WorldWideScience

Sample records for synthase gene therapy

  1. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  2. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  3. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  4. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  5. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  6. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  7. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  8. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  9. Nitric oxide synthase gene G298 allele

    International Nuclear Information System (INIS)

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

    2004-01-01

    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  10. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  11. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  12. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  13. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  14. Radiotechnologies and gene therapy

    International Nuclear Information System (INIS)

    Xia Jinsong

    2001-01-01

    Gene therapy is an exciting frontier in medicine today. Radiologist will make an uniquely contribution to these exciting new technologies at every level by choosing sites for targeting therapy, perfecting and establishing routes of delivery, developing imaging strategies to monitor therapy and assess gene expression, developing radiotherapeutic used of gene therapy

  15. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  16. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  17. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-04-06

    Apr 6, 2009 ... Ginkgo biloba is one of the oldest living plant species and often referred to as “a .... GbGGDPS were analyzed and the sequence comparison was conducted ... function of plant GGDPS genes (Zhu et al., 1997) and human and.

  18. The anthocyanidin synthase gene from sweetpotato [Ipomoea ...

    African Journals Online (AJOL)

    USER

    2010-06-21

    Jun 21, 2010 ... The tissue expression profiles of IbANS indicated that it could be expressed in all tissues but at different ... al., 1997). Likewise, transcripts of the apple ANS gene are detected ... electrophoresis (EC250-90, E-C Apparatus Corporation) and ... Instruments Inc.) analyses and the RNA samples were stored in a.

  19. Tumor targeted gene therapy

    International Nuclear Information System (INIS)

    Kang, Joo Hyun

    2006-01-01

    Knowledge of molecular mechanisms governing malignant transformation brings new opportunities for therapeutic intervention against cancer using novel approaches. One of them is gene therapy based on the transfer of genetic material to an organism with the aim of correcting a disease. The application of gene therapy to the cancer treatment had led to the development of new experimental approaches such as suicidal gene therapy, inhibition of oncogenes and restoration of tumor-suppressor genes. Suicidal gene therapy is based on the expression in tumor cells of a gene encoding an enzyme that converts a prodrug into a toxic product. Representative suicidal genes are Herpes simplex virus type 1 thymidine kinase (HSV1-tk) and cytosine deaminase (CD). Especially, physicians and scientists of nuclear medicine field take an interest in suicidal gene therapy because they can monitor the location and magnitude, and duration of expression of HSV1-tk and CD by PET scanner

  20. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  1. History of gene therapy.

    Science.gov (United States)

    Wirth, Thomas; Parker, Nigel; Ylä-Herttuala, Seppo

    2013-08-10

    Two decades after the initial gene therapy trials and more than 1700 approved clinical trials worldwide we not only have gained much new information and knowledge regarding gene therapy in general, but also learned to understand the concern that has persisted in society. Despite the setbacks gene therapy has faced, success stories have increasingly emerged. Examples for these are the positive recommendation for a gene therapy product (Glybera) by the EMA for approval in the European Union and the positive trials for the treatment of ADA deficiency, SCID-X1 and adrenoleukodystrophy. Nevertheless, our knowledge continues to grow and during the course of time more safety data has become available that helps us to develop better gene therapy approaches. Also, with the increased understanding of molecular medicine, we have been able to develop more specific and efficient gene transfer vectors which are now producing clinical results. In this review, we will take a historical view and highlight some of the milestones that had an important impact on the development of gene therapy. We will also discuss briefly the safety and ethical aspects of gene therapy and address some concerns that have been connected with gene therapy as an important therapeutic modality. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  3. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  4. Gene therapy: An overview

    Directory of Open Access Journals (Sweden)

    Sudip Indu

    2013-01-01

    Full Text Available Gene therapy "the use of genes as medicine" involves the transfer of a therapeutic or working copy of a gene into specific cells of an individual in order to repair a faulty gene copy. The technique may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. The objective of gene therapy is to introduce new genetic material into target cells while causing no damage to the surrounding healthy cells and tissues, hence the treatment related morbidity is decreased. The delivery system includes a vector that delivers a therapeutic gene into the patient′s target cell. Functional proteins are created from the therapeutic gene causing the cell to return to a normal stage. The vectors used in gene therapy can be viral and non-viral. Gene therapy, an emerging field of biomedicine, is still at infancy and much research remains to be done before this approach to the treatment of condition will realize its full potential.

  5. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  6. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  7. Gene therapy in periodontics.

    Science.gov (United States)

    Chatterjee, Anirban; Singh, Nidhi; Saluja, Mini

    2013-03-01

    GENES are made of DNA - the code of life. They are made up of two types of base pair from different number of hydrogen bonds AT, GC which can be turned into instruction. Everyone inherits genes from their parents and passes them on in turn to their children. Every person's genes are different, and the changes in sequence determine the inherited differences between each of us. Some changes, usually in a single gene, may cause serious diseases. Gene therapy is 'the use of genes as medicine'. It involves the transfer of a therapeutic or working gene copy into specific cells of an individual in order to repair a faulty gene copy. Thus it may be used to replace a faulty gene, or to introduce a new gene whose function is to cure or to favorably modify the clinical course of a condition. It has a promising era in the field of periodontics. Gene therapy has been used as a mode of tissue engineering in periodontics. The tissue engineering approach reconstructs the natural target tissue by combining four elements namely: Scaffold, signaling molecules, cells and blood supply and thus can help in the reconstruction of damaged periodontium including cementum, gingival, periodontal ligament and bone.

  8. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  9. The ethics of gene therapy.

    Science.gov (United States)

    Chan, Sarah; Harris, John

    2006-10-01

    Recent developments have progressed in areas of science that pertain to gene therapy and its ethical implications. This review discusses the current state of therapeutic gene technologies, including stem cell therapies and genetic modification, and identifies ethical issues of concern in relation to the science of gene therapy and its application, including the ethics of embryonic stem cell research and therapeutic cloning, the risks associated with gene therapy, and the ethics of clinical research in developing new therapeutic technologies. Additionally, ethical issues relating to genetic modification itself are considered: the significance of the human genome, the distinction between therapy and enhancement, and concerns regarding gene therapy as a eugenic practice.

  10. Gene expression and gene therapy imaging

    International Nuclear Information System (INIS)

    Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

    2007-01-01

    The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

  11. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  12. Human Gene Therapy: Genes without Frontiers?

    Science.gov (United States)

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  13. Imaging reporter gene for monitoring gene therapy

    International Nuclear Information System (INIS)

    Beco, V. de; Baillet, G.; Tamgac, F.; Tofighi, M.; Weinmann, P.; Vergote, J.; Moretti, J.L.; Tamgac, G.

    2002-01-01

    Scintigraphic images can be obtained to document gene function at cellular level. This approach is presented here and the use of a reporter gene to monitor gene therapy is described. Two main ways are presented: either the use of a reporter gene coding for an enzyme the action of which will be monitored by radiolabeled pro-drug, or a cellular receptor gene, the action of which is documented by a radio labeled cognate receptor ligand. (author)

  14. Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

    Science.gov (United States)

    El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

    2016-11-01

    Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  15. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Science.gov (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  16. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  17. Imaging gene expression in gene therapy

    International Nuclear Information System (INIS)

    Wiebe, Leonard I.

    1997-01-01

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

  18. Imaging gene expression in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-12-31

    Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

  19. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    OpenAIRE

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  20. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  1. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Science.gov (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  2. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  3. American Society of Gene & Cell Therapy

    Science.gov (United States)

    ... Gene & Cell Therapy Defined Gene therapy and cell therapy are overlapping fields of biomedical research that aim to repair the direct cause of genetic diseases. Read More Gene & Cell Therapy FAQ's Read the most common questions raised by ...

  4. Gene therapy for hemophilia

    Science.gov (United States)

    Rogers, Geoffrey L.; Herzog, Roland W.

    2015-01-01

    Hemophilia is an X-linked inherited bleeding disorder consisting of two classifications, hemophilia A and hemophilia B, depending on the underlying mutation. Although the disease is currently treatable with intravenous delivery of replacement recombinant clotting factor, this approach represents a significant cost both monetarily and in terms of quality of life. Gene therapy is an attractive alternative approach to the treatment of hemophilia that would ideally provide life-long correction of clotting activity with a single injection. In this review, we will discuss the multitude of approaches that have been explored for the treatment of both hemophilia A and B, including both in vivo and ex vivo approaches with viral and nonviral delivery vectors. PMID:25553466

  5. Gene Therapy and Children (For Parents)

    Science.gov (United States)

    ... Staying Safe Videos for Educators Search English Español Gene Therapy and Children KidsHealth / For Parents / Gene Therapy ... that don't respond to conventional therapies. About Genes Our genes help make us unique. Inherited from ...

  6. Gene therapy for ocular diseases.

    Science.gov (United States)

    Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

    2011-05-01

    The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

  7. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  8. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  9. Gene therapy and reproductive medicine.

    Science.gov (United States)

    Stribley, John M; Rehman, Khurram S; Niu, Hairong; Christman, Gregory M

    2002-04-01

    To review the literature on the principles of gene therapy and its potential application in reproductive medicine. Literature review. Gene therapy involves transfer of genetic material to target cells using a delivery system, or vector. Attention has primarily focused on viral vectors. Significant problems remain to be overcome including low efficacy of gene transfer, the transient expression of some vectors, safety issues with modified adenoviruses and retroviruses, and ethical concerns. If these issues can be resolved, gene therapy will be applicable to an increasing spectrum of single and multiple gene disorders, as the Human Genome Project data are analyzed, and the genetic component of human disease becomes better understood. Gynecologic gene therapy has advanced to human clinical trials for ovarian carcinoma, and shows potential for the treatment of uterine leiomyomata. Obstetric applications of gene therapy, including fetal gene therapy, remain more distant goals. Concerns about the safety of human gene therapy research are being actively addressed, and remarkable progress in improving DNA transfer has been made. The first treatment success for a genetic disease (severe combined immunodeficiency disease) has been achieved, and ongoing research efforts will eventually yield clinical applications in many spheres of reproductive medicine.

  10. Gene therapy of thyroid carcinoma

    International Nuclear Information System (INIS)

    Zheng Wei; Tan Jian

    2007-01-01

    Normally, differentiated thyroid carcinoma(DTC) is a disease of good prognosis, but about 30% of the tumors are dedifferentiate, which are inaccessible to standard therapeutic procedures such as 'operation, 131 I therapy and thyroid hormone'. Both internal and abroad experts are researching a new therapy of dedifferentiated thyroid carcinoma--gene therapy. Many of them utilize methods of it, but follow different strategies: (1) transduction of the thyroid sodium/iodide transporter gene to make tissues that do not accumulate iodide treatable by 131 I therapy; (2) strengthening of the anti-tumor immune response; (3) suicide gene therapy; (4) depression the generation of tumor cells; (5) gene therapy of anti- vascularization. (authors)

  11. Gene therapy and radionuclides targeting therapy in mammary carcinoma

    International Nuclear Information System (INIS)

    Song Jinhua

    2003-01-01

    Breast carcinoma's gene therapy is a hotspot in study of the tumor's therapy in the recent years. Currently the major therapy methods that in the experimentative and primary clinical application phases include immunological gene therapy, multidrug resistance gene therapy, antisense oligonucleotide therapy and suicide gene therapy. The gene targeting brachytherapy, which is combined with gene therapy and radiotherapy has enhanced the killer effects of the suicide gene and nuclide in tumor cells. That has break a new path in tumor's gene therapy. The further study in this field will step up it's space to the clinical application

  12. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  13. Endothelial Nitric Oxide Synthase Overexpression Restores the Efficiency of Bone Marrow Mononuclear Cell-Based Therapy

    Science.gov (United States)

    Mees, Barend; Récalde, Alice; Loinard, Céline; Tempel, Dennie; Godinho, Marcia; Vilar, José; van Haperen, Rien; Lévy, Bernard; de Crom, Rini; Silvestre, Jean-Sébastien

    2011-01-01

    Bone marrow-derived mononuclear cells (BMMNCs) enhance postischemic neovascularization, and their therapeutic use is currently under clinical investigation. However, cardiovascular risk factors, including diabetes mellitus and hypercholesterolemia, lead to the abrogation of BMMNCs proangiogenic potential. NO has been shown to be critical for the proangiogenic function of BMMNCs, and increased endothelial NO synthase (eNOS) activity promotes vessel growth in ischemic conditions. We therefore hypothesized that eNOS overexpression could restore both the impaired neovascularization response and decreased proangiogenic function of BMMNCs in clinically relevant models of diabetes and hypercholesterolemia. Transgenic eNOS overexpression in diabetic, atherosclerotic, and wild-type mice induced a 1.5- to 2.3-fold increase in postischemic neovascularization compared with control. eNOS overexpression in diabetic or atherosclerotic BMMNCs restored their reduced proangiogenic potential in ischemic hind limb. This effect was associated with an increase in BMMNC ability to differentiate into cells with endothelial phenotype in vitro and in vivo and an increase in BMMNCs paracrine function, including vascular endothelial growth factor A release and NO-dependent vasodilation. Moreover, although wild-type BMMNCs treatment resulted in significant progression of atherosclerotic plaque in ischemic mice, eNOS transgenic atherosclerotic BMMNCs treatment even had antiatherogenic effects. Cell-based eNOS gene therapy has both proangiogenic and antiatherogenic effects and should be further investigated for the development of efficient therapeutic neovascularization designed to treat ischemic cardiovascular disease. PMID:21224043

  14. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  15. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  16. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  17. Gene Therapy for Parkinson's Disease

    Directory of Open Access Journals (Sweden)

    Rachel Denyer

    2012-01-01

    Full Text Available Current pharmacological and surgical treatments for Parkinson's disease offer symptomatic improvements to those suffering from this incurable degenerative neurological disorder, but none of these has convincingly shown effects on disease progression. Novel approaches based on gene therapy have several potential advantages over conventional treatment modalities. These could be used to provide more consistent dopamine supplementation, potentially providing superior symptomatic relief with fewer side effects. More radically, gene therapy could be used to correct the imbalances in basal ganglia circuitry associated with the symptoms of Parkinson's disease, or to preserve or restore dopaminergic neurons lost during the disease process itself. The latter neuroprotective approach is the most exciting, as it could theoretically be disease modifying rather than simply symptom alleviating. Gene therapy agents using these approaches are currently making the transition from the laboratory to the bedside. This paper summarises the theoretical approaches to gene therapy for Parkinson's disease and the findings of clinical trials in this rapidly changing field.

  18. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  19. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    OpenAIRE

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  20. Gene therapy and radiotherapy in malignant tumor

    International Nuclear Information System (INIS)

    Zhang Yaowen; Cao Yongzhen; Li Jin; Wang Qin

    2008-01-01

    Tumor treatment is one of the most important fields in medical research. Nowadays, a novel method which is combined gene therapy with radiotherapy plays an important role in the field of cancer research, and mainly includes immune gene therapy combined with radiotherapy, suicide gene therapy or tumor suppressor gene therapy combined with radiotherapy, antiangiogenesis gene therapy combined with radiotherapy and protective gene therapy combined with radiotherapy based on the technical features. This review summarized the current status of combined therapies of gene therapy and radiotherapy and possible mechanism. (authors)

  1. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  2. Gene Therapy Approaches to Hemoglobinopathies.

    Science.gov (United States)

    Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio

    2017-10-01

    Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Gene therapy for lipid disorders

    Directory of Open Access Journals (Sweden)

    Rader Daniel J

    2000-10-01

    Full Text Available Abstract Lipid disorders are associated with atherosclerotic vascular disease, and therapy is associated with a substantial reduction in cardiovascular events. Current approaches to the treatment of lipid disorders are ineffective in a substantial number of patients. New therapies for refractory hypercholesterolemia, severe hypertriglyceridemia, and low levels of high-density lipoprotein cholesterol are needed: somatic gene therapy is one viable approach. The molecular etiology and pathophysiology of most of the candidate diseases are well understood. Animal models exist for the diseases and in many cases preclinical proof-of-principle studies have already been performed. There has been progress in the development of vectors that provide long-term gene expression. New clinical gene therapy trials for lipid disorders are likely to be initiated within the next few years.

  4. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  5. Imaging after vascular gene therapy

    International Nuclear Information System (INIS)

    Manninen, Hannu I.; Yang, Xiaoming

    2005-01-01

    Targets for cardiovascular gene therapy currently include limiting restenosis after balloon angioplasty and stent placement, inhibiting vein bypass graft intimal hyperplasia/stenosis, therapeutic angiogenesis for cardiac and lower-limb ischemia, and prevention of thrombus formation. While catheter angiography is still standard method to follow-up vascular gene transfer, other modern imaging techniques, especially intravascular ultrasound (IVUS), magnetic resonance (MR), and positron emission tomography (PET) imaging provide complementary information about the therapeutic effect of vascular gene transfer in humans. Although molecular imaging of therapeutic gene expression in the vasculatures is still in its technical development phase, it has already offered basic medical science an extremely useful in vivo evaluation tool for non- or minimally invasive imaging of vascular gene therapy

  6. Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

    International Nuclear Information System (INIS)

    Rothenberg, M.; Hanson, M.R.

    1988-01-01

    A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

  7. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  8. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  9. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    Science.gov (United States)

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  10. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated ... specific human leukocyte antigen alleles that seem to be ... prevents the contractions of the uterine myometrium directly or by an ... an anatomical factor, to avoid this possible bias all candidates.

  11. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  12. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    In the current research, fragments of CHS genes were amplified ... transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the ..... First strand cDNA was amplified by 1 μg of.

  13. Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Figure 1. The Glu298Asp polymorphism of eNOS gene was shown by .... mechanisms by which eNOS Asp298 polymorphism ... Asp298 is exposed to selective proteolytic cleavage in ... grounds, inclusion and exclusion criteria for PE women ... attention to meta analysis study, it is more probable that.

  14. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  15. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  16. Gene Therapy in Cardiac Arrhythmias

    OpenAIRE

    Praveen, S.V; Francis, Johnson; Venugopal, K

    2006-01-01

    Gene therapy has progressed from a dream to a bedside reality in quite a few human diseases. From its first application in adenosine deaminase deficiency, through the years, its application has evolved to vascular angiogenesis and cardiac arrhythmias. Gene based biological pacemakers using viral vectors or mesenchymal cells tested in animal models hold much promise. Induction of pacemaker activity within the left bundle branch can provide stable heart rates. Genetic modification of the AV...

  17. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

    OpenAIRE

    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

    2013-01-01

    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  18. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    Science.gov (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  19. Gene Therapy for Color Blindness.

    Science.gov (United States)

    Hassall, Mark M; Barnard, Alun R; MacLaren, Robert E

    2017-12-01

    Achromatopsia is a rare congenital cause of vision loss due to isolated cone photoreceptor dysfunction. The most common underlying genetic mutations are autosomal recessive changes in CNGA3 , CNGB3 , GNAT2 , PDE6H , PDE6C , or ATF6 . Animal models of Cnga3 , Cngb3 , and Gnat2 have been rescued using AAV gene therapy; showing partial restoration of cone electrophysiology and integration of this new photopic vision in reflexive and behavioral visual tests. Three gene therapy phase I/II trials are currently being conducted in human patients in the USA, the UK, and Germany. This review details the AAV gene therapy treatments of achromatopsia to date. We also present novel data showing rescue of a Cnga3 -/- mouse model using an rAAV.CBA.CNGA3 vector. We conclude by synthesizing the implications of this animal work for ongoing human trials, particularly, the challenge of restoring integrated cone retinofugal pathways in an adult visual system. The evidence to date suggests that gene therapy for achromatopsia will need to be applied early in childhood to be effective.

  20. Gene therapy for lung cancer.

    Science.gov (United States)

    Toloza, Eric M; Morse, Michael A; Lyerly, H Kim

    2006-09-01

    Lung cancer patients suffer a 15% overall survival despite advances in chemotherapy, radiation therapy, and surgery. This unacceptably low survival rate is due to the usual finding of advanced disease at diagnosis. However, multimodality strategies using conventional therapies only minimally improve survival rates even in early stages of lung cancer. Attempts to improve survival in advanced disease using various combinations of platinum-based chemotherapy have demonstrated that no regimen is superior, suggesting a therapeutic plateau and the need for novel, more specific, and less toxic therapeutic strategies. Over the past three decades, the genetic etiology of cancer has been gradually delineated, albeit not yet completely. Understanding the molecular events that occur during the multistep process of bronchogenic carcinogenesis may make these tasks more surmountable. During these same three decades, techniques have been developed which allow transfer of functional genes into mammalian cells. For example, blockade of activated tumor-promoting oncogenes or replacement of inactivated tumor-suppressing or apoptosis-promoting genes can be achieved by gene therapy. This article will discuss the therapeutic implications of these molecular changes associated with bronchogenic carcinomas and will then review the status of gene therapies for treatment of lung cancer. (c) 2006 Wiley-Liss, Inc.

  1. Ethics of Gene Therapy Debated.

    Science.gov (United States)

    Borman, Stu

    1991-01-01

    Presented are the highlights of a press conference featuring biomedical ethicist LeRoy Walters of Georgetown University and attorney Andrew Kimbrell of the Foundation on Economic Trends. The opposing points of view of these two speakers serve to outline the pros and cons of the gene therapy issue. (CW)

  2. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  3. Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

    Science.gov (United States)

    Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2017-08-09

    Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

  4. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  5. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  6. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Gene therapy: theoretical and bioethical concepts.

    Science.gov (United States)

    Smith, Kevin R

    2003-01-01

    Gene therapy holds great promise. Somatic gene therapy has the potential to treat a wide range of disorders, including inherited conditions, cancers, and infectious diseases. Early progress has already been made in the treatment of a range of disorders. Ethical issues surrounding somatic gene therapy are primarily those concerned with safety. Germline gene therapy is theoretically possible but raises serious ethical concerns concerning future generations.

  9. Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

    Science.gov (United States)

    Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

    2018-04-01

    Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

  10. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

    Science.gov (United States)

    von Wettstein-Knowles, Penny

    2017-07-10

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  11. Gene Therapy in Cardiac Arrhythmias

    Directory of Open Access Journals (Sweden)

    Praveen S.V

    2006-04-01

    Full Text Available Gene therapy has progressed from a dream to a bedside reality in quite a few human diseases. From its first application in adenosine deaminase deficiency, through the years, its application has evolved to vascular angiogenesis and cardiac arrhythmias. Gene based biological pacemakers using viral vectors or mesenchymal cells tested in animal models hold much promise. Induction of pacemaker activity within the left bundle branch can provide stable heart rates. Genetic modification of the AV node mimicking beta blockade can be therapeutic in the management of atrial fibrillation. G protein overexpression to modify the AV node also is experimental. Modification and expression of potassium channel genes altering the delayed rectifier potassium currents may permit better management of congenital long QT syndromes. Arrhythmias in a failing heart are due to abnormal calcium cycling. Potential targets for genetic modulation include the sarcoplasmic reticulum calcium pump, calsequestrin and sodium calcium exchanger.Lastly the ethical concerns need to be addressed.

  12. Endocrine aspects of cancer gene therapy.

    Science.gov (United States)

    Barzon, Luisa; Boscaro, Marco; Palù, Giorgio

    2004-02-01

    The field of cancer gene therapy is in continuous expansion, and technology is quickly moving ahead as far as gene targeting and regulation of gene expression are concerned. This review focuses on the endocrine aspects of gene therapy, including the possibility to exploit hormone and hormone receptor functions for regulating therapeutic gene expression, the use of endocrine-specific genes as new therapeutic tools, the effects of viral vector delivery and transgene expression on the endocrine system, and the endocrine response to viral vector delivery. Present ethical concerns of gene therapy and the risk of germ cell transduction are also discussed, along with potential lines of innovation to improve cell and gene targeting.

  13. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  14. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  15. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  16. Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

    Science.gov (United States)

    Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

    2015-03-31

    Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

  17. Gene therapy and its implications in Periodontics

    Science.gov (United States)

    Mahale, Swapna; Dani, Nitin; Ansari, Shumaila S.; Kale, Triveni

    2009-01-01

    Gene therapy is a field of Biomedicine. With the advent of gene therapy in dentistry, significant progress has been made in the control of periodontal diseases and reconstruction of dento-alveolar apparatus. Implementation in periodontics include: -As a mode of tissue engineering with three approaches: cell, protein-based and gene delivery approach. -Genetic approach to Biofilm Antibiotic Resistance. Future strategies of gene therapy in preventing periodontal diseases: -Enhances host defense mechanism against infection by transfecting host cells with an antimicrobial peptide protein-encoding gene. -Periodontal vaccination. Gene therapy is one of the recent entrants and its applications in the field of periodontics are reviewed in general here. PMID:20376232

  18. Radionuclide reporter gene imaging for cardiac gene therapy

    International Nuclear Information System (INIS)

    Inubushi, Masayuki; Tamaki, Nagara

    2007-01-01

    In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

  19. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  20. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  1. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  2. Gene Therapy Targeting HIV Entry

    Directory of Open Access Journals (Sweden)

    Chuka Didigu

    2014-03-01

    Full Text Available Despite the unquestionable success of antiretroviral therapy (ART in the treatment of HIV infection, the cost, need for daily adherence, and HIV-associated morbidities that persist despite ART all underscore the need to develop a cure for HIV. The cure achieved following an allogeneic hematopoietic stem cell transplant (HSCT using HIV-resistant cells, and more recently, the report of short-term but sustained, ART-free control of HIV replication following allogeneic HSCT, using HIV susceptible cells, have served to both reignite interest in HIV cure research, and suggest potential mechanisms for a cure. In this review, we highlight some of the obstacles facing HIV cure research today, and explore the roles of gene therapy targeting HIV entry, and allogeneic stem cell transplantation in the development of strategies to cure HIV infection.

  3. Gene therapy for prostate cancer.

    LENUS (Irish Health Repository)

    Tangney, Mark

    2012-01-31

    Cancer remains a leading cause of morbidity and mortality. Despite advances in understanding, detection, and treatment, it accounts for almost one-fourth of all deaths per year in Western countries. Prostate cancer is currently the most commonly diagnosed noncutaneous cancer in men in Europe and the United States, accounting for 15% of all cancers in men. As life expectancy of individuals increases, it is expected that there will also be an increase in the incidence and mortality of prostate cancer. Prostate cancer may be inoperable at initial presentation, unresponsive to chemotherapy and radiotherapy, or recur following appropriate treatment. At the time of presentation, patients may already have metastases in their tissues. Preventing tumor recurrence requires systemic therapy; however, current modalities are limited by toxicity or lack of efficacy. For patients with such metastatic cancers, the development of alternative therapies is essential. Gene therapy is a realistic prospect for the treatment of prostate and other cancers, and involves the delivery of genetic information to the patient to facilitate the production of therapeutic proteins. Therapeutics can act directly (eg, by inducing tumor cells to produce cytotoxic agents) or indirectly by upregulating the immune system to efficiently target tumor cells or by destroying the tumor\\'s vasculature. However, technological difficulties must be addressed before an efficient and safe gene medicine is achieved (primarily by developing a means of delivering genes to the target cells or tissue safely and efficiently). A wealth of research has been carried out over the past 20 years, involving various strategies for the treatment of prostate cancer at preclinical and clinical trial levels. The therapeutic efficacy observed with many of these approaches in patients indicates that these treatment modalities will serve as an important component of urological malignancy treatment in the clinic, either in isolation or

  4. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Gene transfer therapy in vascular diseases.

    Science.gov (United States)

    McKay, M J; Gaballa, M A

    2001-01-01

    Somatic gene therapy of vascular diseases is a promising new field in modern medicine. Recent advancements in gene transfer technology have greatly evolved our understanding of the pathophysiologic role of candidate disease genes. With this knowledge, the expression of selective gene products provides the means to test the therapeutic use of gene therapy in a multitude of medical conditions. In addition, with the completion of genome sequencing programs, gene transfer can be used also to study the biologic function of novel genes in vivo. Novel genes are delivered to targeted tissue via several different vehicles. These vectors include adenoviruses, retroviruses, plasmids, plasmid/liposomes, and oligonucleotides. However, each one of these vectors has inherent limitations. Further investigations into developing delivery systems that not only allow for efficient, targeted gene transfer, but also are stable and nonimmunogenic, will optimize the clinical application of gene therapy in vascular diseases. This review further discusses the available mode of gene delivery and examines six major areas in vascular gene therapy, namely prevention of restenosis, thrombosis, hypertension, atherosclerosis, peripheral vascular disease in congestive heart failure, and ischemia. Although we highlight some of the recent advances in the use of gene therapy in treating vascular disease discovered primarily during the past two years, many excellent studies published during that period are not included in this review due to space limitations. The following is a selective review of practical uses of gene transfer therapy in vascular diseases. This review primarily covers work performed in the last 2 years. For earlier work, the reader may refer to several excellent review articles. For instance, Belalcazer et al. (6) reviewed general aspects of somatic gene therapy and the different vehicles used for the delivery of therapeutic genes. Gene therapy in restenosis and stimulation of

  7. Gene therapy in cystic fibrosis.

    Science.gov (United States)

    Flotte, T R; Laube, B L

    2001-09-01

    less efficient than viral vectors but do not stimulate inflammatory and immunologic responses. Another challenge to the development of clinically feasible gene therapy is delivery mode. Early pulmonary delivery systems relied on the direct instillation of aerosolized vectors, which can result in the induction of adverse reactions because vector is delivered into the lung parenchyma. More recent studies have examined the potential for using spray technologies to target aerosolized AAV vectors to the larger central airways, thereby avoiding alveolar exposure and adverse effects. Comparisons of lung deposition with nebulized delivery of aerosol and spray delivery indicate that spraying results in a more localized deposition pattern (predominantly in the proximal airways) and significantly higher deposition fractions than nebulization. These findings could lead to more efficient and targeted lung delivery of aerosolized gene vectors in the future.

  8. Targeting Herpetic Keratitis by Gene Therapy

    Directory of Open Access Journals (Sweden)

    Hossein Mostafa Elbadawy

    2012-01-01

    Full Text Available Ocular gene therapy is rapidly becoming a reality. By November 2012, approximately 28 clinical trials were approved to assess novel gene therapy agents. Viral infections such as herpetic keratitis caused by herpes simplex virus 1 (HSV-1 can cause serious complications that may lead to blindness. Recurrence of the disease is likely and cornea transplantation, therefore, might not be the ideal therapeutic solution. This paper will focus on the current situation of ocular gene therapy research against herpetic keratitis, including the use of viral and nonviral vectors, routes of delivery of therapeutic genes, new techniques, and key research strategies. Whereas the correction of inherited diseases was the initial goal of the field of gene therapy, here we discuss transgene expression, gene replacement, silencing, or clipping. Gene therapy of herpetic keratitis previously reported in the literature is screened emphasizing candidate gene therapy targets. Commonly adopted strategies are discussed to assess the relative advantages of the protective therapy using antiviral drugs and the common gene therapy against long-term HSV-1 ocular infections signs, inflammation and neovascularization. Successful gene therapy can provide innovative physiological and pharmaceutical solutions against herpetic keratitis.

  9. A specific and potent inhibitor of glucosylceramide synthase for substrate inhibition therapy of Gaucher disease.

    Science.gov (United States)

    McEachern, Kerry Anne; Fung, John; Komarnitsky, Svetlana; Siegel, Craig S; Chuang, Wei-Lien; Hutto, Elizabeth; Shayman, James A; Grabowski, Gregory A; Aerts, Johannes M F G; Cheng, Seng H; Copeland, Diane P; Marshall, John

    2007-07-01

    An approach to treating Gaucher disease is substrate inhibition therapy which seeks to abate the aberrant lysosomal accumulation of glucosylceramide. We have identified a novel inhibitor of glucosylceramide synthase (Genz-112638) and assessed its activity in a murine model of Gaucher disease (D409V/null). Biochemical characterization of Genz-112638 showed good potency (IC(50) approximately 24nM) and specificity against the target enzyme. Mice that received drug prior to significant accumulation of substrate (10 weeks of age) showed reduced levels of glucosylceramide and number of Gaucher cells in the spleen, lung and liver when compared to age-matched control animals. Treatment of older mice that already displayed significant amounts of tissue glucosylceramide (7 months old) resulted in arrest of further accumulation of the substrate and appearance of additional Gaucher cells in affected organs. These data indicate that substrate inhibition therapy with Genz-112638 represents a viable alternate approach to enzyme therapy to treat the visceral pathology in Gaucher disease.

  10. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  11. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

    Science.gov (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-10-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  12. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    Science.gov (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  13. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  15. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.

    2010-01-01

    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  16. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

  17. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  18. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Progress in Gene Therapy for Prostate Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Ahmed, Kamran A.; Davis, Brian J. [Department of Radiation Oncology, Mayo Clinic, Rochester, MN (United States); Wilson, Torrence M. [Department of Urology, Mayo Clinic, Rochester, MN (United States); Wiseman, Gregory A. [Division of Nuclear Medicine, Mayo Clinic, Rochester, MN (United States); Federspiel, Mark J. [Department of Molecular Medicine, Mayo Clinic, Rochester, MN (United States); Morris, John C., E-mail: davis.brian@mayo.edu [Division of Endocrinology, Mayo Clinic, Rochester, MN (United States)

    2012-11-19

    Gene therapy has held promise to correct various disease processes. Prostate cancer represents the second leading cause of cancer death in American men. A number of clinical trials involving gene therapy for the treatment of prostate cancer have been reported. The ability to efficiently transduce tumors with effective levels of therapeutic genes has been identified as a fundamental barrier to effective cancer gene therapy. The approach utilizing gene therapy in prostate cancer patients at our institution attempts to address this deficiency. The sodium-iodide symporter (NIS) is responsible for the ability of the thyroid gland to transport and concentrate iodide. The characteristics of the NIS gene suggest that it could represent an ideal therapeutic gene for cancer therapy. Published results from Mayo Clinic researchers have indicated several important successes with the use of the NIS gene and prostate gene therapy. Studies have demonstrated that transfer of the human NIS gene into prostate cancer using adenovirus vectors in vitro and in vivo results in efficient uptake of radioactive iodine and significant tumor growth delay with prolongation of survival. Preclinical successes have culminated in the opening of a phase I trial for patients with advanced prostate disease which is currently accruing patients. Further study will reveal the clinical promise of NIS gene therapy in the treatment of prostate as well as other malignancies.

  20. Progress in Gene Therapy for Prostate Cancer

    International Nuclear Information System (INIS)

    Ahmed, Kamran A.; Davis, Brian J.; Wilson, Torrence M.; Wiseman, Gregory A.; Federspiel, Mark J.; Morris, John C.

    2012-01-01

    Gene therapy has held promise to correct various disease processes. Prostate cancer represents the second leading cause of cancer death in American men. A number of clinical trials involving gene therapy for the treatment of prostate cancer have been reported. The ability to efficiently transduce tumors with effective levels of therapeutic genes has been identified as a fundamental barrier to effective cancer gene therapy. The approach utilizing gene therapy in prostate cancer patients at our institution attempts to address this deficiency. The sodium-iodide symporter (NIS) is responsible for the ability of the thyroid gland to transport and concentrate iodide. The characteristics of the NIS gene suggest that it could represent an ideal therapeutic gene for cancer therapy. Published results from Mayo Clinic researchers have indicated several important successes with the use of the NIS gene and prostate gene therapy. Studies have demonstrated that transfer of the human NIS gene into prostate cancer using adenovirus vectors in vitro and in vivo results in efficient uptake of radioactive iodine and significant tumor growth delay with prolongation of survival. Preclinical successes have culminated in the opening of a phase I trial for patients with advanced prostate disease which is currently accruing patients. Further study will reveal the clinical promise of NIS gene therapy in the treatment of prostate as well as other malignancies.

  1. Gene therapy prospects--intranasal delivery of therapeutic genes.

    Science.gov (United States)

    Podolska, Karolina; Stachurska, Anna; Hajdukiewicz, Karolina; Małecki, Maciej

    2012-01-01

    Gene therapy is recognized to be a novel method for the treatment of various disorders. Gene therapy strategies involve gene manipulation on broad biological processes responsible for the spreading of diseases. Cancer, monogenic diseases, vascular and infectious diseases are the main targets of gene therapy. In order to obtain valuable experimental and clinical results, sufficient gene transfer methods are required. Therapeutic genes can be administered into target tissues via gene carriers commonly defined as vectors. The retroviral, adenoviral and adeno-associated virus based vectors are most frequently used in the clinic. So far, gene preparations may be administered directly into target organs or by intravenous, intramuscular, intratumor or intranasal injections. It is common knowledge that the number of gene therapy clinical trials has rapidly increased. However, some limitations such as transfection efficiency and stable and long-term gene expression are still not resolved. Consequently, great effort is focused on the evaluation of new strategies of gene delivery. There are many expectations associated with intranasal delivery of gene preparations for the treatment of diseases. Intranasal delivery of therapeutic genes is regarded as one of the most promising forms of pulmonary gene therapy research. Gene therapy based on inhalation of gene preparations offers an alternative way for the treatment of patients suffering from such lung diseases as cystic fibrosis, alpha-1-antitrypsin defect, or cancer. Experimental and first clinical trials based on plasmid vectors or recombinant viruses have revealed that gene preparations can effectively deliver therapeutic or marker genes to the cells of the respiratory tract. The noninvasive intranasal delivery of gene preparations or conventional drugs seems to be very encouraging, although basic scientific research still has to continue.

  2. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  3. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

    Science.gov (United States)

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

    2016-01-01

    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  4. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  5. Republished review: Gene therapy for ocular diseases.

    Science.gov (United States)

    Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

    2011-07-01

    The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

  6. Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

    Science.gov (United States)

    Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

    2007-10-01

    Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

  7. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Directory of Open Access Journals (Sweden)

    Bin Tang

    2018-01-01

    Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

  8. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  9. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  10. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  11. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  12. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    Science.gov (United States)

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  13. A Comprehensive Review of Retinal Gene Therapy

    OpenAIRE

    Boye, Shannon E; Boye, Sanford L; Lewin, Alfred S; Hauswirth, William W

    2013-01-01

    Blindness, although not life threatening, is a debilitating disorder for which few, if any treatments exist. Ocular gene therapies have the potential to profoundly improve the quality of life in patients with inherited retinal disease. As such, tremendous focus has been given to develop such therapies. Several factors make the eye an ideal organ for gene-replacement therapy including its accessibility, immune privilege, small size, compartmentalization, and the existence of a contralateral co...

  14. Molecular targeting of gene therapy and radiotherapy

    International Nuclear Information System (INIS)

    Weichselbaum, R.R.; Kufe, D.W.; Advani, S.J.; Roizman, B.

    2001-01-01

    The full promise of gene therapy has been limited by the lack of specificity of vectors for tumor tissue as well as the lack of antitumor efficacy of transgenes encoded by gene delivery systems. In this paper we review our studies investigating two modifications of gene therapy combined with radiotherapy. The first investigations described include studies of radiation inducible gene therapy. In this paradigm, radio-inducible DNA sequences from the CarG elements of the Egr-1 promoter are cloned upstream of a cDNA encoding TNFa. The therapeutic gene (TNFa) is induced by radiation within the tumor microenvironment. In the second paradigm, genetically engineered herpes simplex virus (HSV-1) is induced by ionizing radiation to proliferate within the tumor volume. These modifications of radiotherapy and gene therapy may enhance the efficacy of both treatments

  15. Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Lin-Hui Gao

    2018-01-01

    Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

  16. Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

    Science.gov (United States)

    Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

    2008-08-01

    Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

  17. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  18. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    Science.gov (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  19. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  20. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  1. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  2. The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

    Science.gov (United States)

    Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

    2018-05-11

    Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

  3. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  4. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  5. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    International Nuclear Information System (INIS)

    Ge Shimei; Xie Baoen; Chen Sanfeng

    2006-01-01

    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

  6. Biodegradable nanoparticles for gene therapy technology

    International Nuclear Information System (INIS)

    Hosseinkhani, Hossein; He, Wen-Jie; Chiang, Chiao-Hsi; Hong, Po-Da; Yu, Dah-Shyong; Domb, Abraham J.; Ou, Keng-Liang

    2013-01-01

    Rapid propagations in materials technology together with biology have initiated great hopes in the possibility of treating many diseases by gene therapy technology. Viral and non-viral gene carriers are currently applied for gene delivery. Non-viral technology is safe and effective for the delivery of genetic materials to cells and tissues. Non-viral systems are based on plasmid expression containing a gene encoding a therapeutic protein and synthetic biodegradable nanoparticles as a safe carrier of gene. Biodegradable nanoparticles have shown great interest in drug and gene delivery systems as they are easy to be synthesized and have no side effect in cells and tissues. This review provides a critical view of applications of biodegradable nanoparticles on gene therapy technology to enhance the localization of in vitro and in vivo and improve the function of administered genes

  7. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  8. The bystander effect of cancer gene therapy

    International Nuclear Information System (INIS)

    Lumniczky, K.; Safrany, G.

    2008-01-01

    Cancer gene therapy is a new, promising therapeutic agent. In the clinic, it should be used in combination with existing modalities, such as tumour irradiation. First, we summarise the most important fields of cancer gene therapy: gene directed enzyme pro-drug therapy; the activation of an anti-tumour immune attack; restoration of the wild type p53 status; the application of new, replication competent and oncolytic viral vectors; tumour specific, as well as radiation- and hypoxia-induced gene expression. Special emphasizes are put on the combined effect of these modalities with local tumour irradiation. Using the available vector systems, only a small portion of the cancer cells will contain the therapeutic genes under therapeutic situations. Bystander cell killing might contribute to the success of various gene therapy protocols. We summarise the evidences that lethal bystander effects may occur during cancer gene therapy. Bystander effects are especially important in the gene directed enzyme pro-drug therapy. There, bystander cell killing might have different routes: cell communication through gap junction intercellular contacts; release of toxic metabolites into the neighbourhood or to larger distances; phagocytosis of apoptotic bodies; and the activation of the immune system. Bystander cell killing can be enhanced by the introduction of gap junction proteins into the cells, by further activating the immune system with immune-stimulatory molecules, or by introducing genes into the cells that help the transfer of cytotoxic genes and / or metabolites into the bystander cells. In conclusion, there should be additional improvements in cancer gene therapy for the more efficient clinical application. (orig.)

  9. Cancer suicide gene therapy: a patent review.

    Science.gov (United States)

    Navarro, Saúl Abenhamar; Carrillo, Esmeralda; Griñán-Lisón, Carmen; Martín, Ana; Perán, Macarena; Marchal, Juan Antonio; Boulaiz, Houria

    2016-09-01

    Cancer is considered the second leading cause of death worldwide despite the progress made in early detection and advances in classical therapies. Advancing in the fight against cancer requires the development of novel strategies, and the suicide gene transfer to tumor cells is providing new possibilities for cancer therapy. In this manuscript, authors present an overview of suicide gene systems and the latest innovations done to enhance cancer suicide gene therapy strategies by i) improving vectors for targeted gene delivery using tissue specific promoter and receptors; ii) modification of the tropism; and iii) combining suicide genes and/or classical therapies for cancer. Finally, the authors highlight the main challenges to be addressed in the future. Even if many efforts are needed for suicide gene therapy to be a real alternative for cancer treatment, we believe that the significant progress made in the knowledge of cancer biology and characterization of cancer stem cells accompanied by the development of novel targeted vectors will enhance the effectiveness of this type of therapeutic strategy. Moreover, combined with current treatments, suicide gene therapy will improve the clinical outcome of patients with cancer in the future.

  10. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  11. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  12. POLYMORPHISMS OF ENDOTHELIAL NITRIC OXIDE SYNTHASE GENE AS PREDICTORS OF WOLFF-PARKINSON-WHITE SYNDROME

    Directory of Open Access Journals (Sweden)

    G. V. Matyushin

    2017-01-01

    Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups  and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group.  In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men,  this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.

  13. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  14. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  15. Gene Therapy: Potential, Pros, Cons and Ethics

    OpenAIRE

    Ananth Nanjunda Rao

    2002-01-01

    Genetic technology poses risks along with its rewards, just as any technology has in the past. To stop its development and forfeit the benefits gene therapy could offer would be a far greater mistake than forging ahead could ever be. People must always try to be responsible with their new technology, but gene therapy has the potential to be the future of medicine and its possibilities must be explored.

  16. Gene Therapy: Potential, Pros, Cons and Ethics

    Directory of Open Access Journals (Sweden)

    Ananth Nanjunda Rao

    2002-07-01

    Full Text Available Genetic technology poses risks along with its rewards, just as any technology has in the past. To stop its development and forfeit the benefits gene therapy could offer would be a far greater mistake than forging ahead could ever be. People must always try to be responsible with their new technology, but gene therapy has the potential to be the future of medicine and its possibilities must be explored.

  17. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  18. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

    Science.gov (United States)

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

    2016-11-18

    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn.

    Science.gov (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S

    2008-02-01

    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  20. Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.

    Science.gov (United States)

    Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E

    2016-11-01

    Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  1. Strategies in Gene Therapy for Glioblastoma

    International Nuclear Information System (INIS)

    Kwiatkowska, Aneta; Nandhu, Mohan S.; Behera, Prajna; Chiocca, E. Antonio; Viapiano, Mariano S.

    2013-01-01

    Glioblastoma (GBM) is the most aggressive form of brain cancer, with a dismal prognosis and extremely low percentage of survivors. Novel therapies are in dire need to improve the clinical management of these tumors and extend patient survival. Genetic therapies for GBM have been postulated and attempted for the past twenty years, with variable degrees of success in pre-clinical models and clinical trials. Here we review the most common approaches to treat GBM by gene therapy, including strategies to deliver tumor-suppressor genes, suicide genes, immunomodulatory cytokines to improve immune response, and conditionally-replicating oncolytic viruses. The review focuses on the strategies used for gene delivery, including the most common and widely used vehicles (i.e., replicating and non-replicating viruses) as well as novel therapeutic approaches such as stem cell-mediated therapy and nanotechnologies used for gene delivery. We present an overview of these strategies, their targets, different advantages, and challenges for success. Finally, we discuss the potential of gene therapy-based strategies to effectively attack such a complex genetic target as GBM, alone or in combination with conventional therapy

  2. Strategies in Gene Therapy for Glioblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Kwiatkowska, Aneta; Nandhu, Mohan S.; Behera, Prajna; Chiocca, E. Antonio; Viapiano, Mariano S., E-mail: mviapiano@partners.org [Department of Neurosurgery, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 (United States)

    2013-10-22

    Glioblastoma (GBM) is the most aggressive form of brain cancer, with a dismal prognosis and extremely low percentage of survivors. Novel therapies are in dire need to improve the clinical management of these tumors and extend patient survival. Genetic therapies for GBM have been postulated and attempted for the past twenty years, with variable degrees of success in pre-clinical models and clinical trials. Here we review the most common approaches to treat GBM by gene therapy, including strategies to deliver tumor-suppressor genes, suicide genes, immunomodulatory cytokines to improve immune response, and conditionally-replicating oncolytic viruses. The review focuses on the strategies used for gene delivery, including the most common and widely used vehicles (i.e., replicating and non-replicating viruses) as well as novel therapeutic approaches such as stem cell-mediated therapy and nanotechnologies used for gene delivery. We present an overview of these strategies, their targets, different advantages, and challenges for success. Finally, we discuss the potential of gene therapy-based strategies to effectively attack such a complex genetic target as GBM, alone or in combination with conventional therapy.

  3. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

    Science.gov (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

    2001-09-01

    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  4. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2016-02-01

    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  5. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  6. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  7. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

    1999-01-01

    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

  8. Targeted cancer gene therapy : the flexibility of adenoviral gene therapy vectors

    NARCIS (Netherlands)

    Rots, MG; Curiel, DT; Gerritsen, WR; Haisma, HJ

    2003-01-01

    Recombinant adenoviral vectors are promising reagents for therapeutic interventions in humans, including gene therapy for biologically complex diseases like cancer and cardiovascular diseases. In this regard, the major advantage of adenoviral vectors is their superior in vivo gene transfer

  9. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  10. Association of Nitric Oxide Synthase2 gene polymorphisms with leprosy reactions in northern Indian population.

    Science.gov (United States)

    Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja

    2017-07-01

    The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  12. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  13. Gene therapy of cancer and development of therapeutic target gene

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Chang Min; Kwon, Hee Chung

    1998-04-01

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene.

  14. Gene therapy of cancer and development of therapeutic target gene

    International Nuclear Information System (INIS)

    Kim, Chang Min; Kwon, Hee Chung

    1998-04-01

    We applied HSV-tk/GCV strategy to orthotopic rat hepatoma model and showed anticancer effects of hepatoma. The increased expression of Lac Z gene after adenovirus-mediated gene delivery throughout hepatic artery was thought that is increased the possibility of gene therapy for curing hepatoma. With the construction of kGLP-laboratory, it is possible to produce a good quantity and quality of adenovirus in lage-scale production and purification of adenovirus vector. Also, the analysis of hepatoma related genes by PCR-LOH could be used for the diagnosis of patients and the development of therapeutic gene

  15. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  16. Natural Gene Therapy in Dystrophic Epidermolysis Bullosa

    NARCIS (Netherlands)

    van den Akker, Peter C.; Nijenhuis, Albertine; Hofstra, Robert M. W.; Jonkman, Marcel F.; Pasmooij, Anna M. G.; Meijer, G.

    Background: Dystrophic epidermolysis bullosa is a genetic blistering disorder caused by mutations in the type VII collagen gene, COL7A1. In revertant mosaicism, germline mutations are corrected by somatic events resulting in a mosaic disease distribution. This "natural gene therapy" phenomenon long

  17. Human gene therapy and imaging: cardiology

    International Nuclear Information System (INIS)

    Wu, Joseph C.; Yla-Herttuala, Seppo

    2005-01-01

    This review discusses the basics of cardiovascular gene therapy, the results of recent human clinical trials, and the rapid progress in imaging techniques in cardiology. Improved understanding of the molecular and genetic basis of coronary heart disease has made gene therapy a potential new alternative for the treatment of cardiovascular diseases. Experimental studies have established the proof-of-principle that gene transfer to the cardiovascular system can achieve therapeutic effects. First human clinical trials provided initial evidence of feasibility and safety of cardiovascular gene therapy. However, phase II/III clinical trials have so far been rather disappointing and one of the major problems in cardiovascular gene therapy has been the inability to verify gene expression in the target tissue. New imaging techniques could significantly contribute to the development of better gene therapeutic approaches. Although the exact choice of imaging modality will depend on the biological question asked, further improvement in image resolution and detection sensitivity will be needed for all modalities as we move from imaging of organs and tissues to imaging of cells and genes. (orig.)

  18. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  19. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

    Science.gov (United States)

    Oberding, Lisa K; Gieg, Lisa M

    2018-01-01

    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  20. Gene transfer technology and genetic radioisotope targeting therapy

    International Nuclear Information System (INIS)

    Wang Jiaqiong; Wang Zizheng

    2004-01-01

    With deeper cognition about mechanisms of disease at the cellular and molecular level, gene therapy has become one of the most important research fields in medical molecular biology at present. Gene transfer technology plays an important role during the course of gene therapy, and further improvement should be made about vectors carrying target gene sequences. Also, gene survey is needed during gene therapy, and gene imaging is the most effective method. The combination of gene therapy and targeted radiotherapy, that is, 'Genetic Radioisotope Targeting Therapy', will be a novel approach to tumor gene therapy

  1. Role of PET in gene therapy

    International Nuclear Information System (INIS)

    Lee, Kyung Han

    2002-01-01

    In addition to the well-established use of positron emission tomography (PET) in clinical oncology, novel roles for PET are rapidly emerging in the field of gene therapy. Methods for controlled gene delivery to living bodies, made available through advances in molecular biology, are currently being employed in animals for reasearch purposes and in humans to treat diseases such as cancer. Although gene therapy is still in its early developmental stage, it is perceived that many serious illnesses could be treated successfully by the use of therapeutic gene delivery. A major challenge for the widespread use of human gene therapy is to achieve a controlled and effective delivery of foreign genes to target cells and subsequently, adequate levels of expression. As such, the availability of noninvasive imaging methods to accurately assess the location, duration, and level of transgene expression is critical for optimizing gene therapy strategies. Current endeavors to achieve this goal include methods that utilize magnetic resonance imaging, optical imaging, and nuclear imaging techniques. As for PET, reporter systems that utilize gene encoding enzymes that accumulate postion labeled substrates and those transcribing surface receptors that bind specific positron labeled ligands have been successfully developed. More recent advances in this area include improved reporter gene constructs and radiotracers, introduction of potential strategies to monitor endogenous gene expression, and human pilot studies evaluating the distribution and safety of reporter PET tracers. The remarkably rapid progress occuring in gene imaging technology indicates its importance and wide range of application. As such, gene imaging is likely to become a major and exciting new area for future application of PET technology

  2. Role of PET in gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Kyung Han [School of Medicine, Sungkyunkwan Univ., Seoul (Korea, Republic of)

    2002-02-01

    In addition to the well-established use of positron emission tomography (PET) in clinical oncology, novel roles for PET are rapidly emerging in the field of gene therapy. Methods for controlled gene delivery to living bodies, made available through advances in molecular biology, are currently being employed in animals for reasearch purposes and in humans to treat diseases such as cancer. Although gene therapy is still in its early developmental stage, it is perceived that many serious illnesses could be treated successfully by the use of therapeutic gene delivery. A major challenge for the widespread use of human gene therapy is to achieve a controlled and effective delivery of foreign genes to target cells and subsequently, adequate levels of expression. As such, the availability of noninvasive imaging methods to accurately assess the location, duration, and level of transgene expression is critical for optimizing gene therapy strategies. Current endeavors to achieve this goal include methods that utilize magnetic resonance imaging, optical imaging, and nuclear imaging techniques. As for PET, reporter systems that utilize gene encoding enzymes that accumulate postion labeled substrates and those transcribing surface receptors that bind specific positron labeled ligands have been successfully developed. More recent advances in this area include improved reporter gene constructs and radiotracers, introduction of potential strategies to monitor endogenous gene expression, and human pilot studies evaluating the distribution and safety of reporter PET tracers. The remarkably rapid progress occuring in gene imaging technology indicates its importance and wide range of application. As such, gene imaging is likely to become a major and exciting new area for future application of PET technology.

  3. Why commercialization of gene therapy stalled; examining the life cycles of gene therapy technologies.

    Science.gov (United States)

    Ledley, F D; McNamee, L M; Uzdil, V; Morgan, I W

    2014-02-01

    This report examines the commercialization of gene therapy in the context of innovation theories that posit a relationship between the maturation of a technology through its life cycle and prospects for successful product development. We show that the field of gene therapy has matured steadily since the 1980s, with the congruent accumulation of >35 000 papers, >16 000 US patents, >1800 clinical trials and >$4.3 billion in capital investment in gene therapy companies. Gene therapy technologies comprise a series of dissimilar approaches for gene delivery, each of which has introduced a distinct product architecture. Using bibliometric methods, we quantify the maturation of each technology through a characteristic life cycle S-curve, from a Nascent stage, through a Growing stage of exponential advance, toward an Established stage and projected limit. Capital investment in gene therapy is shown to have occurred predominantly in Nascent stage technologies and to be negatively correlated with maturity. Gene therapy technologies are now achieving the level of maturity that innovation research and biotechnology experience suggest may be requisite for efficient product development. Asynchrony between the maturation of gene therapy technologies and capital investment in development-focused business models may have stalled the commercialization of gene therapy.

  4. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    SAM

    2014-05-28

    May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

  5. Therapeutic genes for anti-HIV/AIDS gene therapy.

    Science.gov (United States)

    Bovolenta, Chiara; Porcellini, Simona; Alberici, Luca

    2013-01-01

    The multiple therapeutic approaches developed so far to cope HIV-1 infection, such as anti-retroviral drugs, germicides and several attempts of therapeutic vaccination have provided significant amelioration in terms of life-quality and survival rate of AIDS patients. Nevertheless, no approach has demonstrated efficacy in eradicating this lethal, if untreated, infection. The curative power of gene therapy has been proven for the treatment of monogenic immunodeficiensies, where permanent gene modification of host cells is sufficient to correct the defect for life-time. No doubt, a similar concept is not applicable for gene therapy of infectious immunodeficiensies as AIDS, where there is not a single gene to be corrected; rather engineered cells must gain immunotherapeutic or antiviral features to grant either short- or long-term efficacy mostly by acquisition of antiviral genes or payloads. Anti-HIV/AIDS gene therapy is one of the most promising strategy, although challenging, to eradicate HIV-1 infection. In fact, genetic modification of hematopoietic stem cells with one or multiple therapeutic genes is expected to originate blood cell progenies resistant to viral infection and thereby able to prevail on infected unprotected cells. Ultimately, protected cells will re-establish a functional immune system able to control HIV-1 replication. More than hundred gene therapy clinical trials against AIDS employing different viral vectors and transgenes have been approved or are currently ongoing worldwide. This review will overview anti-HIV-1 infection gene therapy field evaluating strength and weakness of the transgenes and payloads used in the past and of those potentially exploitable in the future.

  6. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

    Science.gov (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

    2012-03-01

    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  7. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  8. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

    Science.gov (United States)

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-09-06

    Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular

  9. New tools in regenerative medicine: gene therapy.

    Science.gov (United States)

    Muñoz Ruiz, Miguel; Regueiro, José R

    2012-01-01

    Gene therapy aims to transfer genetic material into cells to provide them with new functions. A gene transfer agent has to be safe, capable of expressing the desired gene for a sustained period of time in a sufficiently large population of cells to produce a biological effect. Identifying a gene transfer tool that meets all of these criteria has proven to be a difficult objective. Viral and nonviral vectors, in vivo, ex vivo and in situ strategies co-exist at present, although ex vivo lenti-or retroviral vectors are presently the most popular.Natural stem cells (from embryonic, hematopoietic, mesenchymal, or adult tissues) or induced progenitor stem (iPS) cells can be modified by gene therapy for use in regenerative medicine. Among them, hematopoietic stem cells have shown clear clinical benefit, but iPS cells hold humongous potential with no ethical concerns.

  10. Reporter gene imaging: potential impact on therapy

    International Nuclear Information System (INIS)

    Serganova, Inna; Blasberg, Ronald

    2005-01-01

    Positron emission tomography (PET)-based molecular-genetic imaging in living organisms has enjoyed exceptional growth over the past 5 years; this is particularly striking since it has been identified as a new discipline only within the past decade. Positron emission tomography is one of three imaging technologies (nuclear, magnetic resonance and optical) that has begun to incorporate methods that are established in molecular and cell biology research. The convergence of these disciplines and the wider application of multi-modality imaging are at the heart of this success story. Most current molecular-genetic imaging strategies are 'indirect,' coupling a 'reporter gene' with a complimentary 'reporter probe.' Reporter gene constructs can be driven by constitutive promoter elements and used to monitor gene therapy vectors and the efficacy of trans gene targeting and transduction, as well as to monitor adoptive cell-based therapies. Inducible promoters can be used as 'sensors' to regulate the magnitude of reporter gene expression and can be used to provide information about endogenous cell processes. Reporter systems can also be constructed to monitor mRNA stabilization and specific protein-protein interactions. Promoters can be cell specific and restrict transgene expression to certain tissue and organs. The translation of reporter gene imaging to specific clinical applications is discussed. Several examples that have potential for patient imaging studies in the near future include monitoring adenoviral-based gene therapy, oncolytic herpes virus therapy, adoptive cell-based therapies and Salmonella-based tumor-targeted cancer therapy and imaging. The primary translational applications of noninvasive in vivo reporter gene imaging are likely to be (a) quantitative monitoring of the gene therapy vector and the efficacy of transduction in clinical protocols, by imaging the location, extent and duration of transgene expression; (b) monitoring cell trafficking, targeting

  11. Ethical issues of perinatal human gene therapy.

    Science.gov (United States)

    Fletcher, J C; Richter, G

    1996-01-01

    This paper examines some key ethical issues raised by trials of human gene therapy in the perinatal period--i.e., in infants, young children, and the human fetus. It describes five resources in ethics for researchers' considerations prior to such trials: (1) the history of ethical debate about gene therapy, (2) a literature on the relevance of major ethical principles for clinical research, (3) a body of widely accepted norms and practices, (4) knowledge of paradigm cases, and (5) researchers' own professional integrity. The paper also examines ethical concerns that must be met prior to any trial: benefits to and safety of subjects, informed assent of children and informed parental permission, informed consent of pregnant women in fetal gene therapy, protection of privacy, and concerns about fairness in the selection of subjects. The paper criticizes the position that cases of fetal gene therapy should be restricted only to those where the pregnant woman has explicitly refused abortion. Additional topics include concerns about genetic enhancement and germ-line gene therapy.

  12. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  13. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

    Science.gov (United States)

    Schindler, Daniel; Nowrousian, Minou

    2014-07-01

    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  15. Gene Therapy and its applications in Dentistry

    Directory of Open Access Journals (Sweden)

    Sharma Lakhanpal Manisha

    2006-01-01

    Full Text Available This era of advanced technology is marked by progress in identifying and understanding the molecular and cellular cause of a disease. With the conventional methods of treatment failing to render satisfactory results, gene therapy is not only being used for the cure of inherited diseases but also the acquired ones. The broad spectrum of gene therapy includes its application in the treatment of oral cancer and precancerous conditions and lesions, treatment of salivary gland diseases, bone repair, autoimmune diseases, DNA vaccination, etc. The aim of this article is to throw light on the history, methodology, applications and future of gene therapy as it would change the nature and face of dentistry in the coming years.

  16. Lipoplex gene transfer of inducible nitric oxide synthase inhibits the reactive intimal hyperplasia after expanded polytetrafluoroethylene bypass grafting.

    Science.gov (United States)

    Pfeiffer, Tomas; Wallich, Martina; Sandmann, Wilhelm; Schrader, Jürgen; Gödecke, Axel

    2006-05-01

    Intimal hyperplasia (IH) is most commonly the cause of graft occlusion in infrainguinal bypass grafting for arterial occlusive disease. We investigated the influence of nitric oxide on the IH of the arterial vessel wall at the region of prosthetic bypass anastomoses. Experiments were performed in 10 Foxhound dogs. We used a technique of inducible nitric oxide synthase (iNOS) overexpression by a non-virus-mediated, liposome-based iNOS gene transfer. The plasmid pSCMV-iNOS, which drives the expression of iNOS under control of the cytomegalovirus promoter, was complexed with cationic liposomes (lipoplexes). Segments of both carotid arteries were pretreated by intramural injection of a lipoplex solution by using an infiltrator balloon catheter (Infiltrator Drug Delivery Balloon System). In each dog, iNOS was administered at one side, and a control vector (pSCMV2) was administered at the contralateral side. Carotid arteries were ligated, and bypass grafts (expanded polytetrafluoroethylene, 6-mm, ring enforced) were implanted on both sides. The proximal and distal anastomoses (end-to-side fashion; running nonabsorbable sutures) were placed in the pretreated regions. After 6 months, the prostheses were excised, and the intimal thicknesses of 50 cross sections (orcein staining) of each anastomosis were measured planimetrically. The average reduction of the neointima thickness of the iNOS side in proximal anastomoses at the prosthetic wall, suture region, and arterial wall was 43%, 52%, and 81%, respectively. In distal anastomoses, the average reduction was 40%, 47%, and 52%, respectively. All differences of neointima thickness between the iNOS and control sides were statistically significant (Wilcoxon test; P < or = .05). Inducible NOS expression is an efficient approach for inhibition of IH. In contrast to earlier studies, which investigated the efficacy of gene therapeutic NOS expression at 3 to 4 weeks after intervention, the novelty of our findings is that a single

  17. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  18. Gene therapy of cancer by vaccines carrying inserted immunostimulatory genes

    Czech Academy of Sciences Publication Activity Database

    Bubeník, Jan

    2007-01-01

    Roč. 53, č. 3 (2007), s. 71-73 ISSN 0015-5500 Grant - others:EU-FP6 NoE Clinigene(XE) 018933; Liga proti rakovině, Praha(CZ) XX Institutional research plan: CEZ:AV0Z50520514 Keywords : gene therapy * immunostimulatory genes * vaccine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.596, year: 2007

  19. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

    2008-01-01

    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

  20. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    OpenAIRE

    Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

  1. Translational approach for gene therapy in epilepsy

    DEFF Research Database (Denmark)

    Ledri, Litsa Nikitidou; Melin, Esbjörn; Christiansen, Søren H.

    2016-01-01

    clinical trial for gene therapy of temporal lobe epilepsy was explored: We investigated (i) whether the post intrahippocampal kainate-induced status epilepticus (SE) model of chronic epilepsy in rats could be clinically relevant; and (ii) whether a translationally designed neuropeptide Y (NPY)/Y2 receptor...

  2. Theranostic Imaging of Cancer Gene Therapy.

    Science.gov (United States)

    Sekar, Thillai V; Paulmurugan, Ramasamy

    2016-01-01

    Gene-directed enzyme prodrug therapy (GDEPT) is a promising therapeutic approach for treating cancers of various phenotypes. This strategy is independent of various other chemotherapeutic drugs used for treating cancers where the drugs are mainly designed to target endogenous cellular mechanisms, which are different in various cancer subtypes. In GDEPT an external enzyme, which is different from the cellular proteins, is expressed to convert the injected prodrug in to a toxic metabolite, that normally kill cancer cells express this protein. Theranostic imaging is an approach used to directly monitor the expression of these gene therapy enzymes while evaluating therapeutic effect. We recently developed a dual-GDEPT system where we combined mutant human herpes simplex thymidine kinase (HSV1sr39TK) and E. coli nitroreductase (NTR) enzyme, to improve therapeutic efficiency of cancer gene therapy by simultaneously injecting two prodrugs at a lower dose. In this approach we use two different prodrugs such as ganciclovir (GCV) and CB1954 to target two different cellular mechanisms to kill cancer cells. The developed dual GDEPT system was highly efficacious than that of either of the system used independently. In this chapter, we describe the complete protocol involved for in vitro and in vivo imaging of therapeutic cancer gene therapy evaluation.

  3. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  4. Newer Gene Editing Technologies toward HIV Gene Therapy

    Directory of Open Access Journals (Sweden)

    Premlata Shankar

    2013-11-01

    Full Text Available Despite the great success of highly active antiretroviral therapy (HAART in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy.

  5. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  6. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

    Science.gov (United States)

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

    2015-08-01

    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

    2008-01-01

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  9. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.

    2005-01-01

    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  10. of endothelial nitric oxide synthase gene and serum level of vascular ...

    African Journals Online (AJOL)

    uwerhiavwe

    Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

  11. Factors influencing gene silencing of granule-bound starch synthase in potato

    NARCIS (Netherlands)

    Heilersig, H.J.B.

    2005-01-01

    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI

  12. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.

    2004-01-01

    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  13. The gene therapy revolution in ophthalmology.

    Science.gov (United States)

    Al-Saikhan, Fahad I

    2013-04-01

    The advances in gene therapy hold significant promise for the treatment of ophthalmic conditions. Several studies using animal models have been published. Animal models on retinitis pigmentosa, Leber's Congenital Amaurosis (LCA), and Stargardt disease have involved the use of adeno-associated virus (AAV) to deliver functional genes into mice and canines. Mice models have been used to show that a mutation in cGMP phosphodiesterase that results in retinitis pigmentosa can be corrected using rAAV vectors. Additionally, rAAV vectors have been successfully used to deliver ribozyme into mice with a subsequent improvement in autosomal dominant retinitis pigmentosa. By using dog models, researchers have made progress in studying X-linked retinitis pigmentosa which results from a RPGR gene mutation. Mouse and canine models have also been used in the study of LCA. The widely studied form of LCA is LCA2, resulting from a mutation in the gene RPE65. Mice and canines that were injected with normal copies of RPE65 gene showed signs such as improved retinal pigment epithelium transduction, visual acuity, and functional recovery. Studies on Stargardt disease have shown that mutations in the ABCA4 gene can be corrected with AAV vectors, or nanoparticles. Gene therapy for the treatment of red-green color blindness was successful in squirrel monkeys. Plans are at an advanced stage to begin clinical trials. Researchers have also proved that CD59 can be used with AMD. Gene therapy is also able to treat primary open angle glaucoma (POAG) in animal models, and studies show it is economically viable.

  14. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  15. Terapia gênica Gene therapy

    Directory of Open Access Journals (Sweden)

    Nance Beyer Nardi

    2002-01-01

    Full Text Available Terapia gênica é um procedimento médico que envolve a modificação genética de células como forma de tratar doenças. Os genes influenciam praticamente todas as doenças humanas, seja pela codificação de proteínas anormais diretamente responsáveis pela doença, seja por determinar suscetibilidade a agentes ambientais que a induzem. A terapia gênica é ainda experimental, e está sendo estudada em protocolos clínicos para diferentes tipos de doenças. O desenvolvimento de métodos seguros e eficientes de transferência gênica para células humanas é um dos pontos mais importantes na terapia gênica. Apesar do grande esforço dirigido na última década para o aperfeiçoamento dos protocolos de terapia gênica humana, e dos avanços importantes na pesquisa básica, as aplicações terapêuticas da tecnologia de transferência gênica continuam ainda em grande parte teóricas. O potencial da terapia gênica é muito grande, devendo ainda causar grande impacto em todos os aspectos da medicina.Gene therapy is a medical intervention that involves modifying the genetic material of living cells to fight disease. Genes influence virtually every human disease, either by encoding for abnormal proteins, which are directly responsible for the disease, or by causing a susceptibility to environmental agents which induce it. Gene therapy is still experimental, and is being studied in clinical trials for many different types of diseases. The development of safe and effective methods of implanting normal genes into the human cell is one of the most important technical issues in gene therapy. Although much effort has been directed in the last decade toward improvement of protocols in human gene therapy, and in spite of many considerable achievements in basic research, the therapeutic applications of gene transfer technology still remain mostly theoretical. The potential for gene therapy is huge and likely to impact on all aspects of medicine.

  16. An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

    Science.gov (United States)

    Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

  17. Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

    NARCIS (Netherlands)

    Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

    2000-01-01

    The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

  18. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  19. A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105

    Directory of Open Access Journals (Sweden)

    Hiroaki Iwasaka

    2018-04-01

    Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.

  20. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  1. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    International Nuclear Information System (INIS)

    Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

    2014-01-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  2. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2014-07-01

    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  3. Conditional RNAi: towards a silent gene therapy.

    Science.gov (United States)

    Lee, Sang-Kyung; Kumar, Priti

    2009-07-02

    RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.

  4. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus

    2013-01-01

    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound....

  5. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

  6. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  7. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

    Science.gov (United States)

    Yang, Ji; Gu, Hongya; Yang, Ziheng

    2004-01-01

    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

  8. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan

    2017-12-01

    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  9. Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

    2017-11-03

    Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

  10. Gene therapy for Stargardt disease associated with ABCA4 gene.

    Science.gov (United States)

    Han, Zongchao; Conley, Shannon M; Naash, Muna I

    2014-01-01

    Mutations in the photoreceptor-specific flippase ABCA4 lead to accumulation of the toxic bisretinoid A2E, resulting in atrophy of the retinal pigment epithelium (RPE) and death of the photoreceptor cells. Many blinding diseases are associated with these mutations including Stargardt's disease (STGD1), cone-rod dystrophy, retinitis pigmentosa (RP), and increased susceptibility to age-related macular degeneration. There are no curative treatments for any of these dsystrophies. While the monogenic nature of many of these conditions makes them amenable to treatment with gene therapy, the ABCA4 cDNA is 6.8 kb and is thus too large for the AAV vectors which have been most successful for other ocular genes. Here we review approaches to ABCA4 gene therapy including treatment with novel AAV vectors, lentiviral vectors, and non-viral compacted DNA nanoparticles. Lentiviral and compacted DNA nanoparticles in particular have a large capacity and have been successful in improving disease phenotypes in the Abca4 (-/-) murine model. Excitingly, two Phase I/IIa clinical trials are underway to treat patients with ABCA4-associated Startgardt's disease (STGD1). As a result of the development of these novel technologies, effective therapies for ABCA4-associated diseases may finally be within reach.

  11. Suicide genes or p53 gene and p53 target genes as targets for cancer gene therapy by ionizing radiation

    International Nuclear Information System (INIS)

    Liu Bing; Chinese Academy of Sciences, Beijing; Zhang Hong

    2005-01-01

    Radiotherapy has some disadvantages due to the severe side-effect on the normal tissues at a curative dose of ionizing radiation (IR). Similarly, as a new developing approach, gene therapy also has some disadvantages, such as lack of specificity for tumors, limited expression of therapeutic gene, potential biological risk. To certain extent, above problems would be solved by the suicide genes or p53 gene and its target genes therapies targeted by ionizing radiation. This strategy not only makes up the disadvantage from radiotherapy or gene therapy alone, but also promotes success rate on the base of lower dose. By present, there have been several vectors measuring up to be reaching clinical trials. This review focused on the development of the cancer gene therapy through suicide genes or p53 and its target genes mediated by IR. (authors)

  12. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

    Science.gov (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

    2014-01-13

    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  13. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

    Science.gov (United States)

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

    2015-10-01

    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

    Science.gov (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

    2005-06-01

    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  15. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

    2013-01-01

    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  16. Targeted Gene Therapy of Cancer: Second Amendment toward Holistic Therapy.

    Science.gov (United States)

    Barar, Jaleh; Omidi, Yadollah

    2013-01-01

    It seems solid tumors are developing smart organs with specialized cells creating specified bio-territory, the so called "tumor microenvironment (TME)", in which there is reciprocal crosstalk among cancer cells, immune system cells and stromal cells. TME as an intricate milieu also consists of cancer stem cells (CSCs) that can resist against chemotherapies. In solid tumors, metabolism and vascularization appears to be aberrant and tumor interstitial fluid (TIF) functions as physiologic barrier. Thus, chemotherapy, immunotherapy and gene therapy often fail to provide cogent clinical outcomes. It looms that it is the time to accept the fact that initiation of cancer could be generation of another form of life that involves a cluster of thousands of genes, while we have failed to observe all aspects of it. Hence, the current treatment modalities need to be re-visited to cover all key aspects of disease using combination therapy based on the condition of patients. Perhaps personalized cluster of genes need to be simultaneously targeted.

  17. Targeted Gene Therapy of Cancer: Second Amendment toward Holistic Therapy

    Directory of Open Access Journals (Sweden)

    Jaleh Barar

    2013-02-01

    Full Text Available It seems solid tumors are developing smart organs with specialized cells creating specified bio-territory, the so called “tumor microenvironment (TME”, in which there is reciprocal crosstalk among cancer cells, immune system cells and stromal cells. TME as an intricate milieu also consists of cancer stem cells (CSCs that can resist against chemotherapies. In solid tumors, metabolism and vascularization appears to be aberrant and tumor interstitial fluid (TIF functions as physiologic barrier. Thus, chemotherapy, immunotherapy and gene therapy often fail to provide cogent clinical outcomes. It looms that it is the time to accept the fact that initiation of cancer could be generation of another form of life that involves a cluster of thousands of genes, while we have failed to observe all aspects of it. Hence, the current treatment modalities need to be re-visited to cover all key aspects of disease using combination therapy based on the condition of patients. Perhaps personalized cluster of genes need to be simultaneously targeted.

  18. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hansen, K.; Szabo, Peter

    2003-01-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3...... broth was significantly affected by the biomass concentration, the morphology, and also by pH. The chsB disruption strain had lower consistency index K values for all biomass concentrations investigated, which is a desirable trait for industrial Aspergillus fermentations. (C) 2003 Wiley Periodicals, Inc....

  19. Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

    Directory of Open Access Journals (Sweden)

    T. Angeline

    2011-01-01

    Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

  20. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo

    2004-09-01

    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  1. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  2. Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hjort, C.M.; Hansen, K.

    2002-01-01

    In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

  3. Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

    Energy Technology Data Exchange (ETDEWEB)

    Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

    2007-08-01

    To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

  4. Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.)

    Science.gov (United States)

    Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.

    2006-01-01

    Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870

  5. Overexpression of the Anthocyanidin Synthase Gene in Strawberry Enhances Antioxidant Capacity and Cytotoxic Effects on Human Hepatic Cancer Cells.

    Science.gov (United States)

    Giampieri, Francesca; Gasparrini, Massimiliano; Forbes-Hernandez, Tamara Y; Mazzoni, Luca; Capocasa, Franco; Sabbadini, Silvia; Alvarez-Suarez, Josè M; Afrin, Sadia; Rosati, Carlo; Pandolfini, Tiziana; Molesini, Barbara; Sánchez-Sevilla, José F; Amaya, Iraida; Mezzetti, Bruno; Battino, Maurizio

    2018-01-24

    Food fortification through the increase and/or modulation of bioactive compounds has become a major goal for preventing several diseases, including cancer. Here, strawberry lines of cv. Calypso transformed with a construct containing an anthocyanidin synthase (ANS) gene were produced to study the effects on anthocyanin biosynthesis, metabolism, and transcriptome. Three strawberry ANS transgenic lines (ANS L5, ANS L15, and ANS L18) were analyzed for phytochemical composition and total antioxidant capacity (TAC), and their fruit extracts were assessed for cytotoxic effects on hepatocellular carcinoma. ANS L18 fruits had the highest levels of total phenolics and flavonoids, while those of ANS L15 had the highest anthocyanin concentration; TAC positively correlated with total polyphenol content. Fruit transcriptome was also specifically affected in the polyphenol biosynthesis and in other related metabolic pathways. Fruit extracts of all lines exerted cytotoxic effects in a dose/time-dependent manner, increasing cellular apoptosis and free radical levels and impairing mitochondrial functionality.

  6. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Science.gov (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  7. A novel haplotype of low-frequency variants in the aldosterone synthase gene among northern Han Chinese with essential hypertension.

    Science.gov (United States)

    Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun

    2017-09-01

    Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.

  8. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  9. SEQUENCE OF THE STRUCTURAL GENE FOR GRANULE-BOUND STARCH SYNTHASE OF POTATO (SOLANUM-TUBEROSUM L) AND EVIDENCE FOR A SINGLE POINT DELETION IN THE AMF ALLELE

    NARCIS (Netherlands)

    van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem

    The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type

  10. Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

    NARCIS (Netherlands)

    Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

    2004-01-01

    The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

  11. Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

    DEFF Research Database (Denmark)

    Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri

    2014-01-01

    BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...

  12. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review

    Directory of Open Access Journals (Sweden)

    S.N. Koval

    2017-08-01

    of the genotype TT(-344 of the gene CYP11B2 with the risk of MS among residents of the North-West region of Russia. The carrier of 344T allele of AS gene in patients with AO was associated with an increased risk of hypertension development. The features of AS gene polymorphism and blood levels in acromegaly have been stu­died, and the allelic polymorphism of AS and chymase genes (CMA has been analyzed to identify the possible association of alleles of these genes with secondary hypertension and hyperaldosteronism in Russians. The congenital defects of the enzymatic activity of AS are of undoubted interest. AS gene is a promising candidate gene in the European and Asian populations for a number of secondary forms of hypertension, MS, diabetes mellitus, abdominal obesity, renal pathology, diabe­tic nephropathy, gestational hypertension. Genotyping of AS gene polymorphisms can be useful in differential diagnostic in patients with secondary forms of arterial hypertension, hypertension with low plasma renin activity, renovascular and resistant hypertension, adrenal tumors, primary and secondary hyperaldosteronism, aldosteromas, imaginary excess of mi­neralcorticoids syndrome, congenital hyperplasia of adrenal cortex. The advantages and disadvantages of the therapeutic use of MCR antagonists and the prospects for the administration of aldosterone synthase inhibitors among various categories of patients are considered. Carrying out the genotyping of patients by the CYP11B2 gene before therapy starting will allow take into account the genetic factors of sensitivity to drug in patients with the phenomenon of arterial hypertension and endocrine disorders. New AS inhibitors will not only effectively reduce blood pressure, but also will be able to prevent the development of adverse humoral and hormonal changes, what will prolong the life of patients and will help to reduce the level of total mortality from this pathology.

  13. Cancer gene therapy with targeted adenoviruses.

    Science.gov (United States)

    Bachtarzi, Houria; Stevenson, Mark; Fisher, Kerry

    2008-11-01

    Clinical experience with adenovirus vectors has highlighted the need for improved delivery and targeting. This manuscript aims to provide an overview of the techniques currently under development for improving adenovirus delivery to malignant cells in vivo. Primary research articles reporting improvements in adenoviral gene delivery are described. Strategies include genetic modification of viral coat proteins, non-genetic modifications including polymer encapsulation approaches and pharmacological interventions. Reprogramming adenovirus tropism in vitro has been convincingly demonstrated using a range of genetic and physical strategies. These studies have provided new insights into our understanding of virology and the field is progressing. However, there are still some limitations that need special consideration before adenovirus-targeted cancer gene therapy emerges as a routine treatment in the clinical setting.

  14. Gene therapy for carcinoma of the breast: Genetic toxins

    International Nuclear Information System (INIS)

    Vassaux, Georges; Lemoine, Nick R

    2000-01-01

    Gene therapy was initially envisaged as a potential treatment for genetically inherited, monogenic disorders. The applications of gene therapy have now become wider, however, and include cardiovascular diseases, vaccination and cancers in which conventional therapies have failed. With regard to oncology, various gene therapy approaches have been developed. Among them, the use of genetic toxins to kill cancer cells selectively is emerging. Two different types of genetic toxins have been developed so far: the metabolic toxins and the dominant-negative class of toxins. This review describes these two different approaches, and discusses their potential applications in cancer gene therapy

  15. Hereditary hemochromatosis: An opportunity for gene therapy

    Directory of Open Access Journals (Sweden)

    FERNANDO EZQUER

    2006-01-01

    Full Text Available Levels of body iron should be tightly controlled to prevent the formation of oxygen radicals, lipoperoxidation, genotoxicity, and the production of cytotoxic cytokines, which result in damage to a number of organs. Enterocytes in the intestinal villae are involved in the apical uptake of iron from the intestinal lumen; iron is further exported from the cells into the circulation. The apical divalent metal transporter-1 (DMT1 transports ferrous iron from the lumen into the cells, while the basolateral transporter ferroportin extrudes iron from the enterocytes into the circulation. Patients with hereditary hemochromatosis display an accelerated transepithelial uptake of iron, which leads to body iron accumulation that results in cirrhosis, hepatocellular carcinoma, pancreatitis, and cardiomyopathy. Hereditary hemochromatosis, a recessive genetic condition, is the most prevalent genetic disease in Caucasians, with a prevalence of one in 300 subjects. The majority of patients with hereditary hemochromatosis display mutations in the gene coding for HFE, a protein that normally acts as an inhibitor of transepithelial iron transport. We discuss the different control points in the homeostasis of iron and the different mutations that exist in patients with hereditary hemochromatosis. These control sites may be influenced by gene therapeutic approaches; one general therapy for hemochromatosis of different etiologies is the inhibition of DMT1 synthesis by antisense-generating genes, which has been shown to markedly inhibit apical iron uptake by intestinal epithelial cells. We further discuss the most promising strategies to develop gene vectors and deliver them into enterocytes

  16. Evolution and functional insights of different ancestral orthologous clades of chitin synthase genes in the fungal tree of life

    Directory of Open Access Journals (Sweden)

    Mu eLi

    2016-02-01

    Full Text Available Chitin synthases (CHSs are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene

  17. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  18. Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

    Science.gov (United States)

    Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2017-07-01

    The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

  19. Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

    Science.gov (United States)

    Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

    2017-07-01

    Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

  20. Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

    Science.gov (United States)

    Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

    2016-12-01

    To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.

  1. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

    Directory of Open Access Journals (Sweden)

    Linda Koshy

    2008-01-01

    Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

  2. Gene therapy in animal models of autosomal dominant retinitis pigmentosa

    Science.gov (United States)

    Rossmiller, Brian; Mao, Haoyu

    2012-01-01

    Gene therapy for dominantly inherited genetic disease is more difficult than gene-based therapy for recessive disorders, which can be treated with gene supplementation. Treatment of dominant disease may require gene supplementation partnered with suppression of the expression of the mutant gene either at the DNA level, by gene repair, or at the RNA level by RNA interference or transcriptional repression. In this review, we examine some of the gene delivery approaches used to treat animal models of autosomal dominant retinitis pigmentosa, focusing on those models associated with mutations in the gene for rhodopsin. We conclude that combinatorial approaches have the greatest promise for success. PMID:23077406

  3. Personalizing gene therapy in gastric cancer.

    Science.gov (United States)

    Vogiatzi, P; Cassone, M; Claudio, P P

    2006-11-01

    Gene therapy was proposed many decades ago as a more straightforward and definitive way of curing human diseases, but only recently technical advancements and improved knowledge have allowed its active development as a broad and promising research field. After the first successes in the cure of genetic and infectious diseases, it has been actively investigated as a means to decrease the burden and suffering generated by cancer. The field of gastric cancer is witnessing an impressive flourishing of studies testing the possibilities and actual efficacy of the many different strategies employed in gene therapy, and overall results seem to be two-sided: while original ideas and innovative protocols are providing extremely interesting contributions with great potential, more advanced-phase studies concluded so far have fallen short of expectations regarding efficacy, although invariably demonstrating little or no toxicity. An overview of the major efforts in this field is provided here, and a critical discussion is presented on the single strategies undertaken and on the overall balance between potentiality and pitfalls. Copyright 2006 Prous Science. All rights reserved.

  4. Expression of mismatch repair gene PMS2 in nasopharyngeal carcinoma and regulation by glycogen synthase kinase-3β in vivo and in vitro.

    Science.gov (United States)

    Fang, Jugao; Lei, Wenbin; Huang, Xiaoming; Li, Pingdong; Chen, Xiaohong; Zhu, Xiaolin; Wen, Weiping; Li, Huabin

    2012-02-01

    To evaluate the expression of mismatch repair gene PMS2 in human nasopharyngeal carcinoma (NPC) tissues and evaluate the effect of glycogen synthase kinase (GSK)-3β on PMS2 production in vivo and in vitro. The expression of PMS2 and inactivated phosphorylated GSK-3β(s9) was examined by immunohistochemical staining in 25 NPC tissues and the relation was determined by correlation analysis. The effect of GSK-3β transfection in CNE-2 cells on PMS2 production as well as cell apoptosis and chemosensitization were evaluated using small interference RNA (siRNA), immunoblotting and flow cytometric analysis in vitro. The expression of inactivated phosphorylated GSK-3β(s9) was found to negative correlated with PMS2 in vivo. And transfected GSK-3β was found to be able to enhance PMS2 production, and increase cell apoptosis in CNE-2 cells in combination with cisplatin administration in vitro. Inactivation of GSK-3β might be important for NPC tumorgenesis through negatively regulating PMS2 production, and enhanced PMS2 production by GSK-3β is beneficial for understanding the NPC tumorgenesis and developing potential strategy for future therapy. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  5. Nonviral Delivery Systems For Cancer Gene Therapy: Strategies And Challenges.

    Science.gov (United States)

    Shim, Gayong; Kim, Dongyoon; Le, Quoc-Viet; Park, Gyu Thae; Kwon, Taekhyun; Oh, Yu-Kyoung

    2018-01-19

    Gene therapy has been receiving widespread attention due to its unique advantage in regulating the expression of specific target genes. In the field of cancer gene therapy, modulation of gene expression has been shown to decrease oncogenic factors in cancer cells or increase immune responses against cancer. Due to the macromolecular size and highly negative physicochemical features of plasmid DNA, efficient delivery systems are an essential ingredient for successful gene therapy. To date, a variety of nanostructures and materials have been studied as nonviral gene delivery systems. In this review, we will cover nonviral delivery strategies for cancer gene therapy, with a focus on target cancer genes and delivery materials. Moreover, we will address current challenges and perspectives for nonviral delivery-based cancer gene therapeutics. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  6. Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

    Science.gov (United States)

    Xiang, Lin; Zhao, Kaige; Chen, Longqing

    2010-01-01

    Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  7. Gene replacement therapy for genetic hepatocellular jaundice.

    Science.gov (United States)

    van Dijk, Remco; Beuers, Ulrich; Bosma, Piter J

    2015-06-01

    Jaundice results from the systemic accumulation of bilirubin, the final product of the catabolism of haem. Inherited liver disorders of bilirubin metabolism and transport can result in reduced hepatic uptake, conjugation or biliary secretion of bilirubin. In patients with Rotor syndrome, bilirubin (re)uptake is impaired due to the deficiency of two basolateral/sinusoidal hepatocellular membrane proteins, organic anion-transporting polypeptide 1B1 (OATP1B1) and OATP1B3. Dubin-Johnson syndrome is caused by a defect in the ATP-dependent canalicular transporter, multidrug resistance-associated protein 2 (MRP2), which mediates the export of conjugated bilirubin into bile. Both disorders are benign and not progressive and are characterised by elevated serum levels of mainly conjugated bilirubin. Uridine diphospho-glucuronosyl transferase 1A1 (UGT1A1) is responsible for the glucuronidation of bilirubin; deficiency of this enzyme results in unconjugated hyperbilirubinaemia. Gilbert syndrome is the mild and benign form of inherited unconjugated hyperbilirubinaemia and is mostly caused by reduced promoter activity of the UGT1A1 gene. Crigler-Najjar syndrome is the severe inherited form of unconjugated hyperbilirubinaemia due to mutations in the UGT1A1 gene, which can cause kernicterus early in life and can be even lethal when left untreated. Due to major disadvantages of the current standard treatments for Crigler-Najjar syndrome, phototherapy and liver transplantation, new effective therapeutic strategies are under development. Here, we review the clinical features, pathophysiology and genetic background of these inherited disorders of bilirubin metabolism and transport. We also discuss the upcoming treatment option of viral gene therapy for genetic disorders such as Crigler-Najjar syndrome and the possible immunological consequences of this therapy.

  8. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    Science.gov (United States)

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  9. Applications of lipid nanoparticles in gene therapy.

    Science.gov (United States)

    Del Pozo-Rodríguez, Ana; Solinís, María Ángeles; Rodríguez-Gascón, Alicia

    2016-12-01

    Solid lipid nanoparticles (SLNs) and nanostructured lipid carriers (NLCs) have been recognized, among the large number of non-viral vectors for gene transfection, as an effective and safety alternative to potentially treat both genetic and not genetic diseases. A key feature is the possibility to be designed to overcome the numerous challenges for successful gene delivery. Lipid nanoparticles (LNs) are able to overcome the main biological barriers for cell transfection, including degradation by nucleases, cell internalization intracellular trafficking, and selectively targeting to a specific cell type. Additionally, they present important advantages: from a safety point of view LNs are prepared with well tolerated components, and from a technological point of view, they can be easily produced at large-scale, can be subjected to sterilization and lyophilization, and have shown good storage stability. This review focuses on the potential of SLNs and NLCs for gene therapy, including the main advances in their application for the treatment of ocular diseases, infectious diseases, lysosomal storage disorders and cancer, and current research for their future clinical application. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)

    2010-03-08

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  11. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Pejcha, Robert; Ludwig, Martha L.

    2005-01-01

    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  12. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal

    2005-02-01

    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  13. Advances in study of reporter gene imaging for monitoring gene therapy

    International Nuclear Information System (INIS)

    Mu Chuanjie; Zhou Jiwen

    2003-01-01

    To evaluate the efficiency of gene therapy, it is requisite to monitor localization and expression of the therapeutic gene in vivo. Monitoring expression of reporter gene using radionuclide reporter gene technique is the best method. Adenoviral vectors expressing reporter gene are constructed using gene fusion, bicistronic, double promoter or bidirectional transcriptional recombination techniques, and transferred into target cells and tissues, then injected radiolabeled reporter probes which couple to the reporter genes. The reporter genes can be imaged invasively, repeatedly, quantitatively with γ-camera, PET and SPECT. Recently, several reporter gene and reporter probe systems have been used in studies of gene therapy. The part of them has been used for clinic trials

  14. In silico identification and analysis of phytoene synthase genes in plants.

    Science.gov (United States)

    Han, Y; Zheng, Q S; Wei, Y P; Chen, J; Liu, R; Wan, H J

    2015-08-14

    In this study, we examined phytoene synthetase (PSY), the first key limiting enzyme in the synthesis of carotenoids and catalyzing the formation of geranylgeranyl pyrophosphate in terpenoid biosynthesis. We used known amino acid sequences of the PSY gene in tomato plants to conduct a genome-wide search and identify putative candidates in 34 sequenced plants. A total of 101 homologous genes were identified. Phylogenetic analysis revealed that PSY evolved independently in algae as well as monocotyledonous and dicotyledonous plants. Our results showed that the amino acid structures exhibited 5 motifs (motifs 1 to 5) in algae and those in higher plants were highly conserved. The PSY gene structures showed that the number of intron in algae varied widely, while the number of introns in higher plants was 4 to 5. Identification of PSY genes in plants and the analysis of the gene structure may provide a theoretical basis for studying evolutionary relationships in future analyses.

  15. Progresses towards safe and efficient gene therapy vectors.

    Science.gov (United States)

    Chira, Sergiu; Jackson, Carlo S; Oprea, Iulian; Ozturk, Ferhat; Pepper, Michael S; Diaconu, Iulia; Braicu, Cornelia; Raduly, Lajos-Zsolt; Calin, George A; Berindan-Neagoe, Ioana

    2015-10-13

    The emergence of genetic engineering at the beginning of the 1970's opened the era of biomedical technologies, which aims to improve human health using genetic manipulation techniques in a clinical context. Gene therapy represents an innovating and appealing strategy for treatment of human diseases, which utilizes vehicles or vectors for delivering therapeutic genes into the patients' body. However, a few past unsuccessful events that negatively marked the beginning of gene therapy resulted in the need for further studies regarding the design and biology of gene therapy vectors, so that this innovating treatment approach can successfully move from bench to bedside. In this paper, we review the major gene delivery vectors and recent improvements made in their design meant to overcome the issues that commonly arise with the use of gene therapy vectors. At the end of the manuscript, we summarized the main advantages and disadvantages of common gene therapy vectors and we discuss possible future directions for potential therapeutic vectors.

  16. Genes encoding chavicol/eugenol synthase from the creosote bush Larrea tridentata

    Science.gov (United States)

    Lewis, Norman G.; Davin, Laurence B.; Kim, Sung -Jin; Vassao, Daniel Giddings; Patten, Ann M.; Eichinger, Dietmar

    2015-09-15

    Particular aspects provide novel methods for redirecting carbon allocation in plants or cell culture from lignification to inherently more useful and tractable materials, and to facilitate the generation of, e.g., biofuels from the remaining plant ro culture biomass. Particular aspects provided novel methods for converting monolignols into allyl/propenyl phenols, and for chavicol/eugenol formation or production. Additional aspects relate to the discovery of novel chavicol/eugenol synthases that convert p-coumaryl/coniferyl alcohol esters into chavicol/eugenol, and to novel compositions (e.g., novel proteins and nucleic acids encoding same), and novel methods using same for producing or forming chavicol/eugenol and other derivatives in cell culture and/or genetically modified plants, and for re-engineering the composition of plant biomass. Particular aspects provide novel methods for generation in culture or in planta of liquid/combustible allyl/propenyl phenols, and these phenolic products are utilized for (non-ethanol) biofuel/bioenergy purposes, while the remaining plant biomass facilitates the generation of other biofuels.

  17. Dynamic modulation of thymidylate synthase gene expression and fluorouracil sensitivity in human colorectal cancer cells.

    Directory of Open Access Journals (Sweden)

    Kentaro Wakasa

    Full Text Available Biomarkers have revolutionized cancer chemotherapy. However, many biomarker candidates are still in debate. In addition to clinical studies, a priori experimental approaches are needed. Thymidylate synthase (TS expression is a long-standing candidate as a biomarker for 5-fluorouracil (5-FU treatment of cancer patients. Using the Tet-OFF system and a human colorectal cancer cell line, DLD-1, we first constructed an in vitro system in which TS expression is dynamically controllable. Quantitative assays have elucidated that TS expression in the transformant was widely modulated, and that the dynamic range covered 15-fold of the basal level. 5-FU sensitivity of the transformant cells significantly increased in response to downregulated TS expression, although being not examined in the full dynamic range because of the doxycycline toxicity. Intriguingly, our in vitro data suggest that there is a linear relationship between TS expression and the 5-FU sensitivity in cells. Data obtained in a mouse model using transformant xenografts were highly parallel to those obtained in vitro. Thus, our in vitro and in vivo observations suggest that TS expression is a determinant of 5-FU sensitivity in cells, at least in this specific genetic background, and, therefore, support the possibility of TS expression as a biomarker for 5-FU-based cancer chemotherapy.

  18. Novel cystathionine β-synthase gene mutations in a Filipino patient with classic homocystinuria.

    Science.gov (United States)

    Silao, Catherine Lynn T; Fabella, Terence Diane F; Rama, Kahlil Izza D; Estrada, Sylvia C

    2015-10-01

    Classic homocystinuria due to cystathionine β-synthase (CBS) deficiency is an autosomal recessive disorder of sulfur metabolism. Clinical manifestations include mental retardation, dislocation of the optic lens (ectopia lentis), skeletal abnormalities and a tendency to thromboembolic episodes. We present the first mutational analysis of CBS in a Filipino patient with classic homocystinuria. Genomic DNA was extracted from peripheral blood collected from a diagnosed Filipino patient with classic homocystinuria. The entire coding region of CBS (17 exons) was amplified using polymerase chain reaction and bidirectionally sequenced using standard protocols. The patient was found to be compound heterozygous for two novel mutations, g.13995G>A [c.982G>A; p.D328K] and g.15860-15868dupGCAGGAGCT [c.1083-1091dupGCAGGAGCT; p. Q362-L364dupQEL]. Four known single-nucleotide polymorphisms (rs234706, rs1801181, rs706208 and rs706209) were also detected in the present patient's CBS. The patient was heterozygous for all the identified alleles. This is the first mutational analysis of CBS done in a Filipino patient with classic homocystinuria who presented with a novel duplication mutation and a novel missense mutation. Homocystinuria due to CBS deficiency is a heterogeneous disorder at the molecular level. © 2015 Japan Pediatric Society.

  19. Association of a neuronal nitric oxide synthase gene polymorphism with levodopa-induced dyskinesia in Parkinson's disease.

    Science.gov (United States)

    Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor

    2018-04-01

    Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. The Class II trehalose 6-phosphate synthase gene PvTPS9 modulates trehalose metabolism in Phaseolus vulgaris nodules.

    Directory of Open Access Journals (Sweden)

    Aarón Barraza

    2016-11-01

    Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.

  1. Phenotype commitment in vascular smooth muscle cells derived from coronary atherosclerotic plaques: differential gene expression of endothelial Nitric Oxide Synthase

    Directory of Open Access Journals (Sweden)

    ML Rossi

    2009-06-01

    Full Text Available Unstable angina and myocardial infarction are the clinical manifestations of the abrupt thrombotic occlusion of an epicardial coronary artery as a result of spontaneous atherosclerotic plaque rupture or fissuring, and the exposure of highly thrombogenic material to blood. It has been demonstrated that the proliferation of vascular smooth muscle cells (VSMCs and impaired bioavailabilty of nitric oxide (NO are among the most important mechanisms involved in the progression of atherosclerosis. It has also been suggested that a NO imbalance in coronary arteries may be involved in myocardial ischemia as a result of vasomotor dysfunction triggering plaque rupture and the thrombotic response. We used 5’ nuclease assays (TaqMan™ PCRs to study gene expression in coronary plaques collected by means of therapeutic directional coronary atherectomy from 15 patients with stable angina (SA and 15 with acute coronary syndromes (ACS without ST elevation. Total RNA was extracted from the 30 plaques and the cDNA was amplified in order to determine endothelial nitric oxide synthase (eNOS gene expression. Analysis of the results showed that the expression of eNOS was significantly higher (p<0.001 in the plaques from the ACS patients. Furthermore, isolated VSMCs from ACS and SA plaques confirmed the above pattern even after 25 plating passages. In situ RT-PCR was also carried out to co-localize the eNOS messengers and the VSMC phenotype.

  2. 2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

    Science.gov (United States)

    Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

    2012-12-01

    Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

  3. Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene for the Production of Vanillin.

    Science.gov (United States)

    Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan

    2017-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.

  4. Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

    Science.gov (United States)

    Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

    2014-09-01

    Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Nanoparticles for cancer gene therapy: Recent advances, challenges, and strategies.

    Science.gov (United States)

    Wang, Kui; Kievit, Forrest M; Zhang, Miqin

    2016-12-01

    Compared to conventional treatments, gene therapy offers a variety of advantages for cancer treatment including high potency and specificity, low off-target toxicity, and delivery of multiple genes that concurrently target cancer tumorigenesis, recurrence, and drug resistance. In the past decades, gene therapy has undergone remarkable progress, and is now poised to become a first line therapy for cancer. Among various gene delivery systems, nanoparticles have attracted much attention because of their desirable characteristics including low toxicity profiles, well-controlled and high gene delivery efficiency, and multi-functionalities. This review provides an overview on gene therapeutics and gene delivery technologies, and highlight recent advances, challenges and insights into the design and the utility of nanoparticles in gene therapy for cancer treatment. Copyright © 2016. Published by Elsevier Ltd.

  6. Image Guidance and Assessment of Radiation Induced Gene Therapy

    National Research Council Canada - National Science Library

    Pelizzari, Charles

    2004-01-01

    Image guidance and assessment techniques are being developed for combined radiation/gene therapy, which utilizes a radiation-inducible gene promoter to cause expression of tumor necrosis factor alpha...

  7. Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

    Directory of Open Access Journals (Sweden)

    Khalil Zaynali

    2010-06-01

    Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.

  8. The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

    Science.gov (United States)

    Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

    2015-07-28

    Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

  9. Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

    Directory of Open Access Journals (Sweden)

    Michelle F. Valentine

    2017-05-01

    Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

  10. Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

    Science.gov (United States)

    Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.

    2017-01-01

    Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898

  11. Prevalence of endothelial nitric oxide synthase (eNOS) gene exon 7 Glu298Asp variant in North Eastern India

    Science.gov (United States)

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

    2011-01-01

    Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032

  12. Improved animal models for testing gene therapy for atherosclerosis.

    Science.gov (United States)

    Du, Liang; Zhang, Jingwan; De Meyer, Guido R Y; Flynn, Rowan; Dichek, David A

    2014-04-01

    Gene therapy delivered to the blood vessel wall could augment current therapies for atherosclerosis, including systemic drug therapy and stenting. However, identification of clinically useful vectors and effective therapeutic transgenes remains at the preclinical stage. Identification of effective vectors and transgenes would be accelerated by availability of animal models that allow practical and expeditious testing of vessel-wall-directed gene therapy. Such models would include humanlike lesions that develop rapidly in vessels that are amenable to efficient gene delivery. Moreover, because human atherosclerosis develops in normal vessels, gene therapy that prevents atherosclerosis is most logically tested in relatively normal arteries. Similarly, gene therapy that causes atherosclerosis regression requires gene delivery to an existing lesion. Here we report development of three new rabbit models for testing vessel-wall-directed gene therapy that either prevents or reverses atherosclerosis. Carotid artery intimal lesions in these new models develop within 2-7 months after initiation of a high-fat diet and are 20-80 times larger than lesions in a model we described previously. Individual models allow generation of lesions that are relatively rich in either macrophages or smooth muscle cells, permitting testing of gene therapy strategies targeted at either cell type. Two of the models include gene delivery to essentially normal arteries and will be useful for identifying strategies that prevent lesion development. The third model generates lesions rapidly in vector-naïve animals and can be used for testing gene therapy that promotes lesion regression. These models are optimized for testing helper-dependent adenovirus (HDAd)-mediated gene therapy; however, they could be easily adapted for testing of other vectors or of different types of molecular therapies, delivered directly to the blood vessel wall. Our data also supports the promise of HDAd to deliver long

  13. Inducement of radionuclides targeting therapy by gene transfection

    International Nuclear Information System (INIS)

    Luo Quanyong

    2001-01-01

    The author presents an overview of gene transfection methods to genetically induce tumor cells to express enhanced levels of cell surface antigens and receptors to intake radiolabeled antibody and peptide targeting and thus increase their therapeutic effect in radiotherapy. The current research include inducement of radioimmunotherapy through CEA gene transfection, inducement of iodine-131 therapy by sodium iodide symporter gene transfection and inducement of MIBG therapy by noradrenaline transporter gene transfection. These studies raise the prospect that gene-therapy techniques could be used to enable the treatment of a wide range of tumors with radiopharmaceuticals of established clinical acceptability

  14. Genetically engineering adenoviral vectors for gene therapy.

    Science.gov (United States)

    Coughlan, Lynda

    2014-01-01

    Adenoviral (Ad) vectors are commonly used for various gene therapy applications. Significant advances in the genetic engineering of Ad vectors in recent years has highlighted their potential for the treatment of metastatic disease. There are several methods to genetically modify the Ad genome to incorporate retargeting peptides which will redirect the natural tropism of the viruses, including homologous recombination in bacteria or yeast. However, homologous recombination in yeast is highly efficient and can be achieved without the need for extensive cloning strategies. In addition, the method does not rely on the presence of unique restriction sites within the Ad genome and the reagents required for this method are widely available and inexpensive. Large plasmids containing the entire adenoviral genome (~36 kbp) can be modified within Saccharomyces cerevisiae yeast and genomes easily rescued in Escherichia coli hosts for analysis or amplification. A method for two-step homologous recombination in yeast is described in this chapter.

  15. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    International Nuclear Information System (INIS)

    Soliman, S.E.T.; Zaater, M.K.

    2010-01-01

    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  16. Progress toward Gene Therapy for Duchenne Muscular Dystrophy.

    Science.gov (United States)

    Chamberlain, Joel R; Chamberlain, Jeffrey S

    2017-05-03

    Duchenne muscular dystrophy (DMD) has been a major target for gene therapy development for nearly 30 years. DMD is among the most common genetic diseases, and isolation of the defective gene (DMD, or dystrophin) was a landmark discovery, as it was the first time a human disease gene had been cloned without knowledge of the protein product. Despite tremendous obstacles, including the enormous size of the gene and the large volume of muscle tissue in the human body, efforts to devise a treatment based on gene replacement have advanced steadily through the combined efforts of dozens of labs and patient advocacy groups. Progress in the development of DMD gene therapy has been well documented in Molecular Therapy over the past 20 years and will be reviewed here to highlight prospects for success in the imminent human clinical trials planned by several groups. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

  17. Quick guide to polyketide synthase and nonribosomal synthetase genes in Fusarium

    DEFF Research Database (Denmark)

    Hansen, Jørgen T.; Sørensen, Jens L.; Giese, Henriette

    2012-01-01

    Fusarium species produce a plethora of bioactive polyketides and nonribosomal peptides that give rise to health problems in animals and may have drug development potential. Using the genome sequences for Fusarium graminearum, F. oxysporum, F. solani and F. verticillioides we developed a framework...... and NRPS genes in sequenced Fusarium species and their known products. With the rapid increase in the number of sequenced fungal genomes a systematic classification will greatly aid the scientific community in obtaining an overview of the number of different NRPS and PKS genes and their potential...

  18. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Olga Y. Yurkevich

    2017-08-01

    Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  19. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA) Genes in Flax (Linum usitatissimum L.).

    Science.gov (United States)

    Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V

    2017-01-01

    Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  20. Modifier genes: Moving from pathogenesis to therapy.

    Science.gov (United States)

    McCabe, Edward R B

    2017-09-01

    This commentary will focus on how we can use our knowledge about the complexity of human disease and its pathogenesis to identify novel approaches to therapy. We know that even for single gene Mendelian disorders, patients with identical mutations often have different presentations and outcomes. This lack of genotype-phenotype correlation led us and others to examine the roles of modifier genes in the context of biological networks. These investigations have utilized vertebrate and invertebrate model organisms. Since one of the goals of research on modifier genes and networks is to identify novel therapeutic targets, the challenges to patient access and compliance because of the high costs of medications for rare genetic diseases must be recognized. A recent article explored protective modifiers, including plastin 3 (PLS3) and coronin 1C (CORO1C), in spinal muscular atrophy (SMA). SMA is an autosomal recessive deficit of survival motor neuron protein (SMN) caused by mutations in SMN1. However, the severity of SMA is determined primarily by the number of SMN2 copies, and this results in significant phenotypic variability. PLS3 was upregulated in siblings who were asymptomatic compared with those who had SMA2 or SMA3, but identical homozygous SMN1 deletions and equal numbers of SMN2 copies. CORO1C was identified by interrogation of the PLS3 interactome. Overexpression of these proteins rescued endocytosis in SMA models. In addition, antisense RNA for upregulation of SMN2 protein expression is being developed as another way of modifying the SMA phenotype. These investigations suggest the practical application of protective modifiers to rescue SMA phenotypes. Other examples of the potential therapeutic value of novel protective modifiers will be discussed, including in Duchenne muscular dystrophy and glycerol kinase deficiency. This work shows that while we live in an exciting era of genomic sequencing, a functional understanding of biology, the impact of its

  1. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    . This may reflect that many PKs are either produced in small amounts, under special conditions or in developmental stages that are rarely observed under laboratory conditions. In order to trigger expression of “silent” genes we are currently pursuing several approaches; i) stimulation of A. nidulans wild...

  2. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)

    Citric acid is an important organic acid, multifunctional with a wide array of uses. The objectives of this study were the isolation and selection strains of the genus Aspergillus, investigating the solubilization of phosphate of these isolates, verifying the expression rate of genes involved in the identification of isolates, and ...

  3. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ajl yemi

    2011-12-19

    Dec 19, 2011 ... Kohler RH, Horn R, Lossl A (1991). Cytoplasmic male sterility in sunflower is correlated with the co-transcription of a new open reading frame with the atpA gene. Mol. Gen. Genet. 227: 369-376. Langmead B, Schatz MC, Lin J, Pop M, Salzberg SL (2009a). Searching for SNPs with cloud computing. Genom.

  4. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

    Science.gov (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

    2017-12-01

    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  5. Prospects for Gene Therapy in the Fragile X Syndrome

    Science.gov (United States)

    Rattazzi, Mario C.; LaFauci, Giuseppe; Brown, W. Ted

    2004-01-01

    Gene therapy is unarguably the definitive way to treat, and possibly cure, genetic diseases. A straightforward concept in theory, in practice it has proven difficult to realize, even when directed to easily accessed somatic cell systems. Gene therapy for diseases in which the central nervous system (CNS) is the target organ presents even greater…

  6. The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

    2018-03-06

    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Twenty Years of European Union Support to Gene Therapy and Gene Transfer.

    Science.gov (United States)

    Gancberg, David

    2017-11-01

    For 20 years and throughout its research programmes, the European Union has supported the entire innovation chain for gene transfer and gene therapy. The fruits of this investment are ripening as gene therapy products are reaching the European market and as clinical trials are demonstrating the safety of this approach to treat previously untreatable diseases.

  8. Disruption of the Candida albicans TPS1 Gene Encoding Trehalose-6-Phosphate Synthase Impairs Formation of Hyphae and Decreases Infectivity†

    Science.gov (United States)

    Zaragoza, Oscar; Blazquez, Miguel A.; Gancedo, Carlos

    1998-01-01

    The TPS1 gene from Candida albicans, which encodes trehalose-6-phosphate synthase, has been cloned by functional complementation of a tps1 mutant from Saccharomyces cerevisiae. In contrast with the wild-type strain, the double tps1/tps1 disruptant did not accumulate trehalose at stationary phase or after heat shock. Growth of the tps1/tps1 disruptant at 30°C was indistinguishable from that of the wild type. However, at 42°C it did not grow on glucose or fructose but grew normally on galactose or glycerol. At 37°C, the yeast-hypha transition in the mutant in glucose-calf serum medium did not occur. During growth at 42°C, the mutant did not form hyphae in galactose or in glycerol. Some of the growth defects observed may be traced to an unbalanced sugar metabolism that reduces the cellular content of ATP. Mice inoculated with 106 CFU of the tps1/tps1 mutant did not show visible symptoms of infection 16 days after inoculation, while those similarly inoculated with wild-type cells were dead 12 days after inoculation. PMID:9683476

  9. Identification and regulation of fusA, the polyketide synthase gene responsible for fusarin production in Fusarium fujikuroi.

    Science.gov (United States)

    Díaz-Sánchez, Violeta; Avalos, Javier; Limón, M Carmen

    2012-10-01

    Fusarins are a class of mycotoxins of the polyketide family produced by different Fusarium species, including the gibberellin-producing fungus Fusarium fujikuroi. Based on sequence comparisons between polyketide synthase (PKS) enzymes for fusarin production in other Fusarium strains, we have identified the F. fujikuroi orthologue, called fusA. The participation of fusA in fusarin biosynthesis was demonstrated by targeted mutagenesis. Fusarin production is transiently stimulated by nitrogen availability in this fungus, a regulation paralleled by the fusA mRNA levels in the cell. Illumination of the cultures results in a reduction of the fusarin content, an effect partially explained by a high sensitivity of these compounds to light. Mutants of the fusA gene exhibit no external phenotypic alterations, including morphology and conidiation, except for a lack of the characteristic yellow and/or orange pigmentation of fusarins. Moreover, the fusA mutants are less efficient than the wild type at degrading cellophane on agar cultures, a trait associated with pathogenesis functions in Fusarium oxysporum. The fusA mutants, however, are not affected in their capacities to grow on plant tissues.

  10. A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

    Science.gov (United States)

    Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

    2015-01-01

    Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

  11. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1) in Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.)

    OpenAIRE

    Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek

    2014-01-01

    Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...

  12. Association between Polymorphism of Endothelial Nitric Oxide Synthase Gene (Glu298Asp) and Chronic Heart Failure in Patients with Ischemic Heart Disease and Obesity

    OpenAIRE

    O.I. Kadykova; P.P. Kravchun

    2016-01-01

    The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...

  13. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review)

    OpenAIRE

    Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.

    2017-01-01

    Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...

  14. The Role of ?786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome

    OpenAIRE

    Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard

    2011-01-01

    Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 su...

  15. Gene therapy for the inner ear: challenges and promises.

    Science.gov (United States)

    Ryan, Allen F; Dazert, Stefan

    2009-01-01

    Since the recognition of genes as the discrete units of heritability, and of DNA as their molecular substrate, the utilization of genes for therapeutic purposes has been recognized as a potential means of correcting genetic disorders. The tools of molecular biology, which allow the manipulation of DNA sequence, provided the means to put this concept into practice. However, progress in the implementation of these ideas has been slow. Here we review the history of the idea of gene therapy and the complexity of genetic disorders. We also discuss the requirements for sequence-based therapy to be accomplished for different types of inherited diseases, as well as the methods available for gene manipulation. The challenges that have limited the applications of gene therapy are reviewed, as are ethical concerns. Finally, we discuss the promise of gene therapy to address inherited and acquired disorders of the inner ear. Copyright (c) 2009 S. Karger AG, Basel.

  16. Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

    Directory of Open Access Journals (Sweden)

    Abercrombie Jason M

    2011-07-01

    Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

  17. Cloning, characterisation and comparative analysis of a starch synthase IV gene in wheat: functional and evolutionary implications

    Directory of Open Access Journals (Sweden)

    Broglie Karen E

    2008-09-01

    Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each

  18. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    Science.gov (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  19. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  20. Bacterial Toxins for Oncoleaking Suicidal Cancer Gene Therapy.

    Science.gov (United States)

    Pahle, Jessica; Walther, Wolfgang

    For suicide gene therapy, initially prodrug-converting enzymes (gene-directed enzyme-producing therapy, GDEPT) were employed to intracellularly metabolize non-toxic prodrugs into toxic compounds, leading to the effective suicidal killing of the transfected tumor cells. In this regard, the suicide gene therapy has demonstrated its potential for efficient tumor eradication. Numerous suicide genes of viral or bacterial origin were isolated, characterized, and extensively tested in vitro and in vivo, demonstrating their therapeutic potential even in clinical trials to treat cancers of different entities. Apart from this, growing efforts are made to generate more targeted and more effective suicide gene systems for cancer gene therapy. In this regard, bacterial toxins are an alternative to the classical GDEPT strategy, which add to the broad spectrum of different suicide approaches. In this context, lytic bacterial toxins, such as streptolysin O (SLO) or the claudin-targeted Clostridium perfringens enterotoxin (CPE) represent attractive new types of suicide oncoleaking genes. They permit as pore-forming proteins rapid and also selective toxicity toward a broad range of cancers. In this chapter, we describe the generation and use of SLO as well as of CPE-based gene therapies for the effective tumor cell eradication as promising, novel suicide gene approach particularly for treatment of therapy refractory tumors.

  1. Identification of Hematopoietic Stem Cell Engraftment Genes in Gene Therapy Studies.

    Science.gov (United States)

    Powers, John M; Trobridge, Grant D

    2013-09-01

    Hematopoietic stem cell (HSC) therapy using replication-incompetent retroviral vectors is a promising approach to provide life-long correction for genetic defects. HSC gene therapy clinical studies have resulted in functional cures for several diseases, but in some studies clonal expansion or leukemia has occurred. This is due to the dyregulation of endogenous host gene expression from vector provirus insertional mutagenesis. Insertional mutagenesis screens using replicating retroviruses have been used extensively to identify genes that influence oncogenesis. However, retroviral mutagenesis screens can also be used to determine the role of genes in biological processes such as stem cell engraftment. The aim of this review is to describe the potential for vector insertion site data from gene therapy studies to provide novel insights into mechanisms of HSC engraftment. In HSC gene therapy studies dysregulation of host genes by replication-incompetent vector proviruses may lead to enrichment of repopulating clones with vector integrants near genes that influence engraftment. Thus, data from HSC gene therapy studies can be used to identify novel candidate engraftment genes. As HSC gene therapy use continues to expand, the vector insertion site data collected will be of great interest to help identify novel engraftment genes and may ultimately lead to new therapies to improve engraftment.

  2. Engineering liposomal nanoparticles for targeted gene therapy.

    Science.gov (United States)

    Zylberberg, C; Gaskill, K; Pasley, S; Matosevic, S

    2017-08-01

    Recent mechanistic studies have attempted to deepen our understanding of the process by which liposome-mediated delivery of genetic material occurs. Understanding the interactions between lipid nanoparticles and cells is still largely elusive. Liposome-mediated delivery of genetic material faces systemic obstacles alongside entry into the cell, endosomal escape, lysosomal degradation and nuclear uptake. Rational design approaches for targeted delivery have been developed to reduce off-target effects and enhance transfection. These strategies, which have included the modification of lipid nanoparticles with target-specific ligands to enhance intracellular uptake, have shown significant promise at the proof-of-concept stage. Control of physical and chemical specifications of liposome composition, which includes lipid-to-DNA charge, size, presence of ester bonds, chain length and nature of ligand complexation, is integral to the performance of targeted liposomes as genetic delivery agents. Clinical advances are expected to rely on such systems in the therapeutic application of liposome nanoparticle-based gene therapy. Here, we discuss the latest breakthroughs in the development of targeted liposome-based agents for the delivery of genetic material, paying particular attention to new ligand and cationic lipid design as well as recent in vivo advances.

  3. Myostatin: genetic variants, therapy and gene doping

    Directory of Open Access Journals (Sweden)

    André Katayama Yamada

    2012-09-01

    Full Text Available Since its discovery, myostatin (MSTN has been at the forefront of muscle therapy research because intrinsic mutations or inhibition of this protein, by either pharmacological or genetic means, result in muscle hypertrophy and hyperplasia. In addition to muscle growth, MSTN inhibition potentially disturbs connective tissue, leads to strength modulation, facilitates myoblast transplantation, promotes tissue regeneration, induces adipose tissue thermogenesis and increases muscle oxidative phenotype. It is also known that current advances in gene therapy have an impact on sports because of the illicit use of such methods. However, the adverse effects of these methods, their impact on athletic performance in humans and the means of detecting gene doping are as yet unknown. The aim of the present review is to discuss biosynthesis, genetic variants, pharmacological/genetic manipulation, doping and athletic performance in relation to the MSTN pathway. As will be concluded from the manuscript, MSTN emerges as a promising molecule for combating muscle wasting diseases and for triggering wide-ranging discussion in view of its possible use in gene doping.Desde sua descoberta, a miostatina (MSTN entrou na linha de frente em pesquisas relacionadas às terapias musculares porque mutações intrínsecas ou inibição desta proteína tanto por abordagens farmacológicas como genéticas resultam em hipertrofia muscular e hiperplasia. Além do aumento da massa muscular, a inibição de MSTN potencialmente prejudica o tecido conectivo, modula a força muscular, facilita o transplante de mioblastos, promove regeneração tecidual, induz termogênese no tecido adiposo e aumenta a oxidação na musculatura esquelética. É também sabido que os atuais avanços em terapia gênica têm uma relação com o esporte devido ao uso ilícito de tal método. Os efeitos adversos de tal abordagem, seus efeitos no desempenho de atletas e métodos para detectar doping genético s

  4. Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

    Science.gov (United States)

    Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

    2016-01-01

    The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

  5. Communicating the promise for ocular gene therapies: challenges and recommendations.

    Science.gov (United States)

    Benjaminy, Shelly; Kowal, Stephanie P; MacDonald, Ian M; Bubela, Tania

    2015-09-01

    To identify challenges and pose solutions for communications about ocular gene therapy between patients and clinicians as clinical research progresses. Literature review with recommendations. Literature review of science communication best practices to inform recommendations for patient-clinician discussions about ocular gene therapy. Clinicians need to employ communications about ocular gene therapy that are both attentive to patient priorities and concerns and responsive to other sources of information, including overly positive news media and the Internet. Coverage often conflates research with therapy-clinical trials are experimental and are not risk free. If proven safe and efficacious, gene therapy may present a treatment but not a cure for patients who have already experienced vision loss. Clinicians can assist patients by providing realistic estimates for lengthy clinical development timelines and positioning current research within models of clinical translation. This enables patients to weigh future therapeutic options when making current disease management decisions. Ocular gene therapy clinical trials are raising hopes for treating a myriad of hereditary retinopathies, but most such therapies are many years in the future. Clinicians should be prepared to counter overly positive messaging, found in news media and on the Internet, with optimism tempered by evidence to support the ethical translation of gene therapy and other novel biotherapeutics. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Duchenne Muscular Dystrophy Gene Therapy in the Canine Model

    Science.gov (United States)

    2015-01-01

    Abstract Duchenne muscular dystrophy (DMD) is an X-linked lethal muscle disease caused by dystrophin deficiency. Gene therapy has significantly improved the outcome of dystrophin-deficient mice. Yet, clinical translation has not resulted in the expected benefits in human patients. This translational gap is largely because of the insufficient modeling of DMD in mice. Specifically, mice lacking dystrophin show minimum dystrophic symptoms, and they do not respond to the gene therapy vector in the same way as human patients do. Further, the size of a mouse is hundredfolds smaller than a boy, making it impossible to scale-up gene therapy in a mouse model. None of these limitations exist in the canine DMD (cDMD) model. For this reason, cDMD dogs have been considered a highly valuable platform to test experimental DMD gene therapy. Over the last three decades, a variety of gene therapy approaches have been evaluated in cDMD dogs using a number of nonviral and viral vectors. These studies have provided critical insight for the development of an effective gene therapy protocol in human patients. This review discusses the history, current status, and future directions of the DMD gene therapy in the canine model. PMID:25710459

  7. Bacteria as vectors for gene therapy of cancer.

    LENUS (Irish Health Repository)

    Baban, Chwanrow K

    2012-01-31

    Anti-cancer therapy faces major challenges, particularly in terms of specificity of treatment. The ideal therapy would eradicate tumor cells selectively with minimum side effects on normal tissue. Gene or cell therapies have emerged as realistic prospects for the treatment of cancer, and involve the delivery of genetic information to a tumor to facilitate the production of therapeutic proteins. However, there is still much to be done before an efficient and safe gene medicine is achieved, primarily developing the means of targeting genes to tumors safely and efficiently. An emerging family of vectors involves bacteria of various genera. It has been shown that bacteria are naturally capable of homing to tumors when systemically administered resulting in high levels of replication locally. Furthermore, invasive species can deliver heterologous genes intra-cellularly for tumor cell expression. Here, we review the use of bacteria as vehicles for gene therapy of cancer, detailing the mechanisms of action and successes at preclinical and clinical levels.

  8. Gene therapy, early promises, subsequent problems, and recent breakthroughs.

    Science.gov (United States)

    Razi Soofiyani, Saeideh; Baradaran, Behzad; Lotfipour, Farzaneh; Kazemi, Tohid; Mohammadnejad, Leila

    2013-01-01

    Gene therapy is one of the most attractive fields in medicine. The concept of gene delivery to tissues for clinical applications has been discussed around half a century, but scientist's ability to manipulate genetic material via recombinant DNA technology made this purpose to reality. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. While gene therapy initially conceived as a way to treat life-threatening disorders (inborn errors, cancers) refractory to conventional treatment, to date gene therapy is considered for many non-life-threatening conditions including those adversely influence on a patient's quality of life. Gene therapy has made significant progress, including tangible success, although much slower than was initially predicted. Although, gene therapies still at a fairly primitive stage, it is firmly science based. There is justifiable hope that with enhanced pathobiological understanding and biotechnological improvements, gene therapy will be a standard part of clinical practice within 20 years.

  9. Gene Therapy, Early Promises, Subsequent Problems, and Recent Breakthroughs

    Directory of Open Access Journals (Sweden)

    Saeideh Razi Soofiyani

    2013-08-01

    Full Text Available Gene therapy is one of the most attractive fields in medicine. The concept of gene delivery to tissues for clinical applications has been discussed around half a century, but scientist’s ability to manipulate genetic material via recombinant DNA technology made this purpose to reality. Various approaches, such as viral and non-viral vectors and physical methods, have been developed to make gene delivery safer and more efficient. While gene therapy initially conceived as a way to treat life-threatening disorders (inborn errors, cancers refractory to conventional treatment, to date gene therapy is considered for many non–life-threatening conditions including those adversely influence on a patient’s quality of life. Gene therapy has made significant progress, including tangible success, although much slower than was initially predicted. Although, gene therapies still at a fairly primitive stage, it is firmly science based. There is justifiable hope that with enhanced pathobiological understanding and biotechnological improvements, gene therapy will be a standard part of clinical practice within 20 years.

  10. 77 FR 71194 - Draft Guidance for Industry: Preclinical Assessment of Investigational Cellular and Gene Therapy...

    Science.gov (United States)

    2012-11-29

    ...] Draft Guidance for Industry: Preclinical Assessment of Investigational Cellular and Gene Therapy... Industry: Preclinical Assessment of Investigational Cellular and Gene Therapy Products,'' dated November... Evaluation (CBER), Office of Cellular, Tissue, and Gene Therapies (OCTGT). The product areas covered by this...

  11. Modulation of inducible nitric oxide synthase gene expression in RAW 264.7 murine macrophages by Pacific ciguatoxin.

    Science.gov (United States)

    Kumar-Roiné, Shilpa; Matsui, Mariko; Chinain, Mireille; Laurent, Dominique; Pauillac, Serge

    2008-08-01

    To investigate the possible involvement of the nitric oxide radical (NO) in ciguatera fish poisoning (CFP), the in vitro effects of the main Pacific ciguatoxin (P-CTX-1B) and bacterial lipopolysaccharide (LPS) were comparatively studied on neuroblastoma Neuro-2a and on macrophage RAW 264.7 cell lines. NO accumulation was quantified by measuring nitrite levels in cellular supernatant using Griess reagent while the up-regulation of inducible nitric oxide synthase (iNOS) at the mRNA level was quantified via Real-Time Reverse-Transcription Polymerase Chain Reaction (RT-PCR). P-CTX-1B caused a concentration- and time-dependent induction of iNOS in RAW 264.7 cells but not in Neuro-2a cells. NO production was evidenced by increased nitrite levels in the 10 microM range after 48 h of RAW 264.7 cells exposure to LPS and P-CTX-1B (0.05 microg/ml and 6 nM, respectively). The expression of iNOS mRNA peaked at 8h for LPS then gradually decreased to low level at 48 h. In contrast, a sustained level was recorded with P-CTX-1B in the 8-48 h time interval. The addition of N(omega)-nitro-L-arginine methyl ester (L-NAME), a stereoselective NOS inhibitor, strongly diminished NO formation but had no effect on iNOS mRNA synthesis. The implication of NO in CFP paves the way for new therapies for both western and traditional medicines.

  12. Gene Therapy for Pancreatic Cancer: Specificity, Issues and Hopes.

    Science.gov (United States)

    Rouanet, Marie; Lebrin, Marine; Gross, Fabian; Bournet, Barbara; Cordelier, Pierre; Buscail, Louis

    2017-06-08

    A recent death projection has placed pancreatic ductal adenocarcinoma as the second cause of death by cancer in 2030. The prognosis for pancreatic cancer is very poor and there is a great need for new treatments that can change this poor outcome. Developments of therapeutic innovations in combination with conventional chemotherapy are needed urgently. Among innovative treatments the gene therapy offers a promising avenue. The present review gives an overview of the general strategy of gene therapy as well as the limitations and stakes of the different experimental in vivo models, expression vectors (synthetic and viral), molecular tools (interference RNA, genome editing) and therapeutic genes (tumor suppressor genes, antiangiogenic and pro-apoptotic genes, suicide genes). The latest developments in pancreatic carcinoma gene therapy are described including gene-based tumor cell sensitization to chemotherapy, vaccination and adoptive immunotherapy (chimeric antigen receptor T-cells strategy). Nowadays, there is a specific development of oncolytic virus therapies including oncolytic adenoviruses, herpes virus, parvovirus or reovirus. A summary of all published and on-going phase-1 trials is given. Most of them associate gene therapy and chemotherapy or radiochemotherapy. The first results are encouraging for most of the trials but remain to be confirmed in phase 2 trials.

  13. Communicating in context: a priority for gene therapy researchers.

    Science.gov (United States)

    Robillard, Julie M

    2015-03-01

    History shows that public opinion of emerging biotechnologies has the potential to impact the research process through mechanisms such as funding and advocacy. It is critical, therefore, to consider public attitudes towards modern biotechnology such as gene therapy and more specifically towards the ethics of gene therapy, alongside advances in basic and clinical research. Research conducted through social media recently assessed how online users view the ethics of gene therapy and showed that while acceptability is high, significant ethical concerns remain. To address these concerns, the development of effective and evidence-based communication strategies that engage a wide range of stakeholders should be a priority for researchers.

  14. Germ-line gene therapy and the medical imperative.

    Science.gov (United States)

    Munson, Ronald; Davis, Lawrence H

    1992-06-01

    Somatic cell gene therapy has yielded promising results. If germ cell gene therapy can be developed, the promise is even greater: hundreds of genetic diseases might be virtually eliminated. But some claim the procedure is morally unacceptable. We thoroughly and sympathetically examine several possible reasons for this claim but find them inadequate. There is no moral reason, then, not to develop and employ germ-line gene therapy. Taking the offensive, we argue next that medicine has a prima facie moral obligation to do so.

  15. Design of radiopharmaceuticals for monitoring gene transfer therapy

    International Nuclear Information System (INIS)

    Lambrecht, R.M.; Staehler, P.; Kley, J.; Spiegel, M.; Gross, C.; Graepler, F.T.C.; Gregor, M.; Lauer, U.; Oberdorfer, F.

    1998-01-01

    The development of radiopharmaceuticals for monitoring gene transfer therapy with emission tomography is expected to lead to improved management of cancer by the year 2010. There are now only a few examples and approaches to the design of radiopharmaceuticals for gene transfer therapy. This paper introduces a novel concept for the monitoring of gene therapy. We present the optimisation of the labelling of recombinant human β-NGF ligands for in vitro studies prior to using 123 I for SPET and 124 I for PET studies. (author)

  16. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular damage in hypertensive subjects: an Italian case-control study

    Directory of Open Access Journals (Sweden)

    Pizzo Federica

    2008-05-01

    Full Text Available Abstract Background Nitric oxide (NO synthesized by endothelial nitric oxide synthase (eNOS plays an important role in regulation of endothelial function and in the control of blood pressure. However, the results from some studies on the association between three clinically relevant eNOS gene polymorphisms (G894T, T786C and intron 4b/a and essential hypertension are unclear. We designed a case-control study to evaluate the influence of eNOS polymorphisms on target organ damage in 127 hypertensives and 67 normotensives. Clinical evaluation, biochemical parameters, Urinary Albumin Excretion (UAE and echocardiogram were performed to characterize target organ damage. eNOS polymorphism were recognized by PCR method. Results The distribution of eNOS genotypes was similar in hypertensives and normotensives but 4aa was present in the 2.5% of hypertensives and completely absent in normotensives. Subjects with 4bb, G894T, and T786C genotypes showed an increased prevalence of target organ damage. Moreover prevalence of G894T and introne 4 variants was significantly higher in hypertensives than in normotensives both with cardiovascular damage. Logistic regression analysis didn't show any association between eNOS polymorphisms, Body Mass Index (BMI, hypertension, gender and cardiovascular damage. Only the age (OR 1.11; IC 95% 1.06–1.18 was predictive of cardiovascular damage in our population. Conclusion Our results seem to indicate a lack of association with eNOS variants and cardiovascular damage onset.

  17. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants

    Directory of Open Access Journals (Sweden)

    Jia Fang

    2018-02-01

    Full Text Available Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T2 and T3Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium (CP4. For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid content in transgene-present, transgene-absent, empty vector (EV, and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  18. Overexpressing Exogenous 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS) Genes Increases Fecundity and Auxin Content of Transgenic Arabidopsis Plants.

    Science.gov (United States)

    Fang, Jia; Nan, Peng; Gu, Zongying; Ge, Xiaochun; Feng, Yu-Qi; Lu, Bao-Rong

    2018-01-01

    Transgenic glyphosate-tolerant plants overproducing EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) may exhibit enhanced fitness in glyphosate-free environments. If so, introgression of transgenes overexpressing EPSPS into wild relative species may lead to increased competitiveness of crop-wild hybrids, resulting in unpredicted environmental impact. Assessing fitness effects of transgenes overexpressing EPSPS in a model plant species can help address this question, while elucidating how overproducing EPSPS affects the fitness-related traits of plants. We produced segregating T 2 and T 3 Arabidopsis thaliana lineages with or without a transgene overexpressing EPSPS isolated from rice or Agrobacterium ( CP4 ). For each of the three transgenes, we compared glyphosate tolerance, some fitness-related traits, and auxin (indole-3-acetic acid) content in transgene-present, transgene-absent, empty vector (EV), and parental lineages in a common-garden experiment. We detected substantially increased glyphosate tolerance in T 2 plants of transgene-present lineages that overproduced EPSPS. We also documented significant increases in fecundity, which was associated with increased auxin content in T 3 transgene-present lineages containing rice EPSPS genes, compared with their segregating transgene-absent lineages, EV, and parental controls. Our results from Arabidopsis with nine transgenic events provide a strong support to the hypothesis that transgenic plants overproducing EPSPS can benefit from a fecundity advantage in glyphosate-free environments. Stimulated biosynthesis of auxin, an important plant growth hormone, by overproducing EPSPS may play a role in enhanced fecundity of the transgenic Arabidopsis plants. The obtained knowledge is useful for assessing environmental impact caused by introgression of transgenes overproducing EPSPS from any GE crop into populations of its wild relatives.

  19. Combining Oncolytic Virotherapy with p53 Tumor Suppressor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Christian Bressy

    2017-06-01

    Full Text Available Oncolytic virus (OV therapy utilizes replication-competent viruses to kill cancer cells, leaving non-malignant cells unharmed. With the first U.S. Food and Drug Administration-approved OV, dozens of clinical trials ongoing, and an abundance of translational research in the field, OV therapy is poised to be one of the leading treatments for cancer. A number of recombinant OVs expressing a transgene for p53 (TP53 or another p53 family member (TP63 or TP73 were engineered with the goal of generating more potent OVs that function synergistically with host immunity and/or other therapies to reduce or eliminate tumor burden. Such transgenes have proven effective at improving OV therapies, and basic research has shown mechanisms of p53-mediated enhancement of OV therapy, provided optimized p53 transgenes, explored drug-OV combinational treatments, and challenged canonical roles for p53 in virus-host interactions and tumor suppression. This review summarizes studies combining p53 gene therapy with replication-competent OV therapy, reviews preclinical and clinical studies with replication-deficient gene therapy vectors expressing p53 transgene, examines how wild-type p53 and p53 modifications affect OV replication and anti-tumor effects of OV therapy, and explores future directions for rational design of OV therapy combined with p53 gene therapy.

  20. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  1. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

    Science.gov (United States)

    Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

    2016-03-09

    Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  2. The use of genes for performance enhancement: doping or therapy?

    Directory of Open Access Journals (Sweden)

    R.S. Oliveira

    2011-12-01

    Full Text Available Recent biotechnological advances have permitted the manipulation of genetic sequences to treat several diseases in a process called gene therapy. However, the advance of gene therapy has opened the door to the possibility of using genetic manipulation (GM to enhance athletic performance. In such ‘gene doping’, exogenous genetic sequences are inserted into a specific tissue, altering cellular gene activity or leading to the expression of a protein product. The exogenous genes most likely to be utilized for gene doping include erythropoietin (EPO, vascular endothelial growth factor (VEGF, insulin-like growth factor type 1 (IGF-1, myostatin antagonists, and endorphin. However, many other genes could also be used, such as those involved in glucose metabolic pathways. Because gene doping would be very difficult to detect, it is inherently very attractive for those involved in sports who are prepared to cheat. Moreover, the field of gene therapy is constantly and rapidly progressing, and this is likely to generate many new possibilities for gene doping. Thus, as part of the general fight against all forms of doping, it will be necessary to develop and continually improve means of detecting exogenous gene sequences (or their products in athletes. Nevertheless, some bioethicists have argued for a liberal approach to gene doping.

  3. The use of genes for performance enhancement: doping or therapy?

    Science.gov (United States)

    Oliveira, R S; Collares, T F; Smith, K R; Collares, T V; Seixas, F K

    2011-12-01

    Recent biotechnological advances have permitted the manipulation of genetic sequences to treat several diseases in a process called gene therapy. However, the advance of gene therapy has opened the door to the possibility of using genetic manipulation (GM) to enhance athletic performance. In such 'gene doping', exogenous genetic sequences are inserted into a specific tissue, altering cellular gene activity or leading to the expression of a protein product. The exogenous genes most likely to be utilized for gene doping include erythropoietin (EPO), vascular endothelial growth factor (VEGF), insulin-like growth factor type 1 (IGF-1), myostatin antagonists, and endorphin. However, many other genes could also be used, such as those involved in glucose metabolic pathways. Because gene doping would be very difficult to detect, it is inherently very attractive for those involved in sports who are prepared to cheat. Moreover, the field of gene therapy is constantly and rapidly progressing, and this is likely to generate many new possibilities for gene doping. Thus, as part of the general fight against all forms of doping, it will be necessary to develop and continually improve means of detecting exogenous gene sequences (or their products) in athletes. Nevertheless, some bioethicists have argued for a liberal approach to gene doping.

  4. Stem Cell Gene Therapy for Fanconi Anemia: Report from the 1st International Fanconi Anemia Gene Therapy Working Group Meeting

    Science.gov (United States)

    Tolar, Jakub; Adair, Jennifer E; Antoniou, Michael; Bartholomae, Cynthia C; Becker, Pamela S; Blazar, Bruce R; Bueren, Juan; Carroll, Thomas; Cavazzana-Calvo, Marina; Clapp, D Wade; Dalgleish, Robert; Galy, Anne; Gaspar, H Bobby; Hanenberg, Helmut; Von Kalle, Christof; Kiem, Hans-Peter; Lindeman, Dirk; Naldini, Luigi; Navarro, Susana; Renella, Raffaele; Rio, Paula; Sevilla, Julián; Schmidt, Manfred; Verhoeyen, Els; Wagner, John E; Williams, David A; Thrasher, Adrian J

    2011-01-01

    Survival rates after allogeneic hematopoietic cell transplantation (HCT) for Fanconi anemia (FA) have increased dramatically since 2000. However, the use of autologous stem cell gene therapy, whereby the patient's own blood stem cells are modified to express the wild-type gene product, could potentially avoid the early and late complications of allogeneic HCT. Over the last decades, gene therapy has experienced a high degree of optimism interrupted by periods of diminished expectation. Optimism stems from recent examples of successful gene correction in several congenital immunodeficiencies, whereas diminished expectations come from the realization that gene therapy will not be free of side effects. The goal of the 1st International Fanconi Anemia Gene Therapy Working Group Meeting was to determine the optimal strategy for moving stem cell gene therapy into clinical trials for individuals with FA. To this end, key investigators examined vector design, transduction method, criteria for large-scale clinical-grade vector manufacture, hematopoietic cell preparation, and eligibility criteria for FA patients most likely to benefit. The report summarizes the roadmap for the development of gene therapy for FA. PMID:21540837

  5. Bone Marrow Gene Therapy for HIV/AIDS

    Directory of Open Access Journals (Sweden)

    Elena Herrera-Carrillo

    2015-07-01

    Full Text Available Bone marrow gene therapy remains an attractive option for treating chronic immunological diseases, including acquired immunodeficiency syndrome (AIDS caused by human immunodeficiency virus (HIV. This technology combines the differentiation and expansion capacity of hematopoietic stem cells (HSCs with long-term expression of therapeutic transgenes using integrating vectors. In this review we summarize the potential of bone marrow gene therapy for the treatment of HIV/AIDS. A broad range of antiviral strategies are discussed, with a particular focus on RNA-based therapies. The idea is to develop a durable gene therapy that lasts the life span of the infected individual, thus contrasting with daily drug regimens to suppress the virus. Different approaches have been proposed to target either the virus or cellular genes encoding co-factors that support virus replication. Some of these therapies have been tested in clinical trials, providing proof of principle that gene therapy is a safe option for treating HIV/AIDS. In this review several topics are discussed, ranging from the selection of the antiviral molecule and the viral target to the optimal vector system for gene delivery and the setup of appropriate preclinical test systems. The molecular mechanisms used to formulate a cure for HIV infection are described, including the latest antiviral strategies and their therapeutic applications. Finally, a potent combination of anti-HIV genes based on our own research program is described.

  6. Prospects for Foamy Viral Vector Anti-HIV Gene Therapy

    Directory of Open Access Journals (Sweden)

    Arun K. Nalla

    2016-03-01

    Full Text Available Stem cell gene therapy approaches for Human Immunodeficiency Virus (HIV infection have been explored in clinical trials and several anti-HIV genes delivered by retroviral vectors were shown to block HIV replication. However, gammaretroviral and lentiviral based retroviral vectors have limitations for delivery of anti-HIV genes into hematopoietic stem cells (HSC. Foamy virus vectors have several advantages including efficient delivery of transgenes into HSC in large animal models, and a potentially safer integration profile. This review focuses on novel anti-HIV transgenes and the potential of foamy virus vectors for HSC gene therapy of HIV.

  7. Cancer gene therapy targeting angiogenesis: An updated Review

    Science.gov (United States)

    Liu, Ching-Chiu; Shen, Zan; Kung, Hsiang-Fu; Lin, Marie CM

    2006-01-01

    Since the relationship between angiogenesis and tumor growth was established by Folkman in 1971, scientists have made efforts exploring the possibilities in treating cancer by targeting angiogenesis. Inhibition of angiogenesis growth factors and administration of angiogenesis inhibitors are the basics of anti-angiogenesis therapy. Transfer of anti-angiogenesis genes has received attention recently not only because of the advancement of recombinant vectors, but also because of the localized and sustained expression of therapeutic gene product inside the tumor after gene transfer. This review provides the up-to-date information about the strategies and the vectors studied in the field of anti-angiogenesis cancer gene therapy. PMID:17109514

  8. SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

    Science.gov (United States)

    Ghosh, Subhabrata; Mandi, Swati Sen

    2015-07-25

    Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Cystic Fibrosis Gene Therapy in the UK and Elsewhere

    Science.gov (United States)

    Pytel, Kamila M.; Alton, Eric W.F.W.

    2015-01-01

    Abstract The cystic fibrosis transmembrane conductance regulator (CFTR) gene was identified in 1989. This opened the door for the development of cystic fibrosis (CF) gene therapy, which has been actively pursued for the last 20 years. Although 26 clinical trials involving approximately 450 patients have been carried out, the vast majority of these trials were short and included small numbers of patients; they were not designed to assess clinical benefit, but to establish safety and proof-of-concept for gene transfer using molecular end points such as the detection of recombinant mRNA or correction of the ion transport defect. The only currently published trial designed and powered to assess clinical efficacy (defined as improvement in lung function) administered AAV2-CFTR to the lungs of patients with CF. The U.K. Cystic Fibrosis Gene Therapy Consortium completed, in the autumn of 2014, the first nonviral gene therapy trial designed to answer whether repeated nonviral gene transfer (12 doses over 12 months) can lead to clinical benefit. The demonstration that the molecular defect in CFTR can be corrected with small-molecule drugs, and the success of gene therapy in other monogenic diseases, is boosting interest in CF gene therapy. Developments are discussed here. PMID:25838137

  10. Investor Outlook: Gene Therapy Picking up Steam; At a Crossroads.

    Science.gov (United States)

    Schimmer, Joshua; Breazzano, Steven

    2016-09-01

    The gene therapy field continues to pick up steam with recent successes in a number of different therapeutic indications that highlight the potential for the platform. As the field continues to make progress, a growing data set of long-term safety and efficacy data will continue to define gene therapy's role, determining ultimately how widely it may be used beyond rare, serious diseases with high unmet needs. New technologies often take unanticipated twists and turns as patient exposure accumulates, and gene therapy may be no exception. That said, with many diseases that have no other treatment options beyond gene therapy and that present considerable morbidity and mortality, the field appears poised to withstand some minor and even major bumps in the road should they emerge.

  11. Gene therapy for CNS diseases – Krabbe disease

    Directory of Open Access Journals (Sweden)

    Mohammad A. Rafi

    2016-06-01

    Full Text Available This is a brief report of the 19th Annual Meeting of the American Society of Gene and Cell Therapy that took place from May 4th through May 7th, 2016 in Washington, DC, USA. While the meeting provided many symposiums, lectures, and scientific sessions this report mainly focuses on one of the sessions on the "Gene Therapy for central nervous system (CNS Diseases" and specifically on the "Gene Therapy for the globoid cell leukodystrophy or Krabbe disease. Two presentations focused on this subject utilizing two animal models of this disease: mice and dog models. Different serotypes of adeno-associate viral vectors (AAV alone or in combination with bone marrow transplantations were used in these research projects. The Meeting of the ASGCT reflected continuous growth in the fields of gene and cell therapy and brighter forecast for efficient treatment options for variety of human diseases.

  12. Molecular Genetic and Gene Therapy Studies of the Musculoskeletal System

    National Research Council Canada - National Science Library

    Baylink, David

    2004-01-01

    The primary goal of the proposed work is to apply several state of the art molecular genetic and gene therapy technologies to address fundamental questions in bone biology with a particular emphasis on attempting: l...

  13. Gene Therapy with the Sleeping Beauty Transposon System.

    Science.gov (United States)

    Kebriaei, Partow; Izsvák, Zsuzsanna; Narayanavari, Suneel A; Singh, Harjeet; Ivics, Zoltán

    2017-11-01

    The widespread clinical implementation of gene therapy requires the ability to stably integrate genetic information through gene transfer vectors in a safe, effective, and economical manner. The latest generation of Sleeping Beauty (SB) transposon vectors fulfills these requirements, and may overcome limitations associated with viral gene transfer vectors and transient nonviral gene delivery approaches that are prevalent in ongoing clinical trials. The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use. Here, we review the most important aspects of using SB for gene therapy, including vectorization as well as genomic integration features. We also illustrate the path to successful clinical implementation by highlighting the application of chimeric antigen receptor (CAR)-modified T cells in cancer immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    Energy Technology Data Exchange (ETDEWEB)

    Kirimura, Kohtaro, E-mail: kkohtaro@waseda.jp; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-05-13

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni{sup 2+}-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  15. Heterologous gene expression and functional analysis of a type III polyketide synthase from Aspergillus niger NRRL 328

    International Nuclear Information System (INIS)

    Kirimura, Kohtaro; Watanabe, Shotaro; Kobayashi, Keiichi

    2016-01-01

    Type III polyketide synthases (PKSs) catalyze the formation of pyrone- and resorcinol-types aromatic polyketides. The genomic analysis of the filamentous fungus Aspergillus niger NRRL 328 revealed that this strain has a putative gene (chr-8-2: 2978617–2979847) encoding a type III PKS, although its functions are unknown. In this study, for functional analysis of this putative type III PKS designated as An-CsyA, cloning and heterologous expression of the An-CsyA gene (An-csyA) in Escherichia coli were performed. Recombinant His-tagged An-CsyA was successfully expressed in E. coli BL21 (DE3), purified by Ni"2"+-affinity chromatography, and used for in vitro assay. Tests on the substrate specificity of the His-tagged An-CsyA with myriad acyl-CoAs as starter substrates and malonyl-CoA as extender substrate showed that His-tagged An-CsyA accepted fatty acyl-CoAs (C2-C14) and produced triketide pyrones (C2-C14), tetraketide pyrones (C2-C10), and pentaketide resorcinols (C10-C14). Furthermore, acetoacetyl-CoA, malonyl-CoA, isobutyryl-CoA, and benzoyl-CoA were also accepted as starter substrates, and both of triketide pyrones and tetraketide pyrones were produced. It is noteworthy that the His-tagged An-CsyA produced polyketides from malonyl-CoA as starter and extender substrates and produced tetraketide pyrones from short-chain fatty acyl-CoAs as starter substrates. Therefore, this is the first report showing the functional properties of An-CsyA different from those of other fungal type III PKSs. -- Highlights: •Type III PKS from Aspergillus niger NRRL 328, An-CsyA, was cloned and characterized. •An-CsyA produced triketide pyrones, tetraketide pyrones and pentaketide resorcinols. •Functional properties of An-CsyA differs from those of other fungal type III PKSs.

  16. Prevailing public perceptions of the ethics of gene therapy.

    Science.gov (United States)

    Robillard, Julie M; Roskams-Edris, Dylan; Kuzeljevic, Boris; Illes, Judy

    2014-08-01

    Gene therapy research is advancing rapidly, and hopes of treating a large number of brain disorders exist alongside ethical concerns. Most surveys of public attitudes toward these ethical issues are already dated and the content of these surveys has been researcher-driven. To examine current public perceptions, we developed an online instrument that is responsive and relevant to the latest research about ethics, gene therapy, and the brain. The 16-question survey was launched with the platform Amazon Mechanical Turk and was made available to residents of Canada and the United States. The survey was divided into six themes: (1) demographic information, (2) general opinions about gene therapy, (3) medical applications of gene therapy, (4) identity and moral/belief systems, (5) enhancement, and (6) risks. We received and analyzed responses from a total of 467 participants. Our results show that a majority of respondents (>90%) accept gene therapy as a treatment for severe illnesses such as Alzheimer disease, but this receptivity decreases for conditions perceived as less severe such as attention deficit hyperactivity disorder (79%), and for nontherapeutic applications (47%). The greatest area of concern for the application of gene therapy to brain conditions is the fear of not receiving sufficient information before undergoing the treatment. The main ethical concerns with enhancement were the potential for disparities in resource allocation, access to the procedure, and discrimination. When comparing these data with those from the 1990s, our findings suggest that the acceptability of gene therapy is increasing and that this trend is occurring despite lingering concerns over ethical issues. Providing the public and patients with up-to-date information and opportunities to engage in the discourse about areas of research in gene therapy is a priority.

  17. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  18. Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

    Directory of Open Access Journals (Sweden)

    Tao Zhou

    2015-01-01

    Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

  19. Bioethical conflicts of gene therapy: a brief critical review

    Directory of Open Access Journals (Sweden)

    José Ednésio da Cruz Freire

    2014-12-01

    Full Text Available Methods and techniques employed in gene therapy are reviewed in parallel with pertinent ethical conflicts. Clinical interventions based on gene therapy techniques preferentially use vectors for the transportation of therapeutic genes, however little is known about the potential risks and damages to the patient. Thus, attending carefully to the clinical complications arising as well as to security is essential. Despite the scientific and technological advances, there are still many uncertainties about the side effects of gene therapy. Moreover, there is a need, above all, to understand the principles of bioethics as both science and ethics, in accordance with its socioecological responsibility, in order to prioritize the health and welfare of man and nature, using properly natural resources and technology. Therefore, it is hard to determine objective results and to which extent the insertion of genes can affect the organism, as well as the ethical implication

  20. Gene therapy in dentistry: tool of genetic engineering. Revisited.

    Science.gov (United States)

    Gupta, Khushboo; Singh, Saurabh; Garg, Kavita Nitish

    2015-03-01

    Advances in biotechnology have brought gene therapy to the forefront of medical research. The concept of transferring genes to tissues for clinical applications has been discussed nearly half a century, but the ability to manipulate genetic material via recombinant DNA technology has brought this goal to reality. The feasibility of gene transfer was first demonstrated using tumour viruses. This led to development of viral and nonviral methods for the genetic modification of somatic cells. Applications of gene therapy to dental and oral problems illustrate the potential impact of this technology on dentistry. Preclinical trial results regarding the same have been very promising. In this review we will discuss methods, vectors involved, clinical implication in dentistry and scientific issues associated with gene therapy. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Gene therapy for cartilage and bone tissue engineering

    CERN Document Server

    Hu, Yu-Chen

    2014-01-01

    "Gene Therapy for Cartilage and Bone Tissue Engineering" outlines the tissue engineering and possible applications of gene therapy in the field of biomedical engineering as well as basic principles of gene therapy, vectors and gene delivery, specifically for cartilage and bone engineering. It is intended for tissue engineers, cell therapists, regenerative medicine scientists and engineers, gene therapist and virologists. Dr. Yu-Chen Hu is a Distinguished Professor at the Department of Chemical Engineering, National Tsing Hua University and has received the Outstanding Research Award (National Science Council), Asia Research Award (Society of Chemical Engineers, Japan) and Professor Tsai-Teh Lai Award (Taiwan Institute of Chemical Engineers). He is also a fellow of the American Institute for Medical and Biological Engineering (AIMBE) and a member of the Tissue Engineering International & Regenerative Medicine Society (TERMIS)-Asia Pacific Council.

  2. Gene set analysis of purine and pyrimidine antimetabolites cancer therapies.

    Science.gov (United States)

    Fridley, Brooke L; Batzler, Anthony; Li, Liang; Li, Fang; Matimba, Alice; Jenkins, Gregory D; Ji, Yuan; Wang, Liewei; Weinshilboum, Richard M

    2011-11-01

    Responses to therapies, either with regard to toxicities or efficacy, are expected to involve complex relationships of gene products within the same molecular pathway or functional gene set. Therefore, pathways or gene sets, as opposed to single genes, may better reflect the true underlying biology and may be more appropriate units for analysis of pharmacogenomic studies. Application of such methods to pharmacogenomic studies may enable the detection of more subtle effects of multiple genes in the same pathway that may be missed by assessing each gene individually. A gene set analysis of 3821 gene sets is presented assessing the association between basal messenger RNA expression and drug cytotoxicity using ethnically defined human lymphoblastoid cell lines for two classes of drugs: pyrimidines [gemcitabine (dFdC) and arabinoside] and purines [6-thioguanine and 6-mercaptopurine]. The gene set nucleoside-diphosphatase activity was found to be significantly associated with both dFdC and arabinoside, whereas gene set γ-aminobutyric acid catabolic process was associated with dFdC and 6-thioguanine. These gene sets were significantly associated with the phenotype even after adjusting for multiple testing. In addition, five associated gene sets were found in common between the pyrimidines and two gene sets for the purines (3',5'-cyclic-AMP phosphodiesterase activity and γ-aminobutyric acid catabolic process) with a P value of less than 0.0001. Functional validation was attempted with four genes each in gene sets for thiopurine and pyrimidine antimetabolites. All four genes selected from the pyrimidine gene sets (PSME3, CANT1, ENTPD6, ADRM1) were validated, but only one (PDE4D) was validated for the thiopurine gene sets. In summary, results from the gene set analysis of pyrimidine and purine therapies, used often in the treatment of various cancers, provide novel insight into the relationship between genomic variation and drug response.

  3. A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

    Science.gov (United States)

    Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

    2016-12-28

    The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

  4. Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

    Science.gov (United States)

    Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

    2013-01-01

    The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

  5. Current status of gene therapy for motor neuron disease

    Institute of Scientific and Technical Information of China (English)

    Xingkai An; Rong Peng; Shanshan Zhao

    2006-01-01

    OBJECTIVE: Although the etiology and pathogenesis of motor neuron disease is still unknown, there are many hypotheses on motor neuron mitochondrion, cytoskeleton structure and functional injuries. Thus, gene therapy of motor neuron disease has become a hot topic to apply in viral vector, gene delivery and basic gene techniques.DATA SOURCES: The related articles published between January 2000 and October 2006 were searched in Medline database and ISl database by computer using the keywords "motor neuron disease, gene therapy", and the language is limited to English. Meanwhile, the related references of review were also searched by handiwork. STUDY SELECTION: Original articles and referred articles in review were chosen after first hearing, then the full text which had new ideas were found, and when refer to the similar study in the recent years were considered first.DATA EXTRACTION: Among the 92 related articles, 40 ones were accepted, and 52 were excluded because of repetitive study or reviews.DATA SYNTHESIS: The viral vectors of gene therapy for motor neuron disease include adenoviral, adeno-associated viral vectors, herpes simplex virus type 1 vectors and lentiviral vectors. The delivery of them can be achieved by direct injection into the brain, or by remote delivery after injection vectors into muscle or peripheral nerves, or by ex vivo gene transfer. The viral vectors of gene therapy for motor neuron disease have been successfully developed, but the gene delivery of them is hampered by some difficulties. The RNA interference and neuroprotection are the main technologies for gene-based therapy in motor neuron disease. CONCLUSION : The RNA interference for motor neuron disease has succeeded in animal models, and the neuroprotection also does. But, there are still a lot of questions for gene therapy in the clinical treatment of motor neuron disease.

  6. Specifically targeted gene therapy for small-cell lung cancer

    DEFF Research Database (Denmark)

    Christensen, C.L.; Zandi, R.; Gjetting, T.

    2009-01-01

    Small-cell lung cancer (SCLC) is a highly malignant disease with poor prognosis. Hence, there is great demand for new therapies that can replace or supplement the current available treatment regimes. Gene therapy constitutes a promising strategy and relies on the principle of introducing exogenous...

  7. Gene therapy: light is finally in the tunnel.

    Science.gov (United States)

    Cao, Huibi; Molday, Robert S; Hu, Jim

    2011-12-01

    After two decades of ups and downs, gene therapy has recently achieved a milestone in treating patients with Leber's congenital amaurosis (LCA). LCA is a group of inherited blinding diseases with retinal degeneration and severe vision loss in early infancy. Mutations in several genes, including RPE65, cause the disease. Using adeno-associated virus as a vector, three independent teams of investigators have recently shown that RPE65 can be delivered to retinal pigment epithelial cells of LCA patients by subretinal injections resulting in clinical benefits without side effects. However, considering the whole field of gene therapy, there are still major obstacles to clinical applications for other diseases. These obstacles include innate and immune barriers to vector delivery, toxicity of vectors and the lack of sustained therapeutic gene expression. Therefore, new strategies are needed to overcome these hurdles for achieving safe and effective gene therapy. In this article, we shall review the major advancements over the past two decades and, using lung gene therapy as an example, discuss the current obstacles and possible solutions to provide a roadmap for future gene therapy research.

  8. Recent Advancements in Gene Therapy for Hereditary Retinal Dystrophies

    Directory of Open Access Journals (Sweden)

    Ayşe Öner

    2017-12-01

    Full Text Available Hereditary retinal dystrophies (HRDs are degenerative diseases of the retina which have marked clinical and genetic heterogeneity. Common presentations among these disorders include night or colour blindness, tunnel vision, and subsequent progression to complete blindness. The known causative disease genes have a variety of developmental and functional roles, with mutations in more than 120 genes shown to be responsible for the phenotypes. In addition, mutations within the same gene have been shown to cause different disease phenotypes, even amongst affected individuals within the same family, highlighting further levels of complexity. The known disease genes encode proteins involved in retinal cellular structures, phototransduction, the visual cycle, and photoreceptor structure or gene regulation. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been proposed as potentially efficacious therapies. Because of its favorable anatomical and immunological characteristics, the eye has been at the forefront of translational gene therapy. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Dozens of promising proofs of concept have been obtained in animal models of HRDs and some of them have been relayed to the clinic. The results from the first clinical trials for a congenital form of blindness have generated great interest and have demonstrated the safety and efficacy of intraocular administrations of viral vectors in humans. This review summarizes the clinical development of retinal gene therapy.

  9. Nonviral Technologies for Gene Therapy in Cardiovascular Research

    Directory of Open Access Journals (Sweden)

    Cheng-Huang Su

    2008-06-01

    Full Text Available Gene therapy, which is still at an experimental stage, is a technique that attempts to correct or prevent a disease by delivering genes into an individual's cells and tissues. In gene delivery, a vector is a vehicle for transferring genetic material into cells and tissues. Synthetic vectors are considered to be prerequisites for gene delivery, because viral vectors have fundamental problems in relation to safety issues as well as large-scale production. Among the physical approaches, ultrasound with its associated bioeffects such as acoustic cavitation, especially inertial cavitation, can increase the permeability of cell membranes to macromolecules such as plasmid DNA. Microbubbles or ultrasound contrast agents lower the threshold for cavitation by ultrasound energy. Furthermore, ultrasound-enhanced gene delivery using polymers or other nonviral vectors may hold much promise for the future but is currently at the preclinical stage. We all know aging is cruel and inevitable. Currently, among the promising areas for gene therapy in acquired diseases, the incidences of cancer and ischemic cardiovascular diseases are strongly correlated with the aging process. As a result, gene therapy technology may play important roles in these diseases in the future. This brief review focuses on understanding the barriers to gene transfer as well as describing the useful nonviral vectors or tools that are applied to gene delivery and introducing feasible models in terms of ultrasound-based gene delivery.

  10. Gene therapy imaging in patients for oncological applications

    International Nuclear Information System (INIS)

    Penuelas, Ivan; Haberkorn, Uwe; Yaghoubi, Shahriar; Gambhir, Sanjiv S.

    2005-01-01

    Thus far, traditional methods for evaluating gene transfer and expression have been shown to be of limited value in the clinical arena. Consequently there is a real need to develop new methods that could be repeatedly and safely performed in patients for such purposes. Molecular imaging techniques for gene expression monitoring have been developed and successfully used in animal models, but their sensitivity and reproducibility need to be tested and validated in human studies. In this review, we present the current status of gene therapy-based anticancer strategies and show how molecular imaging, and more specifically radionuclide-based approaches, can be used in gene therapy procedures for oncological applications in humans. The basis of gene expression imaging is described and specific uses of these non-invasive procedures for gene therapy monitoring illustrated. Molecular imaging of transgene expression in humans and evaluation of response to gene-based therapeutic procedures are considered. The advantages of molecular imaging for whole-body monitoring of transgene expression as a way to permit measurement of important parameters in both target and non-target organs are also analyzed. The relevance of this technology for evaluation of the necessary vector dose and how it can be used to improve vector design are also examined. Finally, the advantages of designing a gene therapy-based clinical trial with imaging fully integrated from the very beginning are discussed and future perspectives for the development of these applications outlined. (orig.)

  11. Clinical infection control in gene therapy : A multidisciplinary conference

    NARCIS (Netherlands)

    Evans, ME; Jordan, CT; Chang, SMW; Conrad, C; Gerberding, JL; Kaufman, HL; Mayhall, CG; Nolta, JA; Pilaro, AM; Sullivan, S; Weber, DJ; Wivel, NA

    2000-01-01

    Gene therapy is being studied for the treatment of a variety of acquired and inherited disorders. Retroviruses, adenoviruses, poxviruses, adeno-associated viruses, herpesviruses, and others are being engineered to transfer genes into humans. Treatment protocols using recombinant viruses are being

  12. Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

    1995-08-28

    Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

  13. Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

    Directory of Open Access Journals (Sweden)

    Linjie Wang

    Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

  14. Human gene therapy: novel approaches to improve the current gene delivery systems.

    Science.gov (United States)

    Cucchiarini, Magali

    2016-06-01

    Even though gene therapy made its way through the clinics to treat a number of human pathologies since the early years of experimental research and despite the recent approval of the first gene-based product (Glybera) in Europe, the safe and effective use of gene transfer vectors remains a challenge in human gene therapy due to the existence of barriers in the host organism. While work is under active investigation to improve the gene transfer systems themselves, the use of controlled release approaches may offer alternative, convenient tools of vector delivery to achieve a performant gene transfer in vivo while overcoming the various physiological barriers that preclude its wide use in patients. This article provides an overview of the most significant contributions showing how the principles of controlled release strategies may be adapted for human gene therapy.

  15. Gene Therapy for the Inner Ear: Challenges and Promises

    OpenAIRE

    Ryan, Allen F.; Dazert, Stefan

    2009-01-01

    Since the recognition of genes as the discrete units of heritability, and of DNA as their molecular substrate, the utilization of genes for therapeutic purposes has been recognized as a potential means of correcting genetic disorders. The tools of molecular biology, which allow the manipulation of DNA sequence, provided the means to put this concept into practice. However, progress in the implementation of these ideas has been slow. Here we review the history of the idea of gene therapy and t...

  16. Applications of the Preclinical Molecular Imaging in Biomedicine: Gene Therapy

    International Nuclear Information System (INIS)

    Collantes, M.; Peñuelas, I.

    2014-01-01

    Gene therapy constitutes a promising option for efficient and targeted treatment of several inherited disorders. Imaging techniques using ionizing radiation as PET or SPECT are used for non-invasive monitoring of the distribution and kinetics of vector-mediated gene expression. In this review the main reporter gene/reporter probe strategies are summarized, as well as the contribution of preclinical models to the development of this new imaging modality previously to its application in clinical arena. [es

  17. Advances of reporter gene imaging monitoring stem cell therapy

    International Nuclear Information System (INIS)

    Pei Zhijun; Zhang Yongxue

    2010-01-01

    Stem cell transplantation in the treatment of various tissue damage or degenerative diseases are research hotspots both at home and abroad. However, ignorance of the homing, differentiation and functional expression of the stem cell in vivo influence the further development of stem cell therapy. As an important component of molecular imaging technology, reporter gene imaging dynamically monitors the change of stem cell in vivo via monitoring the expression of transfected reporter gene. This paper briefly describes the latest research progress and the future development trend of the monitoring of reporter gene imaging in stem cell therapy in vivo. (authors)

  18. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    OpenAIRE

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

    1994-01-01

    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...

  19. Stem cell and gene therapies for diabetes mellitus.

    Science.gov (United States)

    Calne, Roy Y; Gan, Shu Uin; Lee, Kok Onn

    2010-03-01

    In this Perspectives article, we comment on the progress in experimental stem cell and gene therapies that might one day become a clinical reality for the treatment of patients with diabetes mellitus. Research on the ability of human embryonic stem cells to differentiate into islet cells has defined the developmental stages and transcription factors involved in this process. However, the clinical applications of human embryonic stem cells are limited by ethical concerns, as well as the potential for teratoma formation. As a consequence, alternative forms of stem cell therapies, such as induced pluripotent stem cells and bone marrow-derived mesenchymal stem cells, have become an area of intense study. Finally, gene therapy shows some promise for the generation of insulin-producing cells. Here, we discuss two of the most frequently used approaches: in vitro gene delivery into cells which are then transplanted into the recipient and direct delivery of genes in vivo.

  20. Pancreatic Cancer Gene Therapy: From Molecular Targets to Delivery Systems

    Energy Technology Data Exchange (ETDEWEB)

    Fillat, Cristina, E-mail: cristina.fillat@crg.es; Jose, Anabel; Ros, Xavier Bofill-De; Mato-Berciano, Ana; Maliandi, Maria Victoria; Sobrevals, Luciano [Programa Gens i Malaltia, Centre de Regulació Genòmica-CRG, UPF, Parc de Recerca Biomedica de Barcelona-PRBB and Centro de Investigación Biomédica en Red de Enfermedades Raras (CIBERER), Barcelona (Spain)

    2011-01-18

    The continuous identification of molecular changes deregulating critical pathways in pancreatic tumor cells provides us with a large number of novel candidates to engineer gene-targeted approaches for pancreatic cancer treatment. Targets—both protein coding and non-coding—are being exploited in gene therapy to influence the deregulated pathways to facilitate cytotoxicity, enhance the immune response or sensitize to current treatments. Delivery vehicles based on viral or non-viral systems as well as cellular vectors with tumor homing characteristics are a critical part of the design of gene therapy strategies. The different behavior of tumoral versus non-tumoral cells inspires vector engineering with the generation of tumor selective products that can prevent potential toxic-associated effects. In the current review, a detailed analysis of the different targets, the delivery vectors, the preclinical approaches and a descriptive update on the conducted clinical trials are presented. Moreover, future possibilities in pancreatic cancer treatment by gene therapy strategies are discussed.

  1. Immunostimulatory Gene Therapy Using Oncolytic Viruses as Vehicles

    Directory of Open Access Journals (Sweden)

    Angelica Loskog

    2015-11-01

    Full Text Available Immunostimulatory gene therapy has been developed during the past twenty years. The aim of immunostimulatory gene therapy is to tilt the suppressive tumor microenvironment to promote anti-tumor immunity. Hence, like a Trojan horse, the gene vehicle can carry warriors and weapons into enemy territory to combat the tumor from within. The most promising immune stimulators are those activating and sustaining Th1 responses, but even if potent effects were seen in preclinical models, many clinical trials failed to show objective responses in cancer patients. However, with new tools to control ongoing immunosuppression in cancer patients, immunostimulatory gene therapy is now emerging as an interesting option. In parallel, oncolytic viruses have been shown to be safe in patients. To prolong immune stimulation and to increase efficacy, these two fields are now merging and oncolytic viruses are armed with immunostimulatory transgenes. These novel agents are racing towards approval as established cancer immunotherapeutics.

  2. Molecular cloning and expression profile of ß-ketoacyl-acp synthase gene from tung tree (Vernicia fordii Hemsl.)

    Science.gov (United States)

    Tung tree (Vernicia fordii) is an important woody oil tree. Tung tree seeds contain 50-60% oil with approximately 80 mole a-eleostearic acid (9cis, 11trans, 13trans octadecatrienoic acid). Fatty acid synthesis is catalyzed by the concerted action of acetyl-CoA carboxylase and fatty acid synthase, a ...

  3. Recent trends in the gene therapy of β-thalassemia

    Science.gov (United States)

    Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

    2015-01-01

    The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

  4. Intracellular delivery of potential therapeutic genes: prospects in cancer gene therapy.

    Science.gov (United States)

    Bakhtiar, Athirah; Sayyad, Mustak; Rosli, Rozita; Maruyama, Atsushi; Chowdhury, Ezharul H

    2014-01-01

    Conventional therapies for malignant cancer such as chemotherapy and radiotherapy are associated with poor survival rates owing to the development of cellular resistance to cancer drugs and the lack of targetability, resulting in unwanted adverse effects on healthy cells and necessitating the lowering of therapeutic dose with consequential lower efficacy of the treatment. Gene therapy employing different types of viral and non-viral carriers to transport gene(s) of interest and facilitating production of the desirable therapeutic protein(s) has tremendous prospects in cancer treatments due to the high-level of specificity in therapeutic action of the expressed protein(s) with diminished off-target effects, although cancer cell-specific delivery of transgene(s) still poses some challenges to be addressed. Depending on the potential therapeutic target genes, cancer gene therapy could be categorized into tumor suppressor gene replacement therapy, immune gene therapy and enzyme- or prodrug-based therapy. This review would shed light on the current progress of delivery of potentially therapeutic genes into various cancer cells in vitro and animal models utilizing a variety of viral and non-viral vectors.

  5. Gene delivery to the lungs: pulmonary gene therapy for cystic fibrosis.

    Science.gov (United States)

    Villate-Beitia, Ilia; Zarate, Jon; Puras, Gustavo; Pedraz, José Luis

    2017-07-01

    Cystic fibrosis (CF) is a monogenic autosomal recessive disorder where the defective gene, the cystic fibrosis transmembrane conductance regulator (CFTR), is well identified. Moreover, the respiratory tract can be targeted through noninvasive aerosolized formulations for inhalation. Therefore, gene therapy is considered a plausible strategy to address this disease. Conventional gene therapy strategies rely on the addition of a correct copy of the CFTR gene into affected cells in order to restore the channel activity. In recent years, genome correction strategies have emerged, such as zinc-finger nucleases, transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats associated to Cas9 nucleases. These gene editing tools aim to repair the mutated gene at its original genomic locus with high specificity. Besides, the success of gene therapy critically depends on the nucleic acids carriers. To date, several clinical studies have been carried out to add corrected copies of the CFTR gene into target cells using viral and non-viral vectors, some of them with encouraging results. Regarding genome editing systems, preliminary in vitro studies have been performed in order to repair the CFTR gene. In this review, after briefly introducing the basis of CF, we discuss the up-to-date gene therapy strategies to address the disease. The review focuses on the main factors to take into consideration when developing gene delivery strategies, such as the design of vectors and plasmid DNA, in vitro/in vivo tests, translation to human use, administration methods, manufacturing conditions and regulatory issues.

  6. Preclinical and clinical experience in vascular gene therapy: advantages over conservative/standard therapy.

    Science.gov (United States)

    Nikol, S; Huehns, T Y

    2001-04-01

    No systemic pharmacological treatment has been shown to convincingly reduce the incidence of restenosis after angioplasty or increase the formation of collaterals in ischemic tissue in patients. The lack of success of many pharmaceutical agents in reducing restenosis rates or in inducing angiogenesis post-angioplasty and following stent implantation has encouraged the development of new technological treatment approaches. Gene therapy is a novel strategy with the potential to prevent some of the sequelae after arterial injury, particularly cell proliferation, and to induce growth of new vessels or remodeling of pre-existing vessel branches, which may help patients with critical ischemia. Gene therapy strategies have the advantage of minimizing systemic side effects and may have a long-term effect as the encoded protein is released. Most clinical trials investigating gene therapy for vascular disease have been uncontrolled phase I and IIa trials. Gene therapy into vessels with the genes for growth factors has been demonstrated to be feasible and efficient. Local drug delivery devices have been used in combination with gene therapy in several trials to maximize safety and efficiency. Data from experimental animal work indicates that gene therapy may modify intimal hyperplasia after arterial injury, but there are few clinical trials on restenosis in patients. Preliminary clinical results show only limited success in altering restenosis rates. In vitro and experimental in vivo investigations into gene therapy for angiogenesis demonstrate increased formation of collaterals and functional improvement of limb ischemia. There is some evidence of increased collateral formation and clinical improvement in patients with critical limb ischemia. Results of placebo-controlled and double-blind trials of gene therapy for vascular disease are awaited.

  7. Radiopharmaceuticals to monitor the expression of transferred genes in gene transfer therapy

    International Nuclear Information System (INIS)

    Wiebe, L. I.

    1997-01-01

    The development and application of radiopharmaceuticals has, in many instances, been based on the pharmacological properties of therapeutic agents. The molecular biology-biotechnology revolution has had an important impact on treatment of diseases, in part through the reduced toxicity of 'biologicals', in part because of their specificity for interaction at unique molecular sites and in part because of their selective delivery to the target site. Immunotherapeutic approaches include the use of monoclonal antibodies (MABs), MAB-fragments and chemotactic peptides. Such agents currently form the basis of both diagnostic and immunotherapeutic radiopharmaceuticals. More recently, gene transfer techniques have been advanced to the point that a new molecular approach, gene therapy, has become a reality. Gene therapy offers an opportunity to attack disease at its most fundamental level. The therapeutic mechanism is based on the expression of a specific gene or genes, the product of which will invoke immunological, receptor-based or enzyme-based therapeutic modalities. Several approaches to gene therapy of cancer have been envisioned, the most clinically-advanced concepts involving the introduction of genes that will encode for molecular targets nor normally found in healthy mammalian cells. A number of gene therapy clinical trials are based on the introduction of the Herpes simplex virus type-1 (HSV-1) gene that encodes for viral thymidine kinase (tk+). Once HSV-1 tk+ is expressed in the target (cancer) cell, therapy can be effected by the administration of a highly molecularly-targeted and systemically non-toxic antiviral drug such as ganciclovir. The development of radiodiagnostic imaging in gene therapy will be reviewed, using HSV-1 tk+ and radioiodinated IVFRU as a basis for development of the theme. Molecular targets that could be exploited in gene therapy, other than tk+, will be identified

  8. Radiopharmaceuticals to monitor the expression of transferred genes in gene transfer therapy

    Energy Technology Data Exchange (ETDEWEB)

    Wiebe, L I [University of Alberta, Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

    1997-10-01

    The development and application of radiopharmaceuticals has, in many instances, been based on the pharmacological properties of therapeutic agents. The molecular biology-biotechnology revolution has had an important impact on treatment of diseases, in part through the reduced toxicity of `biologicals`, in part because of their specificity for interaction at unique molecular sites and in part because of their selective delivery to the target site. Immunotherapeutic approaches include the use of monoclonal antibodies (MABs), MAB-fragments and chemotactic peptides. Such agents currently form the basis of both diagnostic and immunotherapeutic radiopharmaceuticals. More recently, gene transfer techniques have been advanced to the point that a new molecular approach, gene therapy, has become a reality. Gene therapy offers an opportunity to attack disease at its most fundamental level. The therapeutic mechanism is based on the expression of a specific gene or genes, the product of which will invoke immunological, receptor-based or enzyme-based therapeutic modalities. Several approaches to gene therapy of cancer have been envisioned, the most clinically-advanced concepts involving the introduction of genes that will encode for molecular targets nor normally found in healthy mammalian cells. A number of gene therapy clinical trials are based on the introduction of the Herpes simplex virus type-1 (HSV-1) gene that encodes for viral thymidine kinase (tk+). Once HSV-1 tk+ is expressed in the target (cancer) cell, therapy can be effected by the administration of a highly molecularly-targeted and systemically non-toxic antiviral drug such as ganciclovir. The development of radiodiagnostic imaging in gene therapy will be reviewed, using HSV-1 tk+ and radioiodinated IVFRU as a basis for development of the theme. Molecular targets that could be exploited in gene therapy, other than tk+, will be identified

  9. Insulin gene therapy for type 1 diabetes mellitus.

    Science.gov (United States)

    Handorf, Andrew M; Sollinger, Hans W; Alam, Tausif

    2015-04-01

    Type 1 diabetes mellitus is an autoimmune disease resulting from the destruction of pancreatic β cells. Current treatments for patients with type 1 diabetes mellitus include daily insulin injections or whole pancreas transplant, each of which are associated with profound drawbacks. Insulin gene therapy, which has shown great efficacy in correcting hyperglycemia in animal models, holds great promise as an alternative strategy to treat type 1 diabetes mellitus in humans. Insulin gene therapy refers to the targeted expression of insulin in non-β cells, with hepatocytes emerging as the primary therapeutic target. In this review, we present an overview of the current state of insulin gene therapy to treat type 1 diabetes mellitus, including the need for an alternative therapy, important features dictating the success of the therapy, and current obstacles preventing the translation of this treatment option to a clinical setting. In so doing, we hope to shed light on insulin gene therapy as a viable option to treat type 1 diabetes mellitus.

  10. Sjogren Syndrome-Gene Therapy and its Prospective

    Directory of Open Access Journals (Sweden)

    R Rahpeyma

    2003-02-01

    Full Text Available Sjogren syndrome is one of the autoimmune diseases which is characterized by lymphocytic infiltration to exocrine glands and causes keratoconjunctivitis sicca and xerostomia. Today, a large population, with a majority of women over 40, suffer from this disease and have several complications regarding oral health and reduced life quality such as severe dental caries, painful eyes, olfactory and gustatory deficiency, speech, mastication and swallowing discomforts. Unfortunately, these patients do not respond to the conventional therapies. Nowadays in medical world, which its target is basic therapy and not symptomatic one, several gene therapy approaches, have gained importance in treatment of this apparently incurable diseases. Due to the facts that this disease is the second prevelant autoimmune disease, after rheumatoid arthritis, and the conventional therapies of the disease are all relative and symptomatic, researchers have insisted on the basic and causative therapy through gene transfer more than before. In the Present article, through reviewing 58 references containing recent scientific and investigatory findings it has been tried, to consider the pathogenesis and conventional therapies of this syndrome. Another purpose of this study was to investigate several and potentially very effective gene transfer systems and different theraputic genes (mainly membrane water channels, ione transporter molecules, transcription factors, antifungal proteins and free radical scavengers.

  11. Current Experimental Studies of Gene Therapy in Parkinson's Disease

    Directory of Open Access Journals (Sweden)

    Jing-ya Lin

    2017-05-01

    Full Text Available Parkinson's disease (PD was characterized by late-onset, progressive dopamine neuron loss and movement disorders. The progresses of PD affected the neural function and integrity. To date, most researches had largely addressed the dopamine replacement therapies, but the appearance of L-dopa-induced dyskinesia hampered the use of the drug. And the mechanism of PD is so complicated that it's hard to solve the problem by just add drugs. Researchers began to focus on the genetic underpinnings of Parkinson's disease, searching for new method that may affect the neurodegeneration processes in it. In this paper, we reviewed current delivery methods used in gene therapies for PD, we also summarized the primary target of the gene therapy in the treatment of PD, such like neurotrophic factor (for regeneration, the synthesis of neurotransmitter (for prolong the duration of L-dopa, and the potential proteins that might be a target to modulate via gene therapy. Finally, we discussed RNA interference therapies used in Parkinson's disease, it might act as a new class of drug. We mainly focus on the efficiency and tooling features of different gene therapies in the treatment of PD.

  12. Gene engineering biological therapy for juvenile arthritis

    Directory of Open Access Journals (Sweden)

    Kh Mikhel's

    2011-01-01

    However, GEBA therapy cannot completely cure the disease as before despite the progress achieved. GEBAs have potentially a number of serious side effects, among which there are severe infections and there is a risk of developing malignancies and autoimmune processes. Their administration requires careful monitoring to reveal the early development of serious adverse reactions, thus preventing a poor outcome.

  13. The variability of sesquiterpenes emitted from two Zea mays cultivars is controlled by allelic variation of two terpene synthase genes encoding stereoselective multiple product enzymes.

    Science.gov (United States)

    Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

    2004-05-01

    The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.

  14. Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

    Science.gov (United States)

    Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

    2014-11-01

    We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice.

    Science.gov (United States)

    Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing

    2009-05-13

    One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.

  16. Gene therapy clinical trials worldwide to 2017: An update.

    Science.gov (United States)

    Ginn, Samantha L; Amaya, Anais K; Alexander, Ian E; Edelstein, Michael; Abedi, Mohammad R

    2018-03-25

    To date, almost 2600 gene therapy clinical trials have been completed, are ongoing or have been approved worldwide. Our database brings together global information on gene therapy clinical activity from trial databases, official agency sources, published literature, conference presentations and posters kindly provided to us by individual investigators or trial sponsors. This review presents our analysis of clinical trials that, to the best of our knowledge, have been or are being performed worldwide. As of our November 2017 update, we have entries on 2597 trials undertaken in 38 countries. We have analysed the geographical distribution of trials, the disease indications (or other reasons) for trials, the proportions to which different vector types are used, and the genes that have been transferred. Details of the analyses presented, and our searchable database are available via The Journal of Gene Medicine Gene Therapy Clinical Trials Worldwide website at: http://www.wiley.co.uk/genmed/clinical. We also provide an overview of the progress being made in gene therapy clinical trials around the world, and discuss key trends since the previous review, namely the use of chimeric antigen receptor T cells for the treatment of cancer and advancements in genome editing technologies, which have the potential to transform the field moving forward. Copyright © 2018 John Wiley & Sons, Ltd.

  17. Development of Viral Vectors for Gene Therapy for Chronic Pain

    Directory of Open Access Journals (Sweden)

    Yu Huang

    2011-01-01

    Full Text Available Chronic pain is a major health concern that affects millions of people. There are no adequate long-term therapies for chronic pain sufferers, leading to significant cost for both society and the individual. The most commonly used therapy for chronic pain is the application of opioid analgesics and nonsteroidal anti-inflammatory drugs, but these drugs can lead to addiction and may cause side effects. Further studies of the mechanisms of chronic pain have opened the way for development of new treatment strategies, one of which is gene therapy. The key to gene therapy is selecting safe and highly efficient gene delivery systems that can deliver therapeutic genes to overexpress or suppress relevant targets in specific cell types. Here we review several promising viral vectors that could be applied in gene transfer for the treatment of chronic pain and further discuss the possible mechanisms of genes of interest that could be delivered with viral vectors for the treatment of chronic pain.

  18. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

    2011-01-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  19. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Energy Technology Data Exchange (ETDEWEB)

    Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  20. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  1. Clinical adenoviral gene therapy for prostate cancer

    Czech Academy of Sciences Publication Activity Database

    Schenk, E.; Essand, M.; Bangma, Ch. H.; Barber, Ch.; Behr, J.-P.; Briggs, S.; Carlisle, R.; Cheng, W.-S.; Danielsson, A.; Dautzenberg, I. J. C.; Dzojic, H.; Erbacher, P.; Fisher, K.; Frazier, A.; Georgopoulos, L. J.; Hoeben, R.; Kochanek, S.; Koppers-Lalic, D.; Kraaij, R.; Kreppel, F.; Lindholm, L.; Magnusson, M.; Maitland, N.; Neuberg, P.; Nilsson, B.; Ogris, M.; Remy, J.-S.; Scaife, M.; Schooten, E.; Seymour, L.; Totterman, T.; Uil, T. G.; Ulbrich, Karel; Veldhoven-Zweistra, J. L. M.; de Vrij, J.; van Weerden, W.; Wagner, E.; Willemsen, R.

    2010-01-01

    Roč. 21, č. 7 (2010), s. 807-813 ISSN 1043-0342 EU Projects: European Commission(XE) 512087 - GIANT Keywords : adenovirus * gene delivery * prostate cancer Subject RIV: CD - Macromolecular Chemistry Impact factor: 4.829, year: 2010

  2. OFFICIAL MEDICATIONS FOR ANTI-TUMOR GENE THERAPY

    Directory of Open Access Journals (Sweden)

    E. R. Nemtsova

    2016-01-01

    Full Text Available This is a review of modern literature data of official medications for anti-tumor gene therapy as well as of medications that finished clinical trials.The article discusses the concept of gene therapy, the statistical analysis results of initiated clinical trials of gene products, the most actively developing directions of anticancer gene therapy, and the characteristics of anti-tumor gene medications.Various delivery systems for gene material are being examined, including viruses that are defective in  replication (Gendicine™ and Advexin and oncolytic (tumor specific conditionally replicating viruses (Oncorine™, ONYX-015, Imlygic®.By now three preparations for intra-tumor injection have been introduced into oncology clinical practice: two of them – Gendicine™ and Oncorine™ have been registered in China, and one of them – Imlygic® has been registered in the USA. Gendicine™ and Oncorine™ are based on the wild type p53 gene and are designed for treatment of patients with head and neck malignancies. Replicating adenovirus is the delivery system in Gendicine™, whereas oncolytic adenovirus is the vector for gene material in Oncorine™. Imlygic® is based on the  recombinant replicating HSV1 virus with an introduced GM–CSF gene and is designed for treatment of  melanoma patients. These medications are well tolerated and do not cause any serious adverse events. Gendicine™ and Oncorine™ are not effective in monotherapy but demonstrate pronounced synergism with chemoand radiation therapy. Imlygic® has just started the post marketing trials.

  3. Trojan horse at cellular level for tumor gene therapies.

    Science.gov (United States)

    Collet, Guillaume; Grillon, Catherine; Nadim, Mahdi; Kieda, Claudine

    2013-08-10

    Among innovative strategies developed for cancer treatments, gene therapies stand of great interest despite their well-known limitations in targeting, delivery, toxicity or stability. The success of any given gene-therapy is highly dependent on the carrier efficiency. New approaches are often revisiting the mythic trojan horse concept to carry therapeutic nucleic acid, i.e. DNAs, RNAs or small interfering RNAs, to pathologic tumor site. Recent investigations are focusing on engineering carrying modalities to overtake the above limitations bringing new promise to cancer patients. This review describes recent advances and perspectives for gene therapies devoted to tumor treatment, taking advantage of available knowledge in biotechnology and medicine. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Regulation of Cell and Gene Therapy Medicinal Products in Taiwan.

    Science.gov (United States)

    Lin, Yi-Chu; Wang, Po-Yu; Tsai, Shih-Chih; Lin, Chien-Liang; Tai, Hsuen-Yung; Lo, Chi-Fang; Wu, Shiow-Ing; Chiang, Yu-Mei; Liu, Li-Ling

    2015-01-01

    Owing to the rapid and mature development of emerging biotechnology in the fields of cell culture, cell preservation, and recombinant DNA technology, more and more cell or gene medicinal therapy products have been approved for marketing, to treat serious diseases which have been challenging to treat with current medical practice or medicine. This chapter will briefly introduce the Taiwan Food and Drug Administration (TFDA) and elaborate regulation of cell and gene therapy medicinal products in Taiwan, including regulatory history evolution, current regulatory framework, application and review procedures, and relevant jurisdictional issues. Under the promise of quality, safety, and efficacy of medicinal products, it is expected the regulation and environment will be more flexible, streamlining the process of the marketing approval of new emerging cell or gene therapy medicinal products and providing diverse treatment options for physicians and patients.

  5. Factoring nonviral gene therapy into a cure for hemophilia A.

    Science.gov (United States)

    Gabrovsky, Vanessa; Calos, Michele P

    2008-10-01

    Gene therapy for hemophilia A has fallen short of success despite several clinical trials conducted over the past decade. Challenges to its success include vector immunogenicity, insufficient transgene expression levels of Factor VIII, and inhibitor antibody formation. Gene therapy has been dominated by the use of viral vectors, as well as the immunogenic and oncogenic concerns that accompany these strategies. Because of the complexity of viral vectors, the development of nonviral DNA delivery methods may provide an efficient and safe alternative for the treatment of hemophilia A. New types of nonviral strategies, such as DNA integrating vectors, and the success of several nonviral animal studies, suggest that nonviral gene therapy has curative potential and justifies its clinical development.

  6. Adeno-associated virus for cystic fibrosis gene therapy

    Directory of Open Access Journals (Sweden)

    S.V. Martini

    2011-11-01

    Full Text Available Gene therapy is an alternative treatment for genetic lung disease, especially monogenic disorders such as cystic fibrosis. Cystic fibrosis is a severe autosomal recessive disease affecting one in 2500 live births in the white population, caused by mutation of the cystic fibrosis transmembrane conductance regulator (CFTR. The disease is classically characterized by pancreatic enzyme insufficiency, an increased concentration of chloride in sweat, and varying severity of chronic obstructive lung disease. Currently, the greatest challenge for gene therapy is finding an ideal vector to deliver the transgene (CFTR to the affected organ (lung. Adeno-associated virus is the most promising viral vector system for the treatment of respiratory disease because it has natural tropism for airway epithelial cells and does not cause any human disease. This review focuses on the basic properties of adeno-associated virus and its use as a vector for cystic fibrosis gene therapy.

  7. Bioengineering of the plant culture of Capsicum frutescens with vanillin synthase gene for the production of vanillin

    OpenAIRE

    Chee, Marcus Jenn Yang; Lycett, Grantley W.; Khoo, Teng-Jin; Chin, Chiew Foan

    2016-01-01

    Production of vanillin by bioengineering has gained popularity due to consumer demand towards vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a p...

  8. First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

    Directory of Open Access Journals (Sweden)

    Patrick C Y Woo

    Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

  9. [Expression of enterotoxigenic Bacteroides fragilis and polyketide synthase gene-expressing Escherichia coli in colorectal adenoma patients].

    Science.gov (United States)

    Xie, L L; Wu, N; Zhu, Y M; Qiu, X Y; Chen, G D; Zhang, L M; Liu, Y L

    2016-03-29

    To investigate the distribution of various bacteria in adenoma tissue of colorectal adenoma (T/CRA), normal colonic mucosa tissue adjacent to the adenoma (N/CRA), and healthy colonic mucosa tissue (N/H) by comparing the number of total bacteria, Bacteroides fragilis (BF), enterotoxigenic Bacteroides fragilis (ETBF), polyketide synthase (pks) gene-expressing Escherichia coli(E.coli)(pks(+) E. coli)among the above 3 types of tissues. A total of 36 patients diagnosed with colorectal adenoma by colonoscopy and pathology in Department of Gastroenterology, Peking University People's Hospital from September 2011 to September 2013 were selected into this study. T/CRA and N/CRA tissues from the 36 patients and N/H tissues from 18 healthy controls were collected for DNA extraction. The number of total bacteria, BF, ETBF, pks(+) E. coli was detected by quantitative real time PCR, and their correlation with colorectal adenoma was analyzed. (1) The number of total bacteria decreased gradually from N/H, N/CRA, to T/CRA, with the median values being 3.18×10(8,) 1.57×10(8,) and 7.91×10(7) copies/g, respectively, and with significant difference among the three groups and between each two groups (all PCRA, to T/CRA, the median values being 6.03×10(5,) 4.28×10(4,) and 5.48×10(3) copies/g, respectively, and with significant difference among the three groups and between each two groups (all PCRA, to T/CRA, the relative expression being 1.73±0.30, 6.15±1.52, and 8.54±1.80, respectively. Significant difference was found between the T/CRA and N/H tissue (P=0.003), but not between any other two groups. (4) The expression of clbB in pks(+) E.coli was highest in T/CRA colonic tissue (2.96±0.28), followed by the N/CRA (2.79±0.19) and N/H tissue (1.06±0.08). Significant difference was found between T/CRA and N/H tissues, as well as between N/CRA and N/H tissues (both PCRA and N/CRA tissues. The number of total bacteria is markedly reduced in the colonic mucosa of CRA patients

  10. Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

    DEFF Research Database (Denmark)

    Brinch-Pedersen, H.; Galili, G.; Sørensen, K.

    1996-01-01

    In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...

  11. Building for Biology: A Gene Therapy Trial Infrastructure

    Directory of Open Access Journals (Sweden)

    Samuel Taylor-Alexander

    2017-06-01

    Full Text Available In this article, we examine the construction of the infrastructure for a Phase II gene therapy trial for Cystic Fibrosis (CF. Tracing the development of the material technologies and physical spaces used in the trial, we show how the trial infrastructure took form at the uncertain intersection of scientific norms, built environments, regulatory negotiations, patienthood, and the biologies of both disease and therapy. We define infrastructures as material and immaterial (including symbols and affect composites that serve a selective distributive purpose and facilitate projects of making and doing. There is a politics to this distributive action, which is itself twofold, because whilst infrastructures enable and delimit the movement of matter, they also mediate the very activity for which they provide the grounds. An infrastructural focus allows us to show how purposeful connections are made in a context of epistemic and regulatory uncertainty. The gene therapy researchers were working in a context of multiple uncertainties, regarding not only how to do gene therapy, but also how to anticipate and enact ambiguous regulatory requirements in a context of limited resources (technical, spatial, and financial. At the same time, the trial infrastructure had to accommodate Cystic Fibrosis biology by bridging the gap between pathology and therapy. The consortium’s approach to treating CF required that they address concerns about contamination and safety while finding a way of getting a modified gene product into the lungs of the trial participants.

  12. Fight fire with fire: Gene therapy strategies to cure HIV.

    Science.gov (United States)

    Huyghe, Jon; Magdalena, Sips; Vandekerckhove, Linos

    2017-08-01

    Human Immunodeficiency Virus (HIV) to date remains one of the most notorious viruses mankind has ever faced. Despite enormous investments in HIV research for more than 30 years an effective cure for HIV has been elusive. Areas covered: Combination antiretroviral therapy (cART) suppresses active viral replication, but is not able to eliminate the virus completely due to stable integration of HIV inside the host genome of infected cells and the establishment of a latent reservoir, that is insensitive to cART. Nevertheless, this latent HIV reservoir is fully capable to refuel viral replication when treatment is stopped, creating a major obstacle towards a cure for HIV. Several gene therapy approaches ranging from the generation of HIV resistant CD4 + T cells to the eradication of HIV infected cells by immune cell engineering are currently under pre-clinical and clinical investigation and may present a promising road to a cure. In this review, we focus on the status and the prospects of gene therapy strategies to cure/eradicate HIV. Expert commentary: Recent advances in gene therapy for oncology and infectious diseases indicate that gene therapy may be a feasible and very potent cure strategy, and therefore a potential game changer in the search for an effective HIV cure.

  13. Loss of the gene for the alpha subunit of ATP synthase (ATP5A1) from the W chromosome in the African grey parrot (Psittacus erithacus).

    Science.gov (United States)

    de Kloet, S R

    2001-08-01

    This study describes the results of an analysis using Southern blotting, the polymerase chain reaction, and sequencing which shows that the African grey parrot (Psittacus erithacus) lacks the W-chromosomal gene for the alpha subunit of mitochondrial ATP synthase (ATP5A1W). Additional evidence shows that in other psittacines a fragment of the ATP5A1W gene contains five times as many nonsynonymous nucleotide replacements as the homologous fragment of the Z gene. Therefore, whereas in these other psittacines the corresponding ATP5A1Z protein fragment is highly conserved and varies by only a few, moderately conservative amino acid substitutions, the homologous ATP5A1W fragments contain a considerable number of, sometimes highly nonconservative, amino acid replacements. In one of these species, the ringneck parakeet (Psittacula krameri), the ATP5A1W gene is present in an inactive form because of the presence of a nonsense codon. Other changes, possibly leading to an inactive ATP5A1W gene product, involve the substitution of arginine residues by cysteine in the ATP5A1W protein of the mitred conure (Aratinga mitrata) and the blue and gold macaw (Ara ararauna). The data suggest also that although the divergence of the psittacine ATP5A1W and ATP5A1Z genes preceded the origin of the psittacidae, this divergence occurred independently of a similar process in the myna (Gracula religiosa), the outgroup used in this study.

  14. Non-viral gene therapy for bone tissue engineering.

    Science.gov (United States)

    Wegman, Fiona; Oner, F Cumhur; Dhert, Wouter J A; Alblas, Jacqueline

    2013-01-01

    The possibilities of using gene therapy for bone regeneration have been extensively investigated. Improvements in the design of new transfection agents, combining vectors and delivery/release systems to diminish cytotoxicity and increase transfection efficiencies have led to several successful in vitro, ex vivo and in vivo strategies. These include growth factor or short interfering ribonucleic acid (siRNA) delivery, or even enzyme replacement therapies, and have led to increased osteogenic differentiation and bone formation in vivo. These results provide optimism to consider use in humans with some of these gene-delivery strategies in the near future.

  15. Advances of reporter gene monitoring stem cell therapy

    International Nuclear Information System (INIS)

    Zhou Xiang; Yin Hongyan; Zhang Yifan

    2010-01-01

    Stem cell therapy research has made great progress, demonstrating a broad application prospects. However, stem cell therapy as a new disease treatment, there are still many problems to be solved. Reporter gene imaging is a rapid development in recent years, a non-invasive, sensitive method of monitoring of stem cells, in particular radionuclide reporter gene imaging has high sensitivity and specificity of the advantages of strong and can carry out imaging of deep tissue and repeat imaging, is a tracer in vivo conditions, the most promising stem cell transplantation technique, showing good prospects for development. (authors)

  16. Gene Therapy in Thalassemia and Hemoglobinopathies

    OpenAIRE

    Breda, Laura; Gambari, Roberto; Rivella, Stefano

    2009-01-01

    Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

  17. Gene therapy and angiogenesis in patients with coronary artery disease

    DEFF Research Database (Denmark)

    Kastrup, Jens

    2010-01-01

    -blind placebo-controlled trials could not confirm the initial high efficacy of either the growth factor protein or the gene therapy approaches observed in earlier small trials. The clinical studies so far have all been without any gene-related serious adverse events. Future trials will focus on whether...... an improvement in clinical results can be obtained with a cocktail of growth factors or by a combination of gene and stem cell therapy in patients with severe coronary artery disease, which cannot be treated effectively with current treatment strategies....... of VEGF and FGF in patients with coronary artery disease. The initial small and unblinded studies with either recombinant growth factor proteins or genes encoding growth factors were encouraging, demonstrating both clinical improvement and evidence of angiogenesis. However, subsequent larger double...

  18. Genetic correction using engineered nucleases for gene therapy applications.

    Science.gov (United States)

    Li, Hongmei Lisa; Nakano, Takao; Hotta, Akitsu

    2014-01-01

    Genetic mutations in humans are associated with congenital disorders and phenotypic traits. Gene therapy holds the promise to cure such genetic disorders, although it has suffered from several technical limitations for decades. Recent progress in gene editing technology using tailor-made nucleases, such as meganucleases (MNs), zinc finger nucleases (ZFNs), TAL effector nucleases (TALENs) and, more recently, CRISPR/Cas9, has significantly broadened our ability to precisely modify target sites in the human genome. In this review, we summarize recent progress in gene correction approaches of the human genome, with a particular emphasis on the clinical applications of gene therapy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  19. Expression of phytoene synthase1 and carotene desaturase crtI genes result in an increase in the total carotenoids content in transgenic elite wheat (Triticum aestivum L.).

    Science.gov (United States)

    Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan

    2009-09-23

    Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.

  20. Gene transfer strategies for improving radiolabeled peptide imaging and therapy

    International Nuclear Information System (INIS)

    Rogers, B.E.; Buchsbaum, D.J.; Zinn, K.R.

    2000-01-01

    Utilization of molecular biology techniques offers attractive options in nuclear medicine for improving cancer imaging and therapy with radiolabeled peptides. Two of these options include utilization of phage-panning to identify novel tumor specific peptides or single chain antibodies and gene transfer techniques to increase the antibodies and gene transfer techniques to increase the number of antigen/receptor sites expressed on malignant cells. The group has focused on the latter approach for improving radiolabeled peptide imaging and therapy. The most widely used gene transfer vectors in clinical gene therapy trials include retrovirus, cationic lipids and adenovirus. It has been utilized adenovirus vectors for gene transfer because of their ability to accomplish efficient in vivo gene transfer. Adenovirus vectors encoding the genes for a variety of antigens/receptors (carcinoembryonic antigen, gastrin-releasing peptide receptor, somatostatin receptor subtype 2 (SSTr2) have all shown that their expression is increased on cancer cells both in vitro and in vivo following adenovirus infection. Of particular interest has been the adenovirus encoding for SSTr2 (AdCMVSSTr2). Various radioisotopes have been attached to somatostatin analogues for imaging and therapy of SSTr2-positive tumors both clinically and in animal models. The use of these analogues in combination with AdCMVSSTr2 is a promising approach for improving the detection sensitivity and therapeutic efficacy of these radiolabeled peptides against solid tumors. In addition, it has been proposed the use of SSTr2 as a marker for imaging the expression of another cancer therapeutic transgene (e.g. cytosine deaminase, thymidine kinase) encoded within the same vector. This would allow for non-invasive monitoring of gene delivery to tumor sites

  1. Anti-Angiogenic Gene Therapy for Prostate Cancer

    Science.gov (United States)

    2004-04-01

    S. Parvovirus vectors for cancer gene therapy. Expert. Opin. Bid. Ther., 2004, 4: 53-64. Ponnazhagan, S., and Hoover, F. Delivery of DNA to tumor... vaccine with plasmid adjuvants 95h Annual Meeting of the American Society for Cancer Research, Orlando, FL, April 2004. Chaudhuri, T.R., Cao, Z...with recombinant AAV vectors results in sustained expression in a dog model of hemophilia. Gene Ther., 5: 40-49, 1998. 2ś 35. Bohl, D., Bosch, A

  2. Benzalacetone Synthase

    Directory of Open Access Journals (Sweden)

    Ikuro eAbe

    2012-03-01

    Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.

  3. Stem cells’ guided gene therapy of cancer: New frontier in personalized and targeted therapy

    Directory of Open Access Journals (Sweden)

    Mavroudi M

    2014-01-01

    Full Text Available Diagnosis and therapy of cancer remain to be the greatest challenges for all physicians working in clinical oncology and molecular medicine. The grim statistics speak for themselves with reports of 1,638,910 men and women diagnosed with cancer and nearly 577,190 patients passed away due to cancer in the USA in 2012. For practicing clinicians, who treat patients suffering from advanced cancers with contemporary systemic therapies, the main challenge is to attain therapeutic efficacy, while minimizing side effects. Unfortunately, all contemporary systemic therapies cause side effects. In treated patients, these side effects may range from nausea to damaged tissues. In cancer survivors, the iatrogenic outcomes of systemic therapies may include genomic mutations and their consequences. Therefore, there is an urgent need for personalized and targeted therapies. Recently, we reviewed the current status of suicide gene therapy for cancer. Herein, we discuss the novel strategy: genetically engineered stem guided gene therapy. Stem cells have the unique potential for self-renewal and differentiation. This potential is the primary reason for introducing them into medicine to regenerate injured or degenerated organs, as well as to rejuvenate aging tissues. Recent advances in genetic engineering and stem cell research have created the foundations for genetic engineering of stem cells as the vectors for delivery of therapeutic transgenes. Specifically in oncology, the stem cells are genetically engineered to deliver the cell suicide inducing genes selectively to the cancer cells. Expression of the transgenes kills the cancer cells, while leaving healthy cells unaffected. Herein, we present various strategies to bioengineer suicide inducing genes and stem cell vectors. Moreover, we review results of the main preclinical studies and clinical trials. However, the main risk for therapeutic use of stem cells is their cancerous transformation. Therefore, we

  4. Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

    Science.gov (United States)

    Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

    2012-12-01

    Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

  5. Genome-wide analysis of the Solanum tuberosum (potato) trehalose-6-phosphate synthase (TPS) gene family: evolution and differential expression during development and stress.

    Science.gov (United States)

    Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang

    2017-12-01

    Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.

  6. Recent trends in the gene therapy of β-thalassemia

    Directory of Open Access Journals (Sweden)

    Finotti A

    2015-02-01

    Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

  7. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression.

    Science.gov (United States)

    Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan

    2015-01-01

    The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  8. The bZIP transcription factor HY5 interacts with the promoter of the monoterpene synthase gene QH6 in modulating its rhythmic expression

    Directory of Open Access Journals (Sweden)

    Fei eZhou

    2015-04-01

    Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.

  9. Association of endothelial nitric oxide synthase gene polymorphism with the risk of Henoch-Schönlein purpura/Henoch-Schönlein purpura nephritis.

    Science.gov (United States)

    Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei

    2015-04-01

    Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.

  10. The interplay of post-translational modification and gene therapy

    Directory of Open Access Journals (Sweden)

    Osamor VC

    2016-02-01

    Full Text Available Victor Chukwudi Osamor,1–3 Shalom N Chinedu,3,4 Dominic E Azuh,3,5 Emeka Joshua Iweala,3,4 Olubanke Olujoke Ogunlana3,4 1Covenant University Bioinformatics Research (CUBRe Unit, Department of Computer and Information Sciences, College of Science and Technology (CST, Covenant University, Ota, Ogun State, Nigeria; 2Institute of Informatics (Computational biology and Bioinformatics, Faculty of Mathematics, Informatics and Mechanics, University of Warsaw (Uniwersytet Warszawski, Warszawa, Poland; 3Covenant University Public Health and Well-being Research Group (CUPHWERG, Covenant University, 4Biochemistry and Molecular Biology Unit, Department of Biological Sciences, College of Science and Technology, Covenant University, Canaan Land, 5Department of Economics and Development Studies, Covenant University, Ota, Ogun State, Nigeria Abstract: Several proteins interact either to activate or repress the expression of other genes during transcription. Based on the impact of these activities, the proteins can be classified into readers, modifier writers, and modifier erasers depending on whether histone marks are read, added, or removed, respectively, from a specific amino acid. Transcription is controlled by dynamic epigenetic marks with serious health implications in certain complex diseases, whose understanding may be useful in gene therapy. This work highlights traditional and current advances in post-translational modifications with relevance to gene therapy delivery. We report that enhanced understanding of epigenetic machinery provides clues to functional implication of certain genes/gene products and may facilitate transition toward revision of our clinical treatment procedure with effective fortification of gene therapy delivery. Keywords: post-translational modification, gene therapy, epigenetics, histone, methylation

  11. TS gene polymorphisms are not good markers of response to 5-FU therapy in stage III colon cancer patients.

    Science.gov (United States)

    Fariña-Sarasqueta, A; Gosens, M J E M; Moerland, E; van Lijnschoten, I; Lemmens, V E P P; Slooter, G D; Rutten, H J T; van den Brule, Adriaan J C

    2011-08-01

    Although the predictive and prognostic value of thymidylate synthase (TS) expression and gene polymorphism in colon cancer has been widely studied, the results are inconclusive probably because of methodological differences. With this study, we aimed to elucidate the role of TS gene polymorphisms genotyping in therapy response in stage III colon carcinoma patients treated with 5-FU adjuvant chemotherapy. 251 patients diagnosed with stage III colon carcinoma treated with surgery followed by 5-FU based adjuvant therapy were selected. The variable number of tandem repeats (VNTR) and the single nucleotide polymorphism (SNP) in the 5'untranslated region of the TS gene were genotyped. There was a positive association between tumor T stage and the VNTR genotypes (p = 0.05). In both univariate and multivariate survival analysis no effects of the studied polymorphisms on survival were found. However, there was an association between both polymorphisms and age. Among patients younger than 60 years, the patients homozygous for 2R seemed to have a better overall survival, whereas among the patients older than 67 this longer survival was seen by the carriers of other genotypes. We conclude that the TS VNTR and SNP do not predict response to 5-FU therapy in patients with stage III colon carcinoma. However, age appears to modify the effects of TS polymorphisms on survival.

  12. Towards a durable RNAi gene therapy for HIV-AIDS

    NARCIS (Netherlands)

    Berkhout, Ben; ter Brake, Olivier

    2009-01-01

    Background: RNA interference (RNAi) can be employed as a potent antiviral mechanism Objective: To discuss RNAi approaches to target pathogenic human viruses causing acute or chronic infections, in particular RNAi gene therapy against HIV-1. Methods: A review of relevant literature.

  13. Gene therapy in nonhuman primate models of human autoimmune disease

    NARCIS (Netherlands)

    t'Hart, B. A.; Vervoordeldonk, M.; Heeney, J. L.; Tak, P. P.

    2003-01-01

    Before autoimmune diseases in humans can be treated with gene therapy, the safety and efficacy of the used vectors must be tested in valid experimental models. Monkeys, such as the rhesus macaque or the common marmoset, provide such models. This publication reviews the state of the art in monkey

  14. The feasibility of incorporating Vpx into lentiviral gene therapy vectors

    Directory of Open Access Journals (Sweden)

    Samantha A McAllery

    2016-01-01

    Full Text Available While current antiretroviral therapy has significantly improved, challenges still remain in life-long targeting of HIV-1 reservoirs. Lentiviral gene therapy has the potential to deliver protective genes into the HIV-1 reservoir. However, inefficient reverse transcription (RT occurs in HIV-1 reservoirs during lentiviral gene delivery. The viral protein Vpx is capable of increasing lentiviral RT by antagonizing the restriction factor SAMHD1. Incorporating Vpx into lentiviral vectors could substantially increase gene delivery into the HIV-1 reservoir. The feasibility of this Vpx approach was tested in resting cell models utilizing macrophages and dendritic cells. Our results showed Vpx exposure led to increased permissiveness of cells over a period that exceeded 2 weeks. Consequently, significant lower potency of HIV-1 antiretrovirals inhibiting RT and integration was observed. When Vpx was incorporated with anti-HIV-1 genes inhibiting either pre-RT or post-RT stages of the viral life-cycle, transduction levels significantly increased. However, a stronger antiviral effect was only observed with constructs that inhibit pre-RT stages of the viral life cycle. In conclusion this study demonstrates a way to overcome the major delivery obstacle of gene delivery into HIV-1 reservoir cell types. Importantly, incorporating Vpx with pre-RT anti-HIV-1 genes, demonstrated the greatest protection against HIV-1 infection.

  15. Glycogen Phosphorylase and Glycogen Synthase: Gene Cloning and Expression Analysis Reveal Their Role in Trehalose Metabolism in the Brown Planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae).

    Science.gov (United States)

    Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin

    2017-01-01

    RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  16. The Pathway From Genes to Gene Therapy in Glaucoma: A Review of Possibilities for Using Genes as Glaucoma Drugs.

    Science.gov (United States)

    Borrás, Teresa

    2017-01-01

    Treatment of diseases with gene therapy is advancing rapidly. The use of gene therapy has expanded from the original concept of re-placing the mutated gene causing the disease to the use of genes to con-trol nonphysiological levels of expression or to modify pathways known to affect the disease. Genes offer numerous advantages over conventional drugs. They have longer duration of action and are more specific. Genes can be delivered to the target site by naked DNA, cells, nonviral, and viral vectors. The enormous progress of the past decade in molecular bi-ology and delivery systems has provided ways for targeting genes to the intended cell/tissue and safe, long-term vectors. The eye is an ideal organ for gene therapy. It is easily accessible and it is an immune-privileged site. Currently, there are clinical trials for diseases affecting practically every tissue of the eye, including those to restore vision in patients with Leber congenital amaurosis. However, the number of eye trials compared with those for systemic diseases is quite low (1.8%). Nevertheless, judg-ing by the vast amount of ongoing preclinical studies, it is expected that such number will increase considerably in the near future. One area of great need for eye gene therapy is glaucoma, where a long-term gene drug would eliminate daily applications and compliance issues. Here, we review the current state of gene therapy for glaucoma and the possibilities for treating the trabecular meshwork to lower intraocular pressure and the retinal ganglion cells to protect them from neurodegeneration. Copyright© 2017 Asia-Pacific Academy of Ophthalmology.

  17. Neurotrophin gene therapy for sustained neural preservation after deafness.

    Science.gov (United States)

    Atkinson, Patrick J; Wise, Andrew K; Flynn, Brianna O; Nayagam, Bryony A; Hume, Clifford R; O'Leary, Stephen J; Shepherd, Robert K; Richardson, Rachael T

    2012-01-01

    The cochlear implant provides auditory cues to profoundly deaf patients by electrically stimulating the residual spiral ganglion neurons. These neurons, however, undergo progressive degeneration after hearing loss, marked initially by peripheral fibre retraction and ultimately culminating in cell death. This research aims to use gene therapy techniques to both hold and reverse this degeneration by providing a sustained and localised source of neurotrophins to the deafened cochlea. Adenoviral vectors containing green fluorescent protein, with or without neurotrophin-3 and brain derived neurotrophic factor, were injected into the lower basal turn of scala media of guinea pigs ototoxically deafened one week prior to intervention. This single injection resulted in localised and sustained gene expression, principally in the supporting cells within the organ of Corti. Guinea pigs treated with adenoviral neurotrophin-gene therapy had greater neuronal survival compared to contralateral non-treated cochleae when examined at 7 and 11 weeks post injection. Moreover; there was evidence of directed peripheral fibre regrowth towards cells expressing neurotrophin genes after both treatment periods. These data suggest that neurotrophin-gene therapy can provide sustained protection of spiral ganglion neurons and peripheral fibres after hearing loss.

  18. Gene therapy decreases seizures in a model of Incontinentia pigmenti.

    Science.gov (United States)

    Dogbevia, Godwin K; Töllner, Kathrin; Körbelin, Jakob; Bröer, Sonja; Ridder, Dirk A; Grasshoff, Hanna; Brandt, Claudia; Wenzel, Jan; Straub, Beate K; Trepel, Martin; Löscher, Wolfgang; Schwaninger, Markus

    2017-07-01

    Incontinentia pigmenti (IP) is a genetic disease leading to severe neurological symptoms, such as epileptic seizures, but no specific treatment is available. IP is caused by pathogenic variants that inactivate the Nemo gene. Replacing Nemo through gene therapy might provide therapeutic benefits. In a mouse model of IP, we administered a single intravenous dose of the adeno-associated virus (AAV) vector, AAV-BR1-CAG-NEMO, delivering the Nemo gene to the brain endothelium. Spontaneous epileptic seizures and the integrity of the blood-brain barrier (BBB) were monitored. The endothelium-targeted gene therapy improved the integrity of the BBB. In parallel, it reduced the incidence of seizures and delayed their occurrence. Neonate mice intravenously injected with the AAV-BR1-CAG-NEMO vector developed no hepatocellular carcinoma or other major adverse effects 11 months after vector injection, demonstrating that the vector has a favorable safety profile. The data show that the BBB is a target of antiepileptic treatment and, more specifically, provide evidence for the therapeutic benefit of a brain endothelial-targeted gene therapy in IP. Ann Neurol 2017;82:93-104. © 2017 American Neurological Association.

  19. Identification of GIG1, a GlcNAc-induced gene in Candida albicans needed for normal sensitivity to the chitin synthase inhibitor nikkomycin Z.

    Science.gov (United States)

    Gunasekera, Angelo; Alvarez, Francisco J; Douglas, Lois M; Wang, Hong X; Rosebrock, Adam P; Konopka, James B

    2010-10-01

    The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism.

  20. Identification of GIG1, a GlcNAc-Induced Gene in Candida albicans Needed for Normal Sensitivity to the Chitin Synthase Inhibitor Nikkomycin Z▿§

    Science.gov (United States)

    Gunasekera, Angelo; Alvarez, Francisco J.; Douglas, Lois M.; Wang, Hong X.; Rosebrock, Adam P.; Konopka, James B.

    2010-01-01

    The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism. PMID:20675577

  1. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    Directory of Open Access Journals (Sweden)

    Toub Omid

    2010-10-01

    Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information

  2. Update on gene therapy of inherited immune deficiencies.

    Science.gov (United States)

    Engel, Barbara C; Kohn, Donald B; Podsakoff, Greg M

    2003-10-01

    Gene therapy has been under development as a way to correct inborn errors for many years. Recently, patients with two forms of inherited severe combined immunodeficiency (SCID), adenosine deaminase and X-linked, treated by three different clinical investigative teams, have shown significant immune reconstitution leading to protective immunity. These advances irrefutably prove the concept that hematopoietic progenitor cell gene therapy can ameliorate these diseases. However, due to proviral insertional oncogenesis, two individuals in one of the X-SCID studies developed T-cell leukemia more than two years after the gene transfer. Depending upon the results of long-term follow-up, the successes together with the side effects highlight the relative merits of this therapeutic approach.

  3. Down regulation by a low-zinc diet in gene expression of rat prostatic thymidylate synthase and thymidine kinase

    Directory of Open Access Journals (Sweden)

    Sassa Shuji

    2008-05-01

    Full Text Available Abstract Background Zinc has a wide spectrum of biological activities and its deficiency is related to various abnormalities of cell metabolism. Methods Wistar male rats, at age of 4 weeks, were fed a low-zinc diet for six weeks. The levels of bromodeoxyuridine incorporated into the prostatic DNA and the mRNA expression levels of prostate thymidylate synthase and thymidine kinase were examined. Result The low-zinc diet caused a marked reduction in the body growth and organ weights, resulted in a low hematopoiesis, hypo-albuminemia and hypocholesterolemia. Although there were few differences in plasma biochemical markers, plasma levels of luteinizing hormone and testosterone were reduced by the low-zinc diet. Bromodeoxyuridine-immunoreactive (S-phase cells and mRNA expression levels of thymidylate synthase and thymidine kinase in the prostate cells were markedly affected by the low-zinc diet. Conclusion A low-zinc diet appears to reduce the body growth and organ weights including prostate, causing low plasma levels of luteinizing hormone and testosterone and reduction in prostate DNA replication in growing-rats.

  4. The use of molecular imaging of gene expression by radiotracers in gene therapy

    International Nuclear Information System (INIS)

    Richard-Fiardo, P.; Franken, P.R.; Harrington, K.J.; Vassaux, G.; Cambien, B.

    2011-01-01

    Introduction: Progress with gene-based therapies has been hampered by difficulties in monitoring the biodistribution and kinetics of vector-mediated gene expression. Recent developments in non-invasive imaging have allowed researchers and clinicians to assess the location, magnitude and persistence of gene expression in animals and humans. Such advances should eventually lead to improvement in the efficacy and safety of current clinical protocols for future treatments. Areas Covered: The molecular imaging techniques for monitoring gene therapy in the living subject, with a specific highlight on the key reporter gene approaches that have been developed and validated in preclinical models using the latest imaging modalities. The applications of molecular imaging to biotherapy, with a particular emphasis on monitoring of gene and vector biodistribution and on image-guided radiotherapy. Expert Opinion: Among the reporter gene/probe combinations that have been described so far, one stands out, in our view, as the most versatile and easy to implement: the Na/I symporter. This strategy, exploiting more than 50 years of experience in the treatment of differentiated thyroid carcinomas, has been validated in different types of experimental cancers and with different types of oncolytic viruses and is likely to become a key tool in the implementation of human gene therapy. (authors)

  5. Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

    International Nuclear Information System (INIS)

    Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

    2008-01-01

    Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

  6. Short communication: Effect of inhibition of fatty acid synthase on triglyceride accumulation and effect on lipid metabolism genes in goat mammary epithelial cells.

    Science.gov (United States)

    Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J

    2015-05-01

    The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. [Progress in research on pathogenic genes and gene therapy for inherited retinal diseases].

    Science.gov (United States)

    Zhu, Ling; Cao, Cong; Sun, Jiji; Gao, Tao; Liang, Xiaoyang; Nie, Zhipeng; Ji, Yanchun; Jiang, Pingping; Guan, Minxin

    2017-02-10

    Inherited retinal diseases (IRDs), including retinitis pigmentosa, Usher syndrome, Cone-Rod degenerations, inherited macular dystrophy, Leber's congenital amaurosis, Leber's hereditary optic neuropathy are the most common and severe types of hereditary ocular diseases. So far more than 200 pathogenic genes have been identified. With the growing knowledge of the genetics and mechanisms of IRDs, a number of gene therapeutic strategies have been developed in the laboratory or even entered clinical trials. Here the progress of IRD research on the pathogenic genes and therapeutic strategies, particularly gene therapy, are reviewed.

  8. [Gene therapy and cell transplantation for Parkinson's disease].

    Science.gov (United States)

    Muramatsu, Shin-ichi

    2005-11-01

    Increasing enthusiasm in the field of stem cell research is raising the hope of novel cell replacement therapies for Parkinson's disease (PD), but it also raises both scientific and ethical concerns. In most cases, dopaminergic cells are transplanted ectopically into the striatum instead of the substantia nigra. If the main mechanism underlying any observed functional recovery with these cell replacement therapies is restoration of dopaminergic neurotransmission, then viral vector-mediated gene delivery of dopamine-synthesizing enzymes is a more straight forward approach. The development of a recombinant adeno-associated viral (AAV) vector is making gene therapy for PD a feasible therapeutic option in the clinical arena. Efficient and long-term expression of genes for dopamine-synthesizing enzymes in the striatum restored local dopamine production and allowed behavioral recovery in animal models of PD. A clinical trial to evaluate the safety and efficacy of AAV vector-mediated gene transfer of aromatic L-amino acid decarboxylase, an enzyme that converts L-dopa to dopamine, is underway. With this strategy patients would still need to take L-dopa to control their PD symptoms, however, dopamine production could be regulated by altering the dose of L-dopa. Another AAV vector-based clinical trial is also ongoing in which the subthalamic nucleus is transduced to produce inhibitory transmitters.

  9. Applications of Gene Editing Technologies to Cellular Therapies.

    Science.gov (United States)

    Rein, Lindsay A M; Yang, Haeyoon; Chao, Nelson J

    2018-03-27

    Hematologic malignancies are characterized by genetic heterogeneity, making classic gene therapy with a goal of correcting 1 genetic defect ineffective in many of these diseases. Despite initial tribulations, gene therapy, as a field, has grown by leaps and bounds with the recent development of gene editing techniques including zinc finger nucleases, transcription activator-like effector nucleases, and clustered regularly interspaced short palindromic repeat (CRISPR) sequences and CRISPR-associated protein-9 (Cas9) nuclease or CRISPR/Cas9. These novel technologies have been applied to efficiently and specifically modify genetic information in target and effector cells. In particular, CRISPR/Cas9 technology has been applied to various hematologic malignancies and has also been used to modify and improve chimeric antigen receptor-modified T cells for the purpose of providing effective cellular therapies. Although gene editing is in its infancy in malignant hematologic diseases, there is much room for growth and application in the future. Copyright © 2018 The American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

  10. Gene Therapy With Regulatory T Cells: A Beneficial Alliance

    Directory of Open Access Journals (Sweden)

    Moanaro Biswas

    2018-03-01

    Full Text Available Gene therapy aims to replace a defective or a deficient protein at therapeutic or curative levels. Improved vector designs have enhanced safety, efficacy, and delivery, with potential for lasting treatment. However, innate and adaptive immune responses to the viral vector and transgene product remain obstacles to the establishment of therapeutic efficacy. It is widely accepted that endogenous regulatory T cells (Tregs are critical for tolerance induction to the transgene product and in some cases the viral vector. There are two basic strategies to harness the suppressive ability of Tregs: in vivo induction of adaptive Tregs specific to the introduced gene product and concurrent administration of autologous, ex vivo expanded Tregs. The latter may be polyclonal or engineered to direct specificity to the therapeutic antigen. Recent clinical trials have advanced adoptive immunotherapy with Tregs for the treatment of autoimmune disease and in patients receiving cell transplants. Here, we highlight the potential benefit of combining gene therapy with Treg adoptive transfer to achieve a sustained transgene expression. Furthermore, techniques to engineer antigen-specific Treg cell populations, either through reprogramming conventional CD4+ T cells or transferring T cell receptors with known specificity into polyclonal Tregs, are promising in preclinical studies. Thus, based upon these observations and the successful use of chimeric (IgG-based antigen receptors (CARs in antigen-specific effector T cells, different types of CAR-Tregs could be added to the repertoire of inhibitory modalities to suppress immune responses to therapeutic cargos of gene therapy vectors. The diverse approaches to harness the ability of Tregs to suppress unwanted immune responses to gene therapy and their perspectives are reviewed in this article.

  11. Bystander or No Bystander for Gene Directed Enzyme Prodrug Therapy

    Directory of Open Access Journals (Sweden)

    Adam V. Patterson

    2009-11-01

    Full Text Available Gene directed enzyme prodrug therapy (GDEPT of cancer aims to improve the selectivity of chemotherapy by gene transfer, thus enabling target cells to convert nontoxic prodrugs to cytotoxic drugs. A zone of cell kill around gene-modified cells due to transfer of toxic metabolites, known as the bystander effect, leads to tumour regression. Here we discuss the implications of either striving for a strong bystander effect to overcome poor gene transfer, or avoiding the bystander effect to reduce potential systemic effects, with the aid of three successful GDEPT systems. This review concentrates on bystander effects and drug development with regard to these enzyme prodrug combinations, namely herpes simplex virus thymidine kinase (HSV-TK with ganciclovir (GCV, cytosine deaminase (CD from bacteria or yeast with 5-fluorocytodine (5-FC, and bacterial nitroreductase (NfsB with 5-(azaridin-1-yl-2,4-dinitrobenzamide (CB1954, and their respective derivatives.

  12. Gain-of-function mutations in the phosphatidylserine synthase 1 (PTDSS1) gene cause Lenz-Majewski syndrome.

    Science.gov (United States)

    Sousa, Sérgio B; Jenkins, Dagan; Chanudet, Estelle; Tasseva, Guergana; Ishida, Miho; Anderson, Glenn; Docker, James; Ryten, Mina; Sa, Joaquim; Saraiva, Jorge M; Barnicoat, Angela; Scott, Richard; Calder, Alistair; Wattanasirichaigoon, Duangrurdee; Chrzanowska, Krystyna; Simandlová, Martina; Van Maldergem, Lionel; Stanier, Philip; Beales, Philip L; Vance, Jean E; Moore, Gudrun E

    2014-01-01

    Lenz-Majewski syndrome (LMS) is a syndrome of intellectual disability and multiple congenital anomalies that features generalized craniotubular hyperostosis. By using whole-exome sequencing and selecting variants consistent with the predicted dominant de novo etiology of LMS, we identified causative heterozygous missense mutations in PTDSS1, which encodes phosphatidylserine synthase 1 (PSS1). PSS1 is one of two enzymes involved in the production of phosphatidylserine. Phosphatidylserine synthesis was increased in intact fibroblasts from affected individuals, and end-product inhibition of PSS1 by phosphatidylserine was markedly reduced. Therefore, these mutations cause a gain-of-function effect associated with regulatory dysfunction of PSS1. We have identified LMS as the first human disease, to our knowledge, caused by disrupted phosphatidylserine metabolism. Our results point to an unexplored link between phosphatidylserine synthesis and bone metabolism.

  13. Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

    Science.gov (United States)

    Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

    2008-01-01

    FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

  14. Nuclear receptor 5A (NR5A) family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells.

    Science.gov (United States)

    Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru

    2012-11-01

    5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.

  15. Nanoparticle-mediated delivery of suicide genes in cancer therapy.

    Science.gov (United States)

    Vago, Riccardo; Collico, Veronica; Zuppone, Stefania; Prosperi, Davide; Colombo, Miriam

    2016-09-01

    Conventional chemotherapeutics have been employed in cancer treatment for decades due to their efficacy in killing the malignant cells, but the other side of the coin showed off-target effects, onset of drug resistance and recurrences. To overcome these limitations, different approaches have been investigated and suicide gene therapy has emerged as a promising alternative. This approach consists in the introduction of genetic materials into cancerous cells or the surrounding tissue to cause cell death or retard the growth of the tumor mass. Despite promising results obtained both in vitro and in vivo, this innovative approach has been limited, for long time, to the treatment of localized tumors, due to the suboptimal efficiency in introducing suicide genes into cancer cells. Nanoparticles represent a valuable non-viral delivery system to protect drugs in the bloodstream, to improve biodistribution, and to limit side effects by achieving target selectivity through surface ligands. In this scenario, the real potential of suicide genes can be translated into clinically viable treatments for patients. In the present review, we summarize the recent advances of inorganic nanoparticles as non-viral vectors in terms of therapeutic efficacy, targeting capacity and safety issues. We describe the main suicide genes currently used in therapy, with particular emphasis on toxin-encoding genes of bacterial and plant origin. In addition, we discuss the relevance of molecular targeting and tumor-restricted expression to improve treatment specificity to cancer tissue. Finally, we analyze the main clinical applications, limitations and future perspectives of suicide gene therapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Gene mutation-based and specific therapies in precision medicine.

    Science.gov (United States)

    Wang, Xiangdong

    2016-04-01

    Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  17. Engineered CRISPR Systems for Next Generation Gene Therapies.

    Science.gov (United States)

    Pineda, Michael; Moghadam, Farzaneh; Ebrahimkhani, Mo R; Kiani, Samira

    2017-09-15

    An ideal in vivo gene therapy platform provides safe, reprogrammable, and precise strategies which modulate cell and tissue gene regulatory networks with a high temporal and spatial resolution. Clustered regularly interspaced short palindromic repeats (CRISPR), a bacterial adoptive immune system, and its CRISPR-associated protein 9 (Cas9), have gained attention for the ability to target and modify DNA sequences on demand with unprecedented flexibility and precision. The precision and programmability of Cas9 is derived from its complexation with a guide-RNA (gRNA) that is complementary to a desired genomic sequence. CRISPR systems open-up widespread applications including genetic disease modeling, functional screens, and synthetic gene regulation. The plausibility of in vivo genetic engineering using CRISPR has garnered significant traction as a next generation in vivo therapeutic. However, there are hurdles that need to be addressed before CRISPR-based strategies are fully implemented. Some key issues center on the controllability of the CRISPR platform, including minimizing genomic-off target effects and maximizing in vivo gene editing efficiency, in vivo cellular delivery, and spatial-temporal regulation. The modifiable components of CRISPR systems: Cas9 protein, gRNA, delivery platform, and the form of CRISPR system delivered (DNA, RNA, or ribonucleoprotein) have recently been engineered independently to design a better genome engineering toolbox. This review focuses on evaluating CRISPR potential as a next generation in vivo gene therapy platform and discusses bioengineering advancements that can address challenges associated with clinical translation of this emerging technology.

  18. Immuno-Oncology-The Translational Runway for Gene Therapy: Gene Therapeutics to Address Multiple Immune Targets.

    Science.gov (United States)

    Weß, Ludger; Schnieders, Frank

    2017-12-01

    Cancer therapy is once again experiencing a paradigm shift. This shift is based on extensive clinical experience demonstrating that cancer cannot be successfully fought by addressing only single targets or pathways. Even the combination of several neo-antigens in cancer vaccines is not sufficient for successful, lasting tumor eradication. The focus has therefore shifted to the immune system's role in cancer and the striking abilities of cancer cells to manipulate and/or deactivate the immune system. Researchers and pharma companies have started to target the processes and cells known to support immune surveillance and the elimination of tumor cells. Immune processes, however, require novel concepts beyond the traditional "single-target-single drug" paradigm and need parallel targeting of diverse cells and mechanisms. This review gives a perspective on the role of gene therapy technologies in the evolving immuno-oncology space and identifies gene therapy as a major driver in the development and regulation of effective cancer immunotherapy. Present challenges and breakthroughs ranging from chimeric antigen receptor T-cell therapy, gene-modified oncolytic viruses, combination cancer vaccines, to RNA therapeutics are spotlighted. Gene therapy is recognized as the most prominent technology enabling effective immuno-oncology strategies.

  19. Engineering adeno-associated viruses for clinical gene therapy.

    Science.gov (United States)

    Kotterman, Melissa A; Schaffer, David V

    2014-07-01

    Clinical gene therapy has been increasingly successful owing both to an enhanced molecular understanding of human disease and to progressively improving gene delivery technologies. Among these technologies, delivery vectors based on adeno-associated viruses (AAVs) have emerged as safe and effective and, in one recent case, have led to regulatory approval. Although shortcomings in viral vector properties will render extension of such successes to many other human diseases challenging, new approaches to engineer and improve AAV vectors and their genetic cargo are increasingly helping to overcome these barriers.

  20. Thymidylate synthase, dihydropyrimidine dehydrogenase, ERCC1, and thymidine phosphorylase gene expression in primary and metastatic gastrointestinal adenocarcinoma tissue in patients treated on a phase I trial of oxaliplatin and capecitabine

    International Nuclear Information System (INIS)

    Uchida, Kazumi; Danenberg, Peter V; Danenberg, Kathleen D; Grem, Jean L

    2008-01-01

    Over-expression of thymidylate synthase (TS) and dihydropyrimidine dehydrogenase (DPD) in tumor tissue is associated with insensitivity to 5-fluorouracil (5-FU). Over-expression of ERCC1 correlates with insensitivity to oxaliplatin (OX) therapy, while high thymidine phosphorylase (TP) levels predict for increased sensitivity to capecitabine (Xel). Biopsies of metastatic tumor were taken before OX (130 mg/m 2 day 1) given with Xel (1200–3000 mg/m 2 in two divided doses days 1–5 and 8–12) every 3-weeks. Micro-dissected metastatic and primary tumors were analyzed for relative gene expression by real-time quantitative polymerase chain reaction. The clinical protocol prospectively identified the molecular targets of interest that would be tested. Endpoints for the molecular analyses were correlation of median, first and third quartiles for relative gene expression of each target with response, time to treatment failure (TTF), and survival. Among 91 patients participating in this trial; 97% had colorectal cancer. The median number of prior chemotherapy regimens was 2, and most had prior 5-FU and irinotecan. In paired samples, median mRNA levels were significantly higher in metastatic versus primary tumor (-fold): TS (1.9), DPD (3.8), ERCC1 (2.1) and TP (1.6). A strong positive correlation was noted between DPD and TP mRNA levels in both primary (r = 0.693, p < 0.0005) and metastatic tissue (r = 0.697, p < 0.00001). There was an association between TS gene expression and responsive and stable disease: patients whose intratumoral TS mRNA levels were above the median value had significantly greater risk of early disease progression (43% vs 17%), but this did not translate into a significant difference in TTF. ERCC1 gene expression above the third quartile was associated with a shorter TTF (median 85 vs 162 days, p = 0.046). Patients whose TS mRNA levels in metastatic tumor tissue were below the median had a longer overall survival (median 417 vs 294 days, p = 0

  1. Status and advances of p53-gene therapy and radiotherapy in malignant tumor

    International Nuclear Information System (INIS)

    Duan Xin; Chinese Academy of Sciences, Beijing; Zhang Hong

    2006-01-01

    Cancer treatment is one of the most important fields in medical research. All strategies such as radio-therapy, chemotherapy, surgery, and gene-based therapy have their own advantages and disadvantages. Nowadays, a novel method which combined p53-gene therapy with radiotherapy plays an important role in the field of cancer research. This review summarized the current state of combined therapies of p53-gene therapy and radiotherapy, possible mechanism and recent progress. (authors)

  2. Analysis of the clonal repertoire of gene-corrected cells in gene therapy.

    Science.gov (United States)

    Paruzynski, Anna; Glimm, Hanno; Schmidt, Manfred; Kalle, Christof von

    2012-01-01

    Gene therapy-based clinical phase I/II studies using integrating retroviral vectors could successfully treat different monogenetic inherited diseases. However, with increased efficiency of this therapy, severe side effects occurred in various gene therapy trials. In all cases, integration of the vector close to or within a proto-oncogene contributed substantially to the development of the malignancies. Thus, the in-depth analysis of integration site patterns is of high importance to uncover potential clonal outgrowth and to assess the safety of gene transfer vectors and gene therapy protocols. The standard and nonrestrictive linear amplification-mediated PCR (nrLAM-PCR) in combination with high-throughput sequencing exhibits technologies that allow to comprehensively analyze the clonal repertoire of gene-corrected cells and to assess the safety of the used vector system at an early stage on the molecular level. It enables clarifying the biological consequences of the vector system on the fate of the transduced cell. Furthermore, the downstream performance of real-time PCR allows a quantitative estimation of the clonality of individual cells and their clonal progeny. Here, we present a guideline that should allow researchers to perform comprehensive integration site analysis in preclinical and clinical studies. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. Arabidopsis thaliana sucrose phosphate synthase (sps) genes are expressed differentially in organs and tissues, and their transcription is regulated by osmotic stress.

    Science.gov (United States)

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-11-01

    Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. A product of the bicistronic Drosophila melanogaster gene CG31241, which also encodes a trimethylguanosine synthase, plays a role in telomere protection.

    Science.gov (United States)

    Komonyi, Orban; Schauer, Tamas; Papai, Gabor; Deak, Peter; Boros, Imre M

    2009-03-15

    Although telomere formation occurs through a different mechanism in Drosophila compared with other organisms, telomere associations result from mutations in homologous genes, indicating the involvement of similar pathways in chromosome end protection. We report here that mutations of the Drosophila melanogaster gene CG31241 lead to high frequency chromosome end fusions. CG31241 is a bicistronic gene that encodes trimethylguanosine synthase (TGS1), which forms the m3G caps of noncoding small RNAs, and a novel protein, DTL. We show that although TGS1 has no role in telomere protection, DTL is localized at specific sites, including the ends of polytene chromosomes, and its loss results in telomere associations. Mutations of ATM- and Rad3-related (ATR) kinase suppress telomere fusions in the absence of DTL. Thus, genetic interactions place DTL in an ATR-related pathway in telomere protection. In contrast to ATR kinase, mutations of ATM (ataxia telangiectasia mutated) kinase, which acts in a partially overlapping pathway of telomere protection, do not suppress formation of telomere associations in the absence of DTL. Thus, uncovering the role of DTL will help to dissect the evolutionary conserved pathway(s) controlling ATM-ATR-related telomere protection.

  5. Genome mining of the sordarin biosynthetic gene cluster from Sordaria araneosa Cain ATCC 36386: characterization of cycloaraneosene synthase and GDP-6-deoxyaltrose transferase.

    Science.gov (United States)

    Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi

    2016-07-01

    Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.

  6. Anti-EGFR immunonanoparticles containing IL12 and salmosin genes for targeted cancer gene therapy.

    Science.gov (United States)

    Kim, Jung Seok; Kang, Seong Jae; Jeong, Hwa Yeon; Kim, Min Woo; Park, Sang Il; Lee, Yeon Kyung; Kim, Hong Sung; Kim, Keun Sik; Park, Yong Serk

    2016-09-01

    Tumor-directed gene delivery is of major interest in the field of cancer gene therapy. Varied functionalizations of non-viral vectors have been suggested to enhance tumor targetability. In the present study, we prepared two different types of anti-EGF receptor (EGFR) immunonanoparticles containing pDNA, neutrally charged liposomes and cationic lipoplexes, for tumor-directed transfection of cancer therapeutic genes. Even though both anti-EGFR immunonanoparticles had a high binding affinity to the EGFR-positive cancer cells, the anti-EGFR immunolipoplex formulation exhibited approximately 100-fold higher transfection to the target cells than anti-EGFR immunoliposomes. The lipoplex formulation also showed a higher transfection to SK-OV-3 tumor xenografts in mice. Thus, IL12 and/or salmosin genes were loaded in the anti-EGFR immunolipoplexes and intravenously administered to mice carrying SK-OV-3 tumors. Co-transfection of IL12 and salmosin genes using anti-EGFR immunolipoplexes significantly reduced tumor growth and pulmonary metastasis. Furthermore, combinatorial treatment with doxorubicin synergistically inhibited tumor growth. These results suggest that anti-EGFR immunolipoplexes containing pDNA encoding therapeutic genes could be utilized as a gene-transfer modality for cancer gene therapy.

  7. Advances in gene therapy of myocardial ischemia and the monitoring with molecular imaging

    International Nuclear Information System (INIS)

    Zhang Guopeng; Zhang Yongxue

    2008-01-01

    Cardiovascular diseases are harmful for people. Recent advances in understanding the molecular basis of cardiovascular diseases, together with some studies of the gene therapy on cardiovascular disorders, have offered possibilities for new treatments. Gene therapies have demonstrated potential usefulness in treating myocardial ischemia. Therefore, the monitoring of the expression of therapy gene and therapeutic efficacy has become an important issue. (authors)

  8. 75 FR 54351 - Cell and Gene Therapy Clinical Trials in Pediatric Populations; Public Workshop

    Science.gov (United States)

    2010-09-07

    ...] Cell and Gene Therapy Clinical Trials in Pediatric Populations; Public Workshop AGENCY: Food and Drug... Biologics Evaluation and Research (CBER) is announcing a public workshop entitled ``Cell and Gene Therapy... Institutional Review Boards (IRBs), gene and cellular therapy clinical researchers, and other stakeholders...

  9. 76 FR 9028 - Guidance for Industry: Potency Tests for Cellular and Gene Therapy Products; Availability

    Science.gov (United States)

    2011-02-16

    ...] Guidance for Industry: Potency Tests for Cellular and Gene Therapy Products; Availability AGENCY: Food and... Therapy Products'' dated January 2011. The guidance document provides manufacturers of cellular and gene... for Industry: Potency Tests for Cellular and Gene Therapy Products'' dated January 2011. The guidance...

  10. 78 FR 44133 - Cellular, Tissue and Gene Therapies Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2013-07-23

    ...] Cellular, Tissue and Gene Therapies Advisory Committee; Notice of Meeting AGENCY: Food and Drug...: Cellular, Tissue and Gene Therapies Advisory Committee. General Function of the Committee: To provide... documents issued from the Office of Cellular, Tissue and Gene Therapies, Center for Biologics Evaluation and...

  11. 76 FR 22405 - Cellular, Tissue and Gene Therapies Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2011-04-21

    ...] Cellular, Tissue and Gene Therapies Advisory Committee; Notice of Meeting AGENCY: Food and Drug...: Cellular, Tissue and Gene Therapies Advisory Committee. General Function of the Committee: To provide... June 29, 2011, the committee will discuss cellular and gene therapy products for the treatment of...

  12. 78 FR 70307 - Guidance for Industry: Preclinical Assessment of Investigational Cellular and Gene Therapy...

    Science.gov (United States)

    2013-11-25

    ...] Guidance for Industry: Preclinical Assessment of Investigational Cellular and Gene Therapy Products... Assessment of Investigational Cellular and Gene Therapy Products'' dated November 2013. The guidance document... products reviewed by the Office of Cellular, Tissue and Gene Therapies (OCTGT). The product areas covered...

  13. 77 FR 65693 - Cellular, Tissue and Gene Therapies Advisory Committee; Amendment of Notice

    Science.gov (United States)

    2012-10-30

    ...] Cellular, Tissue and Gene Therapies Advisory Committee; Amendment of Notice AGENCY: Food and Drug... notice of a meeting of the Cellular, Tissue and Gene Therapies Advisory Committee. This meeting was... announced that a meeting of the Cellular, Tissue and Gene Therapies Advisory Committee would be held on...

  14. 78 FR 79699 - Cellular, Tissue, and Gene Therapies Advisory Committee; Notice of Meeting

    Science.gov (United States)

    2013-12-31

    ...] Cellular, Tissue, and Gene Therapies Advisory Committee; Notice of Meeting AGENCY: Food and Drug...: Cellular, Tissue, and Gene Therapies Advisory Committee. General Function of the Committee: To provide... updates on guidance documents issued from the Office of Cellular, Tissue, and Gene Therapies, Center for...

  15. Cloning and Characterization of a Flavonol Synthase Gene From Litchi chinensis and Its Variation Among Litchi Cultivars With Different Fruit Maturation Periods

    Directory of Open Access Journals (Sweden)

    Wei Liu

    2018-04-01

    Full Text Available Litchi (Litchi chinensis is an important subtropical fruit tree with high commercial value. However, the short and centralized fruit maturation period of litchi cultivars represents a bottleneck for litchi production. Therefore, the development of novel cultivars with extremely early fruit maturation period is critical. Previously, we showed that the genotypes of extremely early-maturing (EEM, early-maturing (EM, and middle-to-late-maturing (MLM cultivars at a specific locus SNP51 (substitution type C/T were consistent with their respective genetic background at the whole-genome level; a homozygous C/C genotype at SNP51 systematically differentiated EEM cultivars from others. The litchi gene on which SNP51 was located was annotated as flavonol synthase (FLS, which catalyzes the formation of flavonols. Here, we further elucidate the variation of the FLS gene from L. chinensis (LcFLS among EEM, EM, and MLM cultivars. EEM cultivars with a homozygous C/C genotype at SNP51 all contained the same 2,199-bp sequence of the LcFLS gene. For MLM cultivars with a homozygous T/T genotype at SNP51, the sequence lengths of the LcFLS gene were 2,202–2,222 bp. EM cultivars with heterozygous C/T genotypes at SNP51 contained two different alleles of the LcFLS gene: a 2,199-bp sequence identical to that in EEM cultivars and a 2,205-bp sequence identical to that in MLM cultivar ‘Heiye.’ Moreover, the coding regions of LcFLS genes of other MLM cultivars were almost identical to that of ‘Heiye.’ Therefore, the LcFLS gene coding region may be used as a source of diagnostic SNP markers to discriminate or identify genotypes with the EEM trait. The expression pattern of the LcFLS gene and accumulation pattern of flavonol from EEM, EM, and MLM cultivars were analyzed and compared using quantitative real-time PCR (qRT-PCR and high-performance liquid chromatography (HPLC for mature leaves, flower buds, and fruits, 15, 30, 45, and 60 days after anthesis. Flavonol

  16. Lentiviral hematopoietic cell gene therapy for X-linked adrenoleukodystrophy.

    Science.gov (United States)

    Cartier, Nathalie; Hacein-Bey-Abina, Salima; Bartholomae, Cynthia C; Bougnères, Pierre; Schmidt, Manfred; Kalle, Christof Von; Fischer, Alain; Cavazzana-Calvo, Marina; Aubourg, Patrick

    2012-01-01

    X-linked adrenoleukodystrophy (X-ALD) is a severe genetic demyelinating disease caused by a deficiency in ALD protein, an adenosine triphosphate-binding cassette transporter encoded by the ABCD1 gene. When performed at an early stage of the disease, allogeneic hematopoietic stem cell transplantation (HCT) can arrest the progression of cerebral demyelinating lesions. To overcome the limitations of allogeneic HCT, hematopoietic stem cell (HSC) gene therapy strategy aiming to perform autologous transplantation of lentivirally corrected cells was developed. We demonstrated the preclinical feasibility of HSC gene therapy for ALD based on the correction of CD34+ cells from X-ALD patients using an HIV1-derived lentiviral vector. These results prompted us to initiate an HSC gene therapy trial in two X-ALD patients who had developed progressive cerebral demyelination, were candidates for allogeneic HCT, but had no HLA-matched donors or cord blood. Autologous CD34+ cells were purified from the peripheral blood after G-CSF stimulation, genetically corrected ex vivo with a lentiviral vector encoding wild-type ABCD1 cDNA, and then reinfused into the patients after they had received full myeloablative conditioning. Over 3 years of follow-up, the hematopoiesis remained polyclonal in the two patients treated with 7-14% of granulocytes, monocytes, and T and B lymphocytes expressing the lentivirally encoded ALD protein. There was no evidence of clonal dominance or skewing based on the retrieval of lentiviral insertion repertoire in different hematopoietic lineages by deep sequencing. Cerebral demyelination was arrested 14 and 16months, respectively, in the two treated patients, without further progression up to the last follow-up, a clinical outcome that is comparable to that observed after allogeneic HCT. Longer follow-up of these two treated patients and HSC gene therapy performed in additional ALD patients are however needed to evaluate the safety and efficacy of lentiviral HSC

  17. Gene expression profiles in cervical cancer with radiation therapy alone and chemo-radiation therapy

    International Nuclear Information System (INIS)

    Lee, Kyu Chan; Kim, Joo Young; Hwang, You Jin; Kim, Meyoung Kon; Choi, Myung Sun; Kim, Chul Young

    2003-01-01

    To analyze the gene expression profiles of uterine cervical cancer, and its variation after radiation therapy, with or without concurrent chemotherapy, using a cDNA microarray. Sixteen patients, 8 with squamous cell carcinomas of the uterine cervix, who were treated with radiation alone, and the other 8 treated with concurrent chemo-radiation, were included in the study. Before the starting of the treatment, tumor biopsies were carried out, and the second time biopsies were performed after a radiation dose of 16.2-27 Gy. Three normal cervix tissues were used as a control group. The microarray experiments were performed with 5 groups of the total RNAs extracted individually and then admixed as control, pre-radiation therapy alone, during-radiation therapy alone, pre-chemoradiation therapy, and during chemoradiation therapy. The 33P-labeled cDNAs were synthesized from the total RNAs of each group, by reverse transcription, and then they were hybridized to the cDNA microarray membrane. The gene expression of each microarrays was captured by the intensity of each spot produced by the radioactive isotopes. The pixels per spot were counted with an Arrayguage, and were exported to Microsoft Excel. The data were normalized by the Z transformation, and the comparisons were performed on the Z-ratio values calculated. The expressions of 15 genes, including integrin linked kinase (ILK), CDC28 protein kinase 2, Spry 2, and ERK 3, were increased with the Z-ratio values of over 2.0 for the cervix cancer tissues compared to those for the normal controls. Those genes were involved in cell growth and proliferation, cell cycle control, or signal transduction. The expressions of the other 6 genes, including G protein coupled receptor kinase 6, were decreased with the Z-ratio values of below -2.0. After the radiation therapy, most of the genes, with a previously increase expressions, represented the decreased expression profiles, and the genes, with the Z-ratio values of over 2.0, were

  18. Global Regulatory Differences for Gene- and Cell-Based Therapies

    DEFF Research Database (Denmark)

    Coppens, Delphi G M; De Bruin, Marie L; Leufkens, Hubert G M

    2017-01-01

    Gene- and cell-based therapies (GCTs) offer potential new treatment options for unmet medical needs. However, the use of conventional regulatory requirements for medicinal products to approve GCTs may impede patient access and therapeutic innovation. Furthermore, requirements differ between...... jurisdictions, complicating the global regulatory landscape. We provide a comparative overview of regulatory requirements for GCT approval in five jurisdictions and hypothesize on the consequences of the observed global differences on patient access and therapeutic innovation....

  19. The role of gene therapy. Fact or fiction?

    Science.gov (United States)

    Muzzonigro, T S; Ghivizzani, S C; Robbins, P D; Evans, C H

    1999-01-01

    Current research in molecular biology and genetics has dramatically advanced the understanding of the cellular events involved in homeostasis, disease, injury, and healing processes of the tissues of the musculoskeletal system. Recently, genetic predispositions to diseases have been described which offer novel means to address musculoskeletal disorders. Growth factors and cytokines have been identified as key elements in both the injured and healing states. Gene therapy offers an elegant solution to the delivery of therapeutic proteins to the site of disease or injury.

  20. Contemporary Animal Models For Human Gene Therapy Applications.

    Science.gov (United States)

    Gopinath, Chitra; Nathar, Trupti Job; Ghosh, Arkasubhra; Hickstein, Dennis Durand; Nelson, Everette Jacob Remington

    2015-01-01

    Over the past three decades, gene therapy has been making considerable progress as an alternative strategy in the treatment of many diseases. Since 2009, several studies have been reported in humans on the successful treatment of various diseases. Animal models mimicking human disease conditions are very essential at the preclinical stage before embarking on a clinical trial. In gene therapy, for instance, they are useful in the assessment of variables related to the use of viral vectors such as safety, efficacy, dosage and localization of transgene expression. However, choosing a suitable disease-specific model is of paramount importance for successful clinical translation. This review focuses on the animal models that are most commonly used in gene therapy studies, such as murine, canine, non-human primates, rabbits, porcine, and a more recently developed humanized mice. Though small and large animals both have their own pros and cons as disease-specific models, the choice is made largely based on the type and length of study performed. While small animals with a shorter life span could be well-suited for degenerative/aging studies, large animals with longer life span could suit longitudinal studies and also help with dosage adjustments to maximize therapeutic benefit. Recently, humanized mice or mouse-human chimaeras have gained interest in the study of human tissues or cells, thereby providing a more reliable understanding of therapeutic interventions. Thus, animal models are of great importance with regard to testing new vector technologies in vivo for assessing safety and efficacy prior to a gene therapy clinical trial.

  1. Synergistic gene and drug tumor therapy using a chimeric peptide.

    Science.gov (United States)

    Han, Kai; Chen, Si; Chen, Wei-Hai; Lei, Qi; Liu, Yun; Zhuo, Ren-Xi; Zhang, Xian-Zheng

    2013-06-01

    Co-delivery of gene and drug for synergistic therapy has provided a promising strategy to cure devastating diseases. Here, an amphiphilic chimeric peptide (Fmoc)2KH7-TAT with pH-responsibility for gene and drug delivery was designed and fabricated. As a drug carrier, the micelles self-assembled from the peptide exhibited a much faster doxorubicin (DOX) release rate at pH 5.0 than that at pH 7.4. As a non-viral gene vector, (Fmoc)(2)KH(7)-TAT peptide could satisfactorily mediate transfection of pGL-3 reporter plasmid with or without the existence of serum in both 293T and HeLa cell-lines. Besides, the endosome escape capability of peptide/DNA complexes was investigated by confocal laser scanning microscopy (CLSM). To evaluate the co-delivery efficiency and the synergistic anti-tumor effect of gene and drug, p53 plasmid and DOX were simultaneously loaded in the peptide micelles to form micelleplexes during the self-assembly of the peptide. Cellular uptake and intracellular delivery of gene and drug were studied by CLSM and flow cytometry respectively. And p53 protein expression was determined via Western blot analysis. The in vitro cytotoxicity and in vivo tumor inhibition effect were also studied. Results suggest that the co-delivery of gene and drug from peptide micelles resulted in effective cell growth inhibition in vitro and significant tumor growth restraining in vivo. The chimeric peptide-based gene and drug co-delivery system will find great potential for tumor therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Gene therapy for inherited retinal and optic nerve degenerations.

    Science.gov (United States)

    Moore, Nicholas A; Morral, Nuria; Ciulla, Thomas A; Bracha, Peter

    2018-01-01

    The eye is a target for investigational gene therapy due to the monogenic nature of many inherited retinal and optic nerve degenerations (IRD), its accessibility, tight blood-ocular barrier, the ability to non-invasively monitor for functional and anatomic outcomes, as well as its relative immune privileged state.Vectors currently used in IRD clinical trials include adeno-associated virus (AAV), small single-stranded DNA viruses, and lentivirus, RNA viruses of the retrovirus family. Both can transduce non-dividing cells, but AAV are non-integrating, while lentivirus integrate into the host cell genome, and have a larger transgene capacity. Areas covered: This review covers Leber's congenital amaurosis, choroideremia, retinitis pigmentosa, Usher syndrome, Stargardt disease, Leber's hereditary optic neuropathy, Achromatopsia, and X-linked retinoschisis. Expert opinion: Despite great potential, gene therapy for IRD raises many questions, including the potential for less invasive intravitreal versus subretinal delivery, efficacy, safety, and longevity of response, as well as acceptance of novel study endpoints by regulatory bodies, patients, clinicians, and payers. Also, ultimate adoption of gene therapy for IRD will require widespread genetic screening to identify and diagnose patients based on genotype instead of phenotype.

  3. Tandemly arranged chalcone synthase A genes contribute to the spatially regulated expression of siRNA and the natural bicolor floral phenotype in Petunia hybrida.

    Science.gov (United States)

    Morita, Yasumasa; Saito, Ryoko; Ban, Yusuke; Tanikawa, Natsu; Kuchitsu, Kazuyuki; Ando, Toshio; Yoshikawa, Manabu; Habu, Yoshiki; Ozeki, Yoshihiro; Nakayama, Masayoshi

    2012-06-01

    The natural bicolor floral traits of the horticultural petunia (Petunia hybrida) cultivars Picotee and Star are caused by the spatial repression of the chalcone synthase A (CHS-A) gene, which encodes an anthocyanin biosynthetic enzyme. Here we show that Picotee and Star petunias carry the same short interfering RNA (siRNA)-producing locus, consisting of two intact CHS-A copies, PhCHS-A1 and PhCHS-A2, in a tandem head-to-tail orientation. The precursor CHS mRNAs are transcribed from the two CHS-A copies throughout the bicolored petals, but the mature CHS mRNAs are not found in the white tissues. An analysis of small RNAs revealed the accumulation of siRNAs of 21 nucleotides that originated from the exon 2 region of both CHS-A copies. This accumulation is closely correlated with the disappearance of the CHS mRNAs, indicating that the bicolor floral phenotype is caused by the spatially regulated post-transcriptional silencing of both CHS-A genes. Linkage between the tandemly arranged CHS-A allele and the bicolor floral trait indicates that the CHS-A allele is a necessary factor to confer the trait. We suppose that the spatially regulated production of siRNAs in Picotee and Star flowers is triggered by another putative regulatory locus, and that the silencing mechanism in this case may be different from other known mechanisms of post-transcriptional gene silencing in plants. A sequence analysis of wild Petunia species indicated that these tandem CHS-A genes originated from Petunia integrifolia and/or Petunia inflata, the parental species of P. hybrida, as a result of a chromosomal rearrangement rather than a gene duplication event. © 2012 T