurance exercise testing. Our results showed a ventricular dilatation behind impaired heart function upon Mecr overexpression, concurrent with appearance of dysmorphic mitochondria. Furthermore, the data suggested that inappropriate expression of genes of FAS II can result in the development of hereditary cardiomyopathy.

  5. Alternative splicing of a group II intron in a surface layer protein gene in Clostridium tetani. (United States)

    McNeil, Bonnie A; Simon, Dawn M; Zimmerly, Steven


    Group II introns are ribozymes and retroelements found in bacteria, and are thought to have been the ancestors of nuclear pre-mRNA introns. Whereas nuclear introns undergo prolific alternative splicing in some species, group II introns are not known to carry out equivalent reactions. Here we report a group II intron in the human pathogen Clostridium tetani, which undergoes four alternative splicing reactions in vivo. Together with unspliced transcript, five mRNAs are produced, each encoding a distinct surface layer protein isoform. Correct fusion of exon reading frames requires a shifted 5' splice site located 8 nt upstream of the canonical boundary motif. The shifted junction is accomplished by an altered IBS1-EBS1 pairing between the intron and 5' exon. Growth of C. tetani under a variety of conditions did not result in large changes in alternative splicing levels, raising the possibility that alternative splicing is constitutive. This work demonstrates a novel type of gene organization and regulation in bacteria, and provides an additional parallel between group II and nuclear pre-mRNA introns.

  6. Characterisation of four major histocompatibility complex class II genes of the koala (Phascolarctos cinereus). (United States)

    Lau, Quintin; Jobbins, Sarah E; Belov, Katherine; Higgins, Damien P


    Major histocompatibility complex (MHC) class II molecules have an integral role in the adaptive immune response, as they bind and present antigenic peptides to T helper lymphocytes. In this study of koalas, species-specific primers were designed to amplify exon 2 of the MHC class II DA and DB genes, which contain much of the peptide-binding regions of the α and β chains. A total of two DA α1 domain variants and eight DA β1 (DAB), three DB α1 and five DB β1 variants were amplified from 20 koalas from two free-living populations from South East Queensland and the Port Macquarie region in northern New South Wales. We detected greater variation in the β1 than in the α1 domains as well as evidence of positive selection in DAB. The present study provides a springboard to future investigation of the role of MHC in disease susceptibility in koalas.

  7. Engineering cotton (+)-delta-cadinene synthase to an altered function: germacrene D-4-ol synthase. (United States)

    Yoshikuni, Yasuo; Martin, Vincent J J; Ferrin, Thomas E; Keasling, Jay D


    The combined approaches of rational design and random mutagenesis were applied to generate a sesquiterpene synthase with an altered activity. Due to the lack of a convenient screen for sesquiterpene synthase activity, a high-throughput dual-activity screen was used by fusing (+)-delta-cadinene synthase to chloramphenicol acetyltransferase (CAT). The gene encoding (+)-delta-cadinene synthase was mutagenized using error-prone PCR. The resulting mutant fusion proteins were screened for CAT activity and altered sesquiterpene selectivity. Twenty-one clones producing (+)-delta-cadinene and germacrene D-4-ol in different ratios were isolated from the library. Analysis using a homology model of (+)-delta-cadinene synthase suggested that the G helix plays a very important role in (+)-delta-cadinene formation. Reconstruction of the G helix using site-directed, saturation mutagenesis yielded a mutant, N403P/L405H, that maintained its specific activity and showed higher selectivity to germacrene D-4-ol in vivo (up to 93%).

  8. [Cloning and analysis of three genes encoding type II CHH family neuropeptides from Fennropenaeus chinensis]. (United States)

    Wang, Zai-Zhao; Xiang, Jian-Hai


    On the basis of sequence similarity, the crustean hyperglycemic hormone (CHH) family peptides have been classified into two types of hormones: type I and type II. Molt-inhibiting hormone (MIH) is a neuropeptide member of type II CHH family. Molting in shrimp is controlled by MIH and ecdysone. By inhibiting the synthesis of ecdysone in the Y-organ, MIH indirectly suppresses the molting activity of shrimp. In this study, we reported the cloning and characterization of 3 gene fragments encoding type II CHH family neuropeptides of the shrimp Fennropenaeus chinensis. According to the complementary DNA sequence of the mult-inhibiting hormone of Fennropenaeus chinensis, 3 primers were designed and synthesized. MP1 and MP2 are sense primers, and MP3 is anti-sense primer. Polymerase chain reaction was performed using genomic DNA of Fennropenaeus chinensis as template. Three PCR products were obtained using primers MP1 and MP3. Their sizes are about 600 bp, 850 bp, 1050 bp, respectively. A 580 bp PCR product was obtained using primers MP2 and MP3. All the 4 PCR products were cloned into pMD18-T vector. The recombinant clones were sequenced using ABI 310 Genetic Analyzer. After sequencing, all the DNA sequences were searched in the GenBank by Blast program to find similar gene sequences. The searching results revealed 3 DNA fragment sequences were of high similarity with CHH family neuropeptide genes from various crustean species. The 3 DNA fragments were named as NP1, NP2, and NP3. Their sizes were 540 bp, 601 bp, and 826 bp, respectively. Using the mRNA sequences with the most similarity to the 3 sequence fragments as reference, the gene structure of the 3 DNA fragment sequences was analyzed. The exons of 3 sequence fragments were aligned with their similar sequences by Clustal W program. Both NP1 and NP2 consisted of 1 intron and 2 exons. NP3 consisted of 2 introns and 3 exons. Sequence analysis suggested that these 3 products belonged to sequence fragments of neuropeptide

  9. Cleaning up polyketide synthases. (United States)

    Kwan, Jason C; Schmidt, Eric W


    Complex biosynthetic enzymes such as polyketide synthases make mistakes. In this issue of Chemistry & Biology, Jensen et al. report that a discrete family of acyltransferases is responsible for error correction, hydrolyzing key biosynthetic intermediates from a multi-enzyme complex. This activity might find use in understanding polyketide biosynthesis, particularly in uncultivated organisms and in tailoring the synthesis of small molecules. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Hybrid polyketide synthases

    Energy Technology Data Exchange (ETDEWEB)

    Fortman, Jeffrey L.; Hagen, Andrew; Katz, Leonard; Keasling, Jay D.; Poust, Sean; Zhang, Jingwei; Zotchev, Sergey


    The present invention provides for a polyketide synthase (PKS) capable of synthesizing an even-chain or odd-chain diacid or lactam or diamine. The present invention also provides for a host cell comprising the PKS and when cultured produces the even-chain diacid, odd-chain diacid, or KAPA. The present invention also provides for a host cell comprising the PKS capable of synthesizing a pimelic acid or KAPA, and when cultured produces biotin.

  11. The major histocompatibility complex in Old World camelids and low polymorphism of its class II genes. (United States)

    Plasil, Martin; Mohandesan, Elmira; Fitak, Robert R; Musilova, Petra; Kubickova, Svatava; Burger, Pamela A; Horin, Petr


    The Major Histocompatibility Complex (MHC) is a genomic region containing genes with crucial roles in immune responses. MHC class I and class II genes encode antigen-presenting molecules expressed on the cell surface. To counteract the high variability of pathogens, the MHC evolved into a region of considerable heterogeneity in its organization, number and extent of polymorphism. Studies of MHCs in different model species contribute to our understanding of mechanisms of immunity, diseases and their evolution. Camels are economically important domestic animals and interesting biomodels. Three species of Old World camels have been recognized: the dromedary (Camelus dromedarius), Bactrian camel (Camelus bactrianus) and the wild camel (Camelus ferus). Despite their importance, little is known about the MHC genomic region, its organization and diversity in camels. The objectives of this study were to identify, map and characterize the MHC region of Old World camelids, with special attention to genetic variation at selected class MHC II loci. Physical mapping located the MHC region to the chromosome 20 in Camelus dromedarius. Cytogenetic and comparative analyses of whole genome sequences showed that the order of the three major sub-regions is "Centromere - Class II - Class III - Class I". DRA, DRB, DQA and DQB exon 2 sequences encoding the antigen binding site of the corresponding class II antigen presenting molecules showed high degree of sequence similarity and extensive allele sharing across the three species. Unexpectedly low extent of polymorphism with low numbers of alleles and haplotypes was observed in all species, despite different geographic origins of the camels analyzed. The DRA locus was found to be polymorphic, with three alleles shared by all three species. DRA and DQA sequences retrieved from ancient DNA samples of Camelus dromedarius suggested that additional polymorphism might exist. This study provided evidence that camels possess an MHC comparable to

  12. Analysis of prostaglandin-endoperoxide synthase-2 gene polymorphisms and risk of cervical cancer in an East Indian population: A case–control study

    Directory of Open Access Journals (Sweden)

    Dipanshu Sur


    Conclusions: PTGS-2 genotype rs689466:—1195A/G gene polymorphism demonstrated strongly associated with cervical cancer disease. However, exon1-+837T > C polymorphism was not associated with cancer risk in East Indian women. Further studies evaluating the role of PTGS-2 gene polymorphisms in ethnically diverse populations and a larger cohort may help in understanding the etiopathogenesis of cervical cancer in women worldwide.

  13. The role of hexokinases from grape berries (Vitis vinifera L.) in regulating the expression of cell wall invertase and sucrose synthase genes. (United States)

    Wang, X Q; Li, L M; Yang, P P; Gong, C L


    In plants, hexokinase (HXK, EC involved in hexose phosphorylation, plays an important role in sugar sensing and signaling. In this study, we found that at Phase I of grape berry development, lower hexose (glucose or fructose) levels were concomitant with higher HXK activities and protein levels. After the onset of ripening, we demonstrated a drastic reduction in HXK activity and protein levels accompanied by a rising hexose level. Therefore, our results revealed that HXK activity and protein levels had an inverse relationship with the endogenous glucose or fructose levels during grape berry development.