WorldWideScience

Sample records for synthase gene transfer

  1. Glutamate synthase: An archaeal horizontal gene transfer?

    Indian Academy of Sciences (India)

    (GOGAT) which is a key enzyme in ammonia assimilation in bacteria, algae and plants. It catalyzes the reductive transamidation of amido nitrogen from glutamine to 2-oxoglutarate to form two molecules of glutamate (Temple et al 1998). Glutamate synthases differ according to their molecular weights, subunit compositions, ...

  2. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  3. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer

    Science.gov (United States)

    2014-01-01

    Background Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. Results A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Conclusions Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts

  4. Nitric Oxide Synthase Gene Transfer Overcomes the Inhibition of Wound Healing by Sulfur Mustard in a Human Keratinocyte In Vitro Model

    Science.gov (United States)

    Ishida, Hiroshi; Ray, Radharaman; Amnuaysirikul, Jack; Ishida, Keiko; Ray, Prabhati

    2012-01-01

    Sulfur mustard (SM) is a chemical warfare agent that causes extensive skin injury. Previously we reported that SM exposure resulted in suppression of inducible nitric oxide synthase (iNOS) expression to inhibit the healing of scratch wounds in a cultured normal human epidermal keratinocyte (NHEK) model. Based on this finding, the present study was to use adenovirus-mediated gene transfer of iNOS to restore the nitric oxide (NO) supply depleted by exposure to SM and to evaluate the effect of NO on wound healing inhibited by SM in NHEKs. The effect of the iNOS gene transfer on iNOS protein expression and NO generation were monitored by Western blot and flow cytometry, respectively. Wound healing with or without the iNOS gene transfer after SM exposure was assessed by light and confocal microscopy. The iNOS gene transfer via adenovirus resulted in overexpression of the iNOS and an increase in NO production regardless of SM exposure in the NHEK model. The gene transfer was also effective in overcoming the inhibition of wound healing due to SM exposure leading to the promotion of wound closure. The findings in this study suggest that the iNOS gene transfer is a promising therapeutic strategy for SM-induced skin injury. PMID:23762631

  5. Lipoplex gene transfer of inducible nitric oxide synthase inhibits the reactive intimal hyperplasia after expanded polytetrafluoroethylene bypass grafting.

    Science.gov (United States)

    Pfeiffer, Tomas; Wallich, Martina; Sandmann, Wilhelm; Schrader, Jürgen; Gödecke, Axel

    2006-05-01

    Intimal hyperplasia (IH) is most commonly the cause of graft occlusion in infrainguinal bypass grafting for arterial occlusive disease. We investigated the influence of nitric oxide on the IH of the arterial vessel wall at the region of prosthetic bypass anastomoses. Experiments were performed in 10 Foxhound dogs. We used a technique of inducible nitric oxide synthase (iNOS) overexpression by a non-virus-mediated, liposome-based iNOS gene transfer. The plasmid pSCMV-iNOS, which drives the expression of iNOS under control of the cytomegalovirus promoter, was complexed with cationic liposomes (lipoplexes). Segments of both carotid arteries were pretreated by intramural injection of a lipoplex solution by using an infiltrator balloon catheter (Infiltrator Drug Delivery Balloon System). In each dog, iNOS was administered at one side, and a control vector (pSCMV2) was administered at the contralateral side. Carotid arteries were ligated, and bypass grafts (expanded polytetrafluoroethylene, 6-mm, ring enforced) were implanted on both sides. The proximal and distal anastomoses (end-to-side fashion; running nonabsorbable sutures) were placed in the pretreated regions. After 6 months, the prostheses were excised, and the intimal thicknesses of 50 cross sections (orcein staining) of each anastomosis were measured planimetrically. The average reduction of the neointima thickness of the iNOS side in proximal anastomoses at the prosthetic wall, suture region, and arterial wall was 43%, 52%, and 81%, respectively. In distal anastomoses, the average reduction was 40%, 47%, and 52%, respectively. All differences of neointima thickness between the iNOS and control sides were statistically significant (Wilcoxon test; P < or = .05). Inducible NOS expression is an efficient approach for inhibition of IH. In contrast to earlier studies, which investigated the efficacy of gene therapeutic NOS expression at 3 to 4 weeks after intervention, the novelty of our findings is that a single

  6. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  7. Expression of Deinococcus geothermalis trehalose synthase gene ...

    African Journals Online (AJOL)

    A novel trehalose synthase gene from Deinococcus geothermalis (DSMZ 11300) containing 1692 bp reading-frame encoding 564 amino acids was amplified using polymerase chain reaction (PCR). The gene was ligated into pET30Ek/LIC vector and expressed after isopropyl β-D-thiogalactopyranoside induction in ...

  8. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  9. Relationship between endothelial nitric oxide synthase gene ...

    African Journals Online (AJOL)

    Introduction: Endothelial nitric oxide synthase (eNOS), the enzyme in charge of nitric oxide production, plays a crucial role in vascular biology. However, the impact of single nucleotide polymorphisms (SNPs) affecting the gene encoding for eNOS (eNOS) on coronary artery diseases remains under debate and no data were ...

  10. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  11. Divinyl ether synthase gene and protein, and uses thereof

    Science.gov (United States)

    Howe, Gregg A [East Lansing, MI; Itoh, Aya [Tsuruoka, JP

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  12. Impaired ATP synthase assembly associated with a mutation in the human ATP synthase subunit 6 gene.

    NARCIS (Netherlands)

    Nijtmans, L.G.J.; Henderson, N.S.; Attardi, G.; Holt, L.J.

    2001-01-01

    Mutations in human mitochondrial DNA are a well recognized cause of disease. A mutation at nucleotide position 8993 of human mitochondrial DNA, located within the gene for ATP synthase subunit 6, is associated with the neurological muscle weakness, ataxia, and retinitis pigmentosa (NARP) syndrome.

  13. Stereochemical course of enzyme-catalyzed aminopropyl transfer: spermidine synthase

    Energy Technology Data Exchange (ETDEWEB)

    Kullberg, D.W.; Orr, G.R.; Coward, J.K.

    1986-05-01

    The R and S enantionmers of S-adenosyl-3-(/sup 2/H)3-(methylthio)-1-propylamine (decarboxylated S-adenosylmethionine), previously synthesized in this laboratory, were incubated with (1,4-/sup 2/H/sub 4/)-putrescine in the presence of spermidine synthase from E. coli. The resulting chiral (/sup 2/H/sub 5/)spermidines were isolated and converted to their N/sub 1/,N/sub 7/-dibocspermidine-N/sub 4/-(1S,4R)-camphanamides. The derivatives were analyzed by 500 MHz /sup 1/H-NMR and the configuration of the chiral center assigned by correlation with the spectra of synthetic chiral (/sup 2/H/sub 3/)dibocspermidine camphanamide standards. The enzyme-catalyzed aminopropyl transfer was shown to occur with net retention of configuration, indicative of a double-displacement mechanism. This result concurs with that of a previous steady-state kinetics study of spermidine synthase isolated from E. coli, but contradicts the single-displacement mechanism suggested by a stereochemical analysis of chiral spermidines biosynthesized in E. coli treated with chirally deuterated methionines. It also indicates that this aminopropyltransferase is mechanistically distinct from the methyltransferases, which have been shown to act via a single-displacement mechanism (net inversion at -CH/sub 3/) in all cases studied to date.

  14. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  15. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    Background: Previous studies indicated an association between endothelial nitric oxide synthase (eNOS) activity and maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated with recurrent spontaneous abortions (RSAs). Aim: The aim was to investigate ...

  16. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it ...

  17. Improved pestalotiollide B production by deleting competing polyketide synthase genes in Pestalotiopsis microspora.

    Science.gov (United States)

    Chen, Longfei; Li, Yingying; Zhang, Qian; Wang, Dan; Akhberdi, Oren; Wei, Dongsheng; Pan, Jiao; Zhu, Xudong

    2017-02-01

    Pestalotiollide B, an analog of dibenzodioxocinones which are inhibitors of cholesterol ester transfer proteins, is produced by Pestalotiopsis microspora NK17. To increase the production of pestalotiollide B, we attempted to eliminate competing polyketide products by deleting the genes responsible for their biosynthesis. We successfully deleted 41 out of 48 putative polyketide synthases (PKSs) in the genome of NK17. Nine of the 41 PKS deleted strains had significant increased production of pestalotiollide B (P polyketides.

  18. Inferring horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Matt Ravenhall

    2015-05-01

    Full Text Available Horizontal or Lateral Gene Transfer (HGT or LGT is the transmission of portions of genomic DNA between organisms through a process decoupled from vertical inheritance. In the presence of HGT events, different fragments of the genome are the result of different evolutionary histories. This can therefore complicate the investigations of evolutionary relatedness of lineages and species. Also, as HGT can bring into genomes radically different genotypes from distant lineages, or even new genes bearing new functions, it is a major source of phenotypic innovation and a mechanism of niche adaptation. For example, of particular relevance to human health is the lateral transfer of antibiotic resistance and pathogenicity determinants, leading to the emergence of pathogenic lineages. Computational identification of HGT events relies upon the investigation of sequence composition or evolutionary history of genes. Sequence composition-based ("parametric" methods search for deviations from the genomic average, whereas evolutionary history-based ("phylogenetic" approaches identify genes whose evolutionary history significantly differs from that of the host species. The evaluation and benchmarking of HGT inference methods typically rely upon simulated genomes, for which the true history is known. On real data, different methods tend to infer different HGT events, and as a result it can be difficult to ascertain all but simple and clear-cut HGT events.

  19. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained from the ... (Serrano et al., 2004),. Behcet's disease (Karasneh et al., 2005), diabetes (Monti ... EDTA-treated peripheral venous blood using the salting-out method. (Miller et al., 1988).

  20. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-04-06

    Apr 6, 2009 ... necessary to map the ginkgolide pathway at the level of molecular biology. Ginkgolides belong to plant diterpenoids just like the famous anti-tumor ..... A new isopentenyl diphosphate isomerase gene from sweet cloning, characterization and color complementation. Biologia. 63(2): 221-. 226. Liao ZH, Chen ...

  1. Cryptic polyketide synthase genes in non-pathogenic Clostridium SPP.

    Directory of Open Access Journals (Sweden)

    Swantje Behnken

    Full Text Available Modular type I polyketide synthases (PKS produce a vast array of bacterial metabolites with highly diverse biological functions. Notably, all known polyketides were isolated from aerobic bacteria, and yet no example has been reported for strict anaerobes. In this study we explored the diversity and distribution of PKS genes in the genus Clostridium. In addition to comparative genomic analyses combined with predictions of modular type I polyketide synthase (PKS gene clusters in sequenced genomes of Clostridium spp., a representative selection of other species inhabiting a variety of ecological niches was investigated by PCR screening for PKS genes. Our data reveal that all studied pathogenic Clostridium spp. are devoid of putative PKS genes. In stark contrast, cryptic PKS genes are widespread in genomes of non-pathogenic Clostridium species. According to phylogenetic analyses, the Clostridium PKS genes have unusual and diverse origins. However, reverse transcription quantitative PCR demonstrates that these genes are silent under standard cultivation conditions, explaining why the related metabolites have been overlooked until now. This study presents clostridia as a putative source for novel bioactive polyketides.

  2. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  3. The multifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum. Its gene structure relative to that of other polyketide synthases.

    Science.gov (United States)

    Beck, J; Ripka, S; Siegner, A; Schiltz, E; Schweizer, E

    1990-09-11

    6-Methylsalicylic acid synthase (MSAS) from Penicillium patulum is a homomultimer of a single, multifunctional protein subunit. The enzyme is induced, at the transcriptional level, during the end of the logarithmic growth phase. After approximately 150-fold purification, a homogeneous enzyme preparation was obtained exhibiting, upon SDS gel electrophoresis, a subunit molecular mass of 188 kDa. By immunological screening of a genomic P. patulum DNA expression library, the MSAS gene together with its flanking sequences was isolated; 7131 base pairs of the cloned genomic DNA were sequenced. Within this sequence the MSAS gene was identified as a 5322-bp-long open reading frame coding for a protein of 1774 amino acids and 190,731 Da molecular mass. Transcriptional initiation and termination sites were determined both by primer extension studies and from cDNA sequences specially prepared for the 5' and 3' portions of the gene. The same cDNA sequences revealed the presence of a 69-bp intron within the N-terminal part of the MSAS gene. The intron contains the canonical GT and AG dinucleotides at its 5'- and 3'-splice junctions. An internal TACTGAC sequence, resembling the TACTAAC consensus element of Saccharomyces cerevisiae introns is suggested to represent the branch point of the lariat splicing intermediate. When compared to other known polyketide synthases, distinct amino acid sequence similarities of limited lengths were observed with some, though not all, of them. A comparatively low degree of similarity was detected to the yeast and Penicillium FAS or to the plant chalcone and resveratrol synthases. In contrast, a significantly higher sequence similarity was found between MSAS and the rat fatty acid synthase, especially at their transacylase, 2-oxoacyl reductase, 2-oxoacyl synthase and acyl carrier protein domains. Besides several dissimilar, interspersed regions probably coding for MSAS- and FAS-specific functions, the sequential order of the similar domains was

  4. Radiopharmaceuticals to monitor gene transfer

    International Nuclear Information System (INIS)

    Wiebe, L. I.; Morin, K. W.; Knaus, E. E.

    1997-01-01

    Advances in genetic engineering and molecular biology have opened the door to disease treatment by transferring genes to cells that are responsible for the pathological condition being addressed. These genes can serve to supplement or introduce the function of indigenous genes that are either inadequately expressed or that are congenitally absent in the patient. They can introduce new functions such as drug sensitization to provide a unique therapeutic target. Gene transfer is readily monitored in vitro using a range of histochemical and biochemical tests that are ''built in'' to the therapeutic gene cassette. In vivo, in situ monitoring of the gene transfer and gene expression processes can be achieved with these tests only if biopsy is possible. Scintigraphic imaging can offer unique information on both the extent and location of gene expression, provided that an appropriate reporter gene is included in the therapeutic cassette. This overview includes a brief orientation to gene transfer therapy and is followed by a review of current approaches to gene therapy imaging. The concluding section deals with imaging based on radiolabelled nucleoside substrates for herpes simplex type-1 thymidine kinase, with emphasis on IVFRU, a stable potent and selective HSV-1 TK substrate developed in their laboratories

  5. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  6. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  7. Direct transfer of starter substrates from type I fatty acid synthase to type III polyketide synthases in phenolic lipid synthesis.

    Science.gov (United States)

    Miyanaga, Akimasa; Funa, Nobutaka; Awakawa, Takayoshi; Horinouchi, Sueharu

    2008-01-22

    Alkylresorcinols and alkylpyrones, which have a polar aromatic ring and a hydrophobic alkyl chain, are phenolic lipids found in plants, fungi, and bacteria. In the Gram-negative bacterium Azotobacter vinelandii, phenolic lipids in the membrane of dormant cysts are essential for encystment. The aromatic moieties of the phenolic lipids in A. vinelandii are synthesized by two type III polyketide synthases (PKSs), ArsB and ArsC, which are encoded by the ars operon. However, details of the synthesis of hydrophobic acyl chains, which might serve as starter substrates for the type III polyketide synthases (PKSs), were unknown. Here, we show that two type I fatty acid synthases (FASs), ArsA and ArsD, which are members of the ars operon, are responsible for the biosynthesis of C(22)-C(26) fatty acids from malonyl-CoA. In vivo and in vitro reconstitution of phenolic lipid synthesis systems with the Ars enzymes suggested that the C(22)-C(26) fatty acids produced by ArsA and ArsD remained attached to the ACP domain of ArsA and were transferred hand-to-hand to the active-site cysteine residues of ArsB and ArsC. The type III PKSs then used the fatty acids as starter substrates and carried out two or three extensions with malonyl-CoA to yield the phenolic lipids. The phenolic lipids in A. vinelandii were thus found to be synthesized solely from malonyl-CoA by the four members of the ars operon. This is the first demonstration that a type I FAS interacts directly with a type III PKS through substrate transfer.

  8. Transformation of trehalose synthase gene (TPS Gene) into corn ...

    African Journals Online (AJOL)

    ARL

    2011-11-02

    Nov 2, 2011 ... heredity; as such, no improvement can be seen in this way. Therefore, using transgenic technology to .... inherited and expressed stably in transferred plants. This can be verified from the result of drought .... Is verification involved in depression of the phase transition temperature in dry phospholipids.

  9. Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer

    Science.gov (United States)

    Abu-Soud, Husam M.; Stuehr, Dennis J.

    1993-11-01

    Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.

  10. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  11. Plasticity and evolution of (+)-3-carene synthase and (-)-sabinene synthase functions of a sitka spruce monoterpene synthase gene family associated with weevil resistance.

    Science.gov (United States)

    Roach, Christopher R; Hall, Dawn E; Zerbe, Philipp; Bohlmann, Jörg

    2014-08-22

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (-)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (-)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (-)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan

    2001-01-01

    of a functional cdd gene encoding cytidine deaminase. A characterization of the enzyme revealed similar properties as found for CTP synthases from other organisms. However, unlike the majority of CTP synthases the lactococcal enzyme can convert dUTP to dCTP, although a half saturation concentration of 0.6 m...

  13. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Leyva et al. 1995), UV treatments and blue light (Hartmann et al. 1998; Wade et al. 2001; Zhou et al. 2007), elicitor treatments such as salicylic acid and. Keywords. chalcone synthase; real-time PCR; silymarin; anthocyanin; Silybum marianum.

  14. Characterization of a 1-aminocyclopropane-1-carboxylate synthase gene from loblolly pine (Pinus taeda L.).

    Science.gov (United States)

    Barnes, J R; Lorenz, W W; Dean, J F D

    2008-04-30

    1-Aminocyclopropane-1-carboxylate (ACC) synthase catalyzes what is typically the rate-limiting step in the biosynthesis of ethylene, a gaseous plant growth regulator that plays numerous roles in the growth and development of higher plants. Although ACC synthase genes have been characterized from a wide variety of angiosperm plant species, no ACC synthase genes have been described previously for gymnosperms. Evidence suggests that ethylene helps to regulate wood formation in trees, and may also signal for the metabolic shifts that lead to compression wood formation on the undersides of branches and leaning stems in gymnosperm trees. Since compression wood is an inferior feedstock for the manufacturing of most wood products, a better understanding of the factors influencing its formation could lead to substantial economic benefits. This study describes the isolation and characterization of a putative ACC synthase gene, PtaACS1, from loblolly pine (Pinus taeda L.), an important commercial forest tree species. Also described is an apparent splice variant of PtaACS1 (PtaACS1s) that is missing 138 bp from the 5' end of the transcript, including bases that encode a conserved amino acid residue considered critical for ACC synthase activity. The two sequences share interesting homologies with a group of plant aminotransferases, in addition to ACC synthases, but structural models and the conservation of critical catalytic amino acid residues strongly support PtaACS1 as encoding an active ACC synthase. The two transcripts were differentially expressed in various tissues of loblolly pine, as well as in response to perturbations of pine seedling stems. Transcript levels of this ACC synthase gene increased rapidly in response to bending stress but returned to near starting levels within 30 min. It remains unclear to what extent bending-induced expression of this gene product plays a role in compression wood formation.

  15. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  16. Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.

    Directory of Open Access Journals (Sweden)

    Imke Schmitt

    Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.

  17. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    Science.gov (United States)

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  18. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  19. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    coumaroyl-CoA with three acetyl-CoA units, followed by folding, and initial cyclization; all catalyzed by a single enzyme, chalcone synthase (CHS). Further ring closure catalyzed by chalcone isomerase (CHI) yields naringenin. Coupling follows a ...

  20. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Abstract. Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are poten- tially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag ...

  1. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  2. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  3. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana.

    Science.gov (United States)

    Hemleben, V; Frey, M; Rall, S; Koch, M; Kittel, M; Kreuzaler, F; Ragg, H; Fautz, E; Hahlbrock, K

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  4. Gene therapy of transplant arteriopathy by liposome-mediated transfection of endothelial nitric oxide synthase.

    Science.gov (United States)

    Iwata, A; Sai, S; Moore, M; Nyhuis, J; de Fries-Hallstrand, R; Quetingco, G C; Allen, M D

    2000-11-01

    Transplant arteriopathy is the major factor limiting long-term survival after cardiac transplantation. We have previously demonstrated that liposome-mediated gene delivery of endothelial nitric oxide synthase (eNOS) to donor hearts reduces ischemia-reperfusion injury by blocking NFkappaB activation, adhesion molecule expression, and leukocyte infiltration. In this study, we used gene transfer of eNOS in a rabbit carotid transplant model to see whether these same effects would similarly ameliorate transplant arteriopathy. Liposomes complexed to the gene encoding eNOS were injected into donor carotid arterial segments that were transplanted orthotopically into recipient carotid arteries (n = 10). Controls included transplanted carotids transfected with liposomes complexed to empty plasmids (no functional gene) (n = 4) and transplanted carotids treated with saline (n = 6). Transplanted arteries were harvested for processing at 21 days. Intima/media (I/M) area ratios were calculated by computerized image analysis. Infiltrating T-lymphocytes and macrophages, and expression of VCAM-1 and ICAM-1 were quantified on immunocytochemistry. The I/M ratio was significantly reduced in eNOS-transfected arteries compared with arteries transfected with empty plasmids and saline-treated controls. Compared to transplanted control arteries, eNOS-transfected arteries demonstrated significantly reduced T-cell infiltration into the intima and significantly reduced macrophage infiltration into the media. Cell surface expression of VCAM-1 and ICAM-1 were both reduced in eNOS-transfected arteries. ENOS gene delivery can suppress neointimal lesion formation and T-lymphocyte and macrophage infiltration in transplanted arteries, associated with a reduction in relevant adhesion molecule expression. Thus, gene therapy with eNOS may not only reduce ischemia-reperfusion injury but may also ameliorate transplant arteriopathy in transplanted hearts.

  5. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutat...

  6. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis of 3-methyl...

  7. Transferring alien genes to wheat

    International Nuclear Information System (INIS)

    Knott, D.R.

    1987-01-01

    In broad terms an alien gene can be considered to be any gene transferred to wheat from a related species. As described above by Maan (section 7D) the genus Triticum contains a broad range of species, some of which cross readily with the cultivated tetraploid (T. Turgidum L.) or hexaploid (T. aestivum L.) wheats, and others only with great difficulty. In addition, wheat will also cross with species in a number of other genera including Agropyron, Elymus, Elytrigia (=Agropyron), Haynaldia, Hordeum, and Secale (Riley and Kimber, 1966; Knobloch, 1968; Feldman and Sears, 1981). In discussing the Triticum and Aegilops spp., the classification by Kimber and Sears, section SA-I, above, will be followed. For the Agropyron and related species the classification described by Dewey (1983) will be used. To avoid confusion, in referring to the literature the designations used by the authors will be given, followed by the new designation. The wild relatives of wheat are adapted to a broad range of environments and carry a large reservoir of useful genes (Zohary et al., 1969; Kerber and Dyck, 1973; Brezhnev, 1977; Feldman and Sears, 1981; Limin and Fowler, 1981; Sharma et aI., 1981; McGuire and Dvorak, 1981). Initially they were considered to be primarily sources of disease resistance, but more recently they have been recognized as potential sources of genes for high protein, cold tolerance, salt tolerance, drought tolerance, lodging resistance, early maturity, and even yield. Extensive screening of the wild relatives of wheat needs to be done before their useful genes can be fully utilized

  8. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  9. Gene transfer: anything goes in plant mitochondria

    Directory of Open Access Journals (Sweden)

    Richards Thomas A

    2010-12-01

    Full Text Available Abstract Parasitic plants and their hosts have proven remarkably adept at exchanging fragments of mitochondrial DNA. Two recent studies provide important mechanistic insights into the pattern, process and consequences of horizontal gene transfer, demonstrating that genes can be transferred in large chunks and that gene conversion between foreign and native genes leads to intragenic mosaicism. A model involving duplicative horizontal gene transfer and differential gene conversion is proposed as a hitherto unrecognized source of genetic diversity. See research article: http://www.biomedcentral.com/1741-7007/8/150

  10. Gene transfer: anything goes in plant mitochondria

    Science.gov (United States)

    2010-01-01

    Parasitic plants and their hosts have proven remarkably adept at exchanging fragments of mitochondrial DNA. Two recent studies provide important mechanistic insights into the pattern, process and consequences of horizontal gene transfer, demonstrating that genes can be transferred in large chunks and that gene conversion between foreign and native genes leads to intragenic mosaicism. A model involving duplicative horizontal gene transfer and differential gene conversion is proposed as a hitherto unrecognized source of genetic diversity. See research article: http://www.biomedcentral.com/1741-7007/8/150 PMID:21176244

  11. Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily.

    Science.gov (United States)

    Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg

    2004-08-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

  12. Identification and functional analysis of the geranylgeranyl pyrophosphate synthase gene (crtE) and phytoene synthase gene (crtB) for carotenoid biosynthesis in Euglena gracilis.

    Science.gov (United States)

    Kato, Shota; Takaichi, Shinichi; Ishikawa, Takahiro; Asahina, Masashi; Takahashi, Senji; Shinomura, Tomoko

    2016-01-05

    Euglena gracilis, a unicellular phytoflagellate within Euglenida, has attracted much attention as a potential feedstock for renewable energy production. In outdoor open-pond cultivation for biofuel production, excess direct sunlight can inhibit photosynthesis in this alga and decrease its productivity. Carotenoids play important roles in light harvesting during photosynthesis and offer photoprotection for certain non-photosynthetic and photosynthetic organisms including cyanobacteria, algae, and higher plants. Although, Euglenida contains β-carotene and xanthophylls (such as zeaxanthin, diatoxanthin, diadinoxanthin and 9'-cis neoxanthin), the pathway of carotenoid biosynthesis has not been elucidated. To clarify the carotenoid biosynthetic pathway in E. gracilis, we searched for the putative E. gracilis geranylgeranyl pyrophosphate (GGPP) synthase gene (crtE) and phytoene synthase gene (crtB) by tblastn searches from RNA-seq data and obtained their cDNAs. Complementation experiments in Escherichia coli with carotenoid biosynthetic genes of Pantoea ananatis showed that E. gracilis crtE (EgcrtE) and EgcrtB cDNAs encode GGPP synthase and phytoene synthase, respectively. Phylogenetic analyses indicated that the predicted proteins of EgcrtE and EgcrtB belong to a clade distinct from a group of GGPP synthase and phytoene synthase proteins, respectively, of algae and higher plants. In addition, we investigated the effects of light stress on the expression of crtE and crtB in E. gracilis. Continuous illumination at 460 or 920 μmol m(-2) s(-1) at 25 °C decreased the E. gracilis cell concentration by 28-40 % and 13-91 %, respectively, relative to the control light intensity (55 μmol m(-2) s(-1)). When grown under continuous light at 920 μmol m(-2) s(-1), the algal cells turned reddish-orange and showed a 1.3-fold increase in the crtB expression. In contrast, EgcrtE expression was not significantly affected by the light-stress treatments examined. We identified genes

  13. Association of a Soybean Raffinose Synthase Gene with Low Raffinose and Stachyose Seed Phenotype

    Directory of Open Access Journals (Sweden)

    Emily C. Dierking

    2008-11-01

    Full Text Available Oligosaccharides are an important component of soybean [ (L. Merr.] meal in terms of metabolizable energy for monogastric animals. Sucrose, raffinose, and stachyose are the three main oligosaccharides present in soybean meal. Of the three, only sucrose is nutritionally useful. When raffinose and stachyose are fermented by microbes present in the gut, the results are flatulence and discomfort, which ultimately lead to poor weight gain. The long term objective of this research is ultimately to increase the nutritional value of soybean meal by elevating the metabolizable energy at the expense of raffinose and stachyose through the manipulation of soybean raffinose synthase, the key enzyme for raffinose and stachyose biosynthesis. The objectives of this work were to develop molecular genetic information about soybean raffinose synthases and to evaluate the candidate raffinose synthase genes in a soybean germplasm accession (PI 200508 that contains low levels of raffinose and stachyose. Our results indicate the soybean genome contains at least two expressed genes similar to other characterized raffinose synthases. A novel allele of one of these putative soybean raffinose synthase genes was discovered from the PI 200508 that completely associates with the low raffinose and stachyose phenotype. Molecular marker assays specific for the PI 200508 allele were developed to allow direct selection for the low raffinose and low stachyose phenotype.

  14. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  15. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  16. Heterologous expression of dammarenediol synthase gene in an engineered Saccharomyces cerevisiae.

    Science.gov (United States)

    Liang, Y-L; Zhao, S-J; Xu, L-X; Zhang, X-Y

    2012-11-01

    Dammarenediol production by an engineered yeast Saccharomyces cerevisiae was investigated. A dammarenediol-producing engineered yeast was constructed by heterologous expression of the dammarenediol synthase gene from Panax ginseng hairy roots through RT-PCR. Fermentation was carried out in a 5-L GRJY-bioreactor with an inoculum size of 1% v/v at 30°C. Dammarenediol detection was performed with silica gel chromatography and HPLC. Determination of dammarenediol synthase activity subcellular distribution was carried out by surveying the enzyme activity in microsomes, lipid particles and total yeast homogenate. When cultured under aerobic conditions, the engineered yeast could produce dammarenediol up to 250μgl(-1). However, when an anaerobic shift strategy was employed, dammarenediol accumulated at a level as twice as that under aerobic condition. The dammarenediol synthase and dammarenediol were mainly localized in lipid particles. Dammarenediol could be heterologously produced in engineered yeast. The heterologously expressed dammarenediol synthase is mainly localized in lipid particles. Anaerobic shift strategy could enhance the dammarenediol level in the engineered yeast. This study showed that the high-value plant product dammarenediol could be produced by heterologous expression of the according gene in yeast. Furthermore, the anaerobic shift strategy could be potentially applied in oxidosqualene-derived compounds production in yeast. Here, the information about subcellular distribution of heterologously expressed dammarenediol synthase in the engineered yeast was also provided. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  17. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  18. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  19. Horizontal gene transfer in the phytosphere

    NARCIS (Netherlands)

    Elsas, van J.D.; Turner, S.; Bailey, M.J.

    2003-01-01

    Here, the ecological aspects of gene transfer processes between bacteria in the phytosphere are examined in the context of emerging evidence for the dominant role that horizontal gene transfer (HGT) has played in the evolutionary shaping of bacterial communities. Moreover, the impact of the putative

  20. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  1. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    ... our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways ...

  2. Translating Gene Transfer: A Stalled Effort

    OpenAIRE

    Greenberg, Alexandra J.; McCormick, Jennifer; Tapia, Carmen J.; Windebank, Anthony J.

    2011-01-01

    The journey of gene transfer from laboratory to clinic has been slow and fraught with many challenges and barriers. Despite the development of the initial technology in the early 1970s, a standard clinical treatment involving “gene therapy” remains to be seen. Furthermore, much was written about the technology in the early 1990s, but since then, not much has been written about the journey of gene transfer. The translational path of gene transfer thus far, both pitfalls and successes, can serv...

  3. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi.

    Science.gov (United States)

    Karuppayil, S M; Peng, M; Mendoza, L; Levins, T A; Szaniszlo, P J

    1996-01-01

    Primers having designs based on highly conserved stretches in the deduced amino acid sequences of chitin synthase (CHS) genes were used in PCR reactions to amplify 600 bp and 366 bp products from the genomic DNA of three major causal agents of chromoblastomycosis. Cloning and sequencing of the PCR products of one of these fungi, Fonsecaea pedrosoi, identified three CHS sequences designated as FpCHS1, FpCHS2 and FpCHS3. FpCHS1 and FpCHS2 were homologous to regions of CHS1 and CHS2 of Saccharomyces cerevisiae, and their derived amino acid sequences fell into chitin synthase classes I and II, respectively. FpCHS3 was homologous to a region of the CAL1/CSD2 gene of S. cerevisiae, which codes for the chitin synthase three (Chs3) enzyme in that fungus. Phylogenetic trees constructed using the deduced amino acid sequences of PCR-amplified CHS products from many fungi clustered F. pedrosoi with other dematiaceous fungi, providing new molecular evidence for the genetic relatedness of these organisms. The identification of these CHS genes in F. pedrosoi will facilitate future studies of the functional roles of chitin synthases in the unique in vivo dimorphism exhibited by chromoblastomycotic fungi.

  4. Cloning and expression analysis of an anthocyanidin synthase gene ...

    Indian Academy of Sciences (India)

    Expression of ANS in leaves, embryo and seed coat was analysed, which provided a ... taneously amplify the 666-bp fragment of actin gene. The. ANS gene expression in leaves, 15 days after pollination ... ANS expression with shading treatment was evaluated by semiquantitive RT-PCR using B. carinata variety 3H008-6.

  5. Translating gene transfer: a stalled effort.

    Science.gov (United States)

    Greenberg, Alexandra J; McCormick, Jennifer; Tapia, Carmen J; Windebank, Anthony J

    2011-08-01

    The journey of gene transfer from laboratory to clinic has been slow and fraught with many challenges and barriers. Despite the development of the initial technology in the early 1970s, a standard clinical treatment involving "gene therapy" remains to be seen. Furthermore, much was written about the technology in the early 1990s, but since then, not much has been written about the journey of gene transfer. The translational path of gene transfer thus far, both pitfalls and successes, can serve as a study not only in navigating ethical and safety concerns, but also in the importance of scientist-public interactions. Here, we examine the translational progress of gene transfer and what can be gleaned from its history. © 2011 Wiley Periodicals, Inc.

  6. Gene transfer therapy in vascular diseases.

    Science.gov (United States)

    McKay, M J; Gaballa, M A

    2001-01-01

    Somatic gene therapy of vascular diseases is a promising new field in modern medicine. Recent advancements in gene transfer technology have greatly evolved our understanding of the pathophysiologic role of candidate disease genes. With this knowledge, the expression of selective gene products provides the means to test the therapeutic use of gene therapy in a multitude of medical conditions. In addition, with the completion of genome sequencing programs, gene transfer can be used also to study the biologic function of novel genes in vivo. Novel genes are delivered to targeted tissue via several different vehicles. These vectors include adenoviruses, retroviruses, plasmids, plasmid/liposomes, and oligonucleotides. However, each one of these vectors has inherent limitations. Further investigations into developing delivery systems that not only allow for efficient, targeted gene transfer, but also are stable and nonimmunogenic, will optimize the clinical application of gene therapy in vascular diseases. This review further discusses the available mode of gene delivery and examines six major areas in vascular gene therapy, namely prevention of restenosis, thrombosis, hypertension, atherosclerosis, peripheral vascular disease in congestive heart failure, and ischemia. Although we highlight some of the recent advances in the use of gene therapy in treating vascular disease discovered primarily during the past two years, many excellent studies published during that period are not included in this review due to space limitations. The following is a selective review of practical uses of gene transfer therapy in vascular diseases. This review primarily covers work performed in the last 2 years. For earlier work, the reader may refer to several excellent review articles. For instance, Belalcazer et al. (6) reviewed general aspects of somatic gene therapy and the different vehicles used for the delivery of therapeutic genes. Gene therapy in restenosis and stimulation of

  7. Production of taxadiene from cultured ginseng roots transformed with taxadiene synthase gene

    Directory of Open Access Journals (Sweden)

    Mijeong Cha1, Sang Hee Shim1, Sung Hong Kim2, Ok Tae Kim3, Se-Weon Lee4, Suk-Yoon Kwon5 & Kwang-Hyun Baek1,*

    2012-10-01

    Full Text Available Paclitaxel is produced by various species of yew trees and hasbeen extensively used to treat tumors. In our research, ataxadiene synthase (TS gene from Taxus brevifolia was used totransform the roots of cultured ginseng (Panax ginseng C.A.Meyer to produce taxadiene, the unique skeletal precursor totaxol. The TS gene was successfully introduced into theginseng genome, and the de novo formation of taxadiene wasidentified by mass spectroscopy profiling. Without any changein phenotypes or growth difference in a TS-transgenic ginsengline, the transgenic TSS3-2 line accumulated 9.1 μg taxadieneper gram of dry weight. In response to the treatment of methyljasmonate for 3 or 6 days, the accumulation was 14.6 and15.9 μg per g of dry weight, respectively. This is the first reportof the production of taxadiene by engineering ginseng rootswith a taxadiene synthase gene.

  8. Endothelial nitric oxide synthase gene polymorphisms (G894T) in diabetes mellitus in Egypt

    OpenAIRE

    El-baz1 ; Farouk2; Tag Eldin2; Ezat2

    2010-01-01

    Objective: Diabetic nephropathy (DN) is one of the major microvascular complications of diabetes. Genetic predisposition has been implicated in DN. The eNOS protein synthesizes nitric oxide constitutively via a reaction including the conversion of L-arginine to L-citrulline, which involves the transfer of five electrons provided by nicotinamide adenine dinucleotide phosphate The aim of this study is to evaluate the association of G894T polymorphisms of endothelial nitric oxide synthase(eNOS) ...

  9. Cloning of the Nocardia corallina polyhydroxyalkanoate synthase gene and production of poly-(3-hydroxybutyrate-co-3-hydroxyhexanoate) and poly-(3-hydroxyvalerate-co-3-hydroxyheptanoate).

    Science.gov (United States)

    Hall, B; Baldwin, J; Rhie, H G; Dennis, D

    1998-07-01

    The polyhydroxyalkanoate (PHA) synthase gene (phaCNc) from Nocardia corallina was identified in a lambda library on a 6-kb BamHI fragment. A 2.8-kb XhoII subfragment was found to contain the intact PHA synthase. This 2.8-kb fragment was subjected to DNA sequencing and was found to contain the coding region for the PHA synthase and a small downstream open reading frame of unknown function. On the basis of DNA sequence, phaCNc is closest in homology to the PHA synthases (phaCPaI and phaCPaII) of Pseudomonas aeruginosa (approximately 41% identity and 55% similarity). The 2.8-kb XhoII fragment containing phaCNc was subcloned into broad host range mobilizable plasmids and transferred into Escherichia coli, Klebsiella aerogenes (both containing a plasmid bearing phaA and phaB from Ralstonia eutropha), and PHA-negative strains of R. eutropha and Pseudomonas putida. The recombinant strains were grown on various carbon sources and the resulting polymers were analyzed. In these strains, the PHA synthase from N. corallina was able to mediate the production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) containing high levels of 3-hydroxyhexanoate when grown on hexanoate and larger even-chain fatty acids and poly(3-hydroxyvalerate-co-3-hydroxyheptanoate) containing high levels of 3-hydroxyheptanoate when grown on heptanoate or larger odd-chain fatty acids.

  10. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  11. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  12. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  13. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp ...

  14. Cloning and expression pattern of chitin synthase (CHS) gene in ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Aug 16, 2010 ... This study provided an important information for further research on development of RNA interference. (RNAi) technology to control E. ... transcriptional gene silencing; RNAi, RNA interference; RACE, rapid amplification of cDNA .... Alignment showed that the alternately spliced. cDNA sequence of CHS-A in ...

  15. The geranylgeranyl pyrophosphate synthase gene from Ginkgo biloba

    African Journals Online (AJOL)

    polypeptide. Comparative analysis showed that GbGGDPS had a high similarity to other plant GGDPSs. Bioinformatic analysis showed that GbGGDPS was an intron-free gene and its deduced polypeptide contained all the five conserved domains and functional aspartate-rich motifs of the polyprenyltransferases.

  16. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Jimai 22 were used as an experimental model to analyse the expression patterns of wheat TPS genes .... the Bioanalyzer 2100 algorithm (Agilent Technologies, Palo. Alto, USA); high quality (RNA integrity ... software (Premier Biosoft International, Palo Alto, USA). Sequences and other information of the ...

  17. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  18. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Directory of Open Access Journals (Sweden)

    Anam eYousaf

    2015-09-01

    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  19. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  20. Identification of Sporothrix schenckii based on sequences of the chitin synthase 1 gene.

    Science.gov (United States)

    Kano, R; Nakamura, Y; Watanabe, S; Tsujimoto, H; Hasegawa, A

    2001-01-01

    Sporothrix schenckii is pathogenic to human and animals. To detect S. schenckii in the tissue, we designed specific oligonucleotide primers based on the chitin synthase gene. Amplification products were selectively obtained from S. schenckii DNA. Polymerase chain reaction analysis with the primer pair S2-R2 was able to detect 10 pg genomic DNA of S. schenckii with ethidium bromide staining. This detection system will be useful as a microbiological tool for the diagnosis of human and animal sporotrichosis.

  1. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  2. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  3. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  4. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.

    OpenAIRE

    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M

    1997-01-01

    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  5. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  7. Conservation and divergence of Starch Synthase III genes of monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Bhavya Priyadarshini Mishra

    Full Text Available Starch Synthase (SS plays an important role in extending the α-1,4 glucan chains during starch biosynthesis by catalyzing the transfer of the glucosyl moiety from ADP-glucose to the non-reducing end of a pre-existing glucan chain. SS has five distinct isoforms of which SSIII is involved in the formation of longer glucan chain length. Here we report identification and detailed characterization of 'true' orthologs of the well-characterized maize SSIII (ZmSSIII, among six monocots and two dicot species. ZmSSIII orthologs have nucleotide sequence similarity ranging from 56-81%. Variation in gene size among various orthologs ranged from 5.49 kb in Arabidopsis to 11.62 kb in Brachypodium and the variation was mainly due to intron size and indels present in the exons 1 and 3. Number of exons and introns were highly conserved among all orthologs however. While the intron number was conserved, intron phase showed variation at group, genera and species level except for intron 1 and 5. Several species, genera, and class specific cis-acting regulatory elements were identified in the promoter region. The predicted protein size of the SSIII orthologs ranged from 1094 amino acid (aa in Arabidopsis to 1688 aa in Brachypodium with sequence identity ranging from 60%-89%. The N-terminal region of the protein was highly variable whereas the C-terminal region containing the Glycosyltransferase domain was conserved with >80% sequence similarity among the orthologs. In addition to confirming the known motifs, eleven novel motifs possibly providing species, genera and group specific functions, were identified in the three carbohydrate binding domains. Despite of significant sequence variation among orthologs, most of the motifs and their relative distances are highly conserved among the orthologs. The 3-D structure of catalytic region of SSIII orthologs superimposed with higher confidence confirming the presence of similar binding sites with five unidentified

  8. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Science.gov (United States)

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  9. The phytochelatin synthase gene in date palm (Phoenix dactylifera L.): Phylogeny, evolution and expression.

    Science.gov (United States)

    Zayneb, Chaâbene; Imen, Rekik Hakim; Walid, Kriaa; Grubb, C Douglas; Bassem, Khemakhem; Franck, Vandenbulcke; Hafedh, Mejdoub; Amine, Elleuch

    2017-06-01

    We studied date palm phytochelatin synthase type I (PdPCS1), which catalyzes the cytosolic synthesis of phytochelatins (PCs), a heavy metal binding protein, in plant cells. The gene encoding PdPCS1 (Pdpcs) consists of 8 exons and 7 introns and encodes a protein of 528 amino acids. PCs gene history was studied using Notung phylogeny. During evolution, gene loss from several lineages was predicted including Proteobacteria, Bilateria and Brassicaceae. In addition, eleven gene duplication events appeared toward interior nodes of the reconciled tree and four gene duplication events appeared toward the external nodes. These latter sequences belong to species with a second copy of PCs suggesting that this gene evolved through subfunctionalization. Pdpcs1 gene expression was measured in seedling hypocotyls exposed to Cd, Cu and Cr using quantitative real-time polymerase chain reaction (qPCR). A Pdpcs1 overexpression was evidenced in P. dactylifera seedlings exposed to metals suggesting that 1-the Pdpcs1 gene is functional, 2-there is an implication of the enzyme in metal detoxification mechanisms. Additionally, the structure of PdPCS1 was predicted using its homologue from Nostoc (cyanobacterium, NsPCS) as a template in Discovery studio and PyMol software. These analyses allowed us to identify the phytochelatin synthase type I enzyme in date palm (PdPCS1) via recognition of key consensus amino acids involved in the catalytic mechanism, and to propose a hypothetical binding and catalytic site for an additional substrate binding cavity. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Plant gene transfer and expression protocols

    National Research Council Canada - National Science Library

    Jones, Heddwyn

    1995-01-01

    ... proteins in plants can often lead to a better understanding of biochemical and physiological processes. Fourth, gene transfer technology has allowed the improvement of plant agricultural productivity. For example, plants have been engineered with improved viral resistance or the ability to withstand herbicide attack, therefore allowing a more eff...

  11. Quick guide to polyketide synthase and nonribosomal synthetase genes in Fusarium

    DEFF Research Database (Denmark)

    Hansen, Jørgen T.; Sørensen, Jens L.; Giese, Henriette

    2012-01-01

    for future polyketide synthases (PKSs) and nonribosomal peptides synthetases (NRPSs) nomenclature assignment and classification. Sequence similarities of the adenylation and ketosynthase domain sequences were used to group the identified NRPS and PKS genes. We present the current state of knowledge of PKS......Fusarium species produce a plethora of bioactive polyketides and nonribosomal peptides that give rise to health problems in animals and may have drug development potential. Using the genome sequences for Fusarium graminearum, F. oxysporum, F. solani and F. verticillioides we developed a framework...

  12. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  13. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  14. Characterization of Squalene synthase gene from Chlorophytum borivilianum (Sant. and Fernand.).

    Science.gov (United States)

    Kalra, Shikha; Kumar, Sunil; Lakhanpal, Neha; Kaur, Jagdeep; Singh, Kashmir

    2013-07-01

    Saponins are important group of secondary metabolites known for their pharmacological properties. Chlorophytum borivilianum contains high amount of saponins and is thus, recognized as an important medicinal plant with aphrodisiac properties. Though the plant is well known for its pharmaceutical properties, there is meager information available about the genes and enzymes responsible for biosynthesis of saponins from this plant. Squalene synthase (SqS) is the key enzyme of saponin biosynthesis pathway and here, we report cloning and characterization of SqS gene from C. borivilianum. A full-length CbSqS cDNA consisting of 1,760 bp was cloned which contained an open reading frame (ORF) of 1,233 bp, encoding a protein of 411 amino acids. Analysis of deduced amino acid sequence of CbSqS predicted the presence of conserved isoprenoid family domain and catalytic sites. Phylogenetic analysis revealed that CbSqS is closer to Glycine max and monocotyledonous plants. 3D structure prediction using various programs showed CbSqS structure to be similar to SqS from other species. C-terminus truncated recombinant squalene synthase (TruncCbSqS) was expressed in E. coli M15 cells with optimum expression induced with 1 mM IPTG at 37 °C. The gene expression level was analyzed through semi-quantitative RT-PCR and was found to be higher in leaves as compared to the roots.

  15. Genome and transcriptome-wide analyses of cellulose synthase gene superfamily in soybean.

    Science.gov (United States)

    Nawaz, Muhammad Amjad; Rehman, Hafiz Mamoon; Baloch, Faheem Shehzad; Ijaz, Babar; Ali, Muhammad Amjad; Khan, Iqrar Ahmad; Lee, Jeong Dong; Chung, Gyuhwa; Yang, Seung Hwan

    2017-08-01

    The plant cellulose synthase gene superfamily belongs to the category of type-2 glycosyltransferases, and is involved in cellulose and hemicellulose biosynthesis. These enzymes are vital for maintaining cell-wall structural integrity throughout plant life. Here, we identified 78 putative cellulose synthases (CS) in the soybean genome. Phylogenetic analysis against 40 reference Arabidopsis CS genes clustered soybean CSs into seven major groups (CESA, CSL A, B, C, D, E and G), located on 19 chromosomes (except chromosome 18). Soybean CS expansion occurred in 66 duplication events. Additionally, we identified 95 simple sequence repeat makers related to 44 CSs. We next performed digital expression analysis using publically available datasets to understand potential CS functions in soybean. We found that CSs were highly expressed during soybean seed development, a pattern confirmed with an Affymatrix soybean IVT array and validated with RNA-seq profiles. Within CS groups, CESAs had higher relative expression than CSLs. Soybean CS models were designed based on maximum average RPKM values. Gene co-expression networks were developed to explore which CSs could work together in soybean. Finally, RT-PCR analysis confirmed the expression of 15 selected CSs during all four seed developmental stages. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    Science.gov (United States)

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed actinomycetes to produce bioactive molecules.

  17. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    Science.gov (United States)

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  18. Horizontal gene transfer in silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Li Bin

    2011-05-01

    Full Text Available Abstract Background The domesticated silkworm, Bombyx mori, is the model insect for the order Lepidoptera, has economically important values, and has gained some representative behavioral characteristics compared to its wild ancestor. The genome of B. mori has been fully sequenced while function analysis of BmChi-h and BmSuc1 genes revealed that horizontal gene transfer (HGT maybe bestow a clear selective advantage to B. mori. However, the role of HGT in the evolutionary history of B. mori is largely unexplored. In this study, we compare the whole genome of B. mori with those of 382 prokaryotic and eukaryotic species to investigate the potential HGTs. Results Ten candidate HGT events were defined in B. mori by comprehensive sequence analysis using Maximum Likelihood and Bayesian method combining with EST checking. Phylogenetic analysis of the candidate HGT genes suggested that one HGT was plant-to- B. mori transfer while nine were bacteria-to- B. mori transfer. Furthermore, functional analysis based on expression, coexpression and related literature searching revealed that several HGT candidate genes have added important characters, such as resistance to pathogen, to B. mori. Conclusions Results from this study clearly demonstrated that HGTs play an important role in the evolution of B. mori although the number of HGT events in B. mori is in general smaller than those of microbes and other insects. In particular, interdomain HGTs in B. mori may give rise to functional, persistent, and possibly evolutionarily significant new genes.

  19. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    Science.gov (United States)

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  20. Clinical aspects of endothelial NO-synthase gene polymorphism in professional sportsmen (literature review

    Directory of Open Access Journals (Sweden)

    S. N. Malakhova

    2016-08-01

    Full Text Available The article deals the questions of properties and biological role of nitric oxide molecule, which is characterized with vasodilating, stress limiting and neurotransmitter properties, and participates in reactions of oxidative stress, glutamate and calcium cascade and inflammation. Researches of the relationship of endothelial NO-synthase and the risk of cardiovascular, ischemic and respiratory diseases in population of untrained persons and athletes continue. The aim of this study was to establish, according to the literature, the present state of the influence of endothelial NO-synthase gene polymorphism on the formation of the physical qualities of strength, endurance and speed in professional athletes, its changes and influence on functional state of athlete. At the present stage of development of medical genetics it is proved, that the implementation of the action of each individual isoform of the enzyme NO-synthase is caused by the presence of polymorphism. The most studied are the T-786С polymorphism of the eNOS gene promoter, G894T (Glu298Asp polymorphism of the 7th exon, 4a/b–4th intron of eNOS, but their influence is not definitively proven, and is caused by the presence of homo- or heterozygotes. Genetic researches among professional athletes prove the significant role of nitric oxide system in enhancing of physical working capacity, but do not allow evaluating the characteristics of this effect, taking into account multi-directional training process and the level of sports qualification, as well as predicting future professional success and the preservation of the proper functioning of the cardiovascular, respiratory and other body systems. Conclusions. Thus, contemporary researches allow stating that oxide synthesis has a leading role in the functioning of the organism, and in particular athletes, but do not allow assessing its effects on the body of athletes of different sports qualification. It is proved that polymorphism of the

  1. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  2. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Science.gov (United States)

    Wang, Guoliang; Zhao, Ge; Feng, Yanbin; Xuan, Jinsong; Sun, Jianwei; Guo, Baotai; Jiang, Guoyong; Weng, Manli; Yao, Jianting; Wang, Bin; Duan, Delin; Liu, Tao

    2010-01-01

    The full-length cDNA sequence (3219 base pairs) of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS) was isolated by RACE-PCR and deposited in GenBank (NCBI) with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5), whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB). Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI). All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94%) and in amino acid composition (>96%). Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes. PMID:20714424

  3. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  4. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  5. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Widespread of horizontal gene transfer in the human genome

    OpenAIRE

    Huang, Wenze; Tsai, Lillian; Li, Yulong; Hua, Nan; Sun, Chen; Wei, Chaochun

    2017-01-01

    Background A fundamental concept in biology is that heritable material is passed from parents to offspring, a process called vertical gene transfer. An alternative mechanism of gene acquisition is through horizontal gene transfer (HGT), which involves movement of genetic materials between different species. Horizontal gene transfer has been found prevalent in prokaryotes but very rare in eukaryote. In this paper, we investigate horizontal gene transfer in the human genome. Results From the pa...

  7. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  8. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    Science.gov (United States)

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way.

  9. Induction of Malate Synthase Gene Expression in Senescent and Detached Organs of Cucumber.

    Science.gov (United States)

    Graham, IA; Leaver, CJ; Smith, SM

    1992-01-01

    Expression of the malate synthase (MS) gene is activated in cotyledons of cucumber seedlings during postgerminative growth and then repressed as the cotyledons become photosynthetic. MS gene expression is subsequently reactivated in the cotyledons as they senesce a few weeks later. In situ hybridization revealed that MS RNA is distributed throughout the organ during postgerminative growth and senescence, showing that the same cells express the gene at different stages of development. MS RNA also appears in senescing leaves and petals of cucumber plants. In addition, we found that MS RNA appears in mature expanded leaves and roots when they are removed from the plant and incubated in darkness for several days, thus providing a potential experimental system for the manipulation of MS gene expression. Leaves from transgenic Nicotiana plumbaginifolia containing the cucumber MS promoter fused to the [beta]-glucuronidase (GUS) reporter gene accumulated GUS activity when detached, demonstrating an activation of transcription from the MS promoter following leaf excision. These results are discussed in terms of the metabolic regulation of MS gene expression. PMID:12297649

  10. The use of alien gene transfers

    International Nuclear Information System (INIS)

    Bhatia, C.R.

    1976-01-01

    The present status of the gene transfers from alien species belonging to the sub-tribe Triticanae into wheat is reviewed, and the advantages and disadvantages of the different methods available for such transfers are examined. In general, the alien genes provide a high degree of resistance against a notably wide range of physiological races of wheat rusts, powdery mildew and other diseases. The alien resistance, like other sources of resistance, is known to break down for certain new races. This may happen more often when alien genes of resistance are widely incorporated in commercial cultivars and grown over large areas. So far, few of the available induced translocation stocks have contributed to the development of agronomically superior commercial cultivars, mainly due to the associated undesirable effects of the translocations on agronomic characters of the recipient variety. The deleterious effects appear in some genetic backgrounds and not in others. Extensive hybridization of translocation stocks with different genotypes has been emphasized by most investigators. Such programmes have led to the release of three commercial cultivars - 2 in Australia and 1 in the USA. On the other hand, spontaneous wheat-rye translocations carrying gene(s) for disease resistance have been unconsciously incorporated into several wheat cultivars, some of them are widely cultivated and were top in ranking based on grain yield. (author)

  11. Rifkin strikes against gene transfer experiments.

    Science.gov (United States)

    Beardsley, T

    Jeremy Rifkin's lobbying organization, the Foundation on Economic Trends, has brought suit in U.S. District Court, together with the Humane Society of the U.S., to halt gene transfer experiments being carried out in livestock by the Department of Agriculture. The plaintiffs allege that the experiments--which entail injecting fusion genes that include the DNA structural sequence of the human growth hormone into the fertilized eggs of sheep and pigs--are morally objectionable, a potential threat to the biological stability of animal species, and likely to have undesirable economic and environmental consequences.

  12. Reactivation of methionine synthase from Thermotoga maritima (TM0268) requires the downstream gene product TM0269.

    Science.gov (United States)

    Huang, Sha; Romanchuk, Gail; Pattridge, Katherine; Lesley, Scott A; Wilson, Ian A; Matthews, Rowena G; Ludwig, Martha

    2007-08-01

    The crystal structure of the Thermotoga maritima gene product TM0269, determined as part of genome-wide structural coverage of T. maritima by the Joint Center for Structural Genomics, revealed structural homology with the fourth module of the cobalamin-dependent methionine synthase (MetH) from Escherichia coli, despite the lack of significant sequence homology. The gene specifying TM0269 lies in close proximity to another gene, TM0268, which shows sequence homology with the first three modules of E. coli MetH. The fourth module of E. coli MetH is required for reductive remethylation of the cob(II)alamin form of the cofactor and binds the methyl donor for this reactivation, S-adenosylmethionine (AdoMet). Measurements of the rates of methionine formation in the presence and absence of TM0269 and AdoMet demonstrate that both TM0269 and AdoMet are required for reactivation of the inactive cob(II)alamin form of TM0268. These activity measurements confirm the structure-based assignment of the function of the TM0269 gene product. In the presence of TM0269, AdoMet, and reductants, the measured activity of T. maritima MetH is maximal near 80 degrees C, where the specific activity of the purified protein is approximately 15% of that of E. coli methionine synthase (MetH) at 37 degrees C. Comparisons of the structures and sequences of TM0269 and the reactivation domain of E. coli MetH suggest that AdoMet may be bound somewhat differently by the homologous proteins. However, the conformation of a hairpin that is critical for cobalamin binding in E. coli MetH, which constitutes an essential structural element, is retained in the T. maritima reactivation protein despite striking divergence of the sequences.

  13. Functional Characterization of Nine Norway Spruce TPS Genes and Evolution of Gymnosperm Terpene Synthases of the TPS-d Subfamily1[w

    Science.gov (United States)

    Martin, Diane M.; Fäldt, Jenny; Bohlmann, Jörg

    2004-01-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (−)-limonene synthase, (−)-α/β-pinene synthase, and (−)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-α-farnesene synthase, and E-α-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed. PMID:15310829

  14. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    Directory of Open Access Journals (Sweden)

    Chen Aiqun

    2012-06-01

    Full Text Available Abstract Background In plants, sucrose synthase (Sus is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7 identified from diploid fiber cotton (Gossypium arboreum. Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development.

  15. Structural and functional characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42.

    Science.gov (United States)

    Chen, Xiao-Hua; Vater, Joachim; Piel, Jörn; Franke, Peter; Scholz, Romy; Schneider, Kathrin; Koumoutsi, Alexandra; Hitzeroth, Gabriele; Grammel, Nicolas; Strittmatter, Axel W; Gottschalk, Gerhard; Süssmuth, Roderich D; Borriss, Rainer

    2006-06-01

    Although bacterial polyketides are of considerable biomedical interest, the molecular biology of polyketide biosynthesis in Bacillus spp., one of the richest bacterial sources of bioactive natural products, remains largely unexplored. Here we assign for the first time complete polyketide synthase (PKS) gene clusters to Bacillus antibiotics. Three giant modular PKS systems of the trans-acyltransferase type were identified in Bacillus amyloliquefaciens FZB 42. One of them, pks1, is an ortholog of the pksX operon with a previously unknown function in the sequenced model strain Bacillus subtilis 168, while the pks2 and pks3 clusters are novel gene clusters. Cassette mutagenesis combined with advanced mass spectrometric techniques such as matrix-assisted laser desorption ionization-time of flight mass spectrometry and liquid chromatography-electrospray ionization mass spectrometry revealed that the pks1 (bae) and pks3 (dif) gene clusters encode the biosynthesis of the polyene antibiotics bacillaene and difficidin or oxydifficidin, respectively. In addition, B. subtilis OKB105 (pheA sfp(0)), a transformant of the B. subtilis 168 derivative JH642, was shown to produce bacillaene, demonstrating that the pksX gene cluster directs the synthesis of that polyketide. The GenBank accession numbers for gene clusters pks1(bae), pks2, and pks3(dif) are AJ 634060.2, AJ 6340601.2, and AJ 6340602.2, respectively.

  16. Positive selection and functional divergence of farnesyl pyrophosphate synthase genes in plants.

    Science.gov (United States)

    Qian, Jieying; Liu, Yong; Chao, Naixia; Ma, Chengtong; Chen, Qicong; Sun, Jian; Wu, Yaosheng

    2017-02-04

    Farnesyl pyrophosphate synthase (FPS) belongs to the short-chain prenyltransferase family, and it performs a conserved and essential role in the terpenoid biosynthesis pathway. However, its classification, evolutionary history, and the forces driving the evolution of FPS genes in plants remain poorly understood. Phylogeny and positive selection analysis was used to identify the evolutionary forces that led to the functional divergence of FPS in plants, and recombinant detection was undertaken using the Genetic Algorithm for Recombination Detection (GARD) method. The dataset included 68 FPS variation pattern sequences (2 gymnosperms, 10 monocotyledons, 54 dicotyledons, and 2 outgroups). This study revealed that the FPS gene was under positive selection in plants. No recombinant within the FPS gene was found. Therefore, it was inferred that the positive selection of FPS had not been influenced by a recombinant episode. The positively selected sites were mainly located in the catalytic center and functional areas, which indicated that the 98S and 234D were important positively selected sites for plant FPS in the terpenoid biosynthesis pathway. They were located in the FPS conserved domain of the catalytic site. We inferred that the diversification of FPS genes was associated with functional divergence and could be driven by positive selection. It was clear that protein sequence evolution via positive selection was able to drive adaptive diversification in plant FPS proteins. This study provides information on the classification and positive selection of plant FPS genes, and the results could be useful for further research on the regulation of triterpenoid biosynthesis.

  17. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  19. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii. Copyright © 2014. Published by Elsevier Inc.

  20. Horizontal Gene Transfer, Dispersal and Haloarchaeal Speciation

    Science.gov (United States)

    Papke, R. Thane; Corral, Paulina; Ram-Mohan, Nikhil; de la Haba, Rafael R.; Sánchez-Porro, Cristina; Makkay, Andrea; Ventosa, Antonio

    2015-01-01

    The Halobacteria are a well-studied archaeal class and numerous investigations are showing how their diversity is distributed amongst genomes and geographic locations. Evidence indicates that recombination between species continuously facilitates the arrival of new genes, and within species, it is frequent enough to spread acquired genes amongst all individuals in the population. To create permanent independent diversity and generate new species, barriers to recombination are probably required. The data support an interpretation that rates of evolution (e.g., horizontal gene transfer and mutation) are faster at creating geographically localized variation than dispersal and invasion are at homogenizing genetic differences between locations. Therefore, we suggest that recurrent episodes of dispersal followed by variable periods of endemism break the homogenizing forces of intrapopulation recombination and that this process might be the principal stimulus leading to divergence and speciation in Halobacteria. PMID:25997110

  1. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  2. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Enhanced thermotolerance for ethanol fermentation of Saccharomyces cerevisiae strain by overexpression of the gene coding for trehalose-6-phosphate synthase.

    Science.gov (United States)

    An, Ming-Zhe; Tang, Yue-Qin; Mitsumasu, Kanako; Liu, Ze-Shen; Shigeru, Morimura; Kenji, Kida

    2011-07-01

    The effect of overexpression of the trehalose-6-phosphate (T6P) synthase gene (TPS1) on ethanol fermentation of Saccharomyces cerevisiae has been studied at 30 and 38°C. The activity of T6P synthase and the accumulation of trehalose during ethanol fermentation were significantly improved by overexpression of TPS1, and especially at 38°C. Ethanol produced by transformants with and without TPS1 gene overexpression at 38°C was approx. 60 and 37 g/l, respectively. The fermentation efficiency of transformants with TPS1 gene overexpression at 38°C was similar to that at 30°C. The critical growth temperature was increased from 36 to 42°C by TPS1 gene overexpression. These results indicated that overexpression of the TPS1 gene had a beneficial effect on the fermentation capacity of the title yeast strain at high temperatures.

  4. Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase.

    Directory of Open Access Journals (Sweden)

    Carole H Sellem

    2016-07-01

    Full Text Available Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO of the ATP synthase drive the rotation of a ring of 8-15 c-subunits, which induces conformational changes in the catalytic part (F1 of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary cells while Atp9-5 is expressed in the cells at the extremity (apex of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before.

  5. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  6. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  7. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    Energy Technology Data Exchange (ETDEWEB)

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. (Vanderbilt Univ., Nashville, TN (United States))

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  8. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  9. Identification of a novel hedycaryol synthase gene isolated from Camellia brevistyla flowers and floral scent of Camellia cultivars.

    Science.gov (United States)

    Hattan, Jun-ichiro; Shindo, Kazutoshi; Ito, Tomoko; Shibuya, Yurica; Watanabe, Arisa; Tagaki, Chie; Ohno, Fumina; Sasaki, Tetsuya; Ishii, Jun; Kondo, Akihiko; Misawa, Norihiko

    2016-04-01

    A novel terpene synthase (Tps) gene isolated from Camellia brevistyla was identified as hedycaryol synthase, which was shown to be expressed specifically in flowers. Camellia plants are very popular because they bloom in winter when other plants seldom flower. Many ornamental cultivars of Camellia have been bred mainly in Japan, although the fragrance of their flowers has not been studied extensively. We analyzed floral scents of several Camellia cultivars by gas chromatography-mass spectrometry (GC-MS) and found that Camellia brevistyla produced various sesquiterpenes in addition to monoterpenes, whereas Camellia japonica and its cross-lines produced only monoterpenes, including linalool as the main product. From a flower of C. brevistyla, we isolated one cDNA encoding a terpene synthase (TPS) comprised of 554 amino acids, which was phylogenetically positioned to a sole gene clade. The cDNA, designated CbTps1, was expressed in mevalonate-pathway-engineered Escherichia coli, which carried the Streptomyces mevalonate-pathway gene cluster in addition to the acetoacetate-CoA ligase gene. A terpene product was purified from recombinant E. coli cultured with lithium acetoacetate, and analyzed by (1)H-nulcear magnetic resonance spectroscopy ((1)H-NMR) and GC-MS. It was shown that a sesquiterpene hedycaryol was produced, because (1)H-NMR signals of the purified product were very broad, and elemol, a thermal rearrangement product from hedycaryol, was identified by GC-MS analysis. Spectroscopic data of elemol were also determined. These results indicated that the CbTps1 gene encodes hedycaryol synthase. Expression analysis of CbTps1 showed that it was expressed specifically in flowers, and hedycaryol is likely to be one of the terpenes that attract insects for pollination of C. brevistyla. A linalool synthase gene, which was isolated from a flower of Camellia saluenensis, is also described.

  10. Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR

    NARCIS (Netherlands)

    Olawole, O.; Jacobsen, E.; Vincken, J.P.; Visser, R.G.F.

    2009-01-01

    Two transgenic potato lines, csr2–1 and csr4–8 that contained two different antisense cellulose synthase (CesA) genes, csr2 and csr4, respectively were crossed. The aim, amongst others, was to investigate the possibility of generating double transformants to validate a hypothetical presence of the

  11. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Directory of Open Access Journals (Sweden)

    Bin Tang

    2018-01-01

    Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

  12. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Science.gov (United States)

    Tang, Bin; Wang, Su; Wang, Shi-Gui; Wang, Hui-Juan; Zhang, Jia-Yong; Cui, Shuai-Ying

    2018-01-01

    The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP) pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects. PMID:29445344

  13. Methods for gene transfer to synovium.

    Science.gov (United States)

    Kang, R; Robbins, P D; Evans, C H

    1997-01-01

    Development of methods for gene transfer to synoviocytes was borne from the idea that gene therapy could be used to more effectively treat rheumatoid arthritis (EU) and other joint disorders (1). Current pharmaceutical modalities in use against RA have limited effectiveness because of problems related to inefficient targeting of drugs to the joint, as well as inefficacies of the drugs themselves. Drug delivery to the joint by traditional oral, iv, and intramuscular routes, depends on passive diffusion of the drug from the synovial vasculature into the joint space (2). Thus, high systemic concentrations of the drug are necessary to achieve therapeutic intra-articular drug levels; in chronic RA, perfusion of the synovium may be compromised (3), driving required systemic drug levels even higher. This is of major concern, as the pharmaceuticals used to treat this disease are associated with serious side effects. Further compounding these problems is the chronic nature of RA, which requires lifelong treatment with high dosages of these drugs.

  14. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  15. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  16. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  17. The polyketide synthase gene pks4 of Trichoderma reesei provides pigmentation and stress resistance.

    Science.gov (United States)

    Atanasova, Lea; Knox, Benjamin P; Kubicek, Christian P; Druzhinina, Irina S; Baker, Scott E

    2013-11-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi.

  18. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    Science.gov (United States)

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  19. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  20. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase ( Ans ) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans +5 . The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans / ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans +5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  1. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L..

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Rafique

    2016-12-01

    Full Text Available Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (Anne. A 5-bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect i.e. nonsense-mRNA mediated decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  2. Reducible cationic lipids for gene transfer.

    Science.gov (United States)

    Wetzer, B; Byk, G; Frederic, M; Airiau, M; Blanche, F; Pitard, B; Scherman, D

    2001-01-01

    One of the main challenges of gene therapy remains the increase of gene delivery into eukaryotic cells. We tested whether intracellular DNA release, an essential step for gene transfer, could be facilitated by using reducible cationic DNA-delivery vectors. For this purpose, plasmid DNA was complexed with cationic lipids bearing a disulphide bond. This reduction-sensitive linker is expected to be reduced and cleaved in the reducing milieu of the cytoplasm, thus potentially improving DNA release and consequently transfection. The DNA--disulphide-lipid complexation was monitored by ethidium bromide exclusion, and the size of complexes was determined by dynamic light scattering. It was found that the reduction kinetics of disulphide groups in DNA--lipid complexes depended on the position of the disulphide linker within the lipid molecule. Furthermore, the internal structure of DNA--lipid particles was examined by small-angle X-ray scattering before and after lipid reduction. DNA release from lipid complexes was observed after the reduction of disulphide bonds of several lipids. Cell-transfection experiments suggested that complexes formed with selected reducible lipids resulted in up to 1000-fold higher reporter-gene activity, when compared with their analogues without disulphide bonds. In conclusion, reduction-sensitive groups introduced into cationic lipid backbones potentially allow enhanced DNA release from DNA--lipid complexes after intracellular reduction and represent a tool for improved vectorization. PMID:11389682

  3. Regulation of acetate metabolism in Corynebacterium glutamicum: transcriptional control of the isocitrate lyase and malate synthase genes.

    Science.gov (United States)

    Wendisch, V F; Spies, M; Reinscheid, D J; Schnicke, S; Sahm, H; Eikmanns, B J

    1997-10-01

    In the amino-acid-producing microorganism Corynebacterium glutamicum, the specific activities of the acetate-activating enzymes acetate kinase and phosphotransacetylase and those of the glyoxylate cycle enzymes isocitrate lyase and malate synthase were found to be high when the cells were grown on acetate (0.8, 2.9, 2.1, and 1.8 U/mg protein, respectively). When the cells were grown on glucose or on other carbon sources such as lactate, succinate, or glutamate, the specific activities were two- to fourfold (acetate kinase and phosphotransacetylase) and 45- to 100-fold (isocitrate lyase and malate synthase) lower, indicating that the synthesis of the four enzymes is regulated by acetate in the growth medium. A comparative Northern (RNA) analysis of the C. glutamicum isocitrate lyase and malate synthase genes (aceA and aceB) and transcriptional cat fusion experiments revealed that aceA and aceB are transcribed as 1.6- and 2.7-kb monocistronic messages, respectively, and that the regulation of isocitrate lyase and malate synthase synthesis is exerted at the level of transcription from the respective promoters. Surprisingly, C. glutamicum mutants defective in either acetate kinase or phosphotransacetylase showed low specific activities of the other three enzymes (phosphotransacetylase, isocitrate lyase, and malate synthase or acetate kinase, isocitrate lyase, and malate synthase, respectively) irrespective of the presence or absence of acetate in the medium. This result and a correlation of a high intracellular acetyl coenzyme A concentration with high specific activities of isocitrate lyase, malate synthase, acetate kinase, and phosphotransacetylase suggest that acetyl coenzyme A or a derivative thereof may be a physiological trigger for the genetic regulation of enzymes involved in acetate metabolism of C. glutamicum.

  4. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    OpenAIRE

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focuse...

  5. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...

  6. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

    Science.gov (United States)

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  7. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  8. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  9. [Antibacterial activity of Porphyra spp. epiphytic bacteria and polyketide synthase I gene screening].

    Science.gov (United States)

    Fang, Wenya; Yang, Rui; Zhu, Peng; Shan, Yuanyuan; Yan, Xiaojun

    2009-02-01

    Based on the antibacterial analysis, we screened Polyketide synthase (PKS I) gene from the epiphytic bacteria of Porphyra spp., in order to obtain the PKS I positive strains and detect the potential connection between the PKS pathway and the antibacterial mechanisms. A total of 31 bacteria with broad-spectrum antibacterial activity were screened by agar-screening methods. The 16S rDNA and the Ketosynthase gene were amplified from the genome DNA of these bacteria, which were cloned into pMD19-T vector for sequencing analysis. Porphyra spp. epiphytic bacteria showed broad-spectrum antibacterial activity. Three PKS I positive epiphytic bacteria were obtained from Wenzhou rotten Porphyra spp. samples which had high antibacterial activity. The BLAST results indicated that the Ketosynthase fragments of PKS I from the strains of WPhG3, WPySwl and WPySw2 shared highest similarity (98%, 99%, 98%) to the strains of Bacillus subtilis subsp. Subtilis str. 168 (NP_389602), Bacillus subtilis (ABR19776) and Aspergillus carbonarius (AAZ99721), respectively. Furthermore, the phylogenetic analysis based on 16S rDNA sequences indicated that they belonged to the genus of Bacillus. The flora of Porphyra spp. epiphytic bacteria was complex, which regulated the phycosphere in many ways. The PKS I pathway might be a performance of antibacterial function of Bacillus from Wenzhou rotten samples.

  10. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  11. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  12. Interkingdom gene transfer of a hybrid NPS/PKS from bacteria to filamentous Ascomycota.

    Directory of Open Access Journals (Sweden)

    Daniel P Lawrence

    Full Text Available Nonribosomal peptides (NRPs and polyketides (PKs are ecologically important secondary metabolites produced by bacteria and fungi using multidomain enzymes called nonribosomal peptide synthetases (NRPSs and polyketide synthases (PKSs, respectively. Previous phylogenetic analyses of fungal NRPSs and PKSs have suggested that a few of these genes were acquired by fungi via horizontal gene transfer (HGT from bacteria, including a hybrid NPS/PKS found in Cochliobolus heterostrophus (Dothideomycetes, Ascomycota. Here, we identify this hybrid gene in fungi representing two additional classes of Ascomycota (Aspergillus spp., Microsporum canis, Arthroderma spp., and Trichophyton spp., Eurotiomycetes; Chaetomium spp. and Metarhizium spp., Sordariomycetes and use phylogenetic analyses of the most highly conserved domains from NRPSs (adenylation (A domain and PKSs (ketoacyl synthase (KS domain to examine the hypothesis that the hybrid NPS7/PKS24 was acquired by fungi from bacteria via HGT relatively early in the evolution of the Pezizomycotina. Our results reveal a unique ancestry of the A domain and KS domain in the hybrid gene relative to known fungal NRPSs and PKSs, provide strong evidence for HGT of the hybrid gene from a putative bacterial donor in the Burkholderiales, and suggest the HGT event occurred early in the evolution of the filamentous Ascomycota.

  13. Diversifying selection on flavanone 3-hydroxylase and isoflavone synthase genes in cultivated soybean and its wild progenitors.

    Directory of Open Access Journals (Sweden)

    Hao Cheng

    Full Text Available Soybean isoflavone synthase (IFS and flavanone 3-hydroxylase (F3H are two key enzymes catalyzing the biosynthesis of isoflavonoids and flavonoids, both of which play diverse roles in stress responses. However, little is known about the evolutionary pattern of these genes in cultivated soybean and its wild progenitors. Herein, we investigated the nucleotide polymorphisms in Isoflavone synthase (IFS1, IFS2 and Flavanone 3-hydroxylase (F3H2 genes from 33 soybean accessions, including 17 cultivars (Glycine max and 16 their wild progenitors (Glycine soja. Our data showed that the target genes shared the levels of nucleotide polymorphism with three reference genes involved in plant-microbe interactions, but possessed a much higher nucleotide polymorphism than other reference genes. Moreover, no significant genetic differentiation was found between cultivated soybean and its wild relatives in three target genes, despite of considering bottleneck and founder effect during domestication. These results indicate that IFS and F3H genes could have experienced gene introgressions or diversifying selection events during domestication process. Especially, F3H2 gene appears to evolve under positive selection and enjoy a faster evolutionary rate than IFS1 and IFS2 genes.

  14. Frequent epigenetic silencing of the folate-metabolising gene cystathionine-beta-synthase in gastrointestinal cancer.

    Directory of Open Access Journals (Sweden)

    Hong Zhao

    Full Text Available Both gastric and colorectal cancers (CRC are the most frequently occurring malignancies worldwide with the overall survival of these patients remains unsatisfied. Identification of tumor suppressor genes (TSG silenced by promoter CpG methylation uncovers mechanisms of tumorigenesis and identifies new epigenetic biomarkers for early cancer detection and prognosis assessment. Cystathionine-beta-synthase (CBS functions in the folate metabolism pathway, which is intricately linked to methylation of genomic DNA. Dysregulation of DNA methylation contributes substantially to cancer development.To identify potential TSGs silenced by aberrant promoter methylation in CRC, we analyzed tumor and adjacent tissues from CRC cases using the Illumina Human Methylation45 BeadChip. We identified hypermethylation of the CBS gene in CRC samples, compared to adjacent tissues. Methylation and decreased mRNA expression of CBS were detected in most CRC cell lines by methylation-specific PCR and semiquantitative RT-PCR, as well as in gastric cancer. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin A reversed methylation and restored CBS mRNA expression indicating a direct effect. Aberrant methylation was further detected in 31% of primary CRCs (29 of 96 and 55% of gastric tumors (11 of 20. In contrast, methylation was seldom found in normal tissues adjacent to the tumor. CBS methylation was associated with KRAS mutations in primary CRCs (P = 0.04, by χ(2-test. However, no association was found between CBS methylation or KRAS mutations with cancer relapse/metastasis in Stage II CRC patients.A novel finding from this study is that the folate metabolism enzyme CBS mRNA levels are frequently downregulated through CpG methylation of the CBS gene in gastric cancer and CRC, suggesting that CBS functions as a tumor suppressor gene. These findings warrant further study of CBS as an epigenetic biomarker for molecular diagnosis of gastrointestinal cancers.

  15. [Cloning and prokaryotic expression of Rhodoblastus acidophilus 5-aminolevlinate synthase gene].

    Science.gov (United States)

    Zhang, De-yong; Cheng, Fei-xue; Cheng, Ju-e; Zhang, Zhan-hong; Liu, Yong

    2007-08-01

    5-aminolevulinic acid (ALA) is formed by the enzyme ALA synthase (ALAS). However, the fidelity of ALAS gene among species is low. The ALAS gene of photosynthetic bacteria Rhodoblastus acidophilus was cloned from its genomic DNA by conventional PCR and Veterette PCR and further sequenced. The identity of ALAS gene among photosynthetic bacteria species is from 64.0% to 95.1% according to phylogenic analysis. Furthermore, the ALAS gene was subcloned into an expression vector pQE30. For the overproduction of ALA, the recombinant ALAS was overexpressed in Escherichia coli strains JM109, M15 and BL21 (DE3), respectively. The expected 44kD protein was detected by SDS-PAGE in three E. coli strains after IPTG induction and further purified by affinity purification on Ni-NTA. The conditions including strain, medium, substrate of ALA synthesize (glycine and succinic acid), and ALA dehydratase inhibitor (levulinic acid) were optimized for attainning the maximum yield of ALA in E. coli. The ALA production was established on E. coli M15, medium 1 supplied with 100mmol/L glycine and 50mmol/L succinic acid, and 40mmol/L levulinic acid. The activity of ALAS was up to 333U/min x mg of protein. Meanwhile, the output of ALA was reached to 5.379g/L, which is the highest yield of ALA up to date by biofermentation. ALA has a variety of agricultural applications not only as an herbicide, insecticide, and growth promoting factor, but also based on its ability to confer salt and cold temperature tolerance in plants. Our recombinant bacteria are of great potential in the production of ALA. Our results offer an easy and simple ALA mass production method and may stimulate the application of ALA in agriculture.

  16. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  17. Benchmarking Quantum Mechanics/Molecular Mechanics (QM/MM) Methods on the Thymidylate Synthase-Catalyzed Hydride Transfer.

    Science.gov (United States)

    Świderek, Katarzyna; Arafet, Kemel; Kohen, Amnon; Moliner, Vicent

    2017-03-14

    Given the ubiquity of hydride-transfer reactions in enzyme-catalyzed processes, identifying the appropriate computational method for evaluating such biological reactions is crucial to perform theoretical studies of these processes. In this paper, the hydride-transfer step catalyzed by thymidylate synthase (TSase) is studied by examining hybrid quantum mechanics/molecular mechanics (QM/MM) potentials via multiple semiempirical methods and the M06-2X hybrid density functional. Calculations of protium and tritium transfer in these reactions across a range of temperatures allowed calculation of the temperature dependence of kinetic isotope effects (KIE). Dynamics and quantum-tunneling effects are revealed to have little effect on the reaction rate, but are significant in determining the KIEs and their temperature dependence. A good agreement with experiments is found, especially when computed for RM1/MM simulations. The small temperature dependence of quantum tunneling corrections and the quasiclassical contribution term cancel each other, while the recrossing transmission coefficient seems to be temperature-independent over the interval of 5-40 °C.

  18. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  19. Progress in gene transfer by germ cells in mammals.

    Science.gov (United States)

    Niu, Yidong; Liang, Shulong

    2008-12-01

    Use of germ cells as vectors for transgenesis in mammals has been well developed and offers exciting prospects for experimental and applied biology, agricultural and medical sciences. Such approach is referred to as either male germ cell mediated gene transfer (MGCMGT) or female germ cell mediated gene transfer (FGCMGT) technique. Sperm-mediated gene transfer (SMGT), including its alternative method, testis-mediated gene transfer (TMGT), becomes an established and reliable method for transgenesis. They have been extensively used for producing transgenic animals. The newly developed approach of FGCMGT, ovary-mediated gene transfer (OMGT) is also a novel and useful tool for efficient transgenesis. This review highlights an overview of the recent progress in germ cell mediated gene transfer techniques, methods developed and mechanisms of nucleic acid uptake by germ cells.

  20. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  1. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  2. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  3. Lentiviral Vector Gene Transfer to Porcine Airways

    Directory of Open Access Journals (Sweden)

    Patrick L Sinn

    2012-01-01

    Full Text Available In this study, we investigated lentiviral vector development and transduction efficiencies in well-differentiated primary cultures of pig airway epithelia (PAE and wild-type pigs in vivo. We noted gene transfer efficiencies similar to that observed for human airway epithelia (HAE. Interestingly, feline immunodeficiency virus (FIV-based vectors transduced immortalized pig cells as well as pig primary cells more efficiently than HIV-1–based vectors. PAE express TRIM5α, a well-characterized species-specific lentiviral restriction factor. We contrasted the restrictive properties of porcine TRIM5α against FIV- and HIV-based vectors using gain and loss of function approaches. We observed no effect on HIV-1 or FIV conferred transgene expression in response to porcine TRIM5α overexpression or knockdown. To evaluate the ability of GP64-FIV to transduce porcine airways in vivo, we delivered vector expressing mCherry to the tracheal lobe of the lung and the ethmoid sinus of 4-week-old pigs. One week later, epithelial cells expressing mCherry were readily detected. Our findings indicate that pseudotyped FIV vectors confer similar tropisms in porcine epithelia as observed in human HAE and provide further support for the selection of GP64 as an appropriate envelope pseudotype for future preclinical gene therapy studies in the porcine model of cystic fibrosis (CF.

  4. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  5. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  6. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Science.gov (United States)

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  7. Radiopharmaceuticals to monitor the expression of transferred genes in gene transfer therapy

    International Nuclear Information System (INIS)

    Wiebe, L. I.

    1997-01-01

    The development and application of radiopharmaceuticals has, in many instances, been based on the pharmacological properties of therapeutic agents. The molecular biology-biotechnology revolution has had an important impact on treatment of diseases, in part through the reduced toxicity of 'biologicals', in part because of their specificity for interaction at unique molecular sites and in part because of their selective delivery to the target site. Immunotherapeutic approaches include the use of monoclonal antibodies (MABs), MAB-fragments and chemotactic peptides. Such agents currently form the basis of both diagnostic and immunotherapeutic radiopharmaceuticals. More recently, gene transfer techniques have been advanced to the point that a new molecular approach, gene therapy, has become a reality. Gene therapy offers an opportunity to attack disease at its most fundamental level. The therapeutic mechanism is based on the expression of a specific gene or genes, the product of which will invoke immunological, receptor-based or enzyme-based therapeutic modalities. Several approaches to gene therapy of cancer have been envisioned, the most clinically-advanced concepts involving the introduction of genes that will encode for molecular targets nor normally found in healthy mammalian cells. A number of gene therapy clinical trials are based on the introduction of the Herpes simplex virus type-1 (HSV-1) gene that encodes for viral thymidine kinase (tk+). Once HSV-1 tk+ is expressed in the target (cancer) cell, therapy can be effected by the administration of a highly molecularly-targeted and systemically non-toxic antiviral drug such as ganciclovir. The development of radiodiagnostic imaging in gene therapy will be reviewed, using HSV-1 tk+ and radioiodinated IVFRU as a basis for development of the theme. Molecular targets that could be exploited in gene therapy, other than tk+, will be identified

  8. Radiopharmaceuticals to monitor the expression of transferred genes in gene transfer therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, L. I. [University of Alberta, Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-10-01

    The development and application of radiopharmaceuticals has, in many instances, been based on the pharmacological properties of therapeutic agents. The molecular biology-biotechnology revolution has had an important impact on treatment of diseases, in part through the reduced toxicity of `biologicals`, in part because of their specificity for interaction at unique molecular sites and in part because of their selective delivery to the target site. Immunotherapeutic approaches include the use of monoclonal antibodies (MABs), MAB-fragments and chemotactic peptides. Such agents currently form the basis of both diagnostic and immunotherapeutic radiopharmaceuticals. More recently, gene transfer techniques have been advanced to the point that a new molecular approach, gene therapy, has become a reality. Gene therapy offers an opportunity to attack disease at its most fundamental level. The therapeutic mechanism is based on the expression of a specific gene or genes, the product of which will invoke immunological, receptor-based or enzyme-based therapeutic modalities. Several approaches to gene therapy of cancer have been envisioned, the most clinically-advanced concepts involving the introduction of genes that will encode for molecular targets nor normally found in healthy mammalian cells. A number of gene therapy clinical trials are based on the introduction of the Herpes simplex virus type-1 (HSV-1) gene that encodes for viral thymidine kinase (tk+). Once HSV-1 tk+ is expressed in the target (cancer) cell, therapy can be effected by the administration of a highly molecularly-targeted and systemically non-toxic antiviral drug such as ganciclovir. The development of radiodiagnostic imaging in gene therapy will be reviewed, using HSV-1 tk+ and radioiodinated IVFRU as a basis for development of the theme. Molecular targets that could be exploited in gene therapy, other than tk+, will be identified

  9. Molecular characterization of a transient expression gene encoding for 1-aminocyclopropane-1-carboxylate synthase in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Wang, Xia; Zhang, Ying; Zhang, Jiedao; Cheng, Cheng; Guo, Xingqi

    2007-09-30

    Ethylene performs an important function in plant growth and development. 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), the key enzyme involved in ethylene biosynthesis, has been the focus of most ethylene studies. Here, a cotton ACS gene referred to as Gossypium hirsutum ACS1 (GhACS1), was isolated. The full-length cDNA of GhACS1 encodes for a 476-amino acid protein which harbors seven conserved regions, 11 invariant amino acid residues, and the PLP binding active site, all of which characterize ACC synthases. Alignment analysis showed that GhACS1 shared a high degree of identity with other known ACC synthases from different species. Two introns were detected in the genomic DNA sequence, and the results of Southern blot analysis suggested that there might be a multi-gene family encoding for ACC synthase in cotton. From the phylogenetic tree constructed with 24 different kinds of ACC synthases, we determined that GhACS1 falls into group II, and was closely associated with the wound-inducible ACS of citrus. The analysis of the 5' flanking region of GhACS1 revealed a group of putative cis-acting elements. The results of expression analysis showed that GhACS1 displayed its transient expression nature after wounding, abscisic acid (ABA), and CuCl(2) treatments. These results indicate that GhACS1, which was transiently expressed in response to certain stimuli, may be involved in the production of ethylene for the transmission of stress signals.

  10. Carotenoid content and expression of phytoene synthase and phytoene desaturase genes in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Park, Nam Il; Lee, Sook Young; Park, Sang Un

    2011-06-15

    Momordica charantia, a tropical plant, produces a fruit that has a β-carotene concentration five times higher than that of carrot. To elucidate the molecular basis of β-carotene accumulation in M. charantia, the gene expression levels of phytoene synthase (McPSY) and phytoene desaturase (McPDS) were determined. These levels were particularly high in the flowers of M. charantia. During fruit maturation, the expression levels of McPSY and McPDS decreased during the mid-stages but increased in the fully mature fruit. In addition, carotenoids accumulated as the peel changed from green to orange. Thus, McPSY and McPDS expression correlated with carotenoid accumulation during fruit maturation. Principal component analysis (PCA) also was used to evaluate the differences among the profiles of seven carotenoids identified in the fruit at several maturation stages. Riper fruits had higher carotenoid concentrations than less ripe fruits. Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  11. Metagenomic Survey of Potential Symbiotic Bacteria and Polyketide Synthase Genes in an Indonesian Marine Sponge

    Directory of Open Access Journals (Sweden)

    Nia M. Kurnia

    2017-01-01

    Full Text Available There has been emerging evidence that the bacteria associated with marine sponges are the key producers of many complex bioactive compounds. The as-yet uncultured candidate bacterial genus “Candidatus Entotheonella” of the marine sponge Theonella swinhoei from Japan have recently been recognized as the source of numerous pharmacologically relevant polyketides and modified peptides, as previously reported by the Piel group (Wilson et al. 2014. This work reported the presence of “Candidatus Entotheonella sp.” in the highly complex microbiome of an Indonesian marine sponge from Kapoposang Island, South Sulawesi. We further identified the Kapoposang sponge specimen used in this work as Rhabdastrella sp. based on the integrated morphological, histological, and cytochrome oxidase subunit I (COI gene analyses. To detect the polyketide biosynthetic machinery called type I polyketide synthase (PKS in this Indonesian Rhabdastrella sp., we amplified and cloned the ketosynthase-encoding DNA regions of approximately 700 bp from the uncultured sponge's microbiome. Further sequencing and analysis of several randomly chosen clones indicated that all of them are mostly likely involved in the biosynthesis of methyl-branched fatty acids. However, employing a PKS-targeting primer designed in this work led to the isolation of four positive clones. BlastX search and subsequent phylogenetic analysis showed that one of the positive clones, designed as RGK32, displayed high homology with ketosynthase domains of many type I PKS systems and may belong to the subclass cis-AT PKS group.

  12. Expression of monoamine transporters, nitric oxide synthase 3 and neurotrophin genes in antidepressant-stimulated astrocytes

    Directory of Open Access Journals (Sweden)

    Sarah eKittel-Schneider

    2012-04-01

    Full Text Available Background: There is increasing evidence that glial cells play a role in the pathomechanisms of mood disorders and the mode of action of antidepressant drugs. Methods: To examine whether there is a direct effect on the expression of different genes encoding proteins that have been implicated in the pathophysiology of affective disorders, primary astrocyte cell cultures from rats were treated with two different antidepressant drugs, imipramine and escitalopram, and the mRNA expression of brain derived neurotrophic factor (Bdnf, serotonin transporter (5Htt, dopamine transporter (Dat and endothelial nitric oxide synthase (Nos3 was examined. Results: Stimulation of astroglial cell culture with imipramine, a tricyclic antidepressant, lead to a significant increase of the Bdnf mRNA level whereas treatment with escitalopram did not. In contrast, 5Htt was not differentially expressed after antidepressant treatment. Finally, neither Dat nor Nos3 mRNA expression was detected in cultured astrocytes. Conclusions: These data provide further evidence for a role of astroglial cells in the molecular mechanisms of action of antidepressants.

  13. Identification and characterization of a novel trehalose synthase gene derived from saline-alkali soil metagenomes.

    Directory of Open Access Journals (Sweden)

    Ling Jiang

    Full Text Available A novel trehalose synthase (TreS gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn(2+ and Hg(2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficiency (Kcat/K m for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%, making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis.

  14. Patterns of prokaryotic lateral gene transfers affecting parasitic microbial eukaryotes

    DEFF Research Database (Denmark)

    Alsmark, Cecilia; Foster, Peter G; Sicheritz-Pontén, Thomas

    2013-01-01

    BACKGROUND: The influence of lateral gene transfer on gene origins and biology in eukaryotes is poorly understood compared with those of prokaryotes. A number of independent investigations focusing on specific genes, individual genomes, or specific functional categories from various eukaryotes have...... indicated that lateral gene transfer does indeed affect eukaryotic genomes. However, the lack of common methodology and criteria in these studies makes it difficult to assess the general importance and influence of lateral gene transfer on eukaryotic genome evolution. RESULTS: We used a phylogenomic...... are conserved among lineages, the genes making up those pathways can have very different origins in different eukaryotes. Thus, from the perspective of the effects of lateral gene transfer on individual gene ancestries in different lineages, eukaryotic metabolism appears to be chimeric....

  15. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

    Science.gov (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

    2001-09-01

    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  16. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2016-02-01

    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  17. Mitochondrial ATP synthase deficiency due to a mutation in the ATP5E gene for the F1 e subunit

    Czech Academy of Sciences Publication Activity Database

    Mayr, J. A.; Havlíčková, Vendula; Zimmermann, F.; Magler, I.; Kaplanová, Vilma; Ješina, Pavel; Pecinová, Alena; Nůsková, Hana; Koch, J.; Sperl, W.; Houštěk, Josef

    2010-01-01

    Roč. 19, č. 17 (2010), s. 3430-3439 ISSN 0964-6906 R&D Projects: GA MZd(CZ) NS9759; GA MŠk(CZ) 1M0520 Grant - others:Univerzita Karlova(CZ) 97807 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP-synthase * ATP5E * disease Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 8.058, year: 2010

  18. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  19. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  20. Identification and characterization of genetic variation in the folylpolyglutamate synthase gene.

    Science.gov (United States)

    Leil, Tarek A; Endo, Chiaki; Adjei, Araba A; Dy, Grace K; Salavaggione, Oreste E; Reid, Joel R; Ames, Matthew M; Adjei, Alex A

    2007-09-15

    Folylpolyglutamate synthase (FPGS) catalyzes the polyglutamation of folic acid, methotrexate, and pemetrexed to produce highly active metabolites. To characterize genetic variation in the FPGS gene, FPGS, have resequenced the gene in four different ethnic populations. Thirty-four single nucleotide polymorphisms were identified including five nonsynonymous coding single nucleotide polymorphisms that altered the FPGS protein sequence: F13L and V22I polymorphisms in the mitochondrial isoform of FPGS, and R466/424C, A489/447V, and S499/457F polymorphisms, which exist in both the mitochondrial and cytosolic isoforms. When expressed in AuxB1 cells, the A447V cytosolic variant was functionally similar to the wild-type cytosolic (WT Cyt) allozyme, whereas the R424C and S457F cytosolic variants were reduced by approximately 2-fold in protein expression compared with WT Cyt (P glutamate was reduced by 12.3-fold (R424C, P < 0.01) and 6.2-fold (S457F, P < 0.01), whereas the intrinsic clearance of methotrexate was reduced by 4.2-fold (R424C, P < 0.05) and 5.4-fold (S457F, P < 0.05) in these two cytosolic variants when compared with the WT Cyt isoform. Additionally, the in vitro enzyme velocity at saturating pemetrexed concentrations was reduced by 1.6-fold (R424C, P < 0.05) and 2.6-fold (S457F, P < 0.01) compared with WT Cyt. AuxB1 cells harboring these same cytosolic variant allozymes displayed significant increases in the EC(50) for folic acid and in the IC(50) values for both methotrexate and pemetrexed relative to the WT Cyt form of FPGS. These observations suggest that genetic variations in FPGS may alter the efficacy of antifolate therapy in cancer patients.

  1. Endothelial Nitric Oxide Synthase Gene Variation Associated With Chronic Kidney Disease After Liver Transplant

    Science.gov (United States)

    Bambha, Kiran; Kim, W. Ray; Rosen, Charles B.; Pedersen, Rachel A.; Rys, Cynthia; Kolbert, Christopher P.; Cunningham, Julie M.; Therneau, Terry M.

    2010-01-01

    OBJECTIVE: To identify single nucleotide polymorphisms (SNPs) associated with risk of developing chronic kidney disease (CKD), a prevalent comorbidity, after liver transplant (LT). PATIENTS AND METHODS: This study consists of a cohort of adult (≥18 years) primary-LT recipients who had normal renal function before LT and who survived 1 year or more after LT at a high-volume US LT program between January 1, 1990, and December 31, 2000. Patients with adequate renal function (estimated glomerular filtration rate, ≥40 mL/min per 1.73 m2 during follow-up; n=308) and patients with incident CKD (estimated glomerular filtration rate, <40 mL/min per 1.73 m2 after LT; n=92) were identified. To investigate the association of 6 candidate genes with post-LT CKD, we selected SNPs that have been associated with renal function in the literature. Hazard ratios were estimated using Cox regression, adjusted for potential confounding variables. RESULTS: The variant allele (298Asp) of the Glu298Asp SNP in the endothelial nitric oxide synthase gene (NOS3) was significantly associated with CKD after LT (P=.05; adjusted for multiple comparisons). The 5-year incidence of CKD was 70% among patients homozygous for the NOS3 variant allele (298Asp) compared with 42% among those not homozygous for the NOS3 variant allele. Specifically, homozygosity for the NOS3 variant allele conferred a 2.5-fold increased risk of developing CKD after LT (P=.005, adjusted for confounding variables). CONCLUSION: Homozygosity for the variant allele of NOS3 (298Asp) is associated with CKD after LT and may be useful for identifying recipients at higher risk of post-LT CKD. PMID:20810793

  2. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  3. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  4. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  5. Widespread of horizontal gene transfer in the human genome.

    Science.gov (United States)

    Huang, Wenze; Tsai, Lillian; Li, Yulong; Hua, Nan; Sun, Chen; Wei, Chaochun

    2017-04-04

    A fundamental concept in biology is that heritable material is passed from parents to offspring, a process called vertical gene transfer. An alternative mechanism of gene acquisition is through horizontal gene transfer (HGT), which involves movement of genetic materials between different species. Horizontal gene transfer has been found prevalent in prokaryotes but very rare in eukaryote. In this paper, we investigate horizontal gene transfer in the human genome. From the pair-wise alignments between human genome and 53 vertebrate genomes, 1,467 human genome regions (2.6 M bases) from all chromosomes were found to be more conserved with non-mammals than with most mammals. These human genome regions involve 642 known genes, which are enriched with ion binding. Compared to known horizontal gene transfer regions in the human genome, there were few overlapping regions, which indicated horizontal gene transfer is more common than we expected in the human genome. Horizontal gene transfer impacts hundreds of human genes and this study provided insight into potential mechanisms of HGT in the human genome.

  6. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

    Science.gov (United States)

    Oberding, Lisa K; Gieg, Lisa M

    2018-01-01

    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  7. Ethical perception of cross-species gene transfer in plant

    African Journals Online (AJOL)

    Jane

    2011-09-30

    Sep 30, 2011 ... the ethical acceptance of cross-species gene transfers in developing country. Key words: Ethical perception, genetically modified (GM) rice, cross-species gene transfer, Malaysia. INTRODUCTION. Rice is a staple food in much of Asia countries including. Malaysia, and by 2025 about 60% more rice must ...

  8. Gene transfer technology and genetic radioisotope targeting therapy

    International Nuclear Information System (INIS)

    Wang Jiaqiong; Wang Zizheng

    2004-01-01

    With deeper cognition about mechanisms of disease at the cellular and molecular level, gene therapy has become one of the most important research fields in medical molecular biology at present. Gene transfer technology plays an important role during the course of gene therapy, and further improvement should be made about vectors carrying target gene sequences. Also, gene survey is needed during gene therapy, and gene imaging is the most effective method. The combination of gene therapy and targeted radiotherapy, that is, 'Genetic Radioisotope Targeting Therapy', will be a novel approach to tumor gene therapy

  9. Restricting the conformational freedom of the neuronal nitric-oxide synthase flavoprotein domain reveals impact on electron transfer and catalysis.

    Science.gov (United States)

    Dai, Yue; Haque, Mohammad Mahfuzul; Stuehr, Dennis J

    2017-04-21

    The signaling molecule nitric oxide (NO) is synthesized in animals by structurally related NO synthases (NOSs), which contain NADPH/FAD- and FMN-binding domains. During catalysis, NADPH-derived electrons transfer into FAD and then distribute into the FMN domain for further transfer to internal or external heme groups. Conformational freedom of the FMN domain is thought to be essential for the electron transfer (ET) reactions in NOSs. To directly examine this concept, we utilized a "Cys-lite" neuronal NOS flavoprotein domain and substituted Cys for two residues (Glu-816 and Arg-1229) forming a salt bridge between the NADPH/FAD and FMN domains in the conformationally closed structure to allow cross-domain disulfide bond formation or cross-linking by bismaleimides of various lengths. The disulfide bond cross-link caused a ≥95% loss of cytochrome c reductase activity that was reversible with DTT treatment, whereas graded cross-link lengthening gradually increased activity, thus defining the conformational constraints in the catalytic process. We used spectroscopic and stopped-flow techniques to further investigate how the changes in FMN domain conformational freedom impact the following: (i) the NADPH interaction; (ii) kinetics of electron loading (flavin reduction); (iii) stabilization of open versus closed conformational forms in two different flavin redox states; (iv) reactivity of the reduced FMN domain toward cytochrome c ; (v) response to calmodulin binding; and (vi) the rates of interflavin ET and the FMN domain conformational dynamics. Together, our findings help explain how the spatial and temporal behaviors of the FMN domain impact catalysis by the NOS flavoprotein domain and how these behaviors are governed to enable electron flow through the enzyme. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Linalool and linalool nerolidol synthases in roses, several genes for little scent.

    Science.gov (United States)

    Magnard, Jean-Louis; Bony, Aurélie Rius; Bettini, Fabienne; Campanaro, Ausilia; Blerot, Bernard; Baudino, Sylvie; Jullien, Frédéric

    2018-03-11

    Roses are widely appreciated for the appearance of their flowers and for their fragrance. This latter character results from the combination of different odorant molecules among which monoterpenes are often prevalent constituents. In this study, we report the cloning and characterization of three rose monoterpene synthases. In vitro functional characterization of these enzymes showed that one is a (-)-(3R)-linalool synthase whereas the others have a dual (+)-(3S)-linalool nerolidol synthase activity. However, given that the characterized rose cultivars were only able to produce the (-)-(3R)-linalool stereoisomer, the linalool nerolidol synthases are probably not active in planta. Furthermore, these three enzymes were also characterized by a weak expression level as assessed by RT-qPCR and by the low abundance of the corresponding sequences in an EST library. This characteristic is likely to explain why linalool is generally a minor constituent in rose flowers' scents. On this basis, we propose that in roses the monoterpene biosynthesis effort is focused on the production of acyclic monoterpenes derived from geraniol through the recently characterized Nudix biosynthesis pathway, at the expense of conventional monoterpene biosynthesis via terpene synthases such as linalool or linalool nerolidol synthases. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  11. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  12. Detecting Horizontal Gene Transfer between Closely Related Taxa.

    OpenAIRE

    Orit Adato; Noga Ninyo; Uri Gophna; Sagi Snir

    2015-01-01

    Horizontal gene transfer (HGT), the transfer of genetic material between organisms, is crucial for genetic innovation and the evolution of genome architecture. Existing HGT detection algorithms rely on a strong phylogenetic signal distinguishing the transferred sequence from ancestral (vertically derived) genes in its recipient genome. Detecting HGT between closely related species or strains is challenging, as the phylogenetic signal is usually weak and the nucleotide composition is normally ...

  13. Problems associated with gene transfer and opportunities for microgravity environments

    Science.gov (United States)

    Tennessen, Daniel J.

    1997-01-01

    The method of crop improvement by gene transfer is becoming increasingly routine with transgenic foods and ornamental crops now being marketed to consumers. However, biological processes of plants, and the physical barriers of current protocols continue to limit the application of gene transfer in many commercial crops. The goal of this paper is to outline the current limitations of gene transfer and to hypothesize possible opportunities for use of microgravity to overcome such limitations. The limitations detailed in this paper include host-range specificity of Agrobacterium mediated transformation, probability of gene insertion, position effects of the inserted genes, gene copy number, stability of foreign gene expression in host plants, and regeneration of recalcitrant plant species. Microgravity offers an opportunity for gene transfer where cell growth kinetics, DNA synthesis, and genetic recombination rates can be altered. Such biological conditions may enhance the ability for recombination of reporter genes and other genes of interest to agriculture. Proposed studies would be useful for understanding instability of foreign gene expression and may lead to stable transformed plants. Other aspects of gene transfer in microgravity are discussed.

  14. Application of an optimized electroporation procedure for replacement of the polyhydroxyalkanoate synthase I gene in Nocardia corallina.

    Science.gov (United States)

    Valentin, H E; Dennis, D

    1996-07-01

    To develop a system for gene replacement in Nocardia corallina, a protocol for electroporation was optimized by systematic alterations of growth conditions, field strength, time constant and the electroporation buffer. Transformation efficiencies of 0.5 x 10(6) - 3 x 10(6) transformants/microgram plasmid DNA were obtained routinely. The gene encoding the polyhydroxyalkanoate (PHA) synthase I of N. corallina was cloned and interrupted by insertion of a kanamycin-resistance gene. The resulting plasmid was introduced into N. corallina by electroporation to inactivate the wild-type gene by homologous recombination. Kanamycin-resistant clones were screened by Southern hybridization for the absence of the wild-type gene and analyzed for PHA accumulation.

  15. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  17. Pollen irradiation and possible gene transfer in Nicotiana species

    DEFF Research Database (Denmark)

    Engvild, Kjeld Christensen

    1985-01-01

    Progeny from crosses of Nicotiana langsdorffii with gamma irradiated pollen of Nicotiana alata ‘Crimson Bedder’ showed skewed segregation in the F2 favoring the maternal parent. This is probably not gene transfer in a strict sense, rather just an extreme case of reduced transmission of irradiated...... chromosomes, leading to massive overrepresentation of maternal genes. Gene transfer or mutational loss may explain some anomalous F1 plants. Segregation in the F2 progeny showed the presence of several genes from the irradiated pollen. Crosses of Nicotiana sylvestris, N. plumbaginifolia N. paniculata......, and Petunia parodii with irradiated pollen from N. alata and Petunia hybrida showed no evidence of gene transfer, nor did experiments with irradiated mentor pollen. This indicates that gene transfer with irradiated pollen between non-crossing species or between species giving sterile hybrids is probably...

  18. How complex an intron may be? The example of the first intron of the CTP synthase gene of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Roberto Piergentili

    2013-02-01

    Full Text Available In eukaryotes, maturation of primary transcripts into mature messenger RNAs involves the elimination of parts of the gene called ‘introns’. The biological significance of introns is not yet completely understood. It has been demonstrated that introns may contain other genes, or regulatory sequences that may be involved in transcriptional control, or also being involved in alternative splicing mechanisms. However, these functions explain the role of only a small number of them, and it is very difficult to formulate any generalization. The CTP synthase gene of Drosophila melanogaster is characterized by the presence of a long first intron (approximately 7.2 kilobases whose role is currently unknown. In the present report we analyzed in silico the content of this intron, and found that it contains at least three interesting sub-sequences. Two of them are homologous to the CTP synthase itself and to a putative nucleotide pyrophosphatase, respectively. The third is a short stretch of DNA able to fold into a thermodynamically stable hairpin and showing homology with other 19 sequences from 21 genes inside the D. melanogaster genome. These findings suggest a complex yet very accurate way of controlling gene expression inside the fruit fly.

  19. A functional isopenicillin N synthase in an animal genome

    NARCIS (Netherlands)

    Roelofs, D.; Timmermans, M.J.T.N.; Hensbergen, P.J.; van Leeuwen, H.; Koopman, J.; Faddeeva-Vakhrusheva, A.; Suring, W.J.; de Boer, T.E.; Mariën, A.G.H.; Boer, R.; Bovenberg, R.; van Straalen, N.M.

    Horizontal transfer of genes is widespread among prokaryotes, but is less common between microorganisms and animals. Here, we present evidence for the presence of a gene encoding functional isopenicillin N synthase, an enzyme in the β-lactam antibiotics biosynthesis pathway, in the genome of the

  20. Functional isopenicillin N synthase in an animal genome

    NARCIS (Netherlands)

    Roelofs, D.; Timmermans, M.J.T.N.; Hensbergen, P.; van Leeuwen, H.; Koopman, J.; Faddeeva, A.; Suring, W.; de Boer, T.E.; Mariën, J.; Boer, R.; Bovenberg, R.; van Straalen, N.M.

    2013-01-01

    Horizontal transfer of genes is widespread among prokaryotes, but is less common between microorganisms and animals. Here, we present evidence for the presence of a gene encoding functional isopenicillin N synthase, an enzyme in the β-lactam antibiotics biosynthesis pathway, in the genome of the

  1. Catalytic mechanism of Sep-tRNA:Cys-tRNA synthase: sulfur transfer is mediated by disulfide and persulfide.

    Science.gov (United States)

    Liu, Yuchen; Dos Santos, Patricia C; Zhu, Xiang; Orlando, Ron; Dean, Dennis R; Söll, Dieter; Yuan, Jing

    2012-02-17

    Sep-tRNA:Cys-tRNA synthase (SepCysS) catalyzes the sulfhydrylation of tRNA-bound O-phosphoserine (Sep) to form cysteinyl-tRNA(Cys) (Cys-tRNA(Cys)) in methanogens that lack the canonical cysteinyl-tRNA synthetase (CysRS). A crystal structure of the Archaeoglobus fulgidus SepCysS apoenzyme provides information on the binding of the pyridoxal phosphate cofactor as well as on amino acid residues that may be involved in substrate binding. However, the mechanism of sulfur transfer to form cysteine was not known. Using an in vivo Escherichia coli complementation assay, we showed that all three highly conserved Cys residues in SepCysS (Cys(64), Cys(67), and Cys(272) in the Methanocaldococcus jannaschii enzyme) are essential for the sulfhydrylation reaction in vivo. Biochemical and mass spectrometric analysis demonstrated that Cys(64) and Cys(67) form a disulfide linkage and carry a sulfane sulfur in a portion of the enzyme. These results suggest that a persulfide group (containing a sulfane sulfur) is the proximal sulfur donor for cysteine biosynthesis. The presence of Cys(272) increased the amount of sulfane sulfur in SepCysS by 3-fold, suggesting that this Cys residue facilitates the generation of the persulfide group. Based upon these findings, we propose for SepCysS a sulfur relay mechanism that recruits both disulfide and persulfide intermediates.

  2. Transferability of microsatellite markers located in candidate genes for wood properties between Eucalyptus species

    Directory of Open Access Journals (Sweden)

    Cintia V. Acuña

    2014-12-01

    Full Text Available Aim of study:  To analyze the feasibility of extrapolating conclusions on wood quality genetic control between different Eucalyptus species, particularly from species with better genomic information, to those less characterized. For this purpose, the first step is to analyze the conservation and cross-transferability of microsatellites markers (SSRs located in candidate genes.Area of study: Eucalyptus species implanted in Argentina coming from different Australian origins.Materials and methods: Twelve validated and polymorphic SSRs in candidate genes (SSR-CGs for wood quality in E. globulus were selected for cross species amplification in six species: E. grandis, E. saligna, E. dunnii, E. viminalis, E. camaldulensis and E. tereticornis.Main results: High cross-species transferability (92% to 100% was found for the 12 polymorphic SSRs detected in E. globulus. These markers revealed allelic diversity in nine important candidate genes: cinnamoyl CoA reductase (CCR, cellulose synthase 3 (CesA3, the transcription factor LIM1, homocysteine S-methyltransferase (HMT, shikimate kinase (SK, xyloglucan endotransglycosylase 2 (XTH2, glutathione S-transferase (GST, glutamate decarboxylase (GAD and peroxidase (PER.Research highlights: The markers described are potentially suitable for comparative QTL mapping, molecular marker assisted breeding (MAB and for population genetic studies across different species within the subgenus Symphyomyrtus.Keywords: validation; cross-transferability; SSR; functional markers; eucalypts; Symphyomyrtus.

  3. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    Science.gov (United States)

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  4. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    Science.gov (United States)

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites.

  5. LATERAL GENE TRANSFER AND THE HISTORY OF BACTERIAL GENOMES

    Energy Technology Data Exchange (ETDEWEB)

    Howard Ochman

    2006-02-22

    The aims of this research were to elucidate the role and extent of lateral transfer in the differentiation of bacterial strains and species, and to assess the impact of gene transfer on the evolution of bacterial genomes. The ultimate goal of the project is to examine the dynamics of a core set of protein-coding genes (i.e., those that are distributed universally among Bacteria) by developing conserved primers that would allow their amplification and sequencing in any bacterial taxa. In addition, we adopted a bioinformatic approach to elucidate the extent of lateral gene transfer in sequenced genome.

  6. Trends and barriers to lateral gene transfer in prokaryotes.

    Science.gov (United States)

    Popa, Ovidiu; Dagan, Tal

    2011-10-01

    Gene acquisition by lateral gene transfer (LGT) is an important mechanism for natural variation among prokaryotes. Laboratory experiments show that protein-coding genes can be laterally transferred extremely fast among microbial cells, inherited to most of their descendants, and adapt to a new regulatory regime within a short time. Recent advance in the phylogenetic analysis of microbial genomes using networks approach reveals a substantial impact of LGT during microbial genome evolution. Phylogenomic networks of LGT among prokaryotes reconstructed from completely sequenced genomes uncover barriers to LGT in multiple levels. Here we discuss the kinds of barriers to gene acquisition in nature including physical barriers for gene transfer between cells, genomic barriers for the integration of acquired DNA, and functional barriers for the acquisition of new genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Production of dammarane-type sapogenins in rice by expressing the dammarenediol-II synthase gene from Panax ginseng C.A. Mey.

    Science.gov (United States)

    Huang, Zhiwei; Lin, Juncheng; Cheng, Zuxin; Xu, Ming; Huang, Xinying; Yang, Zhijian; Zheng, Jingui

    2015-10-01

    Ginsenosides are the main active ingredients in Chinese medicinal ginseng; 2,3-oxidosqualene is a precursor metabolite to ginsenosides that is present in rice. Because rice lacks a key rate-limiting enzyme (dammarenediol-II synthase, DS), rice cannot synthesize dammarane-type ginsenosides. In this study, the ginseng (Panax ginseng CA Mey.) DS gene (GenBank: AB265170.1) was transformed into rice using agrobacterium, and 64 rice transgenic plants were produced. The Transfer-DNA (T-DNA) insertion sites in homozygous lines of the T2 generation were determined by using high-efficiency thermal asymmetric interlaced PCR (hiTAIL-PCR) and differed in all tested lines. One to two copies of the T-DNA were present in each transformant, and real-time PCR and Western blotting showed that the transformed DS gene could be transcribed and highly expressed. High performance liquid chromatography (HPLC) analysis showed that the dammarane-type sapogenin 20(S)-protopanaxadiol (PPD) content was 0.35-0.59 mg/g dw and the dammarane-type sapogenin 20(S)-protopanaxatriol (PPT) content was 0.23-0.43 mg/g dw in the transgenic rice. LC/MS analysis confirmed production of PPD and PPT. These results indicate that a new "ginseng rice" germplasm containing dammarane-type sapogenins has been successfully developed by transforming the ginseng DS gene into rice. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.

    2005-01-01

    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  9. of endothelial nitric oxide synthase gene and serum level of vascular ...

    African Journals Online (AJOL)

    uwerhiavwe

    Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

  10. A single arabidopsis gene encodes two differentially targeted geranylgeranyl diphosphate synthase isoforms

    NARCIS (Netherlands)

    Águila Ruiz-Sola, M.; Barja, M.V.; Manzano, David; Llorente, Briardo; Schipper, Bert; Beekwilder, Jules; Rodriguez-Concepcion, Manuel

    2016-01-01

    A wide diversity of isoprenoids is produced in different plant compartments. Most groups of isoprenoids synthesized in plastids, and some produced elsewhere in the plant cell derive from geranylgeranyl diphosphate (GGPP) synthesized by GGPP synthase (GGPPS) enzymes. In Arabidopsis (Arabidopsis

  11. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hansen, K.; Szabo, Peter

    2003-01-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3....

  12. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.

    2004-01-01

    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  13. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    Science.gov (United States)

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. AtCSLD3, a cellulose synthase-like gene important for root hair growth in arabidopsis.

    Science.gov (United States)

    Wang, X; Cnops, G; Vanderhaeghen, R; De Block, S; Van Montagu, M; Van Lijsebettens, M

    2001-06-01

    A member of the cellulose synthase-like (subfamily D) gene family of Arabidopsis, AtCSLD3, has been identified by T-DNA tagging. The analysis of the corresponding mutant, csld3-1, showed that the AtCSLD3 gene plays a role in root hair growth in plants. Root hairs grow in phases: First a bulge is formed and then the root hair elongates by polarized growth, the so-called "tip growth." In the mutant, root hairs were initiated at the correct position and grew into a bulge, but their elongation was severely reduced. The tips of the csld3-1 root hairs easily leaked cytoplasm, indicating that the tensile strength of the cell wall had changed at the site of the tip. Based on the mutant phenotype and the functional conservation between CSLD3 and the genuine cellulose synthase proteins, we hypothesized that the CSLD3 protein is essential for the synthesis of polymers for the fast-growing primary cell wall at the root hair tip. The distinct mutant phenotype and the ubiquitous expression pattern indicate that the CSLD3 gene product is only limiting at the zone of the root hair tip, suggesting particular physical properties of the cell wall at this specific site of the root hair cell.

  15. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  16. Mammary-Specific Gene Transfer for Modeling Breast Cancer

    National Research Council Canada - National Science Library

    Li, Yi

    2001-01-01

    In order to develop a mouse model system that allows for rapid assessment of genetic lesions involved in breast tumor development, we are adapting a somatic gene transfer system based on avian leukosis virus A (ALV...

  17. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  18. Prognostic significance of numeric aberrations of genes for thymidylate synthase, thymidine phosphorylase and dihydrofolate reductase in colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Søren Astrup; Vainer, B.; Witton, C.J.

    2008-01-01

    ) in colorectal cancer, and to evaluate its prognostic significance following adjuvant chemotherapy, since these enzymes are closely related to efficacy of 5-fluorouracil (5FU). PATIENTS AND METHODS: Consecutive patients (n = 314), who were completely resected for colorectal cancer stages II-IV and adjuvantly......BACKGROUND: Most human cancer cells have structural aberrations of chromosomal regions leading to loss or gain of gene specific alleles. This study aimed to assess the range of gene copies per nucleus of thymidylate synthase (TYMS), thymidine phosphorylase (TP) and dihydrofolate reductase (DHFR...... the median were compared. Also TYMS expression, assessed by immunohistochemistry, was associated with TYMS copies per nucleus. RESULTS: The number of gene copies per nucleus were 1.7 (0.7-2.8), 1.8 (0.9-3.1) and 1.8 (1.1-2.7) median (range) for TYMS, TP and DHFR, respectively. TYMS expression was directly...

  19. Evolution of glutamate dehydrogenase genes: evidence for lateral gene transfer within and between prokaryotes and eukaryotes

    Directory of Open Access Journals (Sweden)

    Roger Andrew J

    2003-06-01

    Full Text Available Abstract Background Lateral gene transfer can introduce genes with novel functions into genomes or replace genes with functionally similar orthologs or paralogs. Here we present a study of the occurrence of the latter gene replacement phenomenon in the four gene families encoding different classes of glutamate dehydrogenase (GDH, to evaluate and compare the patterns and rates of lateral gene transfer (LGT in prokaryotes and eukaryotes. Results We extend the taxon sampling of gdh genes with nine new eukaryotic sequences and examine the phylogenetic distribution pattern of the various GDH classes in combination with maximum likelihood phylogenetic analyses. The distribution pattern analyses indicate that LGT has played a significant role in the evolution of the four gdh gene families. Indeed, a number of gene transfer events are identified by phylogenetic analyses, including numerous prokaryotic intra-domain transfers, some prokaryotic inter-domain transfers and several inter-domain transfers between prokaryotes and microbial eukaryotes (protists. Conclusion LGT has apparently affected eukaryotes and prokaryotes to a similar extent within the gdh gene families. In the absence of indications that the evolution of the gdh gene families is radically different from other families, these results suggest that gene transfer might be an important evolutionary mechanism in microbial eukaryote genome evolution.

  20. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  1. An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

    Science.gov (United States)

    Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

  2. Cloning and characterization of cellulose synthase-like gene, PtrCSLD2 from developing xylem of aspen trees.

    Science.gov (United States)

    Samuga, Anita; Joshi, Chandrashekhar P.

    2004-04-01

    Genetic improvement of cell wall polymer synthesis in forest trees is one of the major goals of forest biotechnology that could possibly impact their end product utilization. Identification of genes involved in cell wall polymer biogenesis is essential for achieving this goal. Among various candidate cell wall-related genes, cellulose synthase-like D (CSLD) genes are intriguing due to their hitherto unknown functions in cell wall polymer synthesis but strong structural similarity with cellulose synthases (CesAs) involved in cellulose deposition. Little is known about CSLD genes from trees. In the present article PtrCSLD2, a first CSLD gene from an economically important tree, aspen (Populus tremuloides) is reported. PtrCSLD2 cDNA was isolated from an aspen xylem cDNA library and encodes a protein that shares 90% similarity with Arabidopsis AtCSLD3 protein involved in root hair tip growth. It is possible that xylem fibers that also grow by intrusive tip growth may need expression of PtrCSLD2 for controlling the length of xylem fibers, a wood quality trait of great economical importance. PtrCSLD2 protein has a N-terminal cysteine-rich putative zinc-binding domain; eight transmembrane domains; alternating conserved and hypervariable domains; and a processive glycosyltransferases signature, D, D, D, QXXRW; all similar to aspen CesA proteins. However, PtrCSLD2 shares only 43-48% overall identity with the known aspen CesAs suggesting its distinct functional role in cell wall polymer synthesis perhaps other than cellulose biosynthesis. Based on Southern analysis, the aspen CSLD gene family consists of at least three genes and this gene copy estimate is supported by phylogenetic analysis of available CSLDs from plants. Moreover, gene expression studies using RT-PCR and in situ mRNA hybridization showed that PtrCSLD2 is expressed at a low level in all aspen tissues examined with a slightly higher expression level in secondary cell wall-enriched aspen xylem as compared to

  3. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  4. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  5. Horizontal gene transfer and bacterial diversity

    Indian Academy of Sciences (India)

    Unknown

    reservoir; under Antarctic ice or in near-boiling water; in acid springs or in alkaline pools – microbial life exists .... The close similarity of the rrnE region of Salmo- nella subspecies I to that of E. coli suggests lateral ..... transfer and the nature of bacterial innovation; Nature (Lon- don) 405 299–304. Pan A, Dutta C and Das J ...

  6. Evolution of floral scent in Clarkia: novel patterns of S-linalool synthase gene expression in the C. breweri flower.

    Science.gov (United States)

    Dudareva, N; Cseke, L; Blanc, V M; Pichersky, E

    1996-01-01

    Flowers of Clarkia breweri, an annual plant from the coastal range of California, emit a strong sweet scent of which S-linalool, an acyclic monoterpene, is a major component. Chromosomal, chemical, and morphological data, and the species' geographic distribution, suggest that C. breweri evolved from an extant nonscented species, C. concinna. A cDNA of Lis, the gene encoding S-linalool synthase, was isolated from C. breweri. We show that in C. breweri, Lis is highly expressed in cells of the transmitting tract of the stigma and style and in the epidermal cells of petals, as well as in stamens, whereas in the nonscented C. concinna, Lis is expressed only in the stigma and at a relatively low level. In both species, changes in protein levels parallel changes in mRNA levels, and changes in enzyme activity levels parallel changes in protein levels. The results indicate that in C. breweri, the expression of Lis has been upregulated and its range enlarged to include cells not expressing this gene in C. concinna. These results show how scent can evolve in a relatively simple way without the evolution of highly specialized "scent glands" and other specialized structures. Lis encodes a protein that is structurally related to the family of proteins termed terpene synthases. The protein encoded by Lis is the first member of this family found to catalyze the formation of an acyclic monoterpene. PMID:8768373

  7. Addressing the issue of horizontal gene transfer from a diet ...

    African Journals Online (AJOL)

    One of these hazards, which have great controversy reports, is the possible horizontal gene transfer from GM-food or feed to human or animal tissues. Many researches were conducted to investigate the presence of some transgenic sequences in animal tissues fed on GM- crops. Many of the inserted genes in the GM-crops ...

  8. Design of radiopharmaceuticals for monitoring gene transfer therapy

    International Nuclear Information System (INIS)

    Lambrecht, R.M.; Staehler, P.; Kley, J.; Spiegel, M.; Gross, C.; Graepler, F.T.C.; Gregor, M.; Lauer, U.; Oberdorfer, F.

    1998-01-01

    The development of radiopharmaceuticals for monitoring gene transfer therapy with emission tomography is expected to lead to improved management of cancer by the year 2010. There are now only a few examples and approaches to the design of radiopharmaceuticals for gene transfer therapy. This paper introduces a novel concept for the monitoring of gene therapy. We present the optimisation of the labelling of recombinant human β-NGF ligands for in vitro studies prior to using 123 I for SPET and 124 I for PET studies. (author)

  9. Horizontal gene transfer between Wolbachia and the mosquito Aedes aegypti

    Directory of Open Access Journals (Sweden)

    Walker Thomas

    2009-01-01

    Full Text Available Abstract Background The evolutionary importance of horizontal gene transfer (HGT from Wolbachia endosymbiotic bacteria to their eukaryotic hosts is a topic of considerable interest and debate. Recent transfers of genome fragments from Wolbachia into insect chromosomes have been reported, but it has been argued that these fragments may be on an evolutionary trajectory to degradation and loss. Results We have discovered a case of HGT, involving two adjacent genes, between the genomes of Wolbachia and the currently Wolbachia-uninfected mosquito Aedes aegypti, an important human disease vector. The lower level of sequence identity between Wolbachia and insect, the transcription of all the genes involved, and the fact that we have identified homologs of the two genes in another Aedes species (Ae. mascarensis, suggest that these genes are being expressed after an extended evolutionary period since horizontal transfer, and therefore that the transfer has functional significance. The association of these genes with Wolbachia prophage regions also provides a mechanism for the transfer. Conclusion The data support the argument that HGT between Wolbachia endosymbiotic bacteria and their hosts has produced evolutionary innovation.

  10. Environmental Stability of Seed Carbohydrate Profiles in Soybeans Containing Different Alleles of the Raffinose Synthase 2 (RS2) Gene.

    Science.gov (United States)

    Bilyeu, Kristin D; Wiebold, William J

    2016-02-10

    Soybean [Glycine max (L.) Merr.] is important for the high protein meal used for livestock feed formulations. Carbohydrates contribute positively or negatively to the potential metabolizable energy in soybean meal. The positive carbohydrate present in soybean meal consists primarily of sucrose, whereas the negative carbohydrate components are the raffinose family of oligosaccharides (RFOs), raffinose and stachyose. Increasing sucrose and decreasing raffinose and stachyose are critical targets to improve soybean. In three recently characterized lines, variant alleles of the soybean raffinose synthase 2 (RS2) gene were associated with increased sucrose and decreased RFOs. The objective of this research was to compare the environmental stability of seed carbohydrates in soybean lines containing wild-type or variant alleles of RS2 utilizing a field location study and a date of planting study. The results define the carbohydrate variation in distinct regional and temporal environments using soybean lines with different alleles of the RS2 gene.

  11. Constitutive nitric oxide synthase gene polymorphisms and house dust mite respiratory allergy in an Algerian patient group.

    Science.gov (United States)

    Djidjik, R; Ghaffor, M; Brun, M; Gharnaout, M; Salah, S S; Boukouaci, W; Djidjik, H; Benyounes, A; Koumaravelou, K; Krishnamoorthy, R; Abbadi, M C; Charron, D; Tamouza, R

    2008-02-01

    Genetic polymorphisms in neuronal nitric oxide synthase (NOS1) and calmodulin-dependent endothelial NOS (NOS3) genes are known to influence the course of allergic respiratory disorders. We investigated the role of NOS1 -84 G-->A and NOS3 -786 T-->C, 894 G-->T and 27 base pair (bp) repeat polymorphisms in 125 patients suffering from asthma and/or rhinitis and monosensitized against Dermatophagoides pteronyssinus (Dpter) and 111 controls from Algeria. We found a higher frequency of the -786 C NOS3 allele in patients than in controls [corrected P value (Pc) = 0.04], especially in female cases (Pc = 0.02) and that the 'ab' genotype of the 27-bp polymorphism was significantly associated with specific immunoglobulin E production against Dpter (P = 0.006). This study brings further support for the participation of NOS3 gene polymorphism in the pathogenesis of respiratory allergic disorders.

  12. Interspecies gene transfer provides soybean resistance to a fungal pathogen.

    Science.gov (United States)

    Langenbach, Caspar; Schultheiss, Holger; Rosendahl, Martin; Tresch, Nadine; Conrath, Uwe; Goellner, Katharina

    2016-02-01

    Fungal pathogens pose a major challenge to global crop production. Crop varieties that resist disease present the best defence and offer an alternative to chemical fungicides. Exploiting durable nonhost resistance (NHR) for crop protection often requires identification and transfer of NHR-linked genes to the target crop. Here, we identify genes associated with NHR of Arabidopsis thaliana to Phakopsora pachyrhizi, the causative agent of the devastating fungal disease called Asian soybean rust. We transfer selected Arabidopsis NHR-linked genes to the soybean host and discover enhanced resistance to rust disease in some transgenic soybean lines in the greenhouse. Interspecies NHR gene transfer thus presents a promising strategy for genetically engineered control of crop diseases. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  13. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  14. Diversification of the monoterpene synthase gene family (TPSb) in Protium, a highly diverse genus of tropical trees.

    Science.gov (United States)

    Zapata, Felipe; Fine, Paul V A

    2013-09-01

    Plant monoterpenes are a diverse class of secondary metabolites mediating biotic and abiotic interactions with direct effects on plant fitness. To evaluate the hypothesis that monoterpene diversity is related to functional diversification after gene duplication, we reconstructed the evolutionary history of monoterpene synthases (TPSb)--the genes underlying monoterpene synthesis--in Protium, a taxonomically and chemically diverse genus of tropical trees. We isolated multiple copies of TPSb genes from chemically divergent Protium species, reconstructed the phylogeny of this gene family, used maximum-likelihood estimation of selection coefficients, and inferred residues evolving under positive selection. We found evidence for one ancient and multiple more recent duplication events giving rise to three, and potentially five, copies of TPSb genes currently present in Protium. There was evidence for adaptive evolution in one copy with a positively selected residue likely involved in protein folding and product specificity. All other copies were inferred to be evolving under a combination of stabilizing and/or relaxed selection. Although gene copy number is consistent with the extensive phenotypic diversity in monoterpenes shown in Protium, selection analyses suggest that not all copies are undergoing divergent selection consistent with a coevolutionary arms race with enemies, but instead may be under stabilizing and relaxed selection consistent with signaling or physiological stress functionality. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Evolutionary Insights Based on SNP Haplotypes of Red Pericarp, Grain Size and Starch Synthase Genes in Wild and Cultivated Rice

    Directory of Open Access Journals (Sweden)

    Nisha Singh

    2017-06-01

    Full Text Available The origin and domestication of rice has been a subject of considerable debate in the post-genomic era. Rice varieties have been categorized based on isozyme and DNA markers into two broad cultivar groups, Indica and Japonica. Among other well-known cultivar groups Aus varieties are closer to Indica and Aromatic varieties including Basmati are closer to Japonica, while deep-water rice varieties share kinship to both Indica and Japonica cultivar groups. Here, we analyzed haplotype networks and phylogenetic relationships in a diverse set of genotypes including Indian Oryza nivara/Oryza rufipogon wild rice accessions and representative varieties of four rice cultivar groups based on pericarp color (Rc, grain size (GS3 and eight different starch synthase genes (GBSSI, SSSI, SSIIa, SSIIb, SSIIIa, SSIIIb, SSIVa, and SSIVb. Aus cultivars appear to have the most ancient origin as they shared the maximum number of haplotypes with the wild rice populations, while Indica, Japonica and Aromatic cultivar groups showed varying phylogenetic origins of these genes. Starch synthase genes showed higher variability in cultivated rice than wild rice populations, suggesting diversified selection during and after domestication. O. nivara/O. rufipogon wild rice accessions belonging to different sub-populations shared common haplotypes for all the 10 genes analyzed. Our results support polyphyletic origin of cultivated rice with a complex pattern of migration of domestication alleles from wild to different rice cultivar groups. The findings provide novel insights into evolutionary and domestication history of rice and will help utilization of wild rice germplasm for genetic improvement of rice cultivars.

  16. Evolutionary Insights Based on SNP Haplotypes of Red Pericarp, Grain Size and Starch Synthase Genes in Wild and Cultivated Rice.

    Science.gov (United States)

    Singh, Nisha; Singh, Balwant; Rai, Vandna; Sidhu, Sukhjeet; Singh, Ashok K; Singh, Nagendra K

    2017-01-01

    The origin and domestication of rice has been a subject of considerable debate in the post-genomic era. Rice varieties have been categorized based on isozyme and DNA markers into two broad cultivar groups, Indica and Japonica. Among other well-known cultivar groups Aus varieties are closer to Indica and Aromatic varieties including Basmati are closer to Japonica, while deep-water rice varieties share kinship to both Indica and Japonica cultivar groups. Here, we analyzed haplotype networks and phylogenetic relationships in a diverse set of genotypes including Indian Oryza nivara/Oryza rufipogon wild rice accessions and representative varieties of four rice cultivar groups based on pericarp color ( Rc ), grain size ( GS3 ) and eight different starch synthase genes ( GBSSI, SSSI, SSIIa, SSIIb, SSIIIa, SSIIIb, SSIVa , and SSIVb ). Aus cultivars appear to have the most ancient origin as they shared the maximum number of haplotypes with the wild rice populations, while Indica, Japonica and Aromatic cultivar groups showed varying phylogenetic origins of these genes. Starch synthase genes showed higher variability in cultivated rice than wild rice populations, suggesting diversified selection during and after domestication. O. nivara/O. rufipogon wild rice accessions belonging to different sub-populations shared common haplotypes for all the 10 genes analyzed. Our results support polyphyletic origin of cultivated rice with a complex pattern of migration of domestication alleles from wild to different rice cultivar groups. The findings provide novel insights into evolutionary and domestication history of rice and will help utilization of wild rice germplasm for genetic improvement of rice cultivars.

  17. Cloning and functional characterization of a gene for capsanthin-capsorubin synthase from tiger lily (Lilium lancifolium Thunb. 'Splendens').

    Science.gov (United States)

    Jeknić, Zoran; Morré, Jeffrey T; Jeknić, Stevan; Jevremović, Sladana; Subotić, Angelina; Chen, Tony H H

    2012-11-01

    The orange color of tiger lily (Lolium lancifolium 'Splendens') flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription-PCR (RT-PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species.

  18. Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

    2017-11-03

    Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

  19. Detecting Horizontal Gene Transfer between Closely Related Taxa.

    Science.gov (United States)

    Adato, Orit; Ninyo, Noga; Gophna, Uri; Snir, Sagi

    2015-10-01

    Horizontal gene transfer (HGT), the transfer of genetic material between organisms, is crucial for genetic innovation and the evolution of genome architecture. Existing HGT detection algorithms rely on a strong phylogenetic signal distinguishing the transferred sequence from ancestral (vertically derived) genes in its recipient genome. Detecting HGT between closely related species or strains is challenging, as the phylogenetic signal is usually weak and the nucleotide composition is normally nearly identical. Nevertheless, there is a great importance in detecting HGT between congeneric species or strains, especially in clinical microbiology, where understanding the emergence of new virulent and drug-resistant strains is crucial, and often time-sensitive. We developed a novel, self-contained technique named Near HGT, based on the synteny index, to measure the divergence of a gene from its native genomic environment and used it to identify candidate HGT events between closely related strains. The method confirms candidate transferred genes based on the constant relative mutability (CRM). Using CRM, the algorithm assigns a confidence score based on "unusual" sequence divergence. A gene exhibiting exceptional deviations according to both synteny and mutability criteria, is considered a validated HGT product. We first employed the technique to a set of three E. coli strains and detected several highly probable horizontally acquired genes. We then compared the method to existing HGT detection tools using a larger strain data set. When combined with additional approaches our new algorithm provides richer picture and brings us closer to the goal of detecting all newly acquired genes in a particular strain.

  20. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    in insect cells, and each CslA protein catalyzed mannan and glucomannan synthase reactions in vitro. Microarray mining and quantitative real-time reverse transcription-polymerase chain reaction analysis demonstrated that transcripts of Arabidopsis and loblolly pine (Pinus taeda) CslA genes display tissue...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  1. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

    2013-01-01

    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  2. Gene transfer strategies for improving radiolabeled peptide imaging and therapy

    International Nuclear Information System (INIS)

    Rogers, B.E.; Buchsbaum, D.J.; Zinn, K.R.

    2000-01-01

    Utilization of molecular biology techniques offers attractive options in nuclear medicine for improving cancer imaging and therapy with radiolabeled peptides. Two of these options include utilization of phage-panning to identify novel tumor specific peptides or single chain antibodies and gene transfer techniques to increase the antibodies and gene transfer techniques to increase the number of antigen/receptor sites expressed on malignant cells. The group has focused on the latter approach for improving radiolabeled peptide imaging and therapy. The most widely used gene transfer vectors in clinical gene therapy trials include retrovirus, cationic lipids and adenovirus. It has been utilized adenovirus vectors for gene transfer because of their ability to accomplish efficient in vivo gene transfer. Adenovirus vectors encoding the genes for a variety of antigens/receptors (carcinoembryonic antigen, gastrin-releasing peptide receptor, somatostatin receptor subtype 2 (SSTr2) have all shown that their expression is increased on cancer cells both in vitro and in vivo following adenovirus infection. Of particular interest has been the adenovirus encoding for SSTr2 (AdCMVSSTr2). Various radioisotopes have been attached to somatostatin analogues for imaging and therapy of SSTr2-positive tumors both clinically and in animal models. The use of these analogues in combination with AdCMVSSTr2 is a promising approach for improving the detection sensitivity and therapeutic efficacy of these radiolabeled peptides against solid tumors. In addition, it has been proposed the use of SSTr2 as a marker for imaging the expression of another cancer therapeutic transgene (e.g. cytosine deaminase, thymidine kinase) encoded within the same vector. This would allow for non-invasive monitoring of gene delivery to tumor sites

  3. The interconnection between biofilm formation and horizontal gene transfer

    DEFF Research Database (Denmark)

    Madsen, Jonas Stenløkke; Burmølle, Mette; Hansen, Lars H.

    2012-01-01

    of their believed importance in the understanding of the adaptation and subsequent evolution of social traits in bacteria. Here, we discuss current evidence for such interconnectedness centred on plasmids. Horizontal transfer rates are typically higher in biofilm communities compared with those in planktonic states....... Biofilms, furthermore, promote plasmid stability and may enhance the host range of mobile genetic elements that are transferred horizontally. Plasmids, on the other hand, are very well suited to promote the evolution of social traits such as biofilm formation. This, essentially, transpires because plasmids...... stable social interactions. It also indicates that horizontal gene transfer ultimately enhances the relatedness of bacteria carrying the mobile genetic elements of the same origin. The perspective of this review extends to an overall interconnectedness between horizontal gene transfer, mobile genetic...

  4. Alfalfa Cellulose Synthase Gene Expression under Abiotic Stress: A Hitchhiker’s Guide to RT-qPCR Normalization

    Science.gov (United States)

    Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

    2014-01-01

    Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

  5. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  6. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  7. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... but it was relatively lower in other three tissues. In addition, the atpA gene was successfully expressed in Escherichia coli. Key words: Sweet potato, atpA gene, gene expression, digital gene expression profiling, quantitative analysis. INTRODUCTION. Sweet potato (Ipomoea batatas L. Lam) is the seventh.

  8. A gene in the process of endosymbiotic transfer.

    Directory of Open Access Journals (Sweden)

    Kateřina Jiroutová

    Full Text Available BACKGROUND: The endosymbiotic birth of organelles is accompanied by massive transfer of endosymbiont genes to the eukaryotic host nucleus. In the centric diatom Thalassiosira pseudonana the Psb28 protein is encoded in the plastid genome while a second version is nuclear-encoded and possesses a bipartite N-terminal presequence necessary to target the protein into the diatom complex plastid. Thus it can represent a gene captured during endosymbiotic gene transfer. METHODOLOGY/PRINCIPAL FINDINGS: To specify the origin of nuclear- and plastid-encoded Psb28 in T. pseudonana we have performed extensive phylogenetic analyses of both mentioned genes. We have also experimentally tested the intracellular location of the nuclear-encoded Psb28 protein (nuPsb28 through transformation of the diatom Phaeodactylum tricornutum with the gene in question fused to EYFP. CONCLUSIONS/SIGNIFICANCE: We show here that both versions of the psb28 gene in T. pseudonana are transcribed. We also provide experimental evidence for successful targeting of the nuPsb28 fused with EYFP to the diatom complex plastid. Extensive phylogenetic analyses demonstrate that nucleotide composition of the analyzed genes deeply influences the tree topology and that appropriate methods designed to deal with a compositional bias of the sequences and the long branch attraction artefact (LBA need to be used to overcome this obstacle. We propose that nuclear psb28 in T. pseudonana is a duplicate of a plastid localized version, and that it has been transferred from its endosymbiont.

  9. Expression of a transferred nuclear gene in a mitochondrial genome

    Directory of Open Access Journals (Sweden)

    Yichun Qiu

    2014-08-01

    Full Text Available Transfer of mitochondrial genes to the nucleus, and subsequent gain of regulatory elements for expression, is an ongoing evolutionary process in plants. Many examples have been characterized, which in some cases have revealed sources of mitochondrial targeting sequences and cis-regulatory elements. In contrast, there have been no reports of a nuclear gene that has undergone intracellular transfer to the mitochondrial genome and become expressed. Here we show that the orf164 gene in the mitochondrial genome of several Brassicaceae species, including Arabidopsis, is derived from the nuclear ARF17 gene that codes for an auxin responsive protein and is present across flowering plants. Orf164 corresponds to a portion of ARF17, and the nucleotide and amino acid sequences are 79% and 81% identical, respectively. Orf164 is transcribed in several organ types of Arabidopsis thaliana, as detected by RT-PCR. In addition, orf164 is transcribed in five other Brassicaceae within the tribes Camelineae, Erysimeae and Cardamineae, but the gene is not present in Brassica or Raphanus. This study shows that nuclear genes can be transferred to the mitochondrial genome and become expressed, providing a new perspective on the movement of genes between the genomes of subcellular compartments.

  10. Staphylococci on ICE: Overlooked agents of horizontal gene transfer.

    Science.gov (United States)

    Sansevere, Emily A; Robinson, D Ashley

    2017-01-01

    Horizontal gene transfer plays a significant role in spreading antimicrobial resistance and virulence genes throughout the genus Staphylococcus , which includes species of clinical relevance to humans and animals. While phages and plasmids are the most well-studied agents of horizontal gene transfer in staphylococci, the contribution of integrative conjugative elements (ICEs) has been mostly overlooked. Experimental work demonstrating the activity of ICEs in staphylococci remained frozen for years after initial work in the 1980s that showed Tn 916 was capable of transfer from Enterococcus to Staphylococcus . However, recent work has begun to thaw this field. To date, 2 families of ICEs have been identified among staphylococci - Tn 916 that includes the Tn 5801 subfamily, and ICE 6013 that includes at least 7 subfamilies. Both Tn 5801 and ICE 6013 commonly occur in clinical strains of S. aureus . Tn 5801 is the most studied of the Tn 916 family elements in staphylococci and encodes tetracycline resistance and a protein that, when expressed in Escherichia coli , inhibits restriction barriers to incoming DNA. ICE 6013 is among the shortest known ICEs, but it still includes many uncharacterized open reading frames. This element uses an IS 30 -like transposase as its recombinase, providing some versatility in integration sites. ICE 6013 also conjugatively transfers among receptive S. aureus strains at relatively higher frequency than Tn 5801 . Continued study of these mobile genetic elements may reveal the full extent to which ICEs impact horizontal gene transfer and the evolution of staphylococci.

  11. The Rice Terpene Synthase Gene OsTPS19 Functions as an (S)-Limonene Synthase in planta and its Overexpression Leads to Enhanced Resistance to the Blast Fungus Magnaporthe oryzae.

    Science.gov (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

    2018-03-06

    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defense mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defense gene. Here, we report the functional characterization of OsTPS19, which is upregulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defense against M. oryzae, at least partly, by inhibiting spore germination. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  12. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    Directory of Open Access Journals (Sweden)

    Takashi Kadono

    2015-08-01

    Full Text Available Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase.

  13. Effect of an Introduced Phytoene Synthase Gene Expression on Carotenoid Biosynthesis in the Marine Diatom Phaeodactylum tricornutum

    Science.gov (United States)

    Kadono, Takashi; Kira, Nozomu; Suzuki, Kengo; Iwata, Osamu; Ohama, Takeshi; Okada, Shigeru; Nishimura, Tomohiro; Akakabe, Mai; Tsuda, Masashi; Adachi, Masao

    2015-01-01

    Carotenoids exert beneficial effects on human health through their excellent antioxidant activity. To increase carotenoid productivity in the marine Pennales Phaeodactylum tricornutum, we genetically engineered the phytoene synthase gene (psy) to improve expression because RNA-sequencing analysis has suggested that the expression level of psy is lower than other enzyme-encoding genes that are involved in the carotenoid biosynthetic pathway. We isolated psy from P. tricornutum, and this gene was fused with the enhanced green fluorescent protein gene to detect psy expression. After transformation using the microparticle bombardment technique, we obtained several P. tricornutum transformants and confirmed psy expression in their plastids. We investigated the amounts of PSY mRNA and carotenoids, such as fucoxanthin and β-carotene, at different growth phases. The introduction of psy increased the fucoxanthin content of a transformants by approximately 1.45-fold relative to the levels in the wild-type diatom. However, some transformants failed to show a significant increase in the carotenoid content relative to that of the wild-type diatom. We also found that the amount of PSY mRNA at log phase might contribute to the increase in carotenoids in the transformants at stationary phase. PMID:26308005

  14. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    International Nuclear Information System (INIS)

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-01-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd 2+ and Cu 2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd 2+ and Cu 2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu 2+ ) in A. germinans leaves

  15. Molecular typing using polymorphisms of the polyketide synthase gene (PKS1) of strains in Japan morphologically identified as Fonsecaea pedrosoi.

    Science.gov (United States)

    Ushigami, Tsuyoshi; Anzawa, Kazushi; Mochizuki, Takashi

    2017-01-01

    Fonsecaea pedrosoi sensu lato is a major causative agent of dematiaceous fungal infection in Japan. Recent sequence analysis of the internal transcribed spacer (ITS) regions of the ribosomal RNA gene has shown that this species can be separated into three species: F. pedrosoi sensu stricto, F. monophora and F. nubica. The cell walls of dematiaceous fungi including the genus Fonsecaea contain melanin, which is important for their virulence. Polyketide synthase (PKS1) is an enzyme required for melanin synthesis. This study analyzed the phylogeny of strains of F. pedrosoi sensu lato isolated in Japan by sequencing the PKS1 gene and ITS regions and identifying molecular polymorphism. Sixty strains morphologically identified as F. pedrosoi isolated worldwide, including 37 strains isolated in Japan, were analyzed. ITS regions of the ribosomal RNA gene and part of the PKS1 gene region were amplified, yielding sequences of approximately 600 and 450 bp, respectively. Polymerase chain reaction products were sequenced, and cluster analysis was performed. The proposed phylogenetic tree based on PKS1 sequences closely matched that based on the ITS regions. Sequencing of both regions showed that the isolates from Japan belonged to the clade of F. monophora. Molecular variations of these Japanese strains were evaluated by assessing both ITS and PKS1 sequences. The 37 isolates could be divided into at least seven molecular subtypes. The combination of these two molecular markers provides a most robust method for intraspecies subtyping and further epidemiological study of F. monophora. © 2016 Japanese Dermatological Association.

  16. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper.

    Science.gov (United States)

    Gonzalez-Mendoza, Daniel; Moreno, Adriana Quiroz; Zapata-Perez, Omar

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd2+ and Cu2+ concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd2+ and Cu2+ detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu2+) in A. germinans leaves.

  17. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  18. [Double-antisense ACC oxidase and ACC synthase fusion gene introduced into tomato by Agrobacterium-mediated transformation and analysis the ethylene production of transgenic plants].

    Science.gov (United States)

    Xiong, Ai Sheng; Yao, Quan Hong; Li, Xian; Fan, Hui Qin; Peng, Ri He

    2003-12-01

    The tomato fruit-specific promoter 2A11 was amplified from tomato genomic DNA using PCR techniques. Total RNA was isolated from ripen fruit of tomato, then ACC oxidase gene and ACC synthase gene were obtained using reverse-transcription polymerase chain reaction. The fusion encoding ACC oxidase and ACC synthase gene was obtained through ACC oxidase gene and ACC synthase gene ligation. The fusion gene was then inserted into a plant binary vector pYPX145 in an inverted orientation. Finally, the binary plant expression vector pOSACC was constructed in which the double-antisense fusion gene was controlled by fruit-specific 2A11 promoter. By using hypocotyls and cotyledon petioles as explants, the unit of double-antisense fusion gene was successfully introduced into tomato (Lycopersicon esculentum Mill) cultivar "Hezuo 903" by Agrobacterium tumefaciens-mediated transformation. 105 transgenic plants were obtained through 200 mg/L kanamycin selection and GUS assay. Two lines of DR-1 and DR-2 were obtained through selecting the characteristics of prolonged shelf life and agriculture. The transgenic plants showed the characteristics of prolonged shelf life over 50 d. The amount of ethylene released from DR-1 and DR-2 fruits were reduced significantly to about 9.5% of that released by non-transformed controls.

  19. Allele specific CAPS marker development and characterization of chalcone synthase gene in Indian mulberry (Morus spp., family Moraceae).

    Science.gov (United States)

    Arora, Vivek; Ghosh, M K; Pal, Soumili; Gangopadhyay, Gaurab

    2017-01-01

    Chalcone synthase (CHS) is an essential enzyme in the phenylpropanoid pathway that catalyzes the first step in flavonoid biosynthesis in plants under diverse environmental stress. We have used CHS as a candidate gene in mulberry and developed Single Nucleotide Polymorphism (SNP) based co-dominant Cleaved Amplified Polymorphic Sequence (CAPS) marker associated with the CHS locus. The segregation pattern of the marker was studied in an F1 population derived from a hybridization program between two mulberry genotypes showing polymorphism for the CHS locus. Differential CHS activity of the recombinants has been correlated with the segregation pattern of the marker. Homology modelling and docking studies are performed for both the identified CHS alleles and correlated with respective CHS activity. Phenotyping of Powdery Mildew infected F1 population indicated a probable association with the CAPS marker.

  20. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  1. Allele specific CAPS marker development and characterization of chalcone synthase gene in Indian mulberry (Morus spp., family Moraceae.

    Directory of Open Access Journals (Sweden)

    Vivek Arora

    Full Text Available Chalcone synthase (CHS is an essential enzyme in the phenylpropanoid pathway that catalyzes the first step in flavonoid biosynthesis in plants under diverse environmental stress. We have used CHS as a candidate gene in mulberry and developed Single Nucleotide Polymorphism (SNP based co-dominant Cleaved Amplified Polymorphic Sequence (CAPS marker associated with the CHS locus. The segregation pattern of the marker was studied in an F1 population derived from a hybridization program between two mulberry genotypes showing polymorphism for the CHS locus. Differential CHS activity of the recombinants has been correlated with the segregation pattern of the marker. Homology modelling and docking studies are performed for both the identified CHS alleles and correlated with respective CHS activity. Phenotyping of Powdery Mildew infected F1 population indicated a probable association with the CAPS marker.

  2. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Science.gov (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  3. Overexpression of the Anthocyanidin Synthase Gene in Strawberry Enhances Antioxidant Capacity and Cytotoxic Effects on Human Hepatic Cancer Cells.

    Science.gov (United States)

    Giampieri, Francesca; Gasparrini, Massimiliano; Forbes-Hernandez, Tamara Y; Mazzoni, Luca; Capocasa, Franco; Sabbadini, Silvia; Alvarez-Suarez, Josè M; Afrin, Sadia; Rosati, Carlo; Pandolfini, Tiziana; Molesini, Barbara; Sánchez-Sevilla, José F; Amaya, Iraida; Mezzetti, Bruno; Battino, Maurizio

    2018-01-24

    Food fortification through the increase and/or modulation of bioactive compounds has become a major goal for preventing several diseases, including cancer. Here, strawberry lines of cv. Calypso transformed with a construct containing an anthocyanidin synthase (ANS) gene were produced to study the effects on anthocyanin biosynthesis, metabolism, and transcriptome. Three strawberry ANS transgenic lines (ANS L5, ANS L15, and ANS L18) were analyzed for phytochemical composition and total antioxidant capacity (TAC), and their fruit extracts were assessed for cytotoxic effects on hepatocellular carcinoma. ANS L18 fruits had the highest levels of total phenolics and flavonoids, while those of ANS L15 had the highest anthocyanin concentration; TAC positively correlated with total polyphenol content. Fruit transcriptome was also specifically affected in the polyphenol biosynthesis and in other related metabolic pathways. Fruit extracts of all lines exerted cytotoxic effects in a dose/time-dependent manner, increasing cellular apoptosis and free radical levels and impairing mitochondrial functionality.

  4. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils.

    Science.gov (United States)

    Irmisch, Sandra; Krause, Sandra T; Kunert, Grit; Gershenzon, Jonathan; Degenhardt, Jörg; Köllner, Tobias G

    2012-06-08

    The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS), the key enzymes in constructing terpene carbon skeletons. Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita). Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (-)-(E)-β-caryophyllene (MrTPS1), (+)-germacrene A (MrTPS3), (E)-β-ocimene (MrTPS4) and (-)-germacrene D (MrTPS5). A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (-)-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+)-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  5. The organ-specific expression of terpene synthase genes contributes to the terpene hydrocarbon composition of chamomile essential oils

    Directory of Open Access Journals (Sweden)

    Irmisch Sandra

    2012-06-01

    Full Text Available Abstract Background The essential oil of chamomile, one of the oldest and agronomically most important medicinal plant species in Europe, has significant antiphlogistic, spasmolytic and antimicrobial activities. It is rich in chamazulene, a pharmaceutically active compound spontaneously formed during steam distillation from the sesquiterpene lactone matricine. Chamomile oil also contains sesquiterpene alcohols and hydrocarbons which are produced by the action of terpene synthases (TPS, the key enzymes in constructing terpene carbon skeletons. Results Here, we present the identification and characterization of five TPS enzymes contributing to terpene biosynthesis in chamomile (Matricaria recutita. Four of these enzymes were exclusively expressed in above-ground organs and produced the common terpene hydrocarbons (−-(E-β-caryophyllene (MrTPS1, (+-germacrene A (MrTPS3, (E-β-ocimene (MrTPS4 and (−-germacrene D (MrTPS5. A fifth TPS, the multiproduct enzyme MrTPS2, was mainly expressed in roots and formed several Asteraceae-specific tricyclic sesquiterpenes with (−-α-isocomene being the major product. The TPS transcript accumulation patterns in different organs of chamomile were consistent with the abundance of the corresponding TPS products isolated from these organs suggesting that the spatial regulation of TPS gene expression qualitatively contribute to terpene composition. Conclusions The terpene synthases characterized in this study are involved in the organ-specific formation of essential oils in chamomile. While the products of MrTPS1, MrTPS2, MrTPS4 and MrTPS5 accumulate in the oils without further chemical alterations, (+-germacrene A produced by MrTPS3 accumulates only in trace amounts, indicating that it is converted into another compound like matricine. Thus, MrTPS3, but also the other TPS genes, are good markers for further breeding of chamomile cultivars rich in pharmaceutically active essential oils.

  6. Enhanced cadmium resistance and accumulation in Pseudomonas putida KT2440 expressing the phytochelatin synthase gene of Schizosaccharomyces pombe.

    Science.gov (United States)

    Yong, X; Chen, Y; Liu, W; Xu, L; Zhou, J; Wang, S; Chen, P; Ouyang, P; Zheng, T

    2014-03-01

    Phytochelatins (PCs) are cysteine-rich peptides with high binding affinity for toxic metals. Expressing the PC synthase gene (PCS) in plant growth-promoting bacteria may enhance its metal resistance and accumulation, consequently increasing phytoremediation efficiency in heavy metal pollution. In this study, PCS from Schizosaccharomyces pombe was cloned and expressed in Pseudomonas putida KT2440, which was confirmed by real-time RT-PCR through an increase in SpPCS mRNA expression level when induced by 20 μmol of CdCl2 in the transformed Ps. putida cells. The recombined strain KT2440-SpPCS exhibited enhanced Cd, Ag and Hg resistance. Compared with the original strain, KT2440-SpPCS also displayed a threefold to fivefold increase in Cd accumulation (14·32 μmol g(-1) to 17·38 μmol g(-1) ; dry weight) when grown in 30 and 50 μmol CdCl2 , along with an increase in nonprotein thiols. Further experiments showed significantly enhanced germination rates and growth of wheat seeds in 0·1 mmol to 1·0 mmol Cd when inoculated with KT2440-SpPCS. This study shows potential use of Ps. putida KT2440-SpPCS in plants to construct a symbiotic system for an enhanced phytoremediation of heavy metal-contaminated environments. The symbiotic system of using plant growth-promoting bacteria Pseudomonas putida to express phytochelatin synthase gene of Schizosaccharomyces pombe together in plants resulted in high heavy metal resistance and high accumulation capacity, suggesting potential enhancement in phytoremediation of heavy metal-contaminated environments. © 2013 The Society for Applied Microbiology.

  7. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  8. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides...... in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western...

  9. Systematic inference of highways of horizontal gene transfer in prokaryotes.

    Science.gov (United States)

    Bansal, Mukul S; Banay, Guy; Harlow, Timothy J; Gogarten, J Peter; Shamir, Ron

    2013-03-01

    Horizontal gene transfer (HGT) plays a crucial role in the evolution of prokaryotic species. Typically, no more than a few genes are horizontally transferred between any two species. However, several studies identified pairs of species (or linages) between which many different genes were horizontally transferred. Such a pair is said to be linked by a highway of gene sharing. Inferring such highways is crucial to understanding the evolution of prokaryotes and for inferring past symbiotic and ecological associations among different species. We present a new improved method for systematically detecting highways of gene sharing. As we demonstrate using a variety of simulated datasets, our method is highly accurate and efficient, and robust to noise and high rates of HGT. We further validate our method by applying it to a published dataset of >22 000 gene trees from 144 prokaryotic species. Our method makes it practical, for the first time, to perform accurate highway analysis quickly and easily even on large datasets with high rates of HGT. An implementation of the method can be freely downloaded from: http://acgt.cs.tau.ac.il/hide.

  10. Three-color Förster resonance energy transfer within single F₀F₁-ATP synthases: monitoring elastic deformations of the rotary double motor in real time.

    Science.gov (United States)

    Ernst, Stefan; Düser, Monika G; Zarrabi, Nawid; Börsch, Michael

    2012-01-01

    Catalytic activities of enzymes are associated with elastic conformational changes of the protein backbone. Förster-type resonance energy transfer, commonly referred to as FRET, is required in order to observe the dynamics of relative movements within the protein. Förster-type resonance energy transfer between two specifically attached fluorophores provides a ruler with subnanometer resolution between 3 and 8 nm, submillisecond time resolution for time trajectories of conformational changes, and single-molecule sensitivity to overcome the need for synchronization of various conformations. F(O)F(1)-ATP synthase is a rotary molecular machine which catalyzes the formation of adenosine triphosphate (ATP). The Escherichia coli enzyme comprises a proton driven 10 stepped rotary F(O) motor connected to a 3-stepped F(1) motor, where ATP is synthesized. This mismatch of step sizes will result in elastic deformations within the rotor parts. We present a new single-molecule FRET approach to observe both rotary motors simultaneously in a single F(O)F(1)-ATP synthase at work. We labeled this enzyme with three fluorophores, specifically at the stator part and at the two rotors. Duty cycle-optimized with alternating laser excitation, referred to as DCO-ALEX, allowed to control enzyme activity and to unravel associated transient twisting within the rotors of a single enzyme during ATP hydrolysis and ATP synthesis. Monte Carlo simulations revealed that the rotor twisting is larger than 36 deg.

  11. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  12. Geranyl diphosphate synthase from mint

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Rodney Bruce (Pullman, WA); Wildung, Mark Raymond (Colfax, WA); Burke, Charles Cullen (Moscow, ID); Gershenzon, Jonathan (Jena, DE)

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  13. Quasispecies theory for horizontal gene transfer and recombination

    Science.gov (United States)

    Muñoz, Enrique; Park, Jeong-Man; Deem, Michael W.

    2008-12-01

    We introduce a generalization of the parallel, or Crow-Kimura, and Eigen models of molecular evolution to represent the exchange of genetic information between individuals in a population. We study the effect of different schemes of genetic recombination on the steady-state mean fitness and distribution of individuals in the population, through an analytic field theoretic mapping. We investigate both horizontal gene transfer from a population and recombination between pairs of individuals. Somewhat surprisingly, these nonlinear generalizations of quasispecies theory to modern biology are analytically solvable. For two-parent recombination, we find two selected phases, one of which is spectrally rigid. We present exact analytical formulas for the equilibrium mean fitness of the population, in terms of a maximum principle, which are generally applicable to any permutation invariant replication rate function. For smooth fitness landscapes, we show that when positive epistatic interactions are present, recombination or horizontal gene transfer introduces a mild load against selection. Conversely, if the fitness landscape exhibits negative epistasis, horizontal gene transfer or recombination introduces an advantage by enhancing selection towards the fittest genotypes. These results prove that the mutational deterministic hypothesis holds for quasispecies models. For the discontinuous single sharp peak fitness landscape, we show that horizontal gene transfer has no effect on the fitness, while recombination decreases the fitness, for both the parallel and the Eigen models. We present numerical and analytical results as well as phase diagrams for the different cases.

  14. Detecting Horizontal Gene Transfer between Closely Related Taxa.

    Directory of Open Access Journals (Sweden)

    Orit Adato

    2015-10-01

    Full Text Available Horizontal gene transfer (HGT, the transfer of genetic material between organisms, is crucial for genetic innovation and the evolution of genome architecture. Existing HGT detection algorithms rely on a strong phylogenetic signal distinguishing the transferred sequence from ancestral (vertically derived genes in its recipient genome. Detecting HGT between closely related species or strains is challenging, as the phylogenetic signal is usually weak and the nucleotide composition is normally nearly identical. Nevertheless, there is a great importance in detecting HGT between congeneric species or strains, especially in clinical microbiology, where understanding the emergence of new virulent and drug-resistant strains is crucial, and often time-sensitive. We developed a novel, self-contained technique named Near HGT, based on the synteny index, to measure the divergence of a gene from its native genomic environment and used it to identify candidate HGT events between closely related strains. The method confirms candidate transferred genes based on the constant relative mutability (CRM. Using CRM, the algorithm assigns a confidence score based on "unusual" sequence divergence. A gene exhibiting exceptional deviations according to both synteny and mutability criteria, is considered a validated HGT product. We first employed the technique to a set of three E. coli strains and detected several highly probable horizontally acquired genes. We then compared the method to existing HGT detection tools using a larger strain data set. When combined with additional approaches our new algorithm provides richer picture and brings us closer to the goal of detecting all newly acquired genes in a particular strain.

  15. Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

    Science.gov (United States)

    Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2017-07-01

    The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  16. Isolation and characterization of drought-related trehalose 6-phosphate-synthase gene from cultivated cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Kosmas, Sotirios A; Argyrokastritis, Alexandros; Loukas, Michael G; Eliopoulos, Elias; Tsakas, Spyros; Kaltsikes, Pantouses J

    2006-01-01

    Due to the important role of cotton drought-tolerant varieties and the reported involvement in this trait of trehalose-6-phosphate-synthase, the respective gene (TPS) was isolated and characterized from cultivated cotton, Gossypium hirsutum (ZETA 2 cultivar), using a chromosome-walking technique. TPS has three exons comprising the coding region. Southern blot analysis indicated that the Gossypium genomes (A and D) contain a single copy of TPS per genome. In addition, the expression of this gene was studied in different plant tissues. Plants of the Australian cotton variety Siokra L23, known for its drought tolerance, were subjected to drought stress (using PEG 6,000 solution, for 4 h during the dark period of the day and for four consecutive days); leaves, stems and roots were collected after the end of the stress period. Total extracted RNA was examined for the presence of transcripts, in the above-mentioned tissues of stressed and well-watered plants, by reverse transcription-polymerase chain reaction (RT-PCR). The expression levels, determined semi-quantitatively, indicated that the gene was expressed in all plant tissues under both water availability conditions. However, increased expression levels of TPS were observed mainly in stressed leaves and roots compared to those of the well-watered control. This finding is in agreement with the fact that TPS participates in trehalose biosynthesis, known for its participation in stress signal transduction in higher plants.

  17. Negative feedback regulation of lipopolysaccharide-induced inducible nitric oxide synthase gene expression by heme oxygenase-1 induction in macrophages.

    Science.gov (United States)

    Ashino, Takashi; Yamanaka, Rieko; Yamamoto, Masayuki; Shimokawa, Hiroaki; Sekikawa, Kenji; Iwakura, Yoichiro; Shioda, Seiji; Numazawa, Satoshi; Yoshida, Takemi

    2008-04-01

    Heme oxygenase-1 (HO-1) is induced under infectious diseases in macrophages. We performed experiments using various gene deficient mouse-derived macrophages to determine a detailed induction mechanism of HO-1 by lipopolysaccharide (LPS) and the functional role of HO-1 induction in macrophages. LPS (1 microg/mL) maximally induced inducible nitric oxide synthase (iNOS) and HO-1 mRNAs in wild-type (WT) macrophages at 6h and 12h after treatment, respectively, and liberated tumor necrosis factor alpha (TNFalpha) from WT macrophages. LPS also induced iNOS and HO-1 in TNFalpha(-/-) macrophages, but not in iNOS(-/-) macrophages. Interestingly, although LPS strongly induced iNOS, it failed to induce HO-1 almost completely in nuclear-factor erythroid 2-related factor 2 (Nrf2)(-/-) macrophages. The LPS-induced iNOS gene expression was suppressed by pretreatment with HO-1 inducers, hemin and Co-protoporphyrin (CoPP), but not with HO-1 inhibitor, Sn-protoporphyrin in WT macrophages. In the Nrf2(-/-) macrophages, the ability of CoPP to induce HO-1 and its inhibitory effect on the LPS-induced iNOS gene expression were lower than seen in WT macrophages. The present findings suggest that HO-1 is induced via NO-induced nuclear translocation of Nrf2, and the enzymatic function of HO-1 inhibits the overproduction of NO in macrophages.

  18. Mutational analysis of Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in the interior division of Sabah, Malaysia.

    Science.gov (United States)

    Lau, Tiek Ying; Sylvi, Mersumpin; William, Timothy

    2013-12-10

    The sulphadoxine/pyrimethamine (SDX/PYR) combination had been chosen to treat uncomplicated falciparum malaria in Malaysia for more than 30 years. Non-silent mutations in dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes are responsible for the resistance to pyrimethamine and sulphadoxine, respectively. This study reports the mutational analysis of pfdhfr and pfdhps in single Plasmodium falciparum infection isolates from the interior division of Sabah, Malaysian Borneo. A total of 22 P. falciparum single infection isolates collected from two districts of the interior division of Sabah from February to November 2010 were recruited for the mutational study of pfdhfr and pfdhps. Both genes were amplified by nested PCR prior to DNA sequencing and mutational analysis. A total of three pfdhfr and four pfdhps alleles were identified. The most prevalent pfdhfr allele is ANRNL (86%) involving triple mutation at position 108(S to N), 59(C to R) and 164(I to L). In pfdhps, two novel alleles, SGTGA (73%) and AAKAA (5%) were identified. Alleles involving triple mutation in both pfdhfr (ANRNL) and pfdhps (SGTGA), which were absent in Sabah in a study conducted about 15 years ago, are now prevalent. High prevalence of mutations in SDX/PYR associated drug resistance genes are reported in this study. This mutational study of pfdhps and pfdhfr indicating that SDX/PYR should be discontinued in this region.

  19. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

    Directory of Open Access Journals (Sweden)

    Linda Koshy

    2008-01-01

    Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

  20. VaCPK20 gene overexpression significantly increased resveratrol content and expression of stilbene synthase genes in cell cultures of Vitis amurensis Rupr.

    Science.gov (United States)

    Aleynova-Shumakova, O A; Dubrovina, A S; Manyakhin, A Y; Karetin, Y A; Kiselev, K V

    2014-06-01

    Resveratrol, a naturally occurring plant phenol, has been reported to exhibit a wide range of valuable biological and pharmacological properties. In the present investigation, we show that transformation of a Vitis amurensis Rupr. cell suspension with the gene VaCPK20 for a calcium-dependent protein kinase (CDPK) under the control of double CaMV 35S promoter increased resveratrol production in five independently transformed cell lines in 9-68 times compared with control cells. The VaCPK20-transformed calli were capable of producing 0.04-0.42 % dry wt. of resveratrol, while the control calli produced up to 0.008 % dry wt. of resveratrol Also, we characterized expression of stilbene synthase (STS) genes in the five VaCPK20-transgenic cell lines of V. amurensis. In all VaCPK20-transgenic cell lines, expression of VaSTS7 increased; while expression of VaSTS1 decreased. We suggest that transformation of V. amurensis calli with the VaCPK20 gene induced resveratrol accumulation via enhancement of expression of the VaSTS7 gene involved in resveratrol biosynthesis. The obtained data first demonstrate that overexpression of a CDPK gene resulted in increased accumulation of a stilbenoid phytoalexine in transgenic plant cells. We propose that the VaCPK20 gene could play an important role in the regulation of resveratrol biosynthesis in grape cells.

  1. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    OpenAIRE

    Shuiyuan Cheng; Xiaohui Wang; Feng Xu; Qiangwen Chen; Tingting Tao; Jing Lei; Weiwei Zhang; Yongling Liao; Jie Chang; Xingxiang Li

    2016-01-01

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was c...

  2. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter r...... in the GLUT4 cDNA was a silent polymorphism at codon 130. Southern blotting of both gene loci did not detect any major abnormalities.(ABSTRACT TRUNCATED AT 250 WORDS)...

  3. Detection of Horizontal Gene Transfers from Phylogenetic Comparisons

    Science.gov (United States)

    Pylro, Victor Satler; Vespoli, Luciano de Souza; Duarte, Gabriela Frois; Yotoko, Karla Suemy Clemente

    2012-01-01

    Bacterial phylogenies have become one of the most important challenges for microbial ecology. This field started in the mid-1970s with the aim of using the sequence of the small subunit ribosomal RNA (16S) tool to infer bacterial phylogenies. Phylogenetic hypotheses based on other sequences usually give conflicting topologies that reveal different evolutionary histories, which in some cases may be the result of horizontal gene transfer events. Currently, one of the major goals of molecular biology is to understand the role that horizontal gene transfer plays in species adaptation and evolution. In this work, we compared the phylogenetic tree based on 16S with the tree based on dszC, a gene involved in the cleavage of carbon-sulfur bonds. Bacteria of several genera perform this survival task when living in environments lacking free mineral sulfur. The biochemical pathway of the desulphurization process was extensively studied due to its economic importance, since this step is expensive and indispensable in fuel production. Our results clearly show that horizontal gene transfer events could be detected using common phylogenetic methods with gene sequences obtained from public sequence databases. PMID:22675653

  4. Myeloprotection by Cytidine Deaminase Gene Transfer in Antileukemic Therapy

    Directory of Open Access Journals (Sweden)

    Nico Lachmann

    2013-03-01

    Full Text Available Gene transfer of drug resistance (CTX-R genes can be used to protect the hematopoietic system from the toxicity of anticancer chemotherapy and this concept recently has been proven by overexpression of a mutant O6-methylguaninemethyltransferase in the hematopoietic system of glioblastoma patients treated with temozolomide. Given its protection capacity against such relevant drugs as cytosine arabinoside (ara-C, gemcitabine, decitabine, or azacytidine and the highly hematopoiesis-specific toxicity profile of several of these agents, cytidine deaminase (CDD represents another interesting candidate CTX-R gene and our group recently has established the myeloprotective capacity of CDD gene transfer in a number of murine transplant studies. Clinically, CDD overexpression appears particularly suited to optimize treatment strategies for acute leukemias and myelodysplasias given the efficacy of ara-C (and to a lesser degree decitabine and azacytidine in these disease entities. This article will review the current state of the art with regard to CDD gene transfer and point out potential scenarios for a clinical application of this strategy. In addition, risks and potential side effects associated with this approach as well as strategies to overcome these problems will be highlighted.

  5. Endosymbiotic gene transfer from prokaryotic pangenomes: Inherited chimerism in eukaryotes.

    Science.gov (United States)

    Ku, Chuan; Nelson-Sathi, Shijulal; Roettger, Mayo; Garg, Sriram; Hazkani-Covo, Einat; Martin, William F

    2015-08-18

    Endosymbiotic theory in eukaryotic-cell evolution rests upon a foundation of three cornerstone partners--the plastid (a cyanobacterium), the mitochondrion (a proteobacterium), and its host (an archaeon)--and carries a corollary that, over time, the majority of genes once present in the organelle genomes were relinquished to the chromosomes of the host (endosymbiotic gene transfer). However, notwithstanding eukaryote-specific gene inventions, single-gene phylogenies have never traced eukaryotic genes to three single prokaryotic sources, an issue that hinges crucially upon factors influencing phylogenetic inference. In the age of genomes, single-gene trees, once used to test the predictions of endosymbiotic theory, now spawn new theories that stand to eventually replace endosymbiotic theory with descriptive, gene tree-based variants featuring supernumerary symbionts: prokaryotic partners distinct from the cornerstone trio and whose existence is inferred solely from single-gene trees. We reason that the endosymbiotic ancestors of mitochondria and chloroplasts brought into the eukaryotic--and plant and algal--lineage a genome-sized sample of genes from the proteobacterial and cyanobacterial pangenomes of their respective day and that, even if molecular phylogeny were artifact-free, sampling prokaryotic pangenomes through endosymbiotic gene transfer would lead to inherited chimerism. Recombination in prokaryotes (transduction, conjugation, transformation) differs from recombination in eukaryotes (sex). Prokaryotic recombination leads to pangenomes, and eukaryotic recombination leads to vertical inheritance. Viewed from the perspective of endosymbiotic theory, the critical transition at the eukaryote origin that allowed escape from Muller's ratchet--the origin of eukaryotic recombination, or sex--might have required surprisingly little evolutionary innovation.

  6. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... Full Length Research Paper. Cloning and characterization of ATP ... that atpA gene from sweet potato has high homology with the other plant chloroplast atpA. The transcript levels of the atpA gene in ..... from spinach chloroplasts primary structure deduced from the cloned. cDNA sequence. FEBS J. 232: ...

  7. Isolation of 1-aminocyclopropane-1-carboxylate synthase gene from Oncidium Gower Ramsey.

    Science.gov (United States)

    Yang, G H; Liu, J P

    2014-10-20

    A full-length cDNA of a 1-aminocyclopropane-1-carboxylate synthase (ACS) family member from Oncidium, named OnACS1 (GenBank accession No. JQ822087) was cloned and characterized by reverse transcription polymerase chain reaction and rapid amplification of cDNA ends technology. The full-length cDNA was 1586 bp, including a 1308-bp open reading frame, a 105-bp 5' untranslated region (UTR), and 173-bp 3' UTR, encoding 436 amino acids. The deduced amino acid sequence of OnACS1 shares 85, 84, and 83% homology with ACS proteins of Cattleya bicolor, Dendrobium crumenatum, and Phalaenopsis hybrid, respectively. Prokaryotic expression and sodium dodecyl sulfate polyacrylamide gel electrophoresis showed that a specific band was produced and was consistent with the predicted protein size. A tissue-specific manner of OnACS1 expression was observed, and it was predominantly expressed in the gynostemium. The OnACS1 expression in the sepals and gynandria was upregulated by 1% ethephon treatment.

  8. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  9. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  10. In silico identification and analysis of phytoene synthase genes in plants.

    Science.gov (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  11. Immunotherapy of Malignancy by in vivo Gene Transfer into Tumors

    Science.gov (United States)

    Plautz, Gregory E.; Yang, Zhi-Yong; Wu, Bei-Yue; Gao, Xiang; Huang, Leaf; Nabel, Gary J.

    1993-05-01

    The immune system confers protection against a variety of pathogens and contributes to the surveillance and destruction of neoplastic cells. Several cell types participate in the recognition and lysis of tumors, and appropriate immune stimulation provides therapeutic effects in malignancy. Foreign major histocompatibility complex (MHC) proteins also serve as a potent stimulus to the immune system. In this report, a foreign MHC gene was introduced directly into malignant tumors in vivo in an effort to stimulate tumor rejection. In contrast to previous attempts to induce tumor immunity by cell-mediated gene transfer, the recombinant gene was introduced directly into tumors in vivo. Expression of the murine class I H-2K^s gene within the CT26 mouse colon adenocarcinoma (H-2K^d) or the MCA 106 fibrosarcoma (H-2K^b) induced a cytotoxic T-cell response to H-2K^s and, more importantly, to other antigens present on unmodified tumor cells. This immune response attenuated tumor growth and caused complete tumor regression in many cases. Direct gene transfer in vivo can therefore induce cell-mediated immunity against specific gene products, which provides an immunotherapeutic effect for malignancy, and potentially can be applied to the treatment of cancer and infectious diseases in man.

  12. Important aspects of placental-specific gene transfer.

    Science.gov (United States)

    Kaufman, Melissa R; Albers, Renee E; Keoni, Chanel; Kulkarni-Datar, Kashmira; Natale, David R; Brown, Thomas L

    2014-10-15

    The placenta is a unique and highly complex organ that develops only during pregnancy and is essential for growth and survival of the developing fetus. The placenta provides the vital exchange of gases and wastes, the necessary nutrients for fetal development, acts as immune barrier that protects against maternal rejection, and produces numerous hormones and growth factors that promote fetal maturity to regulate pregnancy until parturition. Abnormal placental development is a major underlying cause of pregnancy-associated disorders that often result in preterm birth. Defects in placental stem cell propagation, growth, and differentiation are the major factors that affect embryonic and fetal well-being and dramatically increase the risk of pregnancy complications. Understanding the processes that regulate placentation is important in determining the underlying factors behind abnormal placental development. The ability to manipulate genes in a placenta-specific manner provides a unique tool to analyze development and eliminates potentially confounding results that can occur with traditional gene knockouts. Trophoblast stem cells and mouse embryos are not overly amenable to traditional gene transfer techniques. Most viral vectors, however, have a low infection rate and often lead to mosaic transgenesis. Although the traditional method of embryo transfer is intrauterine surgical implantation, the methodology reported here, combining lentiviral blastocyst infection and nonsurgical embryo transfer, leads to highly efficient and placental-specific gene transfer. Numerous advantages of our optimized procedures include increased investigator safety, a reduction in animal stress, rapid and noninvasive embryo transfer, and higher a rate of pregnancy and live birth. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin.

    Science.gov (United States)

    Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan

    2017-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.

  14. Monogalactosyldiacylglycerol: An abundant galactosyllipid of Cirsium brevicaule A. GRAY leaves inhibits the expression of gene encoding fatty acid synthase.

    Science.gov (United States)

    Inafuku, Masashi; Takara, Kensaku; Taira, Naoyuki; Nugara, Ruwani N; Kamiyama, Yasuo; Oku, Hirosuke

    2016-05-15

    The leaves of Cirsium brevicaule A. GRAY (CL) significantly decreased hepatic lipid accumulation and the expression of fatty acid synthase gene (FASN) in mice. We aimed to purify and identify the active compound(s) from CL and determine the inhibitory mechanism of expression of FASN. We purified monogalactosyldiacylglycerol (MGDG) from extracts of CL (CL-MGDG) and showed that it was the active CL component through analyses of its effects on the expression of genes of human breast cancer cell line, SKBR-3. The content and fatty acid composition of CL-MGDG are distinctly different from those of other vegetable-derived MGDGs. Treatment of SKBR-3 cells with MGDG decreased the level of FASN mRNA as well as the levels of mRNA encoding other protein involved in lipogenesis. Further, MGDG treatments significantly inhibited luciferase activities of constructs containing liver X receptor response element in FASN promoter region without altering the levels of mRNA encoding transcription factors. MGDG and the FASN inhibitor C75 decreased the viabilities of SKBR-3 cells in a concentration-dependent manner. CL-MGDG more potently inhibited cell viability than a commercial MGDG preparation. CL represents a good source of glycoglycerolipids with potential as functional ingredients of food. Copyright © 2016 Elsevier GmbH. All rights reserved.

  15. Molecular cloning and expression profiling of a chalcone synthase gene from hairy root cultures of Scutellaria viscidula Bunge

    Directory of Open Access Journals (Sweden)

    Wei Lei

    2010-01-01

    Full Text Available A cDNA encoding chalcone synthase (CHS, the key enzyme in flavonoid biosynthesis, was isolated from hairy root cultures of Scutellaria viscidula Bunge by rapid amplification of cDNA ends (RACE. The full-length cDNA of S. viscidula CHS, designated as Svchs (GenBank accession no. EU386767, was 1649 bp with a 1170 bp open reading frame (ORF that corresponded to a deduced protein of 390 amino acid residues, a calculated molecular mass of 42.56 kDa and a theoretical isoelectric point (pI of 5.79. Multiple sequence alignments showed that SvCHS shared high homology with CHS from other plants. Functional analysis in silico indicated that SvCHS was a hydrophilic protein most likely associated with intermediate metabolism. The active sites of the malonyl-CoA binding motif, coumaroyl pocket and cyclization pocket in CHS of Medicago sativa were also found in SvCHS. Molecular modeling indicated that the secondary structure of SvCHS contained mainly α-helixes and random coils. Phylogenetic analysis showed that SvCHS was most closely related to CHS from Scutellaria baicalensis. In agreement with its function as an elicitor-responsive gene, the expression of Svchs was induced and coordinated by methyl jasmonate. To our knowledge, this is the first report to describe the isolation and expression of a gene from S. viscidula.

  16. A novel mutation in the glycogen synthase 2 gene in a child with glycogen storage disease type 0

    Science.gov (United States)

    2010-01-01

    Background Glycogen storage disease type 0 is an autosomal recessive disease presenting in infancy or early childhood and characterized by ketotic hypoglycemia after prolonged fasting and postprandial hyperglycemia and hyperlactatemia. Sixteen different mutations have been identified to date in the gene which encodes hepatic glycogen synthase, resulting in reduction of glycogen storage in the liver. Case Presentation Biochemical evaluation as well as direct sequencing of exons and exon-intron boundary regions of the GYS2 gene were performed in a patient presenting fasting hypoglycemia and postprandial hyperglycemia and her parents. The patient was found to be compound heterozygous for one previously reported nonsense mutation (c.736 C>T; R243X) and a novel frameshift mutation (966_967delGA/insC) which introduces a stop codon 21 aminoacids downstream from the site of the mutation that presumably leads to loss of 51% of the COOH-terminal part of the protein. The glycemia and lactatemia of the parents after an oral glucose tolerance test were evaluated to investigate a possible impact of the carrier status on the metabolic profile. The mother, who presented a positive family history of type 2 diabetes, was classified as glucose intolerant and the father, who did not exhibit metabolic changes after the glucose overload, had an antecedent history of hypoglycemia after moderate alcohol ingestion. Conclusion The current results expand the spectrum of known mutations in GYS2 and suggest that haploinsufficiency could explain metabolic abnormalities in heterozygous carriers in presence of predisposing conditions. PMID:20051115

  17. RNAi-mediated down-regulation of a melanin polyketide synthase (pks1) gene in the fungus Slafractonia leguminicola.

    Science.gov (United States)

    Alhawatema, Mohammad S; Gebril, Sayed; Cook, Daniel; Creamer, Rebecca

    2017-09-20

    The fungus Slafractonia leguminicola, the causal agent of blackpatch disease of legumes produces two mycotoxins slaframine and swainsonine, causing slobbers' symptoms and locoism of grazing animals, respectively. The genetics of this important fungus is poorly understood. This work aimed to develop a genetic transformation system and evaluate the efficacy of RNA interference (RNAi) in S. leguminicola. In this study, S. leguminicola was transformed using a PEG-mediated method with a fungal construct that carries a hygromycin resistance cassette. To assess the use of RNAi, a silencing construct pSilentPKS1-AS was constructed which includes inverted repeat transgenes of the polyketide synthase gene (pks1) that is involved in melanin biosynthesis. Transformation of S. leguminicola with the IRT pks1 vector decreased pks1 transcripts levels 82-92% in knockdown mutants when compared with the wild type and was accompanied with a reduction in melanin and swainsonine production. These results demonstrate that RNAi can be a useful tool for studying gene function in S. leguminicola.

  18. ALLELE STATUS OF ALDOSTERONE SYNTHASE (CYP11B2 GENE POLYMORPHISM AND CARDIAC REMODELING AFTER ST SEGMENT ELEVATION MYOCARDIAL INFARCTION

    Directory of Open Access Journals (Sweden)

    Petyunina O. V.

    2017-12-01

    Full Text Available Aldosterone plays an important role in the development of reparative and reactive fibrosis and cardiac remodeling (CR after myocardial infarction. The objective of the study is to investigate the structural and functional parameters of the myocardium, heart rate variability (HRV, exercise intolerance, levels of sST2 in association with polymorphism of CYP11B2 gene of aldosterone-synthase in ST-myocardial infarction (STEMI patients during a 6-months follow-up period. 85 STEMI patients were enrolled: 68 (80 % male and 17 (20 % female, mean age was 58,94 ± 10,16 years. Examinations were performed twice: during 1–3 days after PCI with infarct-related artery stenting and included clinical assessment, ultrasound diagnostic, immunofermentative blood analyses (sST2, polymerase chain reaction in real time (polymorphism –T344C of the CYP11B2 gene. After 6-months of observation, 57 patients were reexamined – clinical assessment, ultrasound diagnostic, HRV were performed. CYP11B2 TT-genotype in 6 months after STEMI is associated with a maladaptive character of after infarction remodeling.

  19. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  20. Molecular cloning and expression of squalene synthase and 2,3-oxidosqualene cyclase genes in persimmon (Diospyros kaki L.) fruits.

    Science.gov (United States)

    Zhou, Chunhua; Zhao, Daqiu; Sheng, Yanle; Liang, Guohua; Tao, Jun

    2012-02-01

    Oleanolic acid (OA) and ursolic acid (UA) are the main triterpene acids in persimmon fruit, and squalene synthase and 2,3-oxidosqualene cyclases are important enzymes in pentacyclic triterpene biosynthesis. In order to study their relationship, DkSQS and DkOSC were cloned from persimmon fruits in the present study. The full-length cDNA of DkSQS was 1647 bp, containing an open reading frame (ORF) of 1245 bp that encoded a peptide of 415 amino acids (AA). The 3'-end of DkOSC cDNA fragment contained 522 bp, including a partial ORF of 298 bp, a full poly A tail that encoded 98 AA. Two cultivars of persimmon, i.e. cv. Nishimurawase and cv. Niuxinshi, were used to study the content of OA and UA and the related gene expression. Results showed that OA and UA contents changed in both cultivars during fruit development, the difference in cv. Nishimurawase was greater than that in cv. Niuxinshi. The expression of DkSQS and DkOSC had no obvious correlation with the biosynthesis of OA and UA in the flesh. There may be two main reasons. Firstly, different enzymes involved in the biosynthesis of triterpenes and mutual adjustment were existed in different gene expressions. Secondly, it was not clear that the DkOSC cloned in this research belonged to which subfamily. Therefore, the real relationship between triterpenes and DkSQS and DkOSC in persimmon fruits is still to be revealed.

  1. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    Science.gov (United States)

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  2. Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

    Directory of Open Access Journals (Sweden)

    Michelle F. Valentine

    2017-05-01

    Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

  3. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

    Science.gov (United States)

    Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

    2015-07-28

    Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

  4. Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

    Directory of Open Access Journals (Sweden)

    Khalil Zaynali

    2010-06-01

    Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.

  5. Prevalence of endothelial nitric oxide synthase (eNOS) gene exon 7 Glu298Asp variant in North Eastern India

    Science.gov (United States)

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

    2011-01-01

    Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032

  6. Improving Adenovirus Based Gene Transfer: Strategies to Accomplish Immune Evasion

    Directory of Open Access Journals (Sweden)

    Andrea Amalfitano

    2010-09-01

    Full Text Available Adenovirus (Ad based gene transfer vectors continue to be the platform of choice for an increasing number of clinical trials worldwide. In fact, within the last five years, the number of clinical trials that utilize Ad based vectors has doubled, indicating growing enthusiasm for the numerous positive characteristics of this gene transfer platform. For example, Ad vectors can be easily and relatively inexpensively produced to high titers in a cGMP compliant manner, can be stably stored and transported, and have a broad applicability for a wide range of clinical conditions, including both gene therapy and vaccine applications. Ad vector based gene transfer will become more useful as strategies to counteract innate and/or pre-existing adaptive immune responses to Ads are developed and confirmed to be efficacious. The approaches attempting to overcome these limitations can be divided into two broad categories: pre-emptive immune modulation of the host, and selective modification of the Ad vector itself. The first category of methods includes the use of immunosuppressive drugs or specific compounds to block important immune pathways, which are known to be induced by Ads. The second category comprises several innovative strategies inclusive of: (1 Ad-capsid-display of specific inhibitors or ligands; (2 covalent modifications of the entire Ad vector capsid moiety; (3 the use of tissue specific promoters and local administration routes; (4 the use of genome modified Ads; and (5 the development of chimeric or alternative serotype Ads. This review article will focus on both the promise and the limitations of each of these immune evasion strategies, and in the process delineate future directions in developing safer and more efficacious Ad-based gene transfer strategies.

  7. Improving adenovirus based gene transfer: strategies to accomplish immune evasion.

    Science.gov (United States)

    Seregin, Sergey S; Amalfitano, Andrea

    2010-09-01

    Adenovirus (Ad) based gene transfer vectors continue to be the platform of choice for an increasing number of clinical trials worldwide. In fact, within the last five years, the number of clinical trials that utilize Ad based vectors has doubled, indicating growing enthusiasm for the numerous positive characteristics of this gene transfer platform. For example, Ad vectors can be easily and relatively inexpensively produced to high titers in a cGMP compliant manner, can be stably stored and transported, and have a broad applicability for a wide range of clinical conditions, including both gene therapy and vaccine applications. Ad vector based gene transfer will become more useful as strategies to counteract innate and/or pre-existing adaptive immune responses to Ads are developed and confirmed to be efficacious. The approaches attempting to overcome these limitations can be divided into two broad categories: pre-emptive immune modulation of the host, and selective modification of the Ad vector itself. The first category of methods includes the use of immunosuppressive drugs or specific compounds to block important immune pathways, which are known to be induced by Ads. The second category comprises several innovative strategies inclusive of: (1) Ad-capsid-display of specific inhibitors or ligands; (2) covalent modifications of the entire Ad vector capsid moiety; (3) the use of tissue specific promoters and local administration routes; (4) the use of genome modified Ads; and (5) the development of chimeric or alternative serotype Ads. This review article will focus on both the promise and the limitations of each of these immune evasion strategies, and in the process delineate future directions in developing safer and more efficacious Ad-based gene transfer strategies.

  8. Analysis of carbon source-regulated gene expression by the upstream region of the Candida tropicalis malate synthase gene in Saccharomyces cerevisiae.

    Science.gov (United States)

    Umemura, K; Atomi, H; Izuta, M; Kanai, T; Takeshita, S; Ueda, M; Tanaka, A

    1997-01-03

    We investigated the regulation of expression of a gene encoding malate synthase (MS) of an n-alkane-utilizable yeast Candida tropicalis in the yeast Saccharomyces cerevisiae, where its expression is highly induced by acetate. By comparing levels of gene expression in cells grown on glucose, acetate, lactate, and oleic acid, we found that the increase in gene expression was due to a glucose repression-derepression mechanism. In order to obtain information concerning the regulation of the gene expression, a fusion gene which consists of the 5'-upstream region of MS-2 (UPR-MS-2) and the lacZ gene (encoding Escherichia coli beta-galactosidase), was introduced into S. cerevisiae, and beta-galactosidase activities were measured with cells grown on glucose or acetate. Deletion analysis of UPR-MS-2 revealed that the region between -777 and -448 (against the translation initiation codon) enhanced the level of gene expression in both glucose- and acetate-grown cells. In this region, sequences which resemble binding sites of Rap1p/Grf1p/Tufp, a global transcription activator, were found at seven locations and one was found for another pleiotropic activator Abf1p. The result also suggested the presence of multiple upstream repression sequences (URSs), which function specifically in glucose-grown cells, in the region between -368 and -126. In the repressing region, there were three tandem C(A/T)CTCCC sequences and also a putative binding site of Mig1p, a transcriptional repressor which mediates glucose repression of several other genes. When MIG1 gene of S. cerevisiae was disrupted, the expression of the UPR-MS-2-lacZ gene in glucose-grown cells increased approx. 10-fold. Furthermore, the effect of deletion of a putative Mig1p binding site was abolished in the MIG1-disrupted strain, suggesting Mig1p binds to this site and brings about glucose repression. When the SNF1 gene was disrupted, the high level gene expression observed in acetate-grown cells bearing UPR-MS-2 was

  9. Malate synthase gene expression during fruit ripening of Cavendish banana (Musa acuminata cv. Williams).

    Science.gov (United States)

    Pua, Eng-Chong; Chandramouli, Sumana; Han, Ping; Liu, Pei

    2003-01-01

    Malate synthase (MS) is a key enzyme responsible for malic acid synthesis in the glyoxylate cycle, which functions to convert stored lipids to carbohydrates, by catalysing the glyoxylate condensation reaction with acetyl-CoA in the peroxisome. In this study, the cloning of an MS cDNA, designated MaMS-1, from the banana fruit is reported. MaMS-1 was 1801 bp in length encoding a single polypeptide of 556 amino acid residues. Sequence analysis revealed that MaMS-1 possessed the conserved catalytic domain and a putative peroxisomal targeting signal SK(I/L) at the carboxyl terminal. MaMS-1 also shared an extensive sequence homology (79-81.3%) with other plant MS homologues. Southern analysis indicated that MS might be present as multiple members in the banana genome. In Northern analysis, MaMS-1 was expressed specifically in ripening fruit tissue and transcripts were not detected in other organs such as roots, pseudostem, leaves, ovary, male flower, and in fruit at different stages of development. However, the transcript abundance in fruit was affected by stage of ripening, during which transcript was barely detectable at the early stage of ripening (FG and TY), but the level increased markedly in MG and in other fruits at advanced ripening stages. Furthermore, MaMS-1 expression in FG fruit could be stimulated by treatment with 1 microl l(-1) exogenous ethylene, but the stimulatory effect was abolished by the application of an ethylene inhibitor, norbornadiene. Results of this study clearly show that MS expression in banana fruit is temporally regulated during ripening and is ethylene-inducible.

  10. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips.

    Science.gov (United States)

    Yang, Ting; Stoopen, Geert; Thoen, Manus; Wiegers, Gerrie; Jongsma, Maarten A

    2013-09-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the plastids of chrysanthemum plants (Chrysanthemum morifolium). The volatiles of FaNES1 chrysanthemum leaves were strongly dominated by linalool, but they also emitted small amount of the C11-homoterpene, (3E)-4,8-dimethyl-1,3,7-nonatriene, a derivative of nerolidol. Four nonvolatile linalool glycosides in methanolic extracts were found to be significantly increased in the leaves of FaNES1 plants compared to wild-type plants. They were putatively identified by LC-MS-MS as two linalool-malonyl-hexoses, a linalool-pentose-hexose and a glycoside of hydroxy-linalool. A leaf-disc dual-choice assay with western flower thrips (WFT, Frankliniella occidentalis) showed, initially during the first 15 min of WFT release, that FaNES1 plants were significantly preferred. This gradually reversed into significant preference for the control, however, at 20-28 h after WFT release. The initial preference was shown to be based on the linalool odour of FaNES1 plants by olfactory dual-choice assays using paper discs emitting pure linalool at similar rates as leaf discs. The reversal of preference into deterrence could be explained by the initial nonvolatile composition of the FaNES1 plants, as methanolic extracts were less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  11. Can Viruses be Modified to Achieve Sustained Gene Transfer?

    Directory of Open Access Journals (Sweden)

    Hildegund CJ Ertl

    2011-07-01

    Full Text Available It is very easy to replace a faulty gene in an immunocompromised mouse. First, one takes a well-characterized virus, such as an adenovirus or an adeno-associated virus, and incorporates the correct version of the faulty gene together with some regulatory sequences into the genome. Then, one transduces the recombinant genome into helper cells, which will add the viral capsid. At last, one injects the resulting viral vector into the sick mouse, and the mouse is cured. It is not that easy in an immunocompetent mouse, let alone in a human, as over the eons the immune system evolved to eliminate viruses regardless if they penetrate as dangerous pathogens or are injected by a well-meaning gene therapist. Here we offer our perspective on the potential of how viral vectors achieve sustained gene transfer in the face of a hostile immune system.

  12. Characterization of an ancient lepidopteran lateral gene transfer.

    Directory of Open Access Journals (Sweden)

    David Wheeler

    Full Text Available Bacteria to eukaryote lateral gene transfers (LGT are an important potential source of material for the evolution of novel genetic traits. The explosion in the number of newly sequenced genomes provides opportunities to identify and characterize examples of these lateral gene transfer events, and to assess their role in the evolution of new genes. In this paper, we describe an ancient lepidopteran LGT of a glycosyl hydrolase family 31 gene (GH31 from an Enterococcus bacteria. PCR amplification between the LGT and a flanking insect gene confirmed that the GH31 was integrated into the Bombyx mori genome and was not a result of an assembly error. Database searches in combination with degenerate PCR on a panel of 7 lepidopteran families confirmed that the GH31 LGT event occurred deep within the Order approximately 65-145 million years ago. The most basal species in which the LGT was found is Plutella xylostella (superfamily: Yponomeutoidea. Array data from Bombyx mori shows that GH31 is expressed, and low dN/dS ratios indicates the LGT coding sequence is under strong stabilizing selection. These findings provide further support for the proposition that bacterial LGTs are relatively common in insects and likely to be an underappreciated source of adaptive genetic material.

  13. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    International Nuclear Information System (INIS)

    Soliman, S.E.T.; Zaater, M.K.

    2010-01-01

    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  14. [Research progress in sperm mediated gene transfer technology].

    Science.gov (United States)

    Hao, Xiaoxiong; Zhu, Zheng; Cao, Mianfu; Li, Chengren; Lin, Yunlai

    2013-04-01

    With the rapid development of biotechnology, we can change the trait of organism using transgenetic technology. In recent years, there are growing interests in the establishment of sperm mediated gene transfer (SMGT) technology as an effective and convenient method to produce transgenic animals. SMGT technology is a transgenetic method, which is easy in operation and does little harm to the cell compared with the other transgenetic methods. In this review, we expound the background, development, mechanism, operation and application of SMGT.

  15. Phylogeny reconstruction in the Caesalpinieae grade (Leguminosae) based on duplicated copies of the sucrose synthase gene and plastid markers.

    Science.gov (United States)

    Manzanilla, Vincent; Bruneau, Anne

    2012-10-01

    The Caesalpinieae grade (Leguminosae) forms a morphologically and ecologically diverse group of mostly tropical tree species with a complex evolutionary history. This grade comprises several distinct lineages, but the exact delimitation of the group relative to subfamily Mimosoideae and other members of subfamily Caesalpinioideae, as well as phylogenetic relationships among the lineages are uncertain. With the aim of better resolving phylogenetic relationships within the Caesalpinieae grade, we investigated the utility of several nuclear markers developed from genomic studies in the Papilionoideae. We cloned and sequenced the low copy nuclear gene sucrose synthase (SUSY) and combined the data with plastid trnL and matK sequences. SUSY has two paralogs in the Caesalpinieae grade and in the Mimosoideae, but occurs as a single copy in all other legumes tested. Bayesian and maximum likelihood phylogenetic analyses suggest the two nuclear markers are congruent with plastid DNA data. The Caesalpinieae grade is divided into four well-supported clades (Cassia, Caesalpinia, Tachigali and Peltophorum clades), a poorly supported clade of Dimorphandra Group genera, and two paraphyletic groups, one with other Dimorphandra Group genera and the other comprising genera previously recognized as the Umtiza clade. A selection analysis of the paralogs, using selection models from PAML, suggests that SUSY genes are subjected to a purifying selection. One of the SUSY paralogs, under slightly stronger positive selection, may be undergoing subfunctionalization. The low copy SUSY gene is useful for phylogeny reconstruction in the Caesalpinieae despite the presence of duplicate copies. This study confirms that the Caesalpinieae grade is an artificial group, and highlights the need for further analyses of lineages at the base of the Mimosoideae. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Expression Profiles of the Trehalose-6-Phosphate Synthase Gene Associated With Thermal Stress in Ostrinia furnacalis (Lepidoptera: Crambidae)

    Science.gov (United States)

    Jin, Tingting; Gao, Yulin; He, Kanglai

    2018-01-01

    Abstract Trehalose is the major blood sugar in insects. Physiological significance of this compound has been extensively reported. Trehalose-6-phosphate synthase (TPS) is an important enzyme in the trehalose biosynthesis pathway. Full-length cDNAs of TPS (Of tps) and its alternative splicing isoform (Of tps_isoformI) were cloned from the Asian corn borer (ACB), Ostrinia furnacalis (Guenée; Lepidoptera: Crambidae) larvae. The Of tps and Of tps_isoformI transcripts were 2913 and 1689 bp long, contained 2529 and 1293 bp open reading frames encoding proteins of 842 and 430 amino acids with a molecular mass of 94.4 and 48.6 kDa, respectively. Transcriptional profiling and response to thermal stress of Of tps gene were determined by quantitative real-time PCR showing that the Of tps was predominantly expressed in the larval fat body, significantly enhanced during molting and transformation; and thermal stress also induced Of tps expression. Gene structure analysis is indicating that one TPS domain and one trehalose-6-phosphate phosphatase (TPP) domain were located at the N- and C-termini of Of        TPS, respectively, while only the TPS domain was detected in OfTPS_isoformI. Three-dimensional modeling and heterologous expression were developed to predict the putative functions of OfTPS and Of   TPS_isoformI. We infer that the expression of Of tps gene is thermally induced and might be crucial for larvae survival.

  17. Characterization of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS) gene from Ginkgo biloba.

    Science.gov (United States)

    Kim, Sang-Min; Kim, Soo-Un

    2010-02-01

    Diterpene trilactone ginkgolides, one of the major constituents of Ginkgo biloba extract, have shown interesting bioactivities including platelet-activating factor antagonistic activity. 1-Hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase (HDS), converting 2-C-methyl-d-erythritol-2,4-cyclodiphosphate into 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate, is the penultimate enzyme of the seven-step 2-C-methyl-d-erythritol 4-phosphate pathway that supplies building blocks for plant isoprenoids of plastid origin such as ginkgolides and carotenoids. Here, we report on the isolation and characterization of the full-length cDNA encoding HDS (GbHDS, GenBank accession number: DQ251630) from G. biloba. Full-length cDNA of GbHDS, 2,763 bp long, contained an ORF of 2,226 bp encoding a protein composed of 741 amino acids. The theoretical molecular weight and pI of the deduced mature GbHDS of 679 amino acid residues are 75.6 kDa and 5.5, respectively. From 2 weeks after initiation of the culture onward, transcription level of this gene in the ginkgo embryo roots increased to about two times higher than that in the leaves. GbHDS was predicted to possess chloroplast transit peptide of 62 amino acid residues, suggesting its putative localization in the plastids. The transient gene expression in Arabidopsis protoplasts confirmed that the transit peptide was capable of delivering the GbHDS protein from the cytosol into the chloroplasts. The isolation and characterization of GbHDS gene enabled us to further understand the role of GbHDS in the terpenoid biosynthesis in G. biloba.

  18. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Olga Y. Yurkevich

    2017-08-01

    Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  19. Differences in lateral gene transfer in hypersaline versus thermal environments.

    Science.gov (United States)

    Rhodes, Matthew E; Spear, John R; Oren, Aharon; House, Christopher H

    2011-07-08

    The role of lateral gene transfer (LGT) in the evolution of microorganisms is only beginning to be understood. While most LGT events occur between closely related individuals, inter-phylum and inter-domain LGT events are not uncommon. These distant transfer events offer potentially greater fitness advantages and it is for this reason that these "long distance" LGT events may have significantly impacted the evolution of microbes. One mechanism driving distant LGT events is microbial transformation. Theoretically, transformative events can occur between any two species provided that the DNA of one enters the habitat of the other. Two categories of microorganisms that are well-known for LGT are the thermophiles and halophiles. We identified potential inter-class LGT events into both a thermophilic class of Archaea (Thermoprotei) and a halophilic class of Archaea (Halobacteria). We then categorized these LGT genes as originating in thermophiles and halophiles respectively. While more than 68% of transfer events into Thermoprotei taxa originated in other thermophiles, less than 11% of transfer events into Halobacteria taxa originated in other halophiles. Our results suggest that there is a fundamental difference between LGT in thermophiles and halophiles. We theorize that the difference lies in the different natures of the environments. While DNA degrades rapidly in thermal environments due to temperature-driven denaturization, hypersaline environments are adept at preserving DNA. Furthermore, most hypersaline environments, as topographical minima, are natural collectors of cellular debris. Thus halophiles would in theory be exposed to a greater diversity and quantity of extracellular DNA than thermophiles.

  20. Selective Gene Transfer to the Retina Using Intravitreal Ultrasound Irradiation

    Directory of Open Access Journals (Sweden)

    Shozo Sonoda

    2012-01-01

    Full Text Available This paper aims to evaluate the efficacy of intravitreal ultrasound (US irradiation for green fluorescent protein (GFP plasmid transfer into the rabbit retina using a miniature US transducer. Intravitreal US irradiation was performed by a slight modification of the transconjunctival sutureless vitrectomy system utilizing a small probe. After vitrectomy, the US probe was inserted through a scleral incision. A mixture of GFP plasmid (50 μL and bubble liposomes (BLs; 50 μL was injected into the vitreous cavity, and US was generated to the retina using a SonoPore 4000. The control group was not exposed to US. After 72 h, the gene-transfer efficiency was quantified by counting the number of GFP-positive cells. The retinas that received plasmid, BL, and US showed a significant increase in the number (average ± SEM of GFP-positive cells (32±4.9; n=7; P<0.01 . No GFP-positive cells were observed in the control eyes (n=7. Intravitreal retinal US irradiation can transfer the GFP plasmid into the retina without causing any apparent damage. This procedure could be used to transfer genes and drugs directly to the retina and therefore has potential therapeutic value.

  1. Cloning and characterization of homeologous cellulose synthase catalytic subunit 2 genes from allotetraploid cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Kim, Hee Jin; Triplett, Barbara A; Zhang, Hong-Bin; Lee, Mi-Kyung; Hinchliffe, Doug J; Li, Ping; Fang, David D

    2012-02-25

    Cellulose synthase catalytic subunits (CesAs) are the catalytic sites within a multisubunit complex for cellulose biosynthesis in plants. CesAs have been extensively studied in diploid plants, but are not well characterized in polyploid plants. Gossypium hirsutum is an allotetraploid cotton species producing over 90% of the world's cotton fibers. Although G. hirsutum CesAs (GhCesAs) are responsible for cellulose production in cotton fiber, very limited numbers of GhCesA genes have been identified. Here, we report isolating and characterizing a pair of homeologous CesA2 genes and their full-length cDNAs from allotetraploid cotton. The GhCesA2-A(T) gene from the A-subgenome and GhCesA2-D(T) gene from the D-subgenome were screened from a G. hirsutum BAC library. These genes shared 92% sequence similarity throughout the entire sequence. The coding sequences were nearly identical, and the deduced amino acid sequences from GhCesA2-A(T) (1,039 amino acids) and GhCesA2-D(T) (1,040 amino acids) were identical except four amino acids, whereas the noncoding sequences showed divergence. Sequence analyses showed that all exons of GhCesA2-A(T) contained consensus splice donor dinucleotides, but one exon in GhCesA2-D(T) contained nonconsensus splice donor dinucleotides. Although the nonconsensus splice donor dinucleotides were previously suggested to be involved in alternative splice or pseudogenization, our results showed that a majority of GhCesA2-A(T) and GhCesA2-D(T) transcripts consisted of functional and full-length transcripts with little evidence for alternative mRNA isoforms in developing cotton fibers. Expression analyses showed that GhCesA2-A(T) and GhCesA2-D(T) shared common temporal and spatial expression patterns, and they were highly and preferentially expressed during the cellulose biosynthesis stage in developing cotton fibers. The observations of higher expression levels of both GhCesA2-A(T) and GhCesA2-D(T) in developing fibers of one near-isogenic line (NIL

  2. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

  3. Novel description of aldosterone synthase CYP11B2 -344 T>C gene ...

    African Journals Online (AJOL)

    This is a report on population genetics of -344 T>C polymorphism in Amerindians for the first time. The aim was to establish the frequency of this polymorphism present in the 5' promoter region of the CYP11B2 gene in Amerindian (Mayans, Mixtecos, and Teenek) and Mestizo populations from Mexico. It has been associated ...

  4. Dynamic monitoring of horizontal gene transfer in soil

    Science.gov (United States)

    Cheng, H. Y.; Masiello, C. A.; Silberg, J. J.; Bennett, G. N.

    2015-12-01

    Soil microbial gene expression underlies microbial behaviors (phenotypes) central to many aspects of C, N, and H2O cycling. However, continuous monitoring of microbial gene expression in soils is challenging because genetically-encoded reporter proteins widely used in the lab are difficult to deploy in soil matrices: for example, green fluorescent protein cannot be easily visualized in soils, even in the lab. To address this problem we have developed a reporter protein that releases small volatile gases. Here, we applied this gas reporter in a proof-of-concept soil experiment, monitoring horizontal gene transfer, a microbial activity that alters microbial genotypes and phenotypes. Horizontal gene transfer is central to bacterial evolution and adaptation and is relevant to problems such as the spread of antibiotic resistance, increasing metal tolerance in superfund sites, and bioremediation capability of bacterial consortia. This process is likely to be impacted by a number of matrix properties not well-represented in the petri dish, such as microscale variations in water, nutrients, and O2, making petri-dish experiments a poor proxy for environmental processes. We built a conjugation system using synthetic biology to demonstrate the use of gas-reporting biosensors in safe, lab-based biogeochemistry experiments, and here we report the use of these sensors to monitor horizontal gene transfer in soils. Our system is based on the F-plasmid conjugation in Escherichia coli. We have found that the gas signal reports on the number of cells that acquire F-plasmids (transconjugants) in a loamy Alfisol collected from Kellogg Biological Station. We will report how a gas signal generated by transconjugants varies with the number of F-plasmid donor and acceptor cells seeded in a soil, soil moisture, and soil O2 levels.

  5. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

    Science.gov (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

    2017-12-01

    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  6. Radiation improves gene transfer into human ovarian carcinoma cells

    International Nuclear Information System (INIS)

    Canaday, Daniel; Zeng Ming; Cerniglia, George; Stevens, Craig W.

    1997-01-01

    Purpose/Objective: Poor gene transfer is the major stumbling block to successful gene therapy today. We hypothesized that ionizing radiation might activate cellular recombination, and so improve stable gene transfer. During studies to quantitate radiation activated recombination, we also found that both plasmid and adenoviral vector transduction could be increased by irradiation. The studies presented here describe the effects of irradiation on gene transduction efficiency (both transient and stable transduction) in several human ovarian carcinoma lines, as a prelude to in vivo animal studies. Materials and Methods: The effect of irradiation on stable gene transfer efficiency was determined in human ovarian carcinoma cell lines (SKOV3, CAOV3 and PA1). Either irradiated or unirradiated cells were transfected with pRSVZ plasmid (containing a LacZ expression cassette) in either the supercoiled and linearized (XmnI) forms and β-galactosidase expression followed with time. Transfection efficiency was measured by flow cytometry following FDG staining at 0, 48, and 96 hours after irradiation. FDG is converted to a fluorescent metabolite by LacZ, and thus reflects the transfection efficiency of the LacZ containing vector. Vector quantitation was also performed by southern hybridization. Stable transduction efficiency was measured 14 -35 days after irradiation. Optimization of the time of irradiation with respect to transfection was performed. Since cells demonstrated increased stable recombination for as long as 96 hours after irradiation, continuous low dose rate and multiple radiation fractions were also tested. These experiments were repeated using the Ad5CMVlacZ. Dividing cells were exposed to Ad5CMVlacZ at an MOI of 0.1,1,5,10 and 100 to determine optimum transfection concentration. Transduction efficiency was again measured at various intervals to determine the radiation dose and interval post transfection which provides the maximum increase in transfection

  7. Horizontal Gene Transfer Contributes to the Evolution of Arthropod Herbivory.

    Science.gov (United States)

    Wybouw, Nicky; Pauchet, Yannick; Heckel, David G; Van Leeuwen, Thomas

    2016-06-27

    Within animals, evolutionary transition toward herbivory is severely limited by the hostile characteristics of plants. Arthropods have nonetheless counteracted many nutritional and defensive barriers imposed by plants and are currently considered as the most successful animal herbivores in terrestrial ecosystems. We gather a body of evidence showing that genomes of various plant feeding insects and mites possess genes whose presence can only be explained by horizontal gene transfer (HGT). HGT is the asexual transmission of genetic information between reproductively isolated species. Although HGT is known to have great adaptive significance in prokaryotes, its impact on eukaryotic evolution remains obscure. Here, we show that laterally transferred genes into arthropods underpin many adaptations to phytophagy, including efficient assimilation and detoxification of plant produced metabolites. Horizontally acquired genes and the traits they encode often functionally diversify within arthropod recipients, enabling the colonization of more host plant species and organs. We demonstrate that HGT can drive metazoan evolution by uncovering its prominent role in the adaptations of arthropods to exploit plants. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Haplotype analysis of the germacrene A synthase gene and association with cynaropicrin content and biological activities in Cynara cardunculus.

    Science.gov (United States)

    Ferro, Ana Margarida; Ramos, Patrícia; Guerra, Ângela; Parreira, Paula; Brás, Teresa; Guerreiro, Olinda; Jerónimo, Eliana; Capel, Carmen; Capel, Juan; Yuste-Lisbona, Fernando J; Duarte, Maria F; Lozano, Rafael; Oliveira, M Margarida; Gonçalves, Sónia

    2018-04-01

    Cynara cardunculus: L. represents a natural source of terpenic compounds, with the predominant molecule being cynaropicrin. Cynaropicrin is gaining interest since it has been correlated to anti-hyperlipidaemia, antispasmodic and cytotoxicity activity against leukocyte cancer cells. The objective of this work was to screen a collection of C. cardunculus, from different origins, for new allelic variants in germacrene A synthase (GAS) gene involved in the cynaropicrin biosynthesis and correlate them with improved cynaropicrin content and biological activities. Using high-resolution melting, nine haplotypes were identified. The putative impact of the identified allelic variants in GAS protein was evaluated by bioinformatic tools and polymorphisms that putatively lead to protein conformational changes were described. Additionally, cynaropicrin and main pentacyclic triterpenes contents, and antithrombin, antimicrobial and antiproliferative activities were also determined in C. cardunculus leaf lipophilic-derived extracts. In this work we identified allelic variants with putative impact on GAS protein, which are significantly associated with cynaropicrin content and antiproliferative activity. The results obtained suggest that the identified polymorphisms should be explored as putative genetic markers correlated with biological properties in Cynara cardunculus.

  9. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    Science.gov (United States)

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  10. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    Science.gov (United States)

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  11. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review)

    OpenAIRE

    Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.

    2017-01-01

    Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...

  12. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  13. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    Science.gov (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  14. A novel mutation in the glycogen synthase 2 gene in a child with glycogen storage disease type 0

    Directory of Open Access Journals (Sweden)

    Pereira Maria

    2010-01-01

    Full Text Available Abstract Background Glycogen storage disease type 0 is an autosomal recessive disease presenting in infancy or early childhood and characterized by ketotic hypoglycemia after prolonged fasting and postprandial hyperglycemia and hyperlactatemia. Sixteen different mutations have been identified to date in the gene which encodes hepatic glycogen synthase, resulting in reduction of glycogen storage in the liver. Case Presentation Biochemical evaluation as well as direct sequencing of exons and exon-intron boundary regions of the GYS2 gene were performed in a patient presenting fasting hypoglycemia and postprandial hyperglycemia and her parents. The patient was found to be compound heterozygous for one previously reported nonsense mutation (c.736 C>T; R243X and a novel frameshift mutation (966_967delGA/insC which introduces a stop codon 21 aminoacids downstream from the site of the mutation that presumably leads to loss of 51% of the COOH-terminal part of the protein. The glycemia and lactatemia of the parents after an oral glucose tolerance test were evaluated to investigate a possible impact of the carrier status on the metabolic profile. The mother, who presented a positive family history of type 2 diabetes, was classified as glucose intolerant and the father, who did not exhibit metabolic changes after the glucose overload, had an antecedent history of hypoglycemia after moderate alcohol ingestion. Conclusion The current results expand the spectrum of known mutations in GYS2 and suggest that haploinsufficiency could explain metabolic abnormalities in heterozygous carriers in presence of predisposing conditions.

  15. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  16. Simultaneous substitution of Gly96 to Ala and Ala183 to Thr in 5-enolpyruvylshikimate-3-phosphate synthase gene of E. coli (k12) and transformation of rapeseed (Brassica napus L.) in order to make tolerance to glyphosate.

    Science.gov (United States)

    Kahrizi, Danial; Salmanian, Ali Hatef; Afshari, Afsoon; Moieni, Ahmad; Mousavi, Amir

    2007-01-01

    Glyphosate is a non-selective broad-spectrum herbicide that inhibits 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). This is a key enzyme in the aromatic amino acid biosynthesis pathway of microorganisms and plants. The manipulation of bacterial EPSPS gene in order to reduce its affinity for glyphosate, followed by its transfer to plants is one of the most effective approaches for the production of glyphosate-tolerant plants. In this study, we chose to focus on amino acid residues glycine96 and alanine183 of the E. coli (k12) EPSPS enzyme. These two amino acids are important residues for glyphosate binding. We used site directed mutagenesis (SDM) to induce point mutations in the E. coli EPSPS gene, in order to convert glycine96 to alanine (Gly96Ala) and alanine183 to threonine (Ala183Thr). After confirming the mutation by sequencing, the altered EPSPS gene was transferred to rapeseed (Brassica napus L.) via Agrobacterium-mediated transformation. The transformed explants were screened in shoot induction medium containing 25 mg L-1 kanamycin. Glyphosate tolerance was assayed in putative transgenic plants. Statistical analysis of data showed that there was a significant difference between the transgenic and control plants. It was observed that transgenic plants were resistant to glyphosate at a concentration of 10 mM whereas the non-transformed control plants were unable to survive 1 mM glyphosate. The presence and copy numbers of the transgene were confirmed with PCR and Southern blotting analysis, respectively.

  17. Characterization of the Granule-Bound Starch Synthase I Gene in Chenopodium

    Directory of Open Access Journals (Sweden)

    Douglass C. Brown

    2015-03-01

    Full Text Available L. is a relatively under-studied genus that includes the cultivated seed crop quinoa ( Willd.. Quinoa is an allotetraploid (2 = 4 = 36, AABB genomes that is cultivated by subsistence farmers and commercial growers in the Andean regions of South America. Approximately 60% of a quinoa seed is starch, a glucose polymer that is an important carbohydrate energy source in the human diet. Seed starch is normally composed of amylose and amylopectin in a 1:3 ratio. The accumulation of the amylose fraction of starch is controlled by a single dominant gene in quinoa, . We report the sequencing and characterization of the gene in 18 accessions of , including Andean quinoa and the related Mesoamerican chenopod domesticate, subsp. Saff. Two distinct homeologs ( and were identified in the tetraploid accessions, and 19 different alleles were identified, including three null mutants—one in an accession of quinoa and two in a waxy landrace of subsp. . Expression analysis of the null mutants revealed that and were both strongly expressed late in seed development. sequences were used to analyze the phylogenetic relationships between quinoa and other members of the genus. This study and the discovery of null-mutants will assist in the development of new crops with novel starches.

  18. Gene ontology based transfer learning for protein subcellular localization

    Directory of Open Access Journals (Sweden)

    Zhou Shuigeng

    2011-02-01

    Full Text Available Abstract Background Prediction of protein subcellular localization generally involves many complex factors, and using only one or two aspects of data information may not tell the true story. For this reason, some recent predictive models are deliberately designed to integrate multiple heterogeneous data sources for exploiting multi-aspect protein feature information. Gene ontology, hereinafter referred to as GO, uses a controlled vocabulary to depict biological molecules or gene products in terms of biological process, molecular function and cellular component. With the rapid expansion of annotated protein sequences, gene ontology has become a general protein feature that can be used to construct predictive models in computational biology. Existing models generally either concatenated the GO terms into a flat binary vector or applied majority-vote based ensemble learning for protein subcellular localization, both of which can not estimate the individual discriminative abilities of the three aspects of gene ontology. Results In this paper, we propose a Gene Ontology Based Transfer Learning Model (GO-TLM for large-scale protein subcellular localization. The model transfers the signature-based homologous GO terms to the target proteins, and further constructs a reliable learning system to reduce the adverse affect of the potential false GO terms that are resulted from evolutionary divergence. We derive three GO kernels from the three aspects of gene ontology to measure the GO similarity of two proteins, and derive two other spectrum kernels to measure the similarity of two protein sequences. We use simple non-parametric cross validation to explicitly weigh the discriminative abilities of the five kernels, such that the time & space computational complexities are greatly reduced when compared to the complicated semi-definite programming and semi-indefinite linear programming. The five kernels are then linearly merged into one single kernel for

  19. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  20. Differences in lateral gene transfer in hypersaline versus thermal environments

    Directory of Open Access Journals (Sweden)

    House Christopher H

    2011-07-01

    Full Text Available Abstract Background The role of lateral gene transfer (LGT in the evolution of microorganisms is only beginning to be understood. While most LGT events occur between closely related individuals, inter-phylum and inter-domain LGT events are not uncommon. These distant transfer events offer potentially greater fitness advantages and it is for this reason that these "long distance" LGT events may have significantly impacted the evolution of microbes. One mechanism driving distant LGT events is microbial transformation. Theoretically, transformative events can occur between any two species provided that the DNA of one enters the habitat of the other. Two categories of microorganisms that are well-known for LGT are the thermophiles and halophiles. Results We identified potential inter-class LGT events into both a thermophilic class of Archaea (Thermoprotei and a halophilic class of Archaea (Halobacteria. We then categorized these LGT genes as originating in thermophiles and halophiles respectively. While more than 68% of transfer events into Thermoprotei taxa originated in other thermophiles, less than 11% of transfer events into Halobacteria taxa originated in other halophiles. Conclusions Our results suggest that there is a fundamental difference between LGT in thermophiles and halophiles. We theorize that the difference lies in the different natures of the environments. While DNA degrades rapidly in thermal environments due to temperature-driven denaturization, hypersaline environments are adept at preserving DNA. Furthermore, most hypersaline environments, as topographical minima, are natural collectors of cellular debris. Thus halophiles would in theory be exposed to a greater diversity and quantity of extracellular DNA than thermophiles.

  1. The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom.

    Science.gov (United States)

    Chen, Feng; Tholl, Dorothea; Bohlmann, Jörg; Pichersky, Eran

    2011-04-01

    Some plant terpenes such as sterols and carotenes are part of primary metabolism and found essentially in all plants. However, the majority of the terpenes found in plants are classified as 'secondary' compounds, those chemicals whose synthesis has evolved in plants as a result of selection for increased fitness via better adaptation to the local ecological niche of each species. Thousands of such terpenes have been found in the plant kingdom, but each species is capable of synthesizing only a small fraction of this total. In plants, a family of terpene synthases (TPSs) is responsible for the synthesis of the various terpene molecules from two isomeric 5-carbon precursor 'building blocks', leading to 5-carbon isoprene, 10-carbon monoterpenes, 15-carbon sesquiterpenes and 20-carbon diterpenes. The bryophyte Physcomitrella patens has a single TPS gene, copalyl synthase/kaurene synthase (CPS/KS), encoding a bifunctional enzyme producing ent-kaurene, which is a precursor of gibberellins. The genome of the lycophyte Selaginella moellendorffii contains 18 TPS genes, and the genomes of some model angiosperms and gymnosperms contain 40-152 TPS genes, not all of them functional and most of the functional ones having lost activity in either the CPS- or KS-type domains. TPS genes are generally divided into seven clades, with some plant lineages having a majority of their TPS genes in one or two clades, indicating lineage-specific expansion of specific types of genes. Evolutionary plasticity is evident in the TPS family, with closely related enzymes differing in their product profiles, subcellular localization, or the in planta substrates they use. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  2. Simultaneous post-transcriptional gene silencing of two different chalcone synthase genes resulting in pure white flowers in the octoploid dahlia.

    Science.gov (United States)

    Ohno, Sho; Hosokawa, Munetaka; Kojima, Misa; Kitamura, Yoshikuni; Hoshino, Atsushi; Tatsuzawa, Fumi; Doi, Motoaki; Yazawa, Susumu

    2011-11-01

    Garden dahlias (Dahlia variabilis) are autoallooctoploids with redundant genes producing wide color variations in flowers. There are no pure white dahlia cultivars, despite its long breeding history. However, the white areas of bicolor flower petals appear to be pure white. The objective of this experiment was to elucidate the mechanism by which the pure white color is expressed in the petals of some bicolor cultivars. A pigment analysis showed that no flavonoid derivatives were detected in the white areas of petals in a star-type cultivar 'Yuino' and the two seedling cultivars 'OriW1' and 'OriW2' borne from a red-white bicolor cultivar, 'Orihime', indicating that their white areas are pure white. Semi-quantitative RT-PCR showed that in the pure white areas, transcripts of two chalcone synthases (CHS), DvCHS1 and DvCHS2 which share 69% nucleotide similarity with each other, were barely detected. Premature mRNA of DvCHS1 and DvCHS2 were detected, indicating that these two CHS genes are silenced post-transcriptionally. RNA gel blot analysis revealed that small interfering RNAs (siRNAs) derived from CHSs were produced in these pure white areas. By high-throughput sequence analysis of small RNAs in the pure white areas with no mismatch acceptance, small RNAs were mapped to two alleles of DvCHS1 and two alleles of DvCHS2 expressed in 'Yuino' petals. Therefore, we concluded that simultaneous siRNA-mediated post-transcriptional gene silencing of redundant CHS genes results in the appearance of pure white color in dahlias.

  3. Agrobacterium-mediated gene transfer in plants and biosafety considerations.

    Science.gov (United States)

    Mehrotra, Shweta; Goyal, Vinod

    2012-12-01

    Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.

  4. Elastic deformations of the rotary double motor of single F(o)F(1)-ATP synthases detected in real time by Förster resonance energy transfer.

    Science.gov (United States)

    Ernst, Stefan; Düser, Monika G; Zarrabi, Nawid; Dunn, Stanley D; Börsch, Michael

    2012-10-01

    Elastic conformational changes of the protein backbone are essential for catalytic activities of enzymes. To follow relative movements within the protein, Förster-type resonance energy transfer (FRET) between two specifically attached fluorophores can be applied. FRET provides a precise ruler between 3 and 8nm with subnanometer resolution. Corresponding submillisecond time resolution is sufficient to identify conformational changes in FRET time trajectories. Analyzing single enzymes circumvents the need for synchronization of various conformations. F(O)F(1)-ATP synthase is a rotary double motor which catalyzes the synthesis of adenosine triphosphate (ATP). A proton-driven 10-stepped rotary F(O) motor in the Escherichia coli enzyme is connected to a 3-stepped F(1) motor, where ATP is synthesized. To operate the double motor with a mismatch of step sizes smoothly, elastic deformations within the rotor parts have been proposed by W. Junge and coworkers. Here we extend a single-molecule FRET approach to observe both rotary motors simultaneously in individual F(O)F(1)-ATP synthases at work. We labeled this enzyme with two fluorophores specifically, that is, on the ε- and c-subunits of the two rotors. Alternating laser excitation was used to select the FRET-labeled enzymes. FRET changes indicated associated transient twisting within the rotors of single enzyme molecules during ATP hydrolysis and ATP synthesis. Supported by Monte Carlo simulations of the FRET experiments, these studies reveal that the rotor twisting is greater than 36° and is largely suppressed in the presence of the rotation inhibitor DCCD. This article is part of a Special Issue entitled: 17th European Bioenergetics Conference (EBEC 2012). Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    regions and regions of importance for translation, as well as coding sequences of the two genes, were studied using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The genetic analyses were performed in subgroups of 52 Caucasian NIDDM patients and 25 age-matched healthy......To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  6. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    Science.gov (United States)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  7. Laterally Transferred Gene Recruited as a Venom in Parasitoid Wasps.

    Science.gov (United States)

    Martinson, Ellen O; Martinson, Vincent G; Edwards, Rachel; Mrinalini; Werren, John H

    2016-04-01

    Parasitoid wasps use venom to manipulate the immunity and metabolism of their host insects in a variety of ways to provide resources for their offspring. Yet, how genes are recruited and evolve to perform venom functions remain open questions. A recently recognized source of eukaryotic genome innovation is lateral gene transfer (LGT). Glycoside hydrolase family 19 (GH19) chitinases are widespread in bacteria, microsporidia, and plants where they are used in nutrient acquisition or defense, but have previously not been known in metazoans. In this study, a GH19 chitinase LGT is described from the unicellular microsporidia/Rozella clade into parasitoid wasps of the superfamily Chalcidoidea, where it has become recruited as a venom protein. The GH19 chitinase is present in 15 species of chalcidoid wasps representing four families, and phylogenetic analysis indicates that it was laterally transferred near or before the origin of Chalcidoidea (∼95 Ma). The GH19 chitinase gene is highly expressed in the venom gland of at least seven species, indicating a role in the complex host manipulations performed by parasitoid wasp venom. RNAi knockdown in the model parasitoid Nasonia vitripennis reveals that-following envenomation-the GH19 chitinase induces fly hosts to upregulate genes involved in an immune response to fungi. A second, independent LGT of GH19 chitinase from microsporidia into mosquitoes was also found, also supported by phylogenetic reconstructions. Besides these two LGT events, GH19 chitinase is not found in any other sequenced animal genome, or in any fungi outside the microsporidia/Rozella clade. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular damage in hypertensive subjects: an Italian case-control study

    Directory of Open Access Journals (Sweden)

    Pizzo Federica

    2008-05-01

    Full Text Available Abstract Background Nitric oxide (NO synthesized by endothelial nitric oxide synthase (eNOS plays an important role in regulation of endothelial function and in the control of blood pressure. However, the results from some studies on the association between three clinically relevant eNOS gene polymorphisms (G894T, T786C and intron 4b/a and essential hypertension are unclear. We designed a case-control study to evaluate the influence of eNOS polymorphisms on target organ damage in 127 hypertensives and 67 normotensives. Clinical evaluation, biochemical parameters, Urinary Albumin Excretion (UAE and echocardiogram were performed to characterize target organ damage. eNOS polymorphism were recognized by PCR method. Results The distribution of eNOS genotypes was similar in hypertensives and normotensives but 4aa was present in the 2.5% of hypertensives and completely absent in normotensives. Subjects with 4bb, G894T, and T786C genotypes showed an increased prevalence of target organ damage. Moreover prevalence of G894T and introne 4 variants was significantly higher in hypertensives than in normotensives both with cardiovascular damage. Logistic regression analysis didn't show any association between eNOS polymorphisms, Body Mass Index (BMI, hypertension, gender and cardiovascular damage. Only the age (OR 1.11; IC 95% 1.06–1.18 was predictive of cardiovascular damage in our population. Conclusion Our results seem to indicate a lack of association with eNOS variants and cardiovascular damage onset.

  9. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS) Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants.

    Science.gov (United States)

    Fang, Jia; Nan, Peng; Gu, Zongying; Ge, Xiaochun; Feng, Yu-Qi; Lu, Bao-Rong

    2018-01-01

    Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T 2 and T 3 Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium ( CP4 ). For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid) content in transgene-present, transgene-absent, empty vector (EV), and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T 2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T 3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  10. Endothelial nitric oxide synthase gene polymorphisms and risk of erectile dysfunction: An updated meta-analysis of genetic association studies.

    Science.gov (United States)

    Yao, Han-Xin; Ma, Fu-Zhe; Tan, Yu-Ying; Liu, Ling-Yun

    2018-04-11

    Endothelial nitric oxide synthase (eNOS) polymorphisms have been implicated as risk factors for erectile dysfunction (ED), but the results of genetic association studies are inconclusive. We performed a meta-analysis of published studies investigating the association between ED and three eNOS polymorphisms, intron 4 VNTR, G894T and T786C in humans. The PubMed, Web of Science, CNKI and Google Scholar databases were searched for relevant studies published up to November 2017. Association studies with case-control design were included. For each study with genotype information we calculated odds ratios (OR) and 95% confidence intervals (CI). The search identified 13 eligible studies. The G894T and T786C polymorphisms showed a significant association with ED risk in Caucasians (GT + TT versus GG for G894T: OR = 2.13, 95% CI = 1.08-4.19; CC versus CT + TT for T786C: OR = 3.29, 95% CI = 2.30-4.72) and Asians (GT + TT versus GG for G894T: OR = 2.08, 95% CI = 1.53-2.84; CC + CT versus TT for T786C: OR = 3.13, 95% CI = 1.35-7.25). In addition, the intron 4 VNTR polymorphism was associated with ED risk only among Caucasian subjects (aa versus bb + ab: OR = 2.38, 95% CI = 1.15-4.93). We found no evidence of publication bias. The robustness of overall analyses was ensured in sensitivity analyses excluding studies deviating from Hardy-Weinberg equilibrium. Our findings suggest that common genetic polymorphisms in the eNOS gene contribute to risk of ED, presumably by effects on eNOS activity and NO availability. Copyright © 2018. Published by Elsevier Ltd.

  11. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants

    Directory of Open Access Journals (Sweden)

    Jia Fang

    2018-02-01

    Full Text Available Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T2 and T3Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium (CP4. For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid content in transgene-present, transgene-absent, empty vector (EV, and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  12. Gene Transfer Enhancement by Alkylcarboxylation of Poly(propylenimine

    Directory of Open Access Journals (Sweden)

    Maryam Hashemi

    2013-01-01

    Full Text Available Abstract Among synthetic carriers, dendrimers with the more flexible structure have attracted a great deal of researchers’ attention in the field of gene delivery. Followed by the promising results upon hydrophobic modification on polymeric structures in our laboratory, alkylcarboxylated poly (propylenimine-based carriers were synthesized by nucleophilic substitution of amines with alkyl moieties and were further characterized for their physicochemical and biological characteristics for plasmid DNA delivery. Although not noticeably effective gene transfer activity for hexanoate- and hexadecanoate-modified series was observed, but alkylation by decanoic acid significantly improved the transfection efficiency of the final constructs up to 60 fold in comparison with unmodified poly(propylenimine (PPI. PPI modified by 10-bromodecanoic acid at 50% grafting, showed significantly higher gene expression at c/p ratio of 2 compared to Superfect as positive control.  Overall, modification of PPI with 50% primary amines grafting with 10-bromodecanoic acid could increase the transfection efficiency which is occurred at lower c/p ratio when compared to Superfect, i.e. less amount of modified vector is required to exhibit the same efficiency as Superfect. Therefore, the obtained constructs seem to be safer carriers for long-term gene therapy applications.

  13. How the nucleus and mitochondria communicate in energy production during stress: nuclear MtATP6, an early-stress responsive gene, regulates the mitochondrial F₁F₀-ATP synthase complex.

    Science.gov (United States)

    Moghadam, Ali Asghar; Ebrahimie, Eemaeil; Taghavi, Seyed Mohsen; Niazi, Ali; Babgohari, Mahbobeh Zamani; Deihimi, Tahereh; Djavaheri, Mohammad; Ramezani, Amin

    2013-07-01

    A small number of stress-responsive genes, such as those of the mitochondrial F1F0-ATP synthase complex, are encoded by both the nucleus and mitochondria. The regulatory mechanism of these joint products is mysterious. The expression of 6-kDa subunit (MtATP6), a relatively uncharacterized nucleus-encoded subunit of F0 part, was measured during salinity stress in salt-tolerant and salt-sensitive cultivated wheat genotypes, as well as in the wild wheat genotypes, Triticum and Aegilops using qRT-PCR. The MtATP6 expression was suddenly induced 3 h after NaCl treatment in all genotypes, indicating an early inducible stress-responsive behavior. Promoter analysis showed that the MtATP6 promoter includes cis-acting elements such as ABRE, MYC, MYB, GTLs, and W-boxes, suggesting a role for this gene in abscisic acid-mediated signaling, energy metabolism, and stress response. It seems that 6-kDa subunit, as an early response gene and nuclear regulatory factor, translocates to mitochondria and completes the F1F0-ATP synthase complex to enhance ATP production and maintain ion homeostasis under stress conditions. These communications between nucleus and mitochondria are required for inducing mitochondrial responses to stress pathways. Dual targeting of 6-kDa subunit may comprise as a mean of inter-organelle communication and save energy for the cell. Interestingly, MtATP6 showed higher and longer expression in the salt-tolerant wheat and the wild genotypes compared to the salt-sensitive genotype. Apparently, salt-sensitive genotypes have lower ATP production efficiency and weaker energy management than wild genotypes; a stress tolerance mechanism that has not been transferred to cultivated genotypes.

  14. Impact of the Xba1-polymorphism of the human muscle glycogen synthase gene on parameters of the insulin resistance syndrome in a Danish twin population

    DEFF Research Database (Denmark)

    Fenger, M; Poulsen, P; Beck-Nielsen, H

    2000-01-01

    : The Xba1-polymorphism of the human muscle glycogen synthase gene is correlated to insulin resistance and to diastolic blood pressure. The polymorphism does not involve any known transcription factor or any structural change in GYS1, and these correlations are therefore most probably caused by linkage......AIMS: To establish the impact on the insulin resistance syndrome of the intron 14 Xba1-polymorphism in human muscle glycogen synthase (GYS1). METHODS: Parameters related to the insulin resistance syndrome were measured in 244 monozygotic twins and 322 dizygotic twins with or without impaired...... and the remainder had the genotype A1A2. No A2A2-genotypes were detected. In 11 genotypic discordant dizygotic twin pairs the insulin resistance was significantly increased in the twins carrying the A1A2 genotype regardless of sex (HOMA index 1.81 (A1A1) vs. 2.57 (A1A2), P

  15. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  16. Recombinant adenovirus-mediated gene transfer suppresses experimental arthritis

    Directory of Open Access Journals (Sweden)

    E. Quattrocchi

    2011-09-01

    Full Text Available Collagen Induced Arthritis (CIA is a widely studied animal model to develop and test novel therapeutic approaches for treating Rheumatoid Arthritis (RA in humans. Soluble Cytotoxic T-Lymphocyte Antigen 4 (CTLA4-Ig, which binds B7 molecule on antigen presenting cells and blocks CD28 mediated T-lymphocyte activation, has been shown to ameliorate experimental autoimmune diseases such as lupus, diabetes and CIA. Objective of our research was to investigate in vivo the effectiveness of blocking the B7/CD28 T-lymphocyte co-stimulatory pathway, utilizing a gene transfer technology, as a therapeutic strategy against CIA. Replication-deficient adenoviruses encoding a chimeric CTLA4-Ig fusion protein, or β-galactosidase as control, have been injected intravenously once at arthritis onset. Disease activity has been monitored by the assessment of clinical score, paw thickness and type II collagen (CII specific cellular and humoral immune responses for 21 days. The adenovirally delivered CTLA4-Ig fusion protein at a dose of 2×108 pfu suppressed established CIA, whereas the control β-galactosidase did not significantly affect the disease course. CII-specific lymphocyte proliferation, IFNg production and anti-CII antibodies were significantly reduced by CTLA4-Ig treatment. Our results demonstrate that blockade of the B7/CD28 co-stimulatory pathway by adenovirus-mediated CTLA4-Ig gene transfer is effective in treating established CIA suggesting its potential in treating RA.

  17. Resistance gene transfer during treatments for experimental avian colibacillosis.

    Science.gov (United States)

    Dheilly, Alexandra; Le Devendec, Laëtitia; Mourand, Gwenaëlle; Bouder, Axelle; Jouy, Eric; Kempf, Isabelle

    2012-01-01

    An experiment was conducted in animal facilities to compare the impacts of four avian colibacillosis treatments-oxytetracycline (OTC), trimethoprim-sulfadimethoxine (SXT), amoxicillin (AMX), or enrofloxacin (ENR)-on the susceptibility of Escherichia coli in broiler intestinal tracts. Birds were first orally inoculated with rifampin-resistant E. coli strains bearing plasmid genes conferring resistance to fluoroquinolones (qnr), cephalosporins (bla(CTX-M) or bla(FOX)), trimethoprim-sulfonamides, aminoglycosides, or tetracyclines. Feces samples were collected before, during, and after antimicrobial treatments. The susceptibilities of E. coli strains were studied, and resistance gene transfer was analyzed. An increase in the tetracycline-resistant E. coli population was observed only in OTC-treated birds, whereas multiresistant E. coli was detected in the dominant E. coli populations of SXT-, AMX-, or ENR-treated birds. Most multiresistant E. coli strains were susceptible to rifampin and exhibited various pulsed-field gel electrophoresis profiles, suggesting the transfer of one of the multiresistance plasmids from the inoculated strains to other E. coli strains in the intestinal tract. In conclusion, this study clearly illustrates how, in E. coli, "old" antimicrobials may coselect antimicrobial resistance to recent and critical molecules.

  18. AAV5-Factor VIII Gene Transfer in Severe Hemophilia A.

    Science.gov (United States)

    Rangarajan, Savita; Walsh, Liron; Lester, Will; Perry, David; Madan, Bella; Laffan, Michael; Yu, Hua; Vettermann, Christian; Pierce, Glenn F; Wong, Wing Y; Pasi, K John

    2017-12-28

    Patients with hemophilia A rely on exogenous factor VIII to prevent bleeding in joints, soft tissue, and the central nervous system. Although successful gene transfer has been reported in patients with hemophilia B, the large size of the factor VIII coding region has precluded improved outcomes with gene therapy in patients with hemophilia A. We infused a single intravenous dose of a codon-optimized adeno-associated virus serotype 5 (AAV5) vector encoding a B-domain-deleted human factor VIII (AAV5-hFVIII-SQ) in nine men with severe hemophilia A. Participants were enrolled sequentially into one of three dose cohorts (low dose [one participant], intermediate dose [one participant], and high dose [seven participants]) and were followed through 52 weeks. Factor VIII activity levels remained at 3 IU or less per deciliter in the recipients of the low or intermediate dose. In the high-dose cohort, the factor VIII activity level was more than 5 IU per deciliter between weeks 2 and 9 after gene transfer in all seven participants, and the level in six participants increased to a normal value (>50 IU per deciliter) that was maintained at 1 year after receipt of the dose. In the high-dose cohort, the median annualized bleeding rate among participants who had previously received prophylactic therapy decreased from 16 events before the study to 1 event after gene transfer, and factor VIII use for participant-reported bleeding ceased in all the participants in this cohort by week 22. The primary adverse event was an elevation in the serum alanine aminotransferase level to 1.5 times the upper limit of the normal range or less. Progression of preexisting chronic arthropathy in one participant was the only serious adverse event. No neutralizing antibodies to factor VIII were detected. The infusion of AAV5-hFVIII-SQ was associated with the sustained normalization of factor VIII activity level over a period of 1 year in six of seven participants who received a high dose, with

  19. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    Energy Technology Data Exchange (ETDEWEB)

    Kirimura, Kohtaro, E-mail: kkohtaro@waseda.jp; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-05-13

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  20. GENE TRANSFER IN TOBACCO MITOCHONDRIA IN VITRO AND IN VIVO

    Directory of Open Access Journals (Sweden)

    Katyshev A.I.

    2012-08-01

    Full Text Available Earlier, we had showed that isolated mitochondria from different organisms can import DNA. Exploiting this mechanism, we assessed the possibility of genes transfer in tobacco mitochondria in vitro and in vivo. Whereas homologous recombination is a rare occasion in higher plant nuclei, recombination between the large direct repeats in plant mitochondrial genome generates its multipartite structure. Following transfection of isolated organelles with constructs composed of a partial gfp gene flanked by mitochondrial DNA fragments, we showed the homologous recombination of imported DNA with the resident DNA and the integration of the reporter gene. The recombination yielded an insertion of a continuous exogenous DNA fragment including the gfp sequence and at least the 0.5 kb of the flanking sequence on each side. Using of transfection constructs carrying multiple sequences homologous to mitochondrial DNA could be suitable for insertion of a target gene into any region of the mitochondrial genome, which turns this approach to be of a general and methodical importance. Usually mitochondrial reactive oxygen species (ROS level is under strict control of the antioxidant system including the Mn-containing superoxide dismutase (MnSOD. MnSOD is presented in multiple forms encoded by several genes in plants. Possibly, this enzyme, beside its catalytic function, fulfills as well some unknown biochemical functions. Thus, one of maize SOD enzymes (SOD3.4 could bind with mitochondrial DNA. Another SOD form (SOD3.1 is located in close proximity to mitochondrial respiratory complexes, where ROS are generated. To study possible physiological functions of this enzyme, we cloned the maize SOD3.1 gene. Compared to the SOD3.4, this enzyme didn't demonstrate DNA-binding activity. At the same time, SOD3.1 didn't show non-specific DNA-hydrolyzing activity as Cu/ZnSOD does. It means that this enzyme might have some DNA protective function. We made NtPcob-sod3.1-IGR

  1. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 ...

  2. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Science.gov (United States)

    Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

  3. Adenovirus gene transfer to amelogenesis imperfecta ameloblast-like cells.

    Directory of Open Access Journals (Sweden)

    Anton V Borovjagin

    Full Text Available To explore gene therapy strategies for amelogenesis imperfecta (AI, a human ameloblast-like cell population was established from third molars of an AI-affected patient. These cells were characterized by expression of cytokeratin 14, major enamel proteins and alkaline phosphatase staining. Suboptimal transduction of the ameloblast-like cells by an adenovirus type 5 (Ad5 vector was consistent with lower levels of the coxsackie-and-adenovirus receptor (CAR on those cells relative to CAR-positive A549 cells. To overcome CAR -deficiency, we evaluated capsid-modified Ad5 vectors with various genetic capsid modifications including "pK7" and/or "RGD" motif-containing short peptides incorporated in the capsid protein fiber as well as fiber chimera with the Ad serotype 3 (Ad3 fiber "knob" domain. All fiber modifications provided an augmented transduction of AI-ameloblasts, revealed following vector dose normalization in A549 cells with a superior effect (up to 404-fold of pK7/RGD double modification. This robust infectivity enhancement occurred through vector binding to both α(vβ3/α(vβ5 integrins and heparan sulfate proteoglycans (HSPGs highly expressed by AI-ameloblasts as revealed by gene transfer blocking experiments. This work thus not only pioneers establishment of human AI ameloblast-like cell population as a model for in vitro studies but also reveals an optimal infectivity-enhancement strategy for a potential Ad5 vector-mediated gene therapy for AI.

  4. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth......Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate...

  5. Novel "Superspreader" Bacteriophages Promote Horizontal Gene Transfer by Transformation.

    Science.gov (United States)

    Keen, Eric C; Bliskovsky, Valery V; Malagon, Francisco; Baker, James D; Prince, Jeffrey S; Klaus, James S; Adhya, Sankar L

    2017-01-17

    Bacteriophages infect an estimated 10 23 to 10 25 bacterial cells each second, many of which carry physiologically relevant plasmids (e.g., those encoding antibiotic resistance). However, even though phage-plasmid interactions occur on a massive scale and have potentially significant evolutionary, ecological, and biomedical implications, plasmid fate upon phage infection and lysis has not been investigated to date. Here we show that a subset of the natural lytic phage population, which we dub "superspreaders," releases substantial amounts of intact, transformable plasmid DNA upon lysis, thereby promoting horizontal gene transfer by transformation. Two novel Escherichia coli phage superspreaders, SUSP1 and SUSP2, liberated four evolutionarily distinct plasmids with equal efficiency, including two close relatives of prominent antibiotic resistance vectors in natural environments. SUSP2 also mediated the extensive lateral transfer of antibiotic resistance in unbiased communities of soil bacteria from Maryland and Wyoming. Furthermore, the addition of SUSP2 to cocultures of kanamycin-resistant E. coli and kanamycin-sensitive Bacillus sp. bacteria resulted in roughly 1,000-fold more kanamycin-resistant Bacillus sp. bacteria than arose in phage-free controls. Unlike many other lytic phages, neither SUSP1 nor SUSP2 encodes homologs to known hydrolytic endonucleases, suggesting a simple potential mechanism underlying the superspreading phenotype. Consistent with this model, the deletion of endonuclease IV and the nucleoid-disrupting protein ndd from coliphage T4, a phage known to extensively degrade chromosomal DNA, significantly increased its ability to promote plasmid transformation. Taken together, our results suggest that phage superspreaders may play key roles in microbial evolution and ecology but should be avoided in phage therapy and other medical applications. Bacteriophages (phages), viruses that infect bacteria, are the planet's most numerous biological

  6. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  7. Evolutionary Origins of the Eukaryotic Shikimate Pathway: Gene Fusions, Horizontal Gene Transfer, and Endosymbiotic Replacements†

    Science.gov (United States)

    Richards, Thomas A.; Dacks, Joel B.; Campbell, Samantha A.; Blanchard, Jeffrey L.; Foster, Peter G.; McLeod, Rima; Roberts, Craig W.

    2006-01-01

    Currently the shikimate pathway is reported as a metabolic feature of prokaryotes, ascomycete fungi, apicomplexans, and plants. The plant shikimate pathway enzymes have similarities to prokaryote homologues and are largely active in chloroplasts, suggesting ancestry from the plastid progenitor genome. Toxoplasma gondii, which also possesses an alga-derived plastid organelle, encodes a shikimate pathway with similarities to ascomycete genes, including a five-enzyme pentafunctional arom. These data suggests that the shikimate pathway and the pentafunctional arom either had an ancient origin in the eukaryotes or was conveyed by eukaryote-to-eukaryote horizontal gene transfer (HGT). We expand sampling and analyses of the shikimate pathway genes to include the oomycetes, ciliates, diatoms, basidiomycetes, zygomycetes, and the green and red algae. Sequencing of cDNA from Tetrahymena thermophila confirmed the presence of a pentafused arom, as in fungi and T. gondii. Phylogenies and taxon distribution suggest that the arom gene fusion event may be an ancient eukaryotic innovation. Conversely, the Plantae lineage (represented here by both Viridaeplantae and the red algae) acquired different prokaryotic genes for all seven steps of the shikimate pathway. Two of the phylogenies suggest a derivation of the Plantae genes from the cyanobacterial plastid progenitor genome, but if the full Plantae pathway was originally of cyanobacterial origin, then the five other shikimate pathway genes were obtained from a minimum of two other eubacterial genomes. Thus, the phylogenies demonstrate both separate HGTs and shared derived HGTs within the Plantae clade either by primary HGT transfer or secondarily via the plastid progenitor genome. The shared derived characters support the holophyly of the Plantae lineage and a single ancestral primary plastid endosymbiosis. Our analyses also pinpoints a minimum of 50 gene/domain loss events, demonstrating that loss and replacement events have been

  8. The Impact of Gene Silencing on Horizontal Gene Transfer and Bacterial Evolution.

    Science.gov (United States)

    Navarre, W W

    2016-01-01

    The H-NS family of DNA-binding proteins is the subject of intense study due to its important roles in the regulation of horizontally acquired genes critical for virulence, antibiotic resistance, and metabolism. Xenogeneic silencing proteins, typified by the H-NS protein of Escherichia coli, specifically target and downregulate expression from AT-rich genes by selectively recognizing specific structural features unique to the AT-rich minor groove. In doing so, these proteins facilitate bacterial evolution; enabling these cells to engage in horizontal gene transfer while buffering potential any detrimental fitness consequences that may result from it. Xenogeneic silencing and counter-silencing explain how bacterial cells can evolve effective gene regulatory strategies in the face of rampant gene gain and loss and it has extended our understanding of bacterial gene regulation beyond the classic operon model. Here we review the structures and mechanisms of xenogeneic silencers as well as their impact on bacterial evolution. Several H-NS-like proteins appear to play a role in facilitating gene transfer by other mechanisms including by regulating transposition, conjugation, and participating in the activation of virulence loci like the locus of enterocyte effacement pathogenicity island of pathogenic strains of E. coli. Evidence suggests that the critical determinants that dictate whether an H-NS-like protein will be a silencer or will perform a different function do not lie in the DNA-binding domain but, rather, in the domains that control oligomerization. This suggests that H-NS-like proteins are transcription factors that both recognize and alter the shape of DNA to exert specific effects that include but are not limited to gene silencing. © 2016 Elsevier Ltd All rights reserved.

  9. Horizontal gene transfer: building the web of life.

    Science.gov (United States)

    Soucy, Shannon M; Huang, Jinling; Gogarten, Johann Peter

    2015-08-01

    Horizontal gene transfer (HGT) is the sharing of genetic material between organisms that are not in a parent-offspring relationship. HGT is a widely recognized mechanism for adaptation in bacteria and archaea. Microbial antibiotic resistance and pathogenicity are often associated with HGT, but the scope of HGT extends far beyond disease-causing organisms. In this Review, we describe how HGT has shaped the web of life using examples of HGT among prokaryotes, between prokaryotes and eukaryotes, and even between multicellular eukaryotes. We discuss replacement and additive HGT, the proposed mechanisms of HGT, selective forces that influence HGT, and the evolutionary impact of HGT on ancestral populations and existing populations such as the human microbiome.

  10. Suppression of the phytoene synthase gene (EgcrtB) alters carotenoid content and intracellular structure of Euglena gracilis.

    Science.gov (United States)

    Kato, Shota; Soshino, Mika; Takaichi, Shinichi; Ishikawa, Takahiro; Nagata, Noriko; Asahina, Masashi; Shinomura, Tomoko

    2017-07-17

    Photosynthetic organisms utilize carotenoids for photoprotection as well as light harvesting. Our previous study revealed that high-intensity light increases the expression of the gene for phytoene synthase (EgcrtB) in Euglena gracilis (a unicellular phytoflagellate), the encoded enzyme catalyzes the first committed step of the carotenoid biosynthesis pathway. To examine carotenoid synthesis of E. gracilis in response to light stress, we analyzed carotenoid species and content in cells grown under various light intensities. In addition, we investigated the effect of suppressing EgcrtB with RNA interference (RNAi) on growth and carotenoid content. After cultivation for 7 days under continuous light at 920 μmol m -2  s -1 , β-carotene, diadinoxanthin (Ddx), and diatoxanthin (Dtx) content in cells was significantly increased compared with standard light intensity (55 μmol m -2  s -1 ). The high-intensity light (920 μmol m -2  s -1 ) increased the pool size of diadinoxanthin cycle pigments (i.e., Ddx + Dtx) by 1.2-fold and the Dtx/Ddx ratio from 0.05 (control) to 0.09. In contrast, the higher-intensity light treatment caused a 58% decrease in chlorophyll (a + b) content and diminished the number of thylakoid membranes in chloroplasts by approximately half compared with control cells, suggesting that the high-intensity light-induced accumulation of carotenoids is associated with an increase in both the number and size of lipid globules in chloroplasts and the cytoplasm. Transient suppression of EgcrtB in this alga by RNAi resulted in significant decreases in cell number, chlorophyll, and total major carotenoid content by 82, 82 and 86%, respectively, relative to non-electroporated cells. Furthermore, suppression of EgcrtB decreased the number of chloroplasts and thylakoid membranes and increased the Dtx/Ddx ratio by 1.6-fold under continuous illumination even at the standard light intensity, indicating that blocking carotenoid synthesis increased the

  11. Detecting rare gene transfer events in bacterial populations

    Directory of Open Access Journals (Sweden)

    Kaare Magne Nielsen

    2014-01-01

    Full Text Available Horizontal gene transfer (HGT enables bacteria to access, share, and recombine genetic variation, resulting in genetic diversity that cannot be obtained through mutational processes alone. In most cases, the observation of evolutionary successful HGT events relies on the outcome of initially rare events that lead to novel functions in the new host, and that exhibit a positive effect on host fitness. Conversely, the large majority of HGT events occurring in bacterial populations will go undetected due to lack of replication success of transformants. Moreover, other HGT events that would be highly beneficial to new hosts can fail to ensue due to lack of physical proximity to the donor organism, lack of a suitable gene transfer mechanism, genetic compatibility, and stochasticity in tempo-spatial occurrence. Experimental attempts to detect HGT events in bacterial populations have typically focused on the transformed cells or their immediate offspring. However, rare HGT events occurring in large and structured populations are unlikely to reach relative population sizes that will allow their immediate identification; the exception being the unusually strong positive selection conferred by antibiotics. Most HGT events are not expected to alter the likelihood of host survival to such an extreme extent, and will confer only minor changes in host fitness. Due to the large population sizes of bacteria and the time scales involved, the process and outcome of HGT are often not amenable to experimental investigation. Population genetic modeling of the growth dynamics of bacteria with differing HGT rates and resulting fitness changes is therefore necessary to guide sampling design and predict realistic time frames for detection of HGT, as it occurs in laboratory or natural settings. Here we review the key population genetic parameters, consider their complexity and highlight knowledge gaps for further research.

  12. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper

    1999-01-01

    BACKGROUND: Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential...

  13. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...

  14. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  15. Expression in Arabidopsis of a strawberry linalool synthase gene under the control of the inducible potato P12 promoter

    NARCIS (Netherlands)

    Yang, L.; Mercke, P.; Loon, van J.J.A.; Fang, Zhiyuan; Dicke, M.; Jongsma, M.A.

    2008-01-01

    To investigate the role of inducible linalool in Arabidopsis-insect interactions, the FaNES1 linalool synthase (LIS) cDNA from strawberry with plastid targeting and a synthetic intron (LIS') was placed under the control of the wound inducible proteinase inhibitor 2 (PI2) promoter from potato. The

  16. Chrysanthemum expressing a linalool synthase gene ‘smells good’, but ‘tastes bad’to western flower thrips

    NARCIS (Netherlands)

    Ting Yang, Ting; Stoopen, G.M.; Thoen, H.P.M.; Wiegers, G.L.; Jongsma, M.A.

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed in the

  17. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    obtained for csmA indicated that it had high similarity to class V chitin synthases. chsB and csmA disruption strains and a strain in which chsB transcription was controlled were constructed using the nitrite reductase (niiA) promoter. The strains were examined during hyphal growth by Northern analysis...

  18. Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays.

    Science.gov (United States)

    Martin, Diane M; Aubourg, Sébastien; Schouwey, Marina B; Daviet, Laurent; Schalk, Michel; Toub, Omid; Lund, Steven T; Bohlmann, Jörg

    2010-10-21

    Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS) were predicted by in silico analysis of the grapevine (Vitis vinifera) genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information about gene structure and phylogeny for the entire currently

  19. Euglena gracilis chloroplast transfer RNA transcription units. I. Physical map of the transfer RNA gene loci.

    Science.gov (United States)

    Orozco, E M; Hallick, R B

    1982-03-25

    The locations of transfer RNA genes with respect to the restriction endonuclease cleavage map of Euglena gracilis Klebs, strain Z Pringsheim chloroplast DNA have been determined. Purified chloroplast tRNAs were treated with snake venom phosphodiesterase to remove the 3'-CCA terminus, and radioactively labeled by the action of Escherichia coli tRNA nucleotidyltransferase in the presence of [alpha-32P]CTP. Chloroplast DNA was treated individually and with combinations of the enzymes Bal I, Bam HI, Eco RI, Pst I, Pvu II, Sal I, and Xho I. The location of tRNA genes with respect to the cleavage sites for these enzymes was determined by hybridization of the 32P-labeled tRNAs to membrane filter blots of the chloroplast DNA restriction nuclease fragments following gel electrophoresis. The 145-kilobase pair genome was resolved into nine areas of strong tRNA hybridization, separated by areas of weak or no tRNA hybridization. The loci of tRNA genes are within the Eco RI fragments Eco A, B, G, H, I, J', P, Q, and V.

  20. Studies of gene expression and activity of hexokinase, phosphofructokinase and glycogen synthase in human skeletal muscle in states of altered insulin-stimulated glucose metabolism

    DEFF Research Database (Denmark)

    Vestergaard, H

    1999-01-01

    of the review is to discuss our present knowledge of the activities and gene expression of hexokinase II (HKII), phosphofructokinase (PFK) and glycogen synthase (GS) in human skeletal muscle in states of altered insulin-stimulated glucose metabolism. My own experimental studies have comprised patients...... been reported to increase the basal concentration of muscle GS mRNA in NIDDM patients to a level similar to that seen in control subjects although insulin-stimulated glucose disposal rates remain reduced in NIDDM patients. In the insulin resistant states examined so far, basal and insulin...

  1. Construction of a genomic DNA library with a TA vector and its application in cloning of the phytoene synthase gene from the cyanobacterium Spirulina platensis M-135

    Science.gov (United States)

    Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima

    1998-03-01

    An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.

  2. Widespread impact of horizontal gene transfer on plant colonization of land.

    Science.gov (United States)

    Yue, Jipei; Hu, Xiangyang; Sun, Hang; Yang, Yongping; Huang, Jinling

    2012-01-01

    In complex multicellular eukaryotes such as animals and plants, horizontal gene transfer is commonly considered rare with very limited evolutionary significance. Here we show that horizontal gene transfer is a dynamic process occurring frequently in the early evolution of land plants. Our genome analyses of the moss Physcomitrella patens identified 57 families of nuclear genes that were acquired from prokaryotes, fungi or viruses. Many of these gene families were transferred to the ancestors of green or land plants. Available experimental evidence shows that these anciently acquired genes are involved in some essential or plant-specific activities such as xylem formation, plant defence, nitrogen recycling as well as the biosynthesis of starch, polyamines, hormones and glutathione. These findings suggest that horizontal gene transfer had a critical role in the transition of plants from aquatic to terrestrial environments. On the basis of these findings, we propose a model of horizontal gene transfer mechanism in nonvascular and seedless vascular plants.

  3. Characterization of splice variants of the genes encoding human mitochondrial HMG-CoA lyase and HMG-CoA synthase, the main enzymes of the ketogenesis pathway.

    Science.gov (United States)

    Puisac, Beatriz; Ramos, Mónica; Arnedo, María; Menao, Sebastián; Gil-Rodríguez, María Concepción; Teresa-Rodrigo, María Esperanza; Pié, Angeles; de Karam, Juan Carlos; Wesselink, Jan-Jaap; Giménez, Ignacio; Ramos, Feliciano J; Casals, Nuria; Gómez-Puertas, Paulino; Hegardt, Fausto G; Pié, Juan

    2012-04-01

    The genes HMGCS2 and HMGCL encode the two main enzymes for ketone-body synthesis, mitochondrial HMG-CoA synthase and HMG-CoA lyase. Here, we identify and describe possible splice variants of these genes in human tissues. We detected an alternative transcript of HMGCS2 carrying a deletion of exon 4, and two alternative transcripts of HMGCL with deletions of exons 5 and 6, and exons 5, 6 and 7, respectively. All splice variants maintained the reading frame. However, Western blot studies and overexpression measurements in eukaryotic or prokaryotic cell models did not reveal HL or mHS protein variants. Both genes showed a similar distribution of the inactive variants in different tissues. Surprisingly, the highest percentages were found in tissues where almost no ketone bodies are synthesized: heart, skeletal muscle and brain. Our results suggest that alternative splicing might coordinately block the two main enzymes of ketogenesis in specific human tissues.

  4. Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants.

    Science.gov (United States)

    Sanmiya, K; Iwasaki, T; Matsuoka, M; Miyao, M; Yamamoto, N

    1997-02-28

    A cDNA encoding farnesyl diphosphate synthase (FPPS), a key enzyme in isoprenoid biosynthesis, was isolated from a cDNA library constructed from mRNA that had been prepared from etiolated rice (Oriza sativa L. variety Nipponbare) seedlings after three hours of illumination by a subtraction method. The putative polypeptide deduced from the 1289 bp nucleotide sequence consisted of 353 amino acids and had a molecular mass of 40 676 Da. The predicted amino acid sequence exhibited high homology to those of FPPS from Arabidopsis (73% to type 1, 72% to type 2) and white lupin (74%). Southern blot analysis showed that the rice genome might contain only one gene for FPPS. The highest level of expression of the gene was demonstrated in leaves by RNA blot analysis. Moreover, light, in particular blue light, effectively enhanced expression of the gene.

  5. What tangled web: barriers to rampant horizontal gene transfer.

    Science.gov (United States)

    Kurland, Charles G

    2005-07-01

    Dawkins in his The Selfish Gene(1) quite aptly applies the term "selfish" to parasitic repetitive DNA sequences endemic to eukaryotic genomes, especially vertebrates. Doolittle and Sapienza(2) as well as Orgel and Crick(3) enlivened this notion of selfish DNA with the identification of such repetitive sequences as remnants of mobile elements such as transposons. In addition, Orgel and Crick(3) associated parasitic DNA with a potential to outgrow their host genomes by propagating both vertically via conventional genome replication as well as infectiously by horizontal gene transfer (HGT) to other genomes. Still later, Doolittle(4) speculated that unchecked HGT between unrelated genomes so complicates phylogeny that the conventional representation of a tree of life would have to be replaced by a thicket or a web of life.(4) In contrast, considerable data now show that reconstructions based on whole genome sequences are consistent with the conventional "tree of life".(5-10) Here, we identify natural barriers that protect modern genome populations from the inroads of rampant HGT. Copyright (c) 2005 Wiley Periodicals, Inc.

  6. Effect of the environment on horizontal gene transfer between bacteria and archaea.

    Science.gov (United States)

    Fuchsman, Clara A; Collins, Roy Eric; Rocap, Gabrielle; Brazelton, William J

    2017-01-01

    Horizontal gene transfer, the transfer and incorporation of genetic material between different species of organisms, has an important but poorly quantified role in the adaptation of microbes to their environment. Previous work has shown that genome size and the number of horizontally transferred genes are strongly correlated. Here we consider how genome size confuses the quantification of horizontal gene transfer because the number of genes an organism accumulates over time depends on its evolutionary history and ecological context (e.g., the nutrient regime for which it is adapted). We investigated horizontal gene transfer between archaea and bacteria by first counting reciprocal BLAST hits among 448 bacterial and 57 archaeal genomes to find shared genes. Then we used the DarkHorse algorithm, a probability-based, lineage-weighted method (Podell & Gaasterland, 2007), to identify potential horizontally transferred genes among these shared genes. By removing the effect of genome size in the bacteria, we have identified bacteria with unusually large numbers of shared genes with archaea for their genome size. Interestingly, archaea and bacteria that live in anaerobic and/or high temperature conditions are more likely to share unusually large numbers of genes. However, high salt was not found to significantly affect the numbers of shared genes. Numbers of shared (genome size-corrected, reciprocal BLAST hits) and transferred genes (identified by DarkHorse) were strongly correlated. Thus archaea and bacteria that live in anaerobic and/or high temperature conditions are more likely to share horizontally transferred genes. These horizontally transferred genes are over-represented by genes involved in energy conversion as well as the transport and metabolism of inorganic ions and amino acids. Anaerobic and thermophilic bacteria share unusually large numbers of genes with archaea. This is mainly due to horizontal gene transfer of genes from the archaea to the bacteria. In

  7. Effect of the environment on horizontal gene transfer between bacteria and archaea

    Directory of Open Access Journals (Sweden)

    Clara A. Fuchsman

    2017-09-01

    Full Text Available Background Horizontal gene transfer, the transfer and incorporation of genetic material between different species of organisms, has an important but poorly quantified role in the adaptation of microbes to their environment. Previous work has shown that genome size and the number of horizontally transferred genes are strongly correlated. Here we consider how genome size confuses the quantification of horizontal gene transfer because the number of genes an organism accumulates over time depends on its evolutionary history and ecological context (e.g., the nutrient regime for which it is adapted. Results We investigated horizontal gene transfer between archaea and bacteria by first counting reciprocal BLAST hits among 448 bacterial and 57 archaeal genomes to find shared genes. Then we used the DarkHorse algorithm, a probability-based, lineage-weighted method (Podell & Gaasterland, 2007, to identify potential horizontally transferred genes among these shared genes. By removing the effect of genome size in the bacteria, we have identified bacteria with unusually large numbers of shared genes with archaea for their genome size. Interestingly, archaea and bacteria that live in anaerobic and/or high temperature conditions are more likely to share unusually large numbers of genes. However, high salt was not found to significantly affect the numbers of shared genes. Numbers of shared (genome size-corrected, reciprocal BLAST hits and transferred genes (identified by DarkHorse were strongly correlated. Thus archaea and bacteria that live in anaerobic and/or high temperature conditions are more likely to share horizontally transferred genes. These horizontally transferred genes are over-represented by genes involved in energy conversion as well as the transport and metabolism of inorganic ions and amino acids. Conclusions Anaerobic and thermophilic bacteria share unusually large numbers of genes with archaea. This is mainly due to horizontal gene transfer of

  8. Chalcone synthase family genes have redundant roles in anthocyanin biosynthesis and in response to blue/UV-A light in turnip (Brassica rapa; Brassicaceae).

    Science.gov (United States)

    Zhou, Bo; Wang, Yu; Zhan, Yaguang; Li, Yuhua; Kawabata, Saneyuki

    2013-12-01

    The epidermis of Brassica rapa (turnip) cv. Tsuda contains light-induced anthocyanins, visible signs of activity of chalcone synthase (CHS), a key anthocyanin biosynthetic enzyme, which is encoded by the CHS gene family. To elucidate the regulation of this light-induced pigmentation, we isolated Brassica rapa CHS1-CHS6 (BrCHS1-CHS6) and characterized their cis-elements and expression patterns. Epidermises of light-exposed swollen hypocotyls (ESHS) were harvested to analyze transcription levels of BrCHS genes by real-time PCR. Different promoters for the genes were inserted into tobacco to examine pCHS-GUS activity by histochemistry. Yeast-one-hybridization was used to detect binding activity of BrCHS motifs to transcription factors. Transcript levels of BrCHS1, -4, and -5 and anthocyanin-biosynthesis-related genes F3H, DFR, and ANS were high, while those of BrCHS2, -3, and -6 were almost undetectable in pigmented ESHS. However, in leaves, CHS5, F3H, and ANS expression was higher than in nonpigmented ESHS, but transcription of DFR was not detected. In the analysis of BrCHS1 and BrCHS3 promoter activity, GUS activity was strong in pigmented flowers of BrPCHS1-GUS-transformed tobacco plants, but nearly absent in BrPCHS3-GUS-transformed plants. Transcript levels of regulators, BrMYB75 and BrTT8, were strongly associated with the anthocyanin content and were light-induced. Coregulated cis-elements were found in promoters of BrCHS1,-4, and -5, and BrMYB75 and BrTT8 had high binding activities to the BrCHS Unit 1 motif. The chalcone synthase gene family encodes a redundant set of light-responsive, tissue-specific genes that are expressed at different levels and are involved in flavonoid biosynthesis in Tsuda turnip.

  9. Evaluation of biolistic gene transfer methods in vivo using non-invasive bioluminescent imaging techniques

    Directory of Open Access Journals (Sweden)

    Daniell Henry

    2011-06-01

    Full Text Available Abstract Background Gene therapy continues to hold great potential for treating many different types of disease and dysfunction. Safe and efficient techniques for gene transfer and expression in vivo are needed to enable gene therapeutic strategies to be effective in patients. Currently, the most commonly used methods employ replication-defective viral vectors for gene transfer, while physical gene transfer methods such as biolistic-mediated ("gene-gun" delivery to target tissues have not been as extensively explored. In the present study, we evaluated the efficacy of biolistic gene transfer techniques in vivo using non-invasive bioluminescent imaging (BLI methods. Results Plasmid DNA carrying the firefly luciferase (LUC reporter gene under the control of the human Cytomegalovirus (CMV promoter/enhancer was transfected into mouse skin and liver using biolistic methods. The plasmids were coupled to gold microspheres (1 μm diameter using different DNA Loading Ratios (DLRs, and "shot" into target tissues using a helium-driven gene gun. The optimal DLR was found to be in the range of 4-10. Bioluminescence was measured using an In Vivo Imaging System (IVIS-50 at various time-points following transfer. Biolistic gene transfer to mouse skin produced peak reporter gene expression one day after transfer. Expression remained detectable through four days, but declined to undetectable levels by six days following gene transfer. Maximum depth of tissue penetration following biolistic transfer to abdominal skin was 200-300 μm. Similarly, biolistic gene transfer to mouse liver in vivo also produced peak early expression followed by a decline over time. In contrast to skin, however, liver expression of the reporter gene was relatively stable 4-8 days post-biolistic gene transfer, and remained detectable for nearly two weeks. Conclusions The use of bioluminescence imaging techniques enabled efficient evaluation of reporter gene expression in vivo. Our results

  10. Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

    Science.gov (United States)

    Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

    2014-11-01

    We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  11. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  12. The Fusarium graminearum genome reveals more secondary metabolite gene clusters and hints of horizontal gene transfer.

    Directory of Open Access Journals (Sweden)

    Christian M K Sieber

    Full Text Available Fungal secondary metabolite biosynthesis genes are of major interest due to the pharmacological properties of their products (like mycotoxins and antibiotics. The genome of the plant pathogenic fungus Fusarium graminearum codes for a large number of candidate enzymes involved in secondary metabolite biosynthesis. However, the chemical nature of most enzymatic products of proteins encoded by putative secondary metabolism biosynthetic genes is largely unknown. Based on our analysis we present 67 gene clusters with significant enrichment of predicted secondary metabolism related enzymatic functions. 20 gene clusters with unknown metabolites exhibit strong gene expression correlation in planta and presumably play a role in virulence. Furthermore, the identification of conserved and over-represented putative transcription factor binding sites serves as additional evidence for cluster co-regulation. Orthologous cluster search provided insight into the evolution of secondary metabolism clusters. Some clusters are characteristic for the Fusarium phylum while others show evidence of horizontal gene transfer as orthologs can be found in representatives of the Botrytis or Cochliobolus lineage. The presented candidate clusters provide valuable targets for experimental examination.

  13. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

    2011-01-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  14. Effects of point mutations in Plasmodium falciparum dihydrofolate reductase and dihydropterate synthase genes on clinical outcomes and in vitro susceptibility to sulfadoxine and pyrimethamine.

    Directory of Open Access Journals (Sweden)

    David J Bacon

    2009-08-01

    Full Text Available Sulfadoxine-pyrimethamine was a common first line drug therapy to treat uncomplicated falciparum malaria, but increasing therapeutic failures associated with the development of significant levels of resistance worldwide has prompted change to alternative treatment regimes in many national malaria control programs. METHODOLOGY AND FINDING: We conducted an in vivo therapeutic efficacy trial of sulfadoxine-pyrimethamine at two locations in the Peruvian Amazon enrolling 99 patients of which, 86 patients completed the protocol specified 28 day follow up. Our objective was to correlate the presence of polymorphisms in P. falciparum dihydrofolate reductase and dihydropteroate synthase to in vitro parasite susceptibility to sulfadoxine and pyrimethamine and to in vivo treatment outcomes. Inhibitory concentration 50 values of isolates increased with numbers of mutations (single [108N], sextuplet [BR/51I/108N/164L and 437G/581G] and septuplet (BR/51I/108N/164L and 437G/540E/581G with geometric means of 76 nM (35-166 nM, 582 nM (49-6890- nM and 4909 (3575-6741 nM nM for sulfadoxine and 33 nM (22-51 nM, 81 nM (19-345 nM, and 215 nM (176-262 nM for pyrimethamine. A single mutation present in the isolate obtained at the time of enrollment from either dihydrofolate reductase (164L or dihydropteroate synthase (540E predicted treatment failure as well as any other single gene alone or in combination. Patients with the dihydrofolate reductase 164L mutation were 3.6 times as likely to be treatment failures [failures 85.4% (164L vs 23.7% (I164; relative risk = 3.61; 95% CI: 2.14 - 6.64] while patients with the dihydropteroate synthase 540E were 2.6 times as likely to fail treatment (96.7% (540E vs 37.5% (K540; relative risk = 2.58; 95% CI: 1.88 - 3.73. Patients with both dihydrofolate reductase 164L and dihydropteroate synthase 540E mutations were 4.1 times as likely to be treatment failures [96.7% vs 23.7%; RR = 4.08; 95% CI: 2.45 - 7.46] compared to patients

  15. International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice.

    Science.gov (United States)

    Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing

    2009-05-13

    One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.

  16. Transduction-like gene transfer in the methanogen Methanococcus voltae

    Science.gov (United States)

    Bertani, G.

    1999-01-01

    Strain PS of Methanococcus voltae (a methanogenic, anaerobic archaebacterium) was shown to generate spontaneously 4.4-kbp chromosomal DNA fragments that are fully protected from DNase and that, upon contact with a cell, transform it genetically. This activity, here called VTA (voltae transfer agent), affects all markers tested: three different auxotrophies (histidine, purine, and cobalamin) and resistance to BES (2-bromoethanesulfonate, an inhibitor of methanogenesis). VTA was most effectively prepared by culture filtration. This process disrupted a fraction of the M. voltae cells (which have only an S-layer covering their cytoplasmic membrane). VTA was rapidly inactivated upon storage. VTA particles were present in cultures at concentrations of approximately two per cell. Gene transfer activity varied from a minimum of 2 x 10(-5) (BES resistance) to a maximum of 10(-3) (histidine independence) per donor cell. Very little VTA was found free in culture supernatants. The phenomenon is functionally similar to generalized transduction, but there is no evidence, for the time being, of intrinsically viral (i.e., containing a complete viral genome) particles. Consideration of VTA DNA size makes the existence of such viral particles unlikely. If they exist, they must be relatively few in number;perhaps they differ from VTA particles in size and other properties and thus escaped detection. Digestion of VTA DNA with the AluI restriction enzyme suggests that it is a random sample of the bacterial DNA, except for a 0.9-kbp sequence which is amplified relative to the rest of the bacterial chromosome. A VTA-sized DNA fraction was demonstrated in a few other isolates of M. voltae.

  17. Bioengineering of the plant culture of Capsicum frutescens with vanillin synthase gene for the production of vanillin

    OpenAIRE

    Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan

    2016-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...

  18. Horizontal Gene Transfer of Functional Type VI Killing Genes by Natural Transformation

    Directory of Open Access Journals (Sweden)

    Jacob Thomas

    2017-07-01

    Full Text Available Horizontal gene transfer (HGT can have profound effects on bacterial evolution by allowing individuals to rapidly acquire adaptive traits that shape their strategies for competition. One strategy for intermicrobial antagonism often used by Proteobacteria is the genetically encoded contact-dependent type VI secretion system (T6SS, a weapon used to kill heteroclonal neighbors by direct injection of toxic effectors. Here, we experimentally demonstrate that Vibrio cholerae can acquire new T6SS effector genes via horizontal transfer and utilize them to kill neighboring cells. Replacement of one or more parental alleles with novel effectors allows the recombinant strain to dramatically outcompete its parent. Using spatially explicit modeling, we examine how this process could affect the ecology and evolution of surface-attached microbial populations. HGT of T6SS effector-immunity pairs is risky: transformation brings a cell into conflict with its former clone mates but can be adaptive when superior T6SS alleles are acquired. More generally, we find that these costs and benefits are not symmetric and that high rates of HGT can act as a hedge against competitors with unpredictable T6SS efficacy. We conclude that antagonism and horizontal transfer drive successive rounds of weapon optimization and selective sweeps, dynamically shaping the composition of microbial communities.

  19. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  20. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, H.; Galili, G.; Sørensen, K.

    1996-01-01

    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...... as observed in T0 seeds. It is concluded that the aspartate family pathway may be genetically engineered by the introduction of genes coding for feed-back-insensitive enzymes, preferentially giving elevated levels of lysine and methionine....

  1. Insights into the molecular pathogenesis of atherosclerosis and therapeutic strategies using gene transfer.

    Science.gov (United States)

    Hiltunen, M O; Turunen, M P; Laitinen, M; Ylä-Herttuala, S

    2000-01-01

    Gene therapy for the treatment of atherosclerosis and related diseases has shown its potential in animal models and in the first human trials. Gene transfer to the vascular system can be performed both via intravascular and extravascular periadventitial routes. Intravascular gene transfer can be done with several types of catheters under fluoroscopic control. Extravascular gene transfer, on the other hand, provides a well-targeted gene delivery route available during vascular surgery. It can be done with direct injection or by using perivascular cuffs or surgical collagen sheets. Ex vivo gene delivery via transfected smooth muscle cells or endothelial cells might be useful for the production of secreted therapeutic compounds. Gene transfer to the liver has been used for the treatment of hyperlipidemia. The first clinical trials for the induction of therapeutic angiogenesis in ischemic myocardium or peripheral muscles with VEGF or FGF gene transfer are under way and preliminary results are promising. VEGF has also been used for the prevention of postangioplasty restenosis because of its capability to induce endothelial repair and production of NO and prostacyclin. However, further basic research is needed to fully understand the pathophysiological mechanisms involved in conditions related to atherosclerosis. Also, further development of gene transfer vectors and gene delivery techniques will improve the efficacy and safety of human gene therapy.

  2. Alteration of flower color in Iris germanica L. 'Fire Bride' through ectopic expression of phytoene synthase gene (crtB) from Pantoea agglomerans.

    Science.gov (United States)

    Jeknić, Zoran; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H H

    2014-08-01

    Genetic modulation of the carotenogenesis in I. germanica 'Fire Bride' by ectopic expression of a crtB gene causes several flower parts to develop novel orange and pink colors. Flower color in tall bearded irises (Iris germanica L.) is determined by two distinct biochemical pathways; the carotenoid pathway, which imparts yellow, orange and pink hues and the anthocyanin pathway, which produces blue, violet and maroon flowers. Red-flowered I. germanica do not exist in nature and conventional breeding methods have thus far failed to produce them. With a goal of developing iris cultivars with red flowers, we transformed a pink iris I. germanica, 'Fire Bride', with a bacterial phytoene synthase gene (crtB) from Pantoea agglomerans under the control of the promoter region of a gene for capsanthin-capsorubin synthase from Lilium lancifolium (Llccs). This approach aimed to increase the flux of metabolites into the carotenoid biosynthetic pathway and lead to elevated levels of lycopene and darker pink or red flowers. Iris callus tissue ectopically expressing the crtB gene exhibited a color change from yellow to pink-orange and red, due to accumulation of lycopene. Transgenic iris plants, regenerated from the crtB-transgenic calli, showed prominent color changes in the ovaries (green to orange), flower stalk (green to orange), and anthers (white to pink), while the standards and falls showed no significant differences in color when compared to control plants. HPLC and UHPLC analysis confirmed that the color changes were primarily due to the accumulation of lycopene. In this study, we showed that ectopic expression of a crtB can be used to successfully alter the color of certain flower parts in I. germanica 'Fire Bride' and produce new flower traits.

  3. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    Science.gov (United States)

    Chen, Tony H.H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-degenerate primer that was based on the sequence of a gene for lycopene β-cyclase (lcyB). The full-length cDNA of Llccs was 1,785 bp long and contained an open reading frame of 1,425 bp that encoded a polypeptide of 474 amino acids with a predicted N-terminal plastid-targeting sequence. Analysis by reverse transcription–PCR (RT–PCR) revealed that expression of Llccs was spatially and temporally regulated, with expression in flower buds and flowers of L. lancifolium but not in vegetative tissues. Stable overexpression of the Llccs gene in callus tissue of Iris germanica, which accumulates several xanthophylls including violaxanthin, the precursor of capsorubin, resulted in transgenic callus whose color had changed from its normal yellow to red-orange. This novel red-orange coloration was due to the accumulation of two non-native κ-xanthophylls, capsanthin and capsorubin, as confirmed by HPLC and ultraperformance liquid chromatography–tandem mass spectrometry (UPLC-MS/MS) analysis with authentic standards. Cloning of the Llccs gene should advance our understanding of the molecular and genetic mechanisms of the biosynthesis of κ-carotenoids in general and in the genus Lilium in particular, and will facilitate transgenic alterations of the colors of flowers and fruits of many plant species. PMID:23008421

  4. Identification and characterization of a chondroitin synthase from Avibacterium paragallinarum.

    Science.gov (United States)

    Wang, Ting-Ting; Zhu, Chen-Ye; Zheng, Shuang; Meng, Cai-Cai; Wang, Tian-Tian; Meng, Dan-Hua; Li, Yi-Jun; Zhu, Hao-Miao; Wang, Feng-Shan; Sheng, Ju-Zheng

    2018-04-03

    Avibacterium paragallinarum is a Gram-negative bacterium that causes infectious coryza in chicken. It was reported that the capsule polysaccharides extracted from Av. paragallinarum genotype A contained chondroitin. Chondroitin synthase of Av. paragallinarum (ApCS) encoded by one gene within the presumed capsule biosynthesis gene cluster exhibited considerable homology to identified bacterial chondroitin synthases. Herein, we report the identification and characterization of ApCS. This enzyme indeed displays chondroitin synthase activity involved in the biosynthesis of the capsule. ApCS is a bifunctional protein catalyzing the elongation of the chondroitin chain by alternatively transferring the glucuronic acid (GlcA) and N-acetyl-D-galactosamine (GalNAc) residues from their nucleotide forms to the non-reducing ends of the saccharide chains. GlcA with a para-nitrophenyl group (pNP) could serve as the acceptor for ApCS; this enzyme shows a stringent donor tolerance when the acceptor is as small as this monosaccharide. Then, UDP-GalNAc and GlcA-pNP were injected sequentially through the chip-immobilized chondroitin synthases, and the surface plasmon resonance data demonstrated that the up-regulated extent caused by the binding of the donor is one possibly essential factor in successful polymerization reaction. This conclusion will, therefore, enhance the understanding of the mode of action of glycosyltransferase. Surprisingly, high activity at near-zero temperature as well as weak temperature dependence of this novel bacterial chondroitin synthase indicate that ApCS was a cold-active enzyme. From all accounts, ApCS becomes the fourth known bacterial chondroitin synthase, and the potential applications in artificial chondroitin sulfate and glycosaminoglycan synthetic approaches make it an attractive glycosyltransferase for further investigation.

  5. Somatostatin receptor gene transfer inhibits established pancreatic cancer xenografts.

    Science.gov (United States)

    Celinski, Scott A; Fisher, William E; Amaya, Felipe; Wu, Yuan Qing; Yao, Q; Youker, Keith A; Li, Min

    2003-11-01

    Most human pancreatic adenocarcinoma cells do not express somatostatin receptors, and somatostatin does not inhibit the growth of these cancers. We have demonstrated previously that somatostatin inhibits the growth of pancreatic cancers expressing somatostatin receptor subtype-2 (SSTR2), but not receptor-negative cancers. SSTR2 expression may be an important tumor-suppressor pathway that is lost in human pancreatic cancer. We hypothesized that SSTR2 gene transfer would restore the growth-inhibitory response of human pancreatic cancer to somatostatin. Palpable human pancreatic adenocarcinoma tumors were established on the backs of nude mice by subcutaneous injection of cultured cells (Panc-1). The animals were divided into 5 groups (n = 10/group). Group I served as an untreated control. Group II received an intramuscular injection of the long-acting somatostatin analogue Sandostatin LAR. Group III received Lac-Z expressing adenovirus via intraperitoneal injection. Group IV received SSTR2 expressing adenovirus via intraperitoneal injection. Group V received SSTR2 expressing adenovirus via intraperitoneal injection and an intramuscular injection of Sandostatin LAR. The rate of tumor growth was assessed with calipers. After 28 days, the animals were anesthetized and exsanguanated, and the tumors were excised and weighed. Plasma somatostatin and octreotide levels were measured by radioimmunoassay. Expression of cell-surface somatostatin-receptor protein and known tumor-suppressor proteins was determined by reverse transcriptase-polymerase chain reaction, Western blot, and immunohistochemistry. Systemic delivery of SSTR2-expressing adenovirus by intraperitoneal injection resulted in expression of SSTR2 protein in the subcutaneous human pancreatic cancers. Final tumor weight was significantly decreased in the groups expressing SSTR2 receptors compared to the other 3 groups. Treatment with Sandostatin LAR increased plasma octreotide levels as determined by radioimmunoassay

  6. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  7. Association of endothelial nitric oxide synthase gene polymorphism with the risk of Henoch-Schönlein purpura/Henoch-Schönlein purpura nephritis.

    Science.gov (United States)

    Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei

    2015-04-01

    Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.

  8. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae).

    Science.gov (United States)

    Xiong, Ke-Cai; Wang, Jia; Li, Jia-Hao; Deng, Yu-Qing; Pu, Po; Fan, Huan; Liu, Ying-Hong

    2016-01-01

    Trehalose is the major blood sugar in insects, which plays a crucial role as an instant source of energy and the starting substrate for chitin biosynthesis. In insects, trehalose is synthesized by catalysis of an important enzyme, trehalose-6-phosphate synthase (TPS). In the present study, a trehalose-6-phosphate synthase gene from Bactrocera minax (BmTPS) was cloned and characterized. BmTPS contained an open reading frame of 2445 nucleotides encoding a protein of 814 amino acids with a predicted molecular weight of 92.05kDa. BmTPS was detectable in all developmental stages of Bactrocera minax and expressed higher in the final- (third-) instar larvae. Tissue-specific expression patterns of BmTPS showed that it was mainly expressed in the fat body. The 20-hydroxyecdysone (20E) induced the expression of BmTPS and three genes in the chitin biosynthesis pathway. Moreover, injection of double-stranded RNA into third-instar larvae successfully silenced the transcription of BmTPS in B. minax, and thereby decreased the activity of TPS and trehalose content. Additionally, silencing of BmTPS inhibited the expression of three key genes in the chitin biosynthesis pathway and exhibited 52% death and abnormal phenotypes. The findings demonstrate that BmTPS is indispensable for larval-pupal metamorphosis. Besides, the establishment of RNAi experimental system in B. minax would lay a solid foundation for further investigation of molecular biology and physiology of this pest. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Disruption of the Bcchs3a chitin synthase gene in Botrytis cinerea is responsible for altered adhesion and overstimulation of host plant immunity.

    Science.gov (United States)

    Arbelet, Delphine; Malfatti, Pierrette; Simond-Côte, Elizabeth; Fontaine, Thierry; Desquilbet, Loïc; Expert, Dominique; Kunz, Caroline; Soulié, Marie-Christine

    2010-10-01

    The fungal cell wall is a dynamic structure that protects the cell from different environmental stresses suggesting that wall synthesizing enzymes are of great importance for fungal virulence. Previously, we reported the isolation and characterization of a mutant in class III chitin synthase, Bcchs3a, in the phytopathogenic fungus Botrytis cinerea. We demonstrated that virulence of this mutant is severely impaired. Here, we describe the virulence phenotype of the cell-wall mutant Bcchs3a on the model plant Arabidopsis thaliana and analyze its virulence properties, using a variety of A. thaliana mutants. We found that mutant Bcchs3a is virulent on pad2 and pad3 mutant leaves defective in camalexin. Mutant Bcchs3a was not more susceptible towards camalexin than the wild-type strain but induced phytoalexin accumulation at the infection site on Col-0 plants. Moreover, this increase in camalexin was correlated with overexpression of the PAD3 gene observed as early as 18 h postinoculation. The infection process of the mutant mycelium was always delayed by 48 h, even on pad3 plants, probably because of lack of mycelium adhesion. No loss in virulence was found when Bcchs3a conidia were used as the inoculum source. Collectively, these data led us to assign a critical role to the BcCHS3a chitin synthase isoform, both in fungal virulence and plant defense response.

  10. Molecular Cloning, Characterization and mRNA Expression of a Chitin Synthase 2 Gene from the Oriental Fruit Fly, Bactrocera dorsalis (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Kang-Kang Xu

    2013-08-01

    Full Text Available Chitin synthase (CHS, a potential target for eco-friendly insecticides, plays an essential role in chitin formation in insects. In this study, a full-length cDNA encoding chitin synthase 2 (BdCHS2 was cloned and characterized in the oriental fruit fly, Bactrocera dorsalis. The BdCHS2 cDNA had 4417 nucleotides, containing an open reading frame of 4122 nucleotides, which encoded 1373 amino acid residues with a predicted molecular weight of 158.5 kDa. Phylogenetic analysis with other insect CHSs suggested that BdCHS2 belongs to insect CHS2. The BdCHS2 transcript was predominately found in midgut but was detected at low levels in fat body, Malpighian tubules, integument, and trachea. Moreover, BdCHS2 was expressed in all developmental stages, and highly expressed in the feeding stages. There was a positive relationship between BdCHS2 expression and total chitin content during development. Furthermore, both the gene expression and chitin content in midgut decreased when the insect was fed for 24 h, then starved for 24 h, while they increased dramatically and rapidly under the condition of starvation for 24 h then feeding for 24 h. These results suggest that BdCHS2 may play an important role in regulating chitin content of the midgut, and subsequently affect the growth and development of B. dorsalis.

  11. Gene transfer from wild Helianthus to sunflower: topicalities and limits

    Directory of Open Access Journals (Sweden)

    Breton Catherine

    2010-03-01

    Full Text Available Sunflower (2n=17 belongs to the Helianthus genus (Asteraceae. Wild Helianthus species display morphological variation for branching and stem number, for architecture and seed size, and for resistance to abiotic and biotic stresses due to which they thrive in different environments in North America. The genus is divided into botanical sections, two for annual as sunflower, and two for perennial species as Jerusalem artichoke that produces rhizomes (tubers. We explain the difficulties and successes obtained by crossing sunflower with these species to improve the agronomic traits of the sunflower crop. It is easier to cross the annual species than the perennials’ with sunflower. Several traits such as Cytoplasmic male sterility and restorer Rf-PET1 genes, Downy mildew resistance, Phomopsis resistance, Sclerotinia resistance, Rust resistance, and Orobanche resistance have already been introduced from annual species into sunflower crop, but the complex genomic organization of these species compared to sunflower limits their important potential. Perennial species are much more diverse, and their genomes display 2n, 4n, or 6n chromosomes for n 17. The realities of inter-specific hybridization are relatively disappointing due to the introgression lines that have low oil and low seed yield. We report here several attempts to introgress agronomic traits from these species to sunflower, and we present as a case study, an introgressed progenies from H. mollis, a diploid species with sessile small leaves. We constructed a preliminary genetic map with AFLP markers in 21 BC1 plants, and we then showed that some progenies display 6 to 44% of introgression from H. mollis. Although this study is promising due to the novel compact architecture of the progenies, we cannot estimate the transferability from H. mollis to other perennial Helianthus to improve sunflower.

  12. Environmental factors influencing gene transfer agent (GTA mediated transduction in the subtropical ocean.

    Directory of Open Access Journals (Sweden)

    Lauren D McDaniel

    Full Text Available Microbial genomic sequence analyses have indicated widespread horizontal gene transfer (HGT. However, an adequate mechanism accounting for the ubiquity of HGT has been lacking. Recently, high frequencies of interspecific gene transfer have been documented, catalyzed by Gene Transfer Agents (GTAs of marine α-Proteobacteria. It has been proposed that the presence of bacterial genes in highly purified viral metagenomes may be due to GTAs. However, factors influencing GTA-mediated gene transfer in the environment have not yet been determined. Several genomically sequenced strains containing complete GTA sequences similar to Rhodobacter capsulatus (RcGTA, type strain were screened to ascertain if they produced putative GTAs, and at what abundance. Five of nine marine strains screened to date spontaneously produced virus-like particles (VLP's in stationary phase. Three of these strains have demonstrated gene transfer activity, two of which were documented by this lab. These two strains Roseovarius nubinhibens ISM and Nitratireductor 44B9s, were utilized to produce GTAs designated RnGTA and NrGTA and gene transfer activity was verified in culture. Cell-free preparations of purified RnGTA and NrGTA particles from marked donor strains were incubated with natural microbial assemblages to determine the level of GTA-mediated gene transfer. In conjunction, several ambient environmental parameters were measured including lysogeny indicated by prophage induction. GTA production in culture systems indicated that approximately half of the strains produced GTA-like particles and maximal GTA counts ranged from 10-30% of host abundance. Modeling of GTA-mediated gene transfer frequencies in natural samples, along with other measured environmental variables, indicated a strong relationship between GTA mediated gene transfer and the combined factors of salinity, multiplicity of infection (MOI and ambient bacterial abundance. These results indicate that GTA

  13. Structure and expression profile of the sucrose synthase gene family in the rubber tree: indicative of roles in stress response and sucrose utilization in the laticifers.

    Science.gov (United States)

    Xiao, Xiaohu; Tang, Chaorong; Fang, Yongjun; Yang, Meng; Zhou, Binhui; Qi, Jiyan; Zhang, Yi

    2014-01-01

    Sucrose synthase (Sus, EC 2.4.1.13) is widely recognized as a key enzyme in sucrose metabolism in plants. However, nothing is known about this gene family in Hevea brasiliensis (para rubber tree). Here, we identified six Sus genes in H. brasiliensis that comprise the entire Sus family in this species. Analysis of the gene structure and phylogeny of the Sus genes demonstrates evolutionary conservation in the Sus families across Hevea and other plant species. The expression of Sus genes was investigated via Solexa sequencing and quantitative PCR in various tissues, at various phases of leaf development, and under abiotic stresses and ethylene treatment. The Sus genes exhibited distinct but partially redundant expression profiles. Each tissue has one abundant Sus isoform, with HbSus3, 4 and 5 being the predominant isoforms in latex (cytoplasm of rubber-producing laticifers), bark and root, respectively. HbSus1 and 6 were barely expressed in any tissue examined. In mature leaves (source), all HbSus genes were expressed at low levels, but HbSus3 and 4 were abundantly expressed in immature leaves (sink). Low temperature and drought treatments conspicuously induced HbSus5 expression in root and leaf, suggesting a role in stress responses. HbSus2 and 3 transcripts were decreased by ethylene treatment, consistent with the reduced sucrose-synthesizing activity of Sus enzymes in the latex in response to ethylene stimulation. Our results are beneficial to further determination of functions for the Sus genes in Hevea trees, especially roles in regulating latex regeneration. © 2013 FEBS.

  14. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    Directory of Open Access Journals (Sweden)

    Toub Omid

    2010-10-01

    Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information

  15. A first glimpse into the pattern and scale of gene transfer in the Apicomplexa

    DEFF Research Database (Denmark)

    Huang, J.L.; Mullapudi, N.; Sicheritz-Pontén, Thomas

    2004-01-01

    with a phylogenomic approach to detect potential gene transfers in four apicomplexan genomes. We have detected genes of algal nuclear, chloroplast (cyanobacterial) and proteobacterial origin. Plant-like genes were detected in species not currently harbouring a plastid (e.g. Cryptosporidium parvum) and putatively...

  16. Horizontal gene and chromosome transfer in plantpathogenic fungi affecting host range

    NARCIS (Netherlands)

    Mehrabi, R.; Bahkali, A.H.; Abd-Elsalam, K.A.; M'Barek, Ben S.; Mirzadi Gohari, A.; Karimi Jashini, M.; Stergiopoulos, I.; Kema, G.H.J.; Wit, de P.J.G.M.

    2011-01-01

    Plant pathogenic fungi adapt quickly to changing environments including overcoming plant disease resistance genes. This is usually achieved by mutations in single effector genes of the pathogens, enabling them to avoid recognition by the host plant. In addition, horizontal gene transfer (HGT) and

  17. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    International Nuclear Information System (INIS)

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

    2008-01-01

    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

  18. A soluble starch synthase I gene, IbSSI, alters the content, composition, granule size and structure of starch in transgenic sweet potato.

    Science.gov (United States)

    Wang, Yannan; Li, Yan; Zhang, Huan; Zhai, Hong; Liu, Qingchang; He, Shaozhen

    2017-05-24

    Soluble starch synthase I (SSI) is a key enzyme in the biosynthesis of plant amylopectin. In this study, the gene named IbSSI, was cloned from sweet potato, an important starch crop. A high expression level of IbSSI was detected in the leaves and storage roots of the sweet potato. Its overexpression significantly increased the content and granule size of starch and the proportion of amylopectin by up-regulating starch biosynthetic genes in the transgenic plants compared with wild-type plants (WT) and RNA interference plants. The frequency of chains with degree of polymerization (DP) 5-8 decreased in the amylopectin fraction of starch, whereas the proportion of chains with DP 9-25 increased in the IbSSI-overexpressing plants compared with WT plants. Further analysis demonstrated that IbSSI was responsible for the synthesis of chains with DP ranging from 9 to 17, which represents a different chain length spectrum in vivo from its counterparts in rice and wheat. These findings suggest that the IbSSI gene plays important roles in determining the content, composition, granule size and structure of starch in sweet potato. This gene may be utilized to improve the content and quality of starch in sweet potato and other plants.

  19. Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells.

    Science.gov (United States)

    Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J

    2015-05-01

    The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  20. The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool.

    Science.gov (United States)

    Zhao, Nan; Wang, Yumei; Hua, Jinping

    2018-02-11

    Intergenomic gene transfer (IGT) is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies) contribute to gene transfer by mediating recombination in the recipient genome.

  1. The Roles of Mitochondrion in Intergenomic Gene Transfer in Plants: A Source and a Pool

    Directory of Open Access Journals (Sweden)

    Nan Zhao

    2018-02-01

    Full Text Available Intergenomic gene transfer (IGT is continuous in the evolutionary history of plants. In this field, most studies concentrate on a few related species. Here, we look at IGT from a broader evolutionary perspective, using 24 plants. We discover many IGT events by assessing the data from nuclear, mitochondrial and chloroplast genomes. Thus, we summarize the two roles of the mitochondrion: a source and a pool. That is, the mitochondrion gives massive sequences and integrates nuclear transposons and chloroplast tRNA genes. Though the directions are opposite, lots of likenesses emerge. First, mitochondrial gene transfer is pervasive in all 24 plants. Second, gene transfer is a single event of certain shared ancestors during evolutionary divergence. Third, sequence features of homologies vary for different purposes in the donor and recipient genomes. Finally, small repeats (or micro-homologies contribute to gene transfer by mediating recombination in the recipient genome.

  2. Horizontal Gene Transfer of Pectinases from Bacteria Preceded the Diversification of Stick and Leaf Insects.

    Science.gov (United States)

    Shelomi, Matan; Danchin, Etienne G J; Heckel, David; Wipfler, Benjamin; Bradler, Sven; Zhou, Xin; Pauchet, Yannick

    2016-05-23

    Genes acquired by horizontal transfer are increasingly being found in animal genomes. Understanding their origin and evolution requires knowledge about the phylogenetic relationships from both source and recipient organisms. We used RNASeq data and respective assembled transcript libraries to trace the evolutionary history of polygalacturonase (pectinase) genes in stick insects (Phasmatodea). By mapping the distribution of pectinase genes on a Polyneoptera phylogeny, we identified the transfer of pectinase genes from known phasmatodean gut microbes into the genome of an early euphasmatodean ancestor that took place between 60 and 100 million years ago. This transfer preceded the rapid diversification of the suborder, enabling symbiont-free pectinase production that would increase the insects' digestive efficiency and reduce dependence on microbes. Bacteria-to-insect gene transfer was thought to be uncommon, however the increasing availability of large-scale genomic data may change this prevailing notion.

  3. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees.

    Science.gov (United States)

    Kordi, Misagh; Bansal, Mukul S

    2017-06-01

    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  4. Horizontal gene transfer and the evolution of transcriptionalregulation in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Dehal, Paramvir S.; Arkin, Adam P.

    2007-12-20

    Background: Most bacterial genes were acquired by horizontalgene transfer from other bacteria instead of being inherited bycontinuous vertical descent from an ancient ancestor}. To understand howthe regulation of these {acquired} genes evolved, we examined theevolutionary histories of transcription factors and of regulatoryinteractions from the model bacterium Escherichia coli K12. Results:Although most transcription factors have paralogs, these usually arose byhorizontal gene transfer rather than by duplication within the E. colilineage, as previously believed. In general, most neighbor regulators --regulators that are adjacent to genes that they regulate -- were acquiredby horizontal gene transfer, while most global regulators evolvedvertically within the gamma-Proteobacteria. Neighbor regulators wereoften acquired together with the adjacent operon that they regulate, sothe proximity might be maintained by repeated transfers (like "selfishoperons"). Many of the as-yet-uncharacterized (putative) regulators havealso been acquired together with adjacent genes, so we predict that theseare neighbor regulators as well. When we analyzed the histories ofregulatory interactions, we found that the evolution of regulation byduplication was rare, and surprisingly, many of the regulatoryinteractions that are shared between paralogs result from convergentevolution. Another surprise was that horizontally transferred genes aremore likely than other genes to be regulated by multiple regulators, andmost of this complex regulation probably evolved after the transfer.Conclusions: Our results highlight the rapid evolution of niche-specificgene regulation in bacteria.

  5. Plasmid transfer by conjugation as a possible route of horizontal gene transfer and recombination in Xylella fastidiosa

    Science.gov (United States)

    Horizontal gene transfer is an important component of evolution and adaptation of bacterial species. Xylella fastidiosa has the ability to incorporate exogenous DNA into its genome by homologous recombination at relatively high rates. This genetic recombination is believed to play a role in adaptati...

  6. Polyketide genes in the marine sponge Plakortis simplex: a new group of mono-modular type I polyketide synthases from sponge symbionts.

    Science.gov (United States)

    Della Sala, Gerardo; Hochmuth, Thomas; Costantino, Valeria; Teta, Roberta; Gerwick, William; Gerwick, Lena; Piel, Jörn; Mangoni, Alfonso

    2013-12-01

    Sponge symbionts are a largely unexplored source of new and unusual metabolic pathways. Insights into the distribution and function of metabolic genes of sponge symbionts are crucial to dissect and exploit their biotechnological potential. Screening of the metagenome of the marine sponge Plakortis simplex led to the discovery of the swf family, a new group of mono-modular type I polyketide synthase/fatty acid synthase (PKS/FAS) specifically associated with sponge symbionts. Two different examples of the swf cluster were present in the metagenome of P. simplex. A third example of the cluster is present in the previously sequenced genome of a poribacterium from the sponge Aplysina aerophoba but was formerly considered orthologous to the wcb/rkp cluster. The swf cluster was also found in six additional species of sponges. Therefore, the swf cluster represents the second group of mono-modular PKS, after the supA family, to be widespread in marine sponges. The putative swf operon consists of swfA (type I PKS/FAS), swfB (reductase and sulphotransferase domains) and swfC (radical S-adenosylmethionine, or radical SAM). Activation of the acyl carrier protein (ACP) domain of the SwfA protein to its holo-form by co-expression with Svp is the first functional proof of swf type genes in marine sponges. However, the precise biosynthetic role of the swf clusters remains unknown. © 2013 The Authors. Environmental Microbiology Reports published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  7. Ultrasound -Assisted Gene Transfer to Adipose Tissue-Derived Stem/Progenitor Cells (ASCs)

    Science.gov (United States)

    Miyamoto, Yoshitaka; Ueno, Hitomi; Hokari, Rei; Yuan, Wenji; Kuno, Shuichi; Kakimoto, Takashi; Enosawa, Shin; Negishi, Yoichi; Yoshinaka, Kiyoshi; Matsumoto, Yoichiro; Chiba, Toshio; Hayashi, Shuji

    2011-09-01

    In recent years, multilineage adipose tissue-derived stem cells (ASCs) have become increasingly attractive as a promising source for cell transplantation and regenerative medicine. Particular interest has been expressed in the potential to make tissue stem cells, such as ASCs and marrow stromal cells (MSCs), differentiate by gene transfection. Gene transfection using highly efficient viral vectors such as adeno- and sendai viruses have been developed for this purpose. Sonoporation, or ultrasound (US)-assisted gene transfer, is an alternative gene manipulation technique which employs the creation of a jet stream by ultrasonic microbubble cavitation. Sonoporation using non-viral vectors is expected to be a much safer, although less efficient, tool for prospective clinical gene therapy. In this report, we assessed the efficacy of the sonoporation technique for gene transfer to ASCs. We isolated and cultured adipocyets from mouse adipose tissue. ASCs that have the potential to differentiate with transformation into adipocytes or osteoblasts were obtained. Using the US-assisted system, plasmid DNA containing beta-galactosidase (beta-Gal) and green fluorescent protein (GFP) genes were transferred to the ASCs. For this purpose, a Sonopore 4000 (NEPAGENE Co.) and a Sonazoid (Daiichi Sankyo Co.) instrument were used in combination. ASCs were subjected to US (3.1 MHz, 50% duty cycle, burst rate 2.0 Hz, intensity 1.2 W/cm2, exposure time 30 sec). We observed that the gene was more efficiently transferred with increased concentrations of plasmid DNA (5-150 μg/mL). However, further optimization of the US parameters is required, as the gene transfer efficiency was still relatively low. In conclusion, we herein demonstrate that a gene can be transferred to ASCs using our US-assisted system. In regenerative medicine, this system might resolve the current issues surrounding the use of viral vectors for gene transfer.

  8. In utero recombinant adeno-associated virus gene transfer in mice, rats, and primates

    Directory of Open Access Journals (Sweden)

    Marrero Luis

    2003-09-01

    Full Text Available Abstract Background Gene transfer into the amniotic fluid using recombinant adenovirus vectors was shown previously to result in high efficiency transfer of transgenes into the lungs and intestines. Adenovirus mediated in utero gene therapy, however, resulted in expression of the transgene for less than 30 days. Recombinant adenovirus associated viruses (rAAV have the advantage of maintaining the viral genome in daughter cells thus providing for long-term expression of transgenes. Methods Recombinant AAV2 carrying green fluorescent protein (GFP was introduced into the amniotic sac of fetal rodents and nonhuman primates. Transgene maintenance and expression was monitor. Results Gene transfer resulted in rapid uptake and long-term gene expression in mice, rats, and non-human primates. Expression and secretion of the reporter gene, GFP, was readily demonstrated within 72 hours post-therapy. In long-term studies in rats and nonhuman primates, maintenance of GFP DNA, protein expression, and reporter gene secretion was documented for over one year. Conclusions Because only multipotential stem cells are present at the time of therapy, these data demonstrated that in utero gene transfer with AAV2 into stem cells resulted in long-term systemic expression of active transgene roducts. Thus, in utero gene transfer via the amniotic fluid may be useful in treatment of gene disorders.

  9. Cross-species gene transfer; implications for a new theory of evolution.

    Science.gov (United States)

    Syvanen, M

    1985-01-21

    It has been established that genes can be transferred and expressed among procaryotes of different species. I am hypothesizing--and there is mounting evidence for this conclusion--that genes are transferred and expressed among all species, and that such exchange is facilitated by, and can help account for, the existence of the biological unities, from the uniform genetic code to the cross-species similarity of the stages of embryological development. If this idea is correct, the uniformity of the genetic code would allow organisms to decipher and use genes transposed from chromosomes of foreign species, and the shared sequence of embryological development within each phylum would allow the organism to integrate these genes, particularly when the genes affect complex morphological traits. The cross-species gene transfer model could help explain many observations which have puzzled evolutionists, such as rapid bursts in evolution and the widespread occurrence of parallelism in the fossil record.

  10. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  11. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    Science.gov (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  12. Intrapleural 'outside-in' gene therapy: therapeutics for organs of the chest via gene transfer to the pleura.

    Science.gov (United States)

    Heguy, Adriana; Crystal, Ronald G

    2005-10-01

    The pleural space is an attractive site for using viral vectors to deliver gene products to the lung parenchyma, other thoracic structures and the systemic circulation. The advantages of intrapleural gene transfer using viral vectors include: (i) easy accessibility; (ii) large surface area; (iii) ability to provide high concentrations of secreted gene products to chest structures; (iv) low risk of detrimental effects of possible vector-induced inflammation compared with intravascular delivery; and (v) because it is local, lower vector doses can be used to deliver therapeutic genes to thoracic structures than less efficient systemic routes. Examples of pleural gene transfer include the use of adenovirus vectors to treat mesothelioma by transiently expressing genes that encode toxic proteins, immunomodulatory molecules or anti-angiogenesis factors. Intrapleural delivery of adeno-associated viral vectors represents an efficient strategy to treat alpha1-antitrypsin (alpha1AT) deficiency, achieving high lung and systemic therapeutic levels of alpha1AT. Intrapleural delivery of gene transfer vectors holds promise for the treatment of diseases requiring transient, localized gene expression, as well as sustained expression of genes to correct hereditary disorders requiring localized or systemic expression of the therapeutic protein.

  13. Arabidopsis thaliana sucrose phosphate synthase (sps) genes are expressed differentially in organs and tissues, and their transcription is regulated by osmotic stress.

    Science.gov (United States)

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-11-01

    Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Alterations in radioresistance of eucaryotic cells after the transfer of genomic wildtype DNA and metallothionein genes

    International Nuclear Information System (INIS)

    Lohrer, H.

    1987-01-01

    The presented paper describes experiments concerning the alteration of radiosensitivity of eucaryotic cells after gene transfer. Ionizing radiation (γ- or X-ray) induces DNA single- or double strand breaks, which are religated by an unknown repair system. Repair deficient cells are highly sensitive to ionizing radiation. In the experiments described, cells from a patient with the heritable disease Ataxia telangiectasia were used as well as two X-ray sensitive CHO mutant cell lines. After gene transfer of an intact human DNA repair gene or a metallothionein gene the cells should regain radioresistance. (orig.) [de

  15. Modifier Genes for Mouse Phosphatidylinositol Transfer Protein alpha (vibrator) That Bypass Juvenile Lethality

    NARCIS (Netherlands)

    Concepcion, Dorothy; Johannes, Frank; Lo, Yuan Hung; Yao, Jay; Fong, Jerry; Hamilton, Bruce A.

    Phosphatidylinositol transfer proteins (PITPs) mediate lipid signaling and membrane trafficking in eukaryotic cells. Loss-of-function mutations of the gene encoding PITP alpha in mice result in a range of dosage-sensitive phenotypes, including neurological dysfunction, neurodegeneration, and

  16. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  17. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review

    Directory of Open Access Journals (Sweden)

    S.N. Koval

    2017-08-01

    Full Text Available Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL, enzyme aldosterone synthase (AS, which takes a direct part in the formation of this hormone, as well as gene polymorphisms of AS, which have not only molecular genetic, but also differential diagnostic and therapeutic significance for secondary forms of arterial hypertension, abdominal obesity (AO, metabolic syndrome (MS, adrenal pathology and other endocrine disorders. AL is a steroid (mineralocorticoid hormone of the adrenal cortex, which is synthesized from cholesterol (CH, mainly in the glomerular zone of the adrenal glands, is released under the action of angiotensin II (A II and potassium ions (K+. AL acti­vity is mediated through the corresponding mineralocorticoid receptors (MKR. The particular importance in AH and MS development belongs to AL activation and MKR density in adipocytes, this phenomenon is accompanied by increased expression of pro-inflammatory cytokines, leptin, an adipogenic effect, and the inhibition of MCR activity is accompanied by increased production of adiponectin, which is more pronounced in patients with AH. Aldosterone synthase, a mitochondrial human enzyme encoded by the CYP11B2 gene (cytochrome P450, family 11, subfamily B, polypeptide 2 is located on the 8th chromosome. AS belongs to the superfamily of cytochrome P450 and regulates the synthesis of AL hormone. The CYP11B2 gene encodes the key enzyme for the synthesis of AL 18-hydroxylase. In scientific papers, single nucleotide polymorphism (SNP of AS gene is often studied, such as 5312T, Intron 2, Lys-173/Arg; T-344C, 3097 C/A. 227 SNP of the AS gene were identified in different

  18. Ambient pH controls glycogen levels by regulating glycogen synthase gene expression in Neurospora crassa. New insights into the pH signaling pathway.

    Science.gov (United States)

    Cupertino, Fernanda Barbosa; Freitas, Fernanda Zanolli; de Paula, Renato Magalhães; Bertolini, Maria Célia

    2012-01-01

    Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn) in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacC(KO) strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8). These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa.

  19. Ambient pH controls glycogen levels by regulating glycogen synthase gene expression in Neurospora crassa. New insights into the pH signaling pathway.

    Directory of Open Access Journals (Sweden)

    Fernanda Barbosa Cupertino

    Full Text Available Glycogen is a polysaccharide widely distributed in microorganisms and animal cells and its metabolism is under intricate regulation. Its accumulation in a specific situation results from the balance between glycogen synthase and glycogen phosphorylase activities that control synthesis and degradation, respectively. These enzymes are highly regulated at transcriptional and post-translational levels. The existence of a DNA motif for the Aspergillus nidulans pH responsive transcription factor PacC in the promoter of the gene encoding glycogen synthase (gsn in Neurospora crassa prompted us to investigate whether this transcription factor regulates glycogen accumulation. Transcription factors such as PacC in A. nidulans and Rim101p in Saccharomyces cerevisiae play a role in the signaling pathway that mediates adaptation to ambient pH by inducing the expression of alkaline genes and repressing acidic genes. We showed here that at pH 7.8 pacC was over-expressed and gsn was down-regulated in wild-type N. crassa coinciding with low glycogen accumulation. In the pacC(KO strain the glycogen levels and gsn expression at alkaline pH were, respectively, similar to and higher than the wild-type strain at normal pH (5.8. These results characterize gsn as an acidic gene and suggest a regulatory role for PACC in gsn expression. The truncated recombinant protein, containing the DNA-binding domain specifically bound to a gsn DNA fragment containing the PacC motif. DNA-protein complexes were observed with extracts from cells grown at normal and alkaline pH and confirmed by ChIP-PCR analysis. The PACC present in these extracts showed equal molecular mass, indicating that the protein is already processed at normal pH, in contrast to A. nidulans. Together, these results show that the pH signaling pathway controls glycogen accumulation by regulating gsn expression and suggest the existence of a different mechanism for PACC activation in N. crassa.

  20. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    OpenAIRE

    Chang, Keejong; Qian, Jin; Jiang, MeiSheng; Liu, Yi-Hsin; Wu, Ming-Che; Chen, Chi-Dar; Lai, Chao-Kuen; Lo, Hsin-Lung; Hsiao, Chin-Ton; Brown, Lucy; Bolen, James; Huang, Hsiao-I; Ho, Pei-Yu; Shih, Ping Yao; Yao, Chen-Wen

    2002-01-01

    Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT) that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal ...

  1. In Vivo Targeted Gene Transfer by Direct Irradiation with Nanosecond Pulsed Laser

    Science.gov (United States)

    Ogura, Makoto; Sato, Shunichi; Ashida, Hiroshi; Obara, Minoru

    2004-10-01

    We demonstrated in vivo targeted gene transfer to rat skin by direct irradiation with nanosecond laser pulses without major side effects. Expressions of enhanced green fluorescent protein (EGFP) were observed only in the area irradiated with laser pulses; in the skin, epidermal cells were selectively transfected. Unlike other physical methods, this method enables noncontact gene transfer. Moreover, the laser intensity required in this method is as low as 20 MW/cm2, and thus fiber-based beam delivery is possible.

  2. Optimization of cationic lipid mediated gene transfer: structure-function, physico-chemical, and cellular studies.

    Science.gov (United States)

    Carrière, Marie; Tranchant, Isabelle; Niore, Pierre-Antoine; Byk, Gerardo; Mignet, Nathalie; Escriou, Virginie; Scherman, Daniel; Herscovici, Jean

    2002-01-01

    The rationale design aimed at the enhancement of cationic lipid mediated gene transfer is discussed. These improvements are based on the straight evaluation of the structure-activity relationship and on the introduction of new structures. Much attention have been given to the supramolecular structures of the lipid/DNA complexes, to the effect of serum on gene transfer and to the intracellular trafficking of the lipoplexes. Finally new avenue using reducible cationic lipids has been discussed.

  3. MUC1 and other sialoglycoconjugates inhibit adenovirus-mediated gene transfer to epithelial cells.

    Science.gov (United States)

    Arcasoy, S M; Latoche, J; Gondor, M; Watkins, S C; Henderson, R A; Hughey, R; Finn, O J; Pilewski, J M

    1997-10-01

    Recombinant adenoviruses are currently being evaluated as gene transfer vectors for the treatment of airway diseases. Recent evidence indicates that gene transfer to differentiated airway epithelial cells is inefficient. We hypothesized that apical membrane glycoconjugates, such as the transmembrane mucin MUC1, reduce the efficiency of adenovirus-mediated gene transfer. To address this, studies were performed in primary bronchial epithelial and Madin Darby canine kidney (MDCK) cells transduced to express human MUC1. Colocalization of MUC1 and an adenoviral lacZ transgene in the bronchial epithelial cells revealed that at several multiplicities of infection, the percentage of cells expressing lacZ was five-fold less in MUC1-expressing cells. Moreover, lacZ expression was three- to eight-fold lower in MUC1-expressing than in control MDCK cells, demonstrating that MUC1 interferes with gene transfer and is not merely a phenotypic marker of a cell that is refractory to adenovirus infection. Neuraminidase pretreatment of cells to remove sialic acid residues prior to viral adsorption increased the efficiency of gene transfer two- to five-fold in human airway and MDCK cells, and in a xenograft model of human airway. This effect was also observed in cultured cells that do not express MUC1, suggesting that other sialylated glycoconjugates impact on the efficiency of gene transfer. An inhibitory effect of negatively charged glycoconjugates on adenovirus binding was further supported by the finding that adsorption of adenovirus with a polycation significantly increased gene transfer efficiency. These data demonstrate for the first time that sialoglycoconjugates on epithelial cells reduce the efficiency of adenovirus-mediated gene transfer.

  4. Haplotype association and synergistic effect of human aldosterone synthase (CYP11B2) gene polymorphisms causing susceptibility to essential hypertension in Indian patients.

    Science.gov (United States)

    Vamsi, Uppuluri Mohana; Swapna, Nagalingam; Padma, Gunda; Vishnupriya, Satti; Padma, Tirunilai

    Aldosterone synthase (CYP11B2) is a key enzyme involved in the terminal steps of aldosterone biosynthesis. Genetic variability in CYP11B2 gene has been associated with heterogeneous aldosterone production, which can affect sodium homeostasis and thereby regulation of blood pressure. Hence, the present study was aimed to explore the single-locus variations, haplotype and epistasis patterns of CYP11B2 (C-344T, intron-2 gene conversion and Lys173Arg) gene polymorphisms, and the risk contributed by them to the development of essential hypertension (EHT). A total of 279 hypertensive patients and 200 normotensive controls were enrolled in this study. C-344T and Lys173Arg polymorphisms of CYP11B2 gene were genotyped by PCR-RFLP method and intron-2 gene conversion (IC) polymorphism by allele-specific PCR analysis. Single-locus analysis revealed significant association of CYP11B2 C-344T and Lys173Arg polymorphisms with EHT (p < 0.05). Considering the sexes, Lys173 allele was found to be at risk for hypertension in males (OR 1.40; 95% CI = 1.01-1.96). Unphased haplotype analysis revealed H1 (T-Conv-Lys; p = 0.0017) to have significant risk for EHT, while haplotype H4 (T-Wt-Arg) had a significant protective effect. Multifactor dimensionality reduction (MDR) interaction analysis found the overall best model with C-344T and IC polymorphisms exhibiting strong synergistic effect. The present study revealed a strong synergistic effect of CYP11B2 C-344T and IC polymorphisms causing susceptibility to EHT and haplotype H1 (-344T-Conv-Lys173) as the risk-conferring factor for hypertension predisposition.

  5. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases.

    Science.gov (United States)

    Diler, S B; Öden, A

    2016-02-01

    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  6. miR-71 and miR-263 Jointly Regulate Target Genes Chitin synthase and Chitinase to Control Locust Molting.

    Science.gov (United States)

    Yang, Meiling; Wang, Yanli; Jiang, Feng; Song, Tianqi; Wang, Huimin; Liu, Qing; Zhang, Jie; Zhang, Jianzhen; Kang, Le

    2016-08-01

    Chitin synthase and chitinase play crucial roles in chitin biosynthesis and degradation during insect molting. Silencing of Dicer-1 results in reduced levels of mature miRNAs and severely blocks molting in the migratory locust. However, the regulatory mechanism of miRNAs in the molting process of locusts has remained elusive. In this study, we found that in chitin metabolism, two crucial enzymes, chitin synthase (CHS) and chitinase (CHT) were regulated by miR-71 and miR-263 during nymph molting. The coding sequence of CHS1 and the 3'-untranslated region of CHT10 contain functional binding sites for miR-71 and miR-263, respectively. miR-71/miR-263 displayed cellular co-localization with their target genes in epidermal cells and directly interacted with CHS1 and CHT10 in the locust integument, respectively. Injections of miR-71 and miR-263 agomirs suppressed the expression of CHS1 and CHT10, which consequently altered chitin production of new and old cuticles and resulted in a molting-defective phenotype in locusts. Unexpectedly, reduced expression of miR-71 and miR-263 increased CHS1 and CHT10 mRNA expression and led to molting defects similar to those induced by miRNA delivery. This study reveals a novel function and balancing modulation pattern of two miRNAs in chitin biosynthesis and degradation, and it provides insight into the underlying molecular mechanisms of the molting process in locusts.

  7. Analysis of cellulose synthase genes from domesticated apple identifies collinear genes WDR53 and CesA8A: partial co-expression, bicistronic mRNA, and alternative splicing of CESA8A.

    Science.gov (United States)

    Guerriero, Gea; Spadiut, Oliver; Kerschbamer, Christine; Giorno, Filomena; Baric, Sanja; Ezcurra, Inés

    2012-10-01

    Cellulose synthase (CesA) genes constitute a complex multigene family with six major phylogenetic clades in angiosperms. The recently sequenced genome of domestic apple, Malus×domestica, was mined for CesA genes, by blasting full-length cellulose synthase protein (CESA) sequences annotated in the apple genome against protein databases from the plant models Arabidopsis thaliana and Populus trichocarpa. Thirteen genes belonging to the six angiosperm CesA clades and coding for proteins with conserved residues typical of processive glycosyltransferases from family 2 were detected. Based on their phylogenetic relationship to Arabidopsis CESAs, as well as expression patterns, a nomenclature is proposed to facilitate further studies. Examination of their genomic organization revealed that MdCesA8-A is closely linked and co-oriented with WDR53, a gene coding for a WD40 repeat protein. The WDR53 and CesA8 genes display conserved collinearity in dicots and are partially co-expressed in the apple xylem. Interestingly, the presence of a bicistronic WDR53-CesA8A transcript was detected in phytoplasma-infected phloem tissues of apple. The bicistronic transcript contains a spliced intergenic sequence that is predicted to fold into hairpin structures typical of internal ribosome entry sites, suggesting its potential cap-independent translation. Surprisingly, the CesA8A cistron is alternatively spliced and lacks the zinc-binding domain. The possible roles of WDR53 and the alternatively spliced CESA8 variant during cellulose biosynthesis in M.×domestica are discussed.

  8. Endogenous post-transcriptional gene silencing of flavone synthase resulting in high accumulation of anthocyanins in black dahlia cultivars.

    Science.gov (United States)

    Deguchi, Ayumi; Ohno, Sho; Hosokawa, Munetaka; Tatsuzawa, Fumi; Doi, Motoaki

    2013-05-01

    Black color in flowers is a highly attractive trait in the floricultural industry, but its underlying mechanisms are largely unknown. This study was performed to identify the bases of the high accumulation of anthocyanidins in black cultivars and to determine whether the high accumulation of total anthocyanidins alone leads to the black appearance. Our approach was to compare black dahlia (Dahlia variabilis) cultivars with purple cultivars and a purple flowering mutant of a black cultivar, using pigment and molecular analyses. Black cultivars characteristically exhibited low lightness, high petal accumulation of cyanidin and total anthocyanidins without flavones, and marked suppression of flavone synthase (DvFNS) expression. A comparative study using black and purple cultivars revealed that neither the absence of flavones nor high accumulation of total anthocyanidins is solely sufficient for black appearance, but that cyanidin content in petals is also an important factor in the phenotype. A study comparing the black cultivar 'Kokucho' and its purple mutant showed that suppression of DvFNS abolishes the competition between anthocyanidin and flavone synthesis and leads to accumulation of cyanidin and total anthocyanidins that produce a black appearance. Surprisingly, in black cultivars the suppression of DvFNS occurred in a post-transcriptional manner, as determined by small RNA mapping.

  9. Targeting a polyketide synthase gene for Aspergillus carbonarius quantification and ochratoxin A assessment in grapes using real-time PCR

    International Nuclear Information System (INIS)

    Atoui, A.; Mathieu, F.; Lebrihi, A.

    2007-01-01

    Aspergillus carbonarius is an ochratoxin producing fungus that has been considered to be responsible of the ochratoxin A (OTA) contamination in grapes and wine. In order to monitor and quantify A. carbonarius, a specific primer pair Ac12RL O TAF/Ac12RL O TAR has been designed from the acyltransferase (AT) domain of the polyketide synthase sequence Ac12RL3 to amplify 141 bp PCR product. Among the mycotoxigenic fungi tested, only A. carbonarius gave a positive result. This specific primer pair was also successfully employed in real-time PCR conjugated with SYBR Green I dye for the direct quantification of this fungus in grape samples. A positive correlation (R2 = 0.81) was found between A. carbonarius DNA content and OTA concentration in 72 grape samples, allowing for the estimation of the potential risk from OTA contamination. Consequently, this work offers a quick alternative to conventional methods of OTA quantification and mycological detection and quantification of A. carbonarius in grapes. (author)

  10. Forest tent caterpillars (Malacosoma disstria) induce local and systemic diurnal emissions of terpenoid volatiles in hybrid poplar (Populus trichocarpa x deltoides): cDNA cloning, functional characterization, and patterns of gene expression of (-)-germacrene D synthase, PtdTPS1.

    Science.gov (United States)

    Arimura, Gen-Ichiro; Huber, Dezene P W; Bohlmann, Jörg

    2004-02-01

    Feeding forest tent caterpillars (FTCs) induced local and systemic diurnal emissions of (-)-germacrene D, along with (E)-beta-ocimene, linalool, (E)-4,8-dimethyl-1,3,7-nonatriene (DMNT), benzene cyanide, and (E,E)-alpha-farnesene, from leaves of hybrid poplar. FTC feeding induced substantially higher levels of volatiles in local and systemic leaves than did mechanical wounding. A full-length poplar sesquiterpene synthase cDNA (PtdTPS1) was isolated and functionally identified as (-)-germacrene D synthase. Expression of PtdTPS1, expression of genes of early, intermediate and late steps in terpenoid biosynthesis, and expression of a lipoxygenase gene (PtdLOX1) were analyzed in local FTC-infested and systemic leaves. Transcript levels of PtdTPS1 and PtdLOX1 were strongly increased in response to herbivory. PtdTPS1 was also induced by mechanical wounding or by methyl jasmonate (MeJA) treatment. FTC feeding did not affect transcript levels of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), 1-deoxy-d-xylulose 5-phosphate reductoisomerase (DXR), and isoprene synthase (IPS). Two other TPS genes, PtdTPS2 and PtTPS3, and farnesyl diphosphate synthase were only very transiently induced. These results illustrate differential expression of terpenoid pathway genes in response to insect feeding and a key function of (-)-germacrene D synthase PtdTPS1 for herbivore-induced local and systemic volatile emissions in hybrid poplar. FTC-induced transcripts of PtdTPS1 followed diurnal rhythm. Spatial patterns of FTC-induced PtdTPS1 transcript accumulation revealed acropetal but not basipetal direction of the systemic response. Implications for tritrophic poplar-FTC-predator/parasitoid interactions are discussed.

  11. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  12. Distinct UV-B and UV-A/blue light signal transduction pathways induce chalcone synthase gene expression in Arabidopsis cells

    International Nuclear Information System (INIS)

    Christie, J.M.; Jenkins, G.I.

    1996-01-01

    UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species

  13. Phylogenetic diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff), detection of polyketide synthase gene and their antagonistic activity analysis.

    Science.gov (United States)

    Wang, Ya; Gao, Bo Liang; Li, Xi Xi; Zhang, Zhi Bin; Yan, Ri Ming; Yang, Hui Lin; Zhu, Du

    2015-11-01

    The biodiversity of plant endophytic fungi is enormous, numerous competent endophytic fungi are capable of providing different forms of fitness benefits to host plants and also could produce a wide array of bioactive natural products, which make them a largely unexplored source of novel compounds with potential bioactivity. In this study, we provided a first insights into revealing the diversity of culturable endophytic fungi in Dongxiang wild rice (Oryza rufipogon Griff.) from China using rDNA-ITS phylogenetic analysis. Here, the potential of fungi in producing bioactive natural products was estimated based on the beta-ketosynthase detected in the polyketide synthase (PKS) gene cluster and on the bioassay of antagonistic activity against two rice phytopathogens Thanatephorus cucumeris and Xanthomonas oryzae. A total of 229 endophytic fungal strains were validated in 19 genera. Among the 24 representative strains, 13 strains displayedantagonistic activity against the phytopathogens. Furthermore, PKS genes were detected in 9 strains, indicating their potential for synthesising PKS compounds. Our study confirms the phylogenetic diversity of endophytic fungi in O. rufipogon G. and highlights that endophytic fungi are not only promising resources of biocontrol agents against phytopathogens of rice plants, but also of bioactive natural products and defensive secondary metabolites. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  14. Functional and Evolutionary Characterization of a UDP-Xylose Synthase Gene from the Plant Pathogen Xylella fastidiosa, Involved in the Synthesis of Bacterial Lipopolysaccharide.

    Science.gov (United States)

    Alencar, Valquíria Campos; Jabes, Daniela Leite; Menegidio, Fabiano Bezerra; Sassaki, Guilherme Lanzi; de Souza, Lucas Rodrigo; Puzer, Luciano; Meneghetti, Maria Cecília Zorél; Lima, Marcelo Andrade; Tersariol, Ivarne Luis Dos Santos; de Oliveira, Regina Costa; Nunes, Luiz R

    2017-02-07

    Xylella fastidiosa is a plant-infecting bacillus, responsible for many important crop diseases, such as Pierce's disease of vineyards, citrus variegated chlorosis, and coffee leaf scorch (CLS), among others. Recent genomic comparisons involving two CLS-related strains, belonging to X. fastidiosa subsp. pauca, revealed that one of them carries a frameshift mutation that inactivates a gene encoding an oxidoreductase of the short-chain dehydrogenase/reductase (SDR) superfamily, which may play important roles in determining structural variations in bacterial glycans and glycoconjugates. However, the exact nature of this SDR has been a matter of controversy, as different annotations of X. fastidiosa genomes have implicated it in distinct reactions. To confirm the nature of this mutated SDR, a comparative analysis was initially performed, suggesting that it belongs to a subgroup of SDR decarboxylases, representing a UDP-xylose synthase (Uxs). Functional assays, using a recombinant derivative of this enzyme, confirmed its nature as XfUxs, and carbohydrate composition analyses, performed with lipopolysaccharide (LPS) molecules obtained from different strains, indicate that inactivation of the X. fastidiosa uxs gene affects the LPS structure among CLS-related X. fastidiosa strains. Finally, a comparative sequence analysis suggests that this mutation is likely to result in a morphological and evolutionary hallmark that differentiates two subgroups of CLS-related strains, which may influence interactions between these bacteria and their plant and/or insect hosts.

  15. Antibody-IL2 Fusion Protein Delivery by Gene Transfer

    National Research Council Canada - National Science Library

    Nicolet, Charles

    1997-01-01

    The purpose of the work described is to assess the feasibility of a gene therapy approach to deliver a specific antibody cytokine fusion protein called CC49-1L2 to a tumor expressing antigen reactive with the antibody...

  16. Ethical perception of cross-species gene transfer in plant | Amin ...

    African Journals Online (AJOL)

    The development of genetically modified (GM) rice to enrich its nutritional value, such as Vitamin C might involve gene transfer across different species. The purpose of this paper is to examine how the public in the Klang Valley region of Malaysia, perceive the development of GM rice which contain mice gene to increase its ...

  17. Transcriptional regulation of pWW0 transfer genes in Pseudomonas putida KT2440

    DEFF Research Database (Denmark)

    Lambertsen, L.M.; Molin, Søren; Kroer, N.

    2004-01-01

    The conjugative IncP-9 plasmid pWW0 (TOL) carries transfer genes, many of whose functions can be predicted from sequence similarities to the well-studied IncW and IncP-1 plasmids, and that are clustered with the replication and maintenance genes of the plasmid core. In this study we show that the...

  18. Chitinase-like (CTL and cellulose synthase (CESA gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L. bast fibers.

    Directory of Open Access Journals (Sweden)

    Natalia Mokshina

    Full Text Available Plant chitinases (EC 3.2.1.14 and chitinase-like (CTL proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs, belonging to glycoside hydrolase family 19 (GH19. Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21 that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8 was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2 that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type cellulosic walls.

  19. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin.

    Science.gov (United States)

    Kumar-Roiné, Shilpa; Matsui, Mariko; Chinain, Mireille; Laurent, Dominique; Pauillac, Serge

    2008-08-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was quantified via Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR). P-CTX-1B caused a concentration- and time-dependent induction of iNOS in RAW 264.7 cells but not in Neuro-2a cells. NO production was evidenced by increased nitrite levels in the 10 microM range after 48 h of RAW 264.7 cells exposure to LPS and P-CTX-1B (0.05 microg/ml and 6 nM, respectively). The expression of iNOS mRNA peaked at 8h for LPS then gradually decreased to low level at 48 h. In contrast, a sustained level was recorded with P-CTX-1B in the 8-48 h time interval. The addition of N(omega)-nitro-L-arginine methyl ester (L-NAME), a stereoselective NOS inhibitor, strongly diminished NO formation but had no effect on iNOS mRNA synthesis. The implication of NO in CFP paves the way for new therapies for both western and traditional medicines.

  20. Gene loss and horizontal gene transfer contributed to the genome evolution of the extreme acidophile Ferrovum

    Directory of Open Access Journals (Sweden)

    Sophie Roxana Ullrich

    2016-05-01

    Full Text Available Acid mine drainage (AMD, associated with active and abandoned mining sites, is a habitat for acidophilic microorganisms that gain energy from the oxidation of reduced sulfur compounds and ferrous iron and that thrive at pH below 4. Members of the recently proposed genus Ferrovum are the first acidophilic iron oxidizers to be described within the Betaproteobacteria. Although they have been detected as typical community members in AMD habitats worldwide, knowledge of their phylogenetic and metabolic diversity is scarce. Genomics approaches appear to be most promising in addressing this lacuna since isolation and cultivation of Ferrovum has proven to be extremely difficult and has so far only been successful for the designated type strain Ferrovum myxofaciens P3G. In this study, the genomes of two novel strains of Ferrovum (PN-J185 and Z-31 derived from water samples of a mine water treatment plant were sequenced. These genomes were compared with those of Ferrovum sp. JA12 that also originated from the mine water treatment plant, and of the type strain (P3G. Phylogenomic scrutiny suggests that the four strains represent three Ferrovum species that cluster in two groups (1 and 2. Comprehensive analysis of their predicted metabolic pathways revealed that these groups harbor characteristic metabolic profiles, notably with respect to motility, chemotaxis, nitrogen metabolism, biofilm formation and their potential strategies to cope with the acidic environment. For example, while the F. myxofaciens strains (group 1 appear to be motile and diazotrophic, the non-motile group 2 strains have the predicted potential to use a greater variety of fixed nitrogen sources. Furthermore, analysis of their genome synteny provides first insights into their genome evolution, suggesting that horizontal gene transfer and genome reduction in the group 2 strains by loss of genes encoding complete metabolic pathways or physiological features contributed to the observed

  1. Horizontal gene transfer in the innovation and adaptation of land plants

    OpenAIRE

    Yue, Jipei; Hu, Xiangyang; Huang, Jinling

    2013-01-01

    Horizontal gene transfer (HGT) has been well documented in prokaryotes and unicellular eukaryotes, but its role in plants and animals remains elusive. In a recent study, we showed that at least 57 families of nuclear genes in the moss Physcomitrella patens were acquired from prokaryotes, fungi or viruses and that HGT played a critical role in plant colonization of land. In this paper, we categorize all acquired genes based on their putative functions and biological processes, and further addr...

  2. The Agricultural Antibiotic Carbadox Induces Phage-mediated Gene Transfer in Salmonella

    Directory of Open Access Journals (Sweden)

    Bradley L. Bearson

    2014-02-01

    Full Text Available Antibiotics are used for disease therapeutic or preventative effects in humans and animals, as well as for enhanced feed conversion efficiency in livestock. Antibiotics can also cause undesirable effects in microbial populations, including selection for antibiotic resistance, enhanced pathogen invasion, and stimulation of horizontal gene transfer. Carbadox is a veterinary antibiotic used in the U.S. during the starter phase of swine production for improved feed efficiency and control of swine dysentery and bacterial swine enteritis. Carbadox has been shown in vitro to induce phage-encoded Shiga toxin in Shiga toxin-producing Escherichia coli and a phage-like element transferring antibiotic resistance genes in Brachyspira hyodysenteriae, but the effect of carbadox on prophages in other bacteria is unknown. This study examined carbadox exposure on prophage induction and genetic transfer in Salmonella enterica serovar Typhimurium, a human foodborne pathogen that frequently colonizes swine without causing disease. S. Typhimurium LT2 exposed to carbadox induced prophage production, resulting in bacterial cell lysis and release of virions that were visible by electron microscopy. Carbadox induction of phage-mediated gene transfer was confirmed by monitoring the transduction of a sodCIII::neo cassette in the Fels-1 prophage from LT2 to a recipient Salmonella strain. Furthermore, carbadox frequently induced generalized transducing phages in multidrug-resistant phage type DT104 and DT120 isolates, resulting in the transfer of chromosomal and plasmid DNA that included antibiotic resistance genes. Our research indicates that exposure of Salmonella to carbadox induces prophages that can transfer virulence and antibiotic resistance genes to susceptible bacterial hosts. Carbadox-induced, phage-mediated gene transfer could serve as a contributing factor in bacterial evolution during animal production, with prophages being a reservoir for bacterial fitness

  3. Cellular automata-based artificial life system of horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Ji-xin Liu

    2016-02-01

    Full Text Available Mutation and natural selection is the core of Darwin's idea about evolution. Many algorithms and models are based on this idea. However, in the evolution of prokaryotes, more and more researches have indicated that horizontal gene transfer (HGT would be much more important and universal than the authors had imagined. Owing to this mechanism, the prokaryotes not only become adaptable in nearly any environment on Earth, but also form a global genetic bank and a super communication network with all the genes of the prokaryotic world. Under this background, they present a novel cellular automata model general gene transfer to simulate and study the vertical gene transfer and HGT in the prokaryotes. At the same time, they use Schrodinger's life theory to formulate some evaluation indices and to discuss the intelligence and cognition of prokaryotes which is derived from HGT.

  4. Fundamental study on gene transfer utilizing magnetic force and jet injector

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, T.; Nakagami, H.; Akiyama, Y.; Nishjima, S. [Osaka University, Osaka (Japan)

    2017-03-15

    Recently, DNA vaccination is attracting attentions as a new therapeutic method for lifestyle diseases and autoimmune diseases. However, its clinical applications are limited because a safe and efficient gene transfer method has not been established yet. In this study, a new method of gene transfer was proposed which utilizes the jet injection and the magnetic transfection. The jet injection is a method to inject medical liquid by momentary high pressure without needle. The injected liquid diffuses in the bio tissue and the endocytosis is considered to be improved by the diffusion. The magnetic transfection is a method to deliver the conjugates of plasmid DNA and magnetic particles to the desired site by external magnetic field. It is expected that jet injection of the conjugates causes slight membrane disruptions and the traction of the conjugates by magnetic field induces the efficient gene transfer. In conclusion, the possibility of improvement of the gene expression by the combination of jet injection and magnetic transfection was confirmed.

  5. Widespread horizontal gene transfer from double-stranded RNA viruses to eukaryotic nuclear genomes.

    Science.gov (United States)

    Liu, Huiquan; Fu, Yanping; Jiang, Daohong; Li, Guoqing; Xie, Jiatao; Cheng, Jiasen; Peng, Youliang; Ghabrial, Said A; Yi, Xianhong

    2010-11-01

    Horizontal gene transfer commonly occurs from cells to viruses but rarely occurs from viruses to their host cells, with the exception of retroviruses and some DNA viruses. However, extensive sequence similarity searches in public genome databases for various organisms showed that the capsid protein and RNA-dependent RNA polymerase genes from totiviruses and partitiviruses have widespread homologs in the nuclear genomes of eukaryotic organisms, including plants, arthropods, fungi, nematodes, and protozoa. PCR amplification and sequencing as well as comparative evidence of junction coverage between virus and host sequences support the conclusion that these viral homologs are real and occur in eukaryotic genomes. Sequence comparison and phylogenetic analysis suggest that these genes were likely transferred horizontally from viruses to eukaryotic genomes. Furthermore, we present evidence showing that some of the transferred genes are conserved and expressed in eukaryotic organisms and suggesting that these viral genes are also functional in the recipient genomes. Our findings imply that horizontal transfer of double-stranded RNA viral genes is widespread among eukaryotes and may give rise to functionally important new genes, thus entailing that RNA viruses may play significant roles in the evolution of eukaryotes.

  6. 4G/5G variant of plasminogen activator inhibitor-1 gene and severe pregnancy-induced hypertension: subgroup analyses of variants of angiotensinogen and endothelial nitric oxide synthase.

    Science.gov (United States)

    Kobashi, Gen; Ohta, Kaori; Yamada, Hideto; Hata, Akira; Minakami, Hisanori; Sakuragi, Noriaki; Tamashiro, Hiko; Fujimoto, Seiichiro

    2009-01-01

    Pregnancy-induced hypertension (PIH) is a common cause of perinatal mortality. It is believed to result from the interaction of several factors, including those related to the blood coagulation system. We performed genotyping and subgroup analyses to determine if the 4G/5G genotypes of the plasminogen activator inhibitor-1 gene (PAI-1) play a role in the pathogenesis of PIH, and to evaluate possible interactions of the PAI-1 polymorphisms with those of the angiotensinogen gene (AGT) and the endothelial nitric oxide synthase gene (NOS3). An association study of PAI-1 polymorphism, and subgroup analyses of common variants of AGT and NOS3, among 128 patients with PIH and 376 healthy pregnant controls. No significant differences were found between the cases and controls in the frequencies of allele 4G or the 4G/4G genotype. In subgroup analyses, after adjustment for multiple comparison, a significant association with the AGT TT genotype was found among women with the PAI-1 4G/4G genotype, and an association with the NOS3 GA+AA genotype was found among women with the 5G/5G or 4G/5G genotypes. Our findings suggest that there are at least 2 pathways in the pathogenesis of severe PIH. However, with respect to early prediction and prevention of severe PIH, although the PAI-1 4G/4G genotype alone was not a risk factor for severe PIH, the fact that PAI-1 genotypes are associated with varying risks for severe PIH suggests that PAI-1 genotyping of pregnant women, in combination with other tests, may be useful in the development of individualized measures that may prevent severe PIH.

  7. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    Science.gov (United States)

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).