DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek
2008-01-01
A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...
Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster
Robertson, Hugh M.; Warr, Coral G.; Carlson, John R.
2003-01-01
The insect chemoreceptor superfamily in Drosophila melanogaster is predicted to consist of 62 odorant receptor (Or) and 68 gustatory receptor (Gr) proteins, encoded by families of 60 Or and 60 Gr genes through alternative splicing. We include two previously undescribed Or genes and two previously undescribed Gr genes; two previously predicted Or genes are shown to be alternative splice forms. Three polymorphic pseudogenes and one highly defective pseudogene are recognized. Phylogenetic analysis reveals deep branches connecting multiple highly divergent clades within the Gr family, and the Or family appears to be a single highly expanded lineage within the superfamily. The genes are spread throughout the Drosophila genome, with some relatively recently diverged genes still clustered in the genome. The Gr5a gene on the X chromosome, which encodes a receptor for the sugar trehalose, has transposed from one such tandem cluster of six genes at cytological location 64, as has Gr61a, and all eight of these receptors might bind sugars. Analysis of intron evolution suggests that the common ancestor consisted of a long N-terminal exon encoding transmembrane domains 1-5 followed by three exons encoding transmembrane domains 6-7. As many as 57 additional introns have been acquired idiosyncratically during the evolution of the superfamily, whereas the ancestral introns and some of the older idiosyncratic introns have been lost at least 48 times independently. Altogether, these patterns of molecular evolution suggest that this is an ancient superfamily of chemoreceptors, probably dating back at least to the origin of the arthropods. PMID:14608037
Directory of Open Access Journals (Sweden)
Raghunath Satpathy
2015-01-01
Full Text Available Context: Paracoccidioides brasiliensis, a dimorphic fungus is the causative agent of paracoccidioidomycosis, a disease globally affecting millions of people. The haloacid dehalogenase (HAD superfamily hydrolases enzyme in the fungi, in particular, is known to be responsible in the pathogenesis by adhering to the tissue. Hence, identification of novel drug targets is essential. Aims: In-silico based identification of co-expressed genes along with HAD superfamily hydrolase in P. brasiliensis during the morphogenesis from mycelium to yeast to identify possible genes as drug targets. Materials and Methods: In total, four datasets were retrieved from the NCBI-gene expression omnibus (GEO database, each containing 4340 genes, followed by gene filtration expression of the data set. Further co-expression (CE study was performed individually and then a combination these genes were visualized in the Cytoscape 2. 8.3. Statistical Analysis Used: Mean and standard deviation value of the HAD superfamily hydrolase gene was obtained from the expression data and this value was subsequently used for the CE calculation purpose by selecting specific correlation power and filtering threshold. Results: The 23 genes that were thus obtained are common with respect to the HAD superfamily hydrolase gene. A significant network was selected from the Cytoscape network visualization that contains total 7 genes out of which 5 genes, which do not have significant protein hits, obtained from gene annotation of the expressed sequence tags by BLAST X. For all the protein PSI-BLAST was performed against human genome to find the homology. Conclusions: The gene co-expression network was obtained with respect to HAD superfamily dehalogenase gene in P. Brasiliensis.
Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun
2015-01-01
Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Directory of Open Access Journals (Sweden)
Feng-Xia Tian
Full Text Available Aldehyde dehydrogenases (ALDHs constitute a superfamily of NAD(P+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Directory of Open Access Journals (Sweden)
Yating Dong
Full Text Available Aldehyde dehydrogenases (ALDHs are a superfamily of enzymes which play important role in the scavenging of active aldehydes molecules. In present work, a comprehensive whole-genomic study of ALDH gene superfamily was carried out for an allotetraploid cultivated cotton species, G. hirsutum, as well as in parallel relative to their diploid progenitors, G. arboreum and G. raimondii. Totally, 30 and 58 ALDH gene sequences belong to 10 families were identified from diploid and allotetraploid cotton species, respectively. The gene structures among the members from same families were highly conserved. Whole-genome duplication and segmental duplication might be the major driver for the expansion of ALDH gene superfamily in G. hirsutum. In addition, the expression patterns of GhALDH genes were diverse across tissues. Most GhALDH genes were induced or repressed by salt stress in upland cotton. Our observation shed lights on the molecular evolutionary properties of ALDH genes in diploid cottons and their alloallotetraploid derivatives. It may be useful to mine key genes for improvement of cotton response to salt stress.
Zarzycki, Jan; Kerfeld, Cheryl A
2013-11-09
Malyl-CoA lyase (MCL) is a promiscuous carbon-carbon bond lyase that catalyzes the reversible cleavage of structurally related Coenzyme A (CoA) thioesters. This enzyme plays a crucial, multifunctional role in the 3-hydroxypropionate bi-cycle for autotrophic CO2 fixation in Chloroflexus aurantiacus. A second, phylogenetically distinct MCL from Rhodobacter sphaeroides is involved in the ethylmalonyl-CoA pathway for acetate assimilation. Both MCLs belong to the large superfamily of CitE-like enzymes, which includes the name-giving β-subunit of citrate lyase (CitE), malyl-CoA thioesterases and other enzymes of unknown physiological function. The CitE-like enzyme superfamily also bears sequence and structural resemblance to the malate synthases. All of these different enzymes share highly conserved catalytic residues, although they catalyze distinctly different reactions: C-C bond formation and cleavage, thioester hydrolysis, or both (the malate synthases). Here we report the first crystal structures of MCLs from two different phylogenetic subgroups in apo- and substrate-bound forms. Both the C. aurantiacus and the R. sphaeroides MCL contain elaborations on the canonical β8/α8 TIM barrel fold and form hexameric assemblies. Upon ligand binding, changes in the C-terminal domains of the MCLs result in closing of the active site, with the C-terminal domain of one monomer forming a lid over and contributing side chains to the active site of the adjacent monomer. The distinctive features of the two MCL subgroups were compared to known structures of other CitE-like superfamily enzymes and to malate synthases, providing insight into the structural subtleties that underlie the functional versatility of these enzymes. Although the C. aurantiacus and the R. sphaeroides MCLs have divergent primary structures (~37% identical), their tertiary and quaternary structures are very similar. It can be assumed that the C-C bond formation catalyzed by the MCLs occurs as proposed for
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Burchell, B.; Nebert, D. W.; Nelson, D. R.; Bock, K. W.; Iyanagi, T.; Jansen, P. L.; Lancet, D.; Mulder, G. J.; Chowdhury, J. R.; Siest, G.
1991-01-01
A nomenclature system for the UDP glucuronosyltransferase superfamily is proposed, based on divergent evolution of the genes. A total of 26 distinct cDNAs in five mammalian species have been sequenced to date. Comparison of the deduced amino acid sequences leads to the definition of two families and
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Directory of Open Access Journals (Sweden)
Silvia Dal Santo
Full Text Available BACKGROUND: Expansins are proteins that loosen plant cell walls in a pH-dependent manner, probably by increasing the relative movement among polymers thus causing irreversible expansion. The expansin superfamily (EXP comprises four distinct families: expansin A (EXPA, expansin B (EXPB, expansin-like A (EXLA and expansin-like B (EXLB. There is experimental evidence that EXPA and EXPB proteins are required for cell expansion and developmental processes involving cell wall modification, whereas the exact functions of EXLA and EXLB remain unclear. The complete grapevine (Vitis vinifera genome sequence has allowed the characterization of many gene families, but an exhaustive genome-wide analysis of expansin gene expression has not been attempted thus far. METHODOLOGY/PRINCIPAL FINDINGS: We identified 29 EXP superfamily genes in the grapevine genome, representing all four EXP families. Members of the same EXP family shared the same exon-intron structure, and phylogenetic analysis confirmed a closer relationship between EXP genes from woody species, i.e. grapevine and poplar (Populus trichocarpa, compared to those from Arabidopsis thaliana and rice (Oryza sativa. We also identified grapevine-specific duplication events involving the EXLB family. Global gene expression analysis confirmed a strong correlation among EXP genes expressed in mature and green/vegetative samples, respectively, as reported for other gene families in the recently-published grapevine gene expression atlas. We also observed the specific co-expression of EXLB genes in woody organs, and the involvement of certain grapevine EXP genes in berry development and post-harvest withering. CONCLUSION: Our comprehensive analysis of the grapevine EXP superfamily confirmed and extended current knowledge about the structural and functional characteristics of this gene family, and also identified properties that are currently unique to grapevine expansin genes. Our data provide a model for the
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Directory of Open Access Journals (Sweden)
Shi-Min Yuan
2018-04-01
Full Text Available Pulmonary artery hypertension (PAH is very rare in childhood, and it can be divided into heritable, idiopathic drug- and toxin-induced and other disease (connective tissue disease, human immunodeficiency virus infection, portal hypertension, congenital heart disease, or schistosomiasis-associated types. PAH could not be interpreted solely by pathophysiological theories. The impact of the transforming growth factor-β superfamily-related genes on the development of PAH in children remains to be clarified. Pertinent literature on the transforming growth factor-β superfamily-related genes in relation to PAH in children published after the year 2000 was reviewed and analyzed. Bone morphogenetic protein receptor type II gene mutation promotes cell division or prevents cell death, resulting in an overgrowth of cells in small arteries throughout the lungs. About 20% of individuals with a bone morphogenetic protein receptor type II gene mutation develop symptomatic PAH. In heritable PAH, bone morphogenetic protein receptor type II mutations may be absent; while mutations of other genes, such as type I receptor activin receptor-like kinase 1 and the type III receptor endoglin (both associated with hereditary hemorrhagic telangiectasia, caveolin-1 and KCNK3, the gene encoding potassium channel subfamily K, member 3, can be detected, instead. Gene mutations, environmental changes and acquired adjustment, etc. may explain the development of PAH. The researches on PAH rat model and familial PAH members may facilitate the elucidations of the mechanisms and further provide theories for prophylaxis and treatment of PAH. Key Words: bone morphogenetic proteins, mutation, pulmonary hypertension
Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Linhard, Verena; Fritzsch, Günter; Zhang, Bin; Michel, Hartmut; Stöckigt, Joachim
2004-09-01
Crystals of vinorine synthase (VS) from medicinal plant Rauvolfia serpentina expressed in Escherichia coli have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. The enzyme is involved in the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure of a member of this enzyme family is known. The crystals belong to the space group P2(1)2(1)2(1) with cell dimensions of a=82.3 A, b=89.6 A and c=136.2 A. Under cryoconditions (120 K), a complete data set up to 2.8 A was collected at a synchrotron source.
Directory of Open Access Journals (Sweden)
Antoinesha L. Hollman
2016-03-01
Full Text Available Exposure to environmental hazards has been associated with diseases in humans. The identification of single nucleotide polymorphisms (SNPs in human populations exposed to different environmental hazards, is vital for detecting the genetic risks of some important human diseases. Several studies in this field have been conducted on glutathione S-transferases (GSTs, a phase II detoxification superfamily, to investigate its role in the occurrence of diseases. Human GSTs consist of cytosolic and microsomal superfamilies that are further divided into subfamilies. Based on scientific search engines and a review of the literature, we have found a large amount of published articles on human GST super- and subfamilies that have greatly assisted in our efforts to examine their role in health and disease. Because of its polymorphic variations in relation to environmental hazards such as air pollutants, cigarette smoke, pesticides, heavy metals, carcinogens, pharmaceutical drugs, and xenobiotics, GST is considered as a significant biomarker. This review examines the studies on gene-environment interactions related to various diseases with respect to single nucleotide polymorphisms (SNPs found in the GST superfamily. Overall, it can be concluded that interactions between GST genes and environmental factors play an important role in human diseases.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
Carmona-Antoñanzas, Greta; Carmichael, Stephen N; Heumann, Jan; Taggart, John B; Gharbi, Karim; Bron, James E; Bekaert, Michaël; Sturm, Armin
2015-01-01
Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Two differentially regulated Arabidopsis genes define a new branch of the DFR superfamily
DEFF Research Database (Denmark)
Østergaard, L; Lauvergeat, V; Naested, H
2001-01-01
that, whereas high expression of AtCRL1 in mature seeds declines during subsequent vegetative growth, transcriptional activity from the AtCRL2 promoter increases during vegetative growth. Expression of both genes is restricted to vascular tissue. Based upon their homology to proteins involved in lignin......Two tandem genes were identified on Arabidopsis chromosome II (AtCRL1 and AtCRL2) encoding proteins with homology to members of the dihydroflavonol-4-reductase (DFR) superfamily. The encoded CRL1 and CRL2 proteins share 87% mutual amino acid sequence identity whereas their promoter regions...
PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila
International Nuclear Information System (INIS)
Enan, M. R.; Bashandy, S.A.
2006-01-01
Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)
Liu, Mu; Liu, Jun; Wang, Wei Min
2012-10-01
A novel major facilitator superfamily (MFS) transporter gene, Thmfs1, was isolated from Trichoderma harzianum (T. harzianum). A Thmfs1 over-expressing mutant displayed enhanced antifungal activity and fungicide tolerance, while the Thmfs1 disruption mutant showed the opposite trend. Trichodermin production in Thmfs1 disruption group (185 mg l(-1)) was decreased by less than 17 % compared to the parental strain, suggesting that Thmfs1 is not mainly responsible for trichodermin secretion. Real-time PCR showed that Thmfs1 transcript level could be induced by a certain range of trichodermin concentrations, while expression of Tri5, encoding a trichodiene synthase, was strongly inhibited under these conditions. To our knowledge, Thmfs1 is the first MFS transporter gene identified in T. harzianum.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance
DEFF Research Database (Denmark)
Huang, Laurence; Crothers, Kristina; Atzori, Chiara
2004-01-01
in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...
Pineda, Sandy S; Sollod, Brianna L; Wilson, David; Darling, Aaron; Sunagar, Kartik; Undheim, Eivind A B; Kely, Laurence; Antunes, Agostinho; Fry, Bryan G; King, Glenn F
2014-03-05
Spiders have evolved pharmacologically complex venoms that serve to rapidly subdue prey and deter predators. The major toxic factors in most spider venoms are small, disulfide-rich peptides. While there is abundant evidence that snake venoms evolved by recruitment of genes encoding normal body proteins followed by extensive gene duplication accompanied by explosive structural and functional diversification, the evolutionary trajectory of spider-venom peptides is less clear. Here we present evidence of a spider-toxin superfamily encoding a high degree of sequence and functional diversity that has evolved via accelerated duplication and diversification of a single ancestral gene. The peptides within this toxin superfamily are translated as prepropeptides that are posttranslationally processed to yield the mature toxin. The N-terminal signal sequence, as well as the protease recognition site at the junction of the propeptide and mature toxin are conserved, whereas the remainder of the propeptide and mature toxin sequences are variable. All toxin transcripts within this superfamily exhibit a striking cysteine codon bias. We show that different pharmacological classes of toxins within this peptide superfamily evolved under different evolutionary selection pressures. Overall, this study reinforces the hypothesis that spiders use a combinatorial peptide library strategy to evolve a complex cocktail of peptide toxins that target neuronal receptors and ion channels in prey and predators. We show that the ω-hexatoxins that target insect voltage-gated calcium channels evolved under the influence of positive Darwinian selection in an episodic fashion, whereas the κ-hexatoxins that target insect calcium-activated potassium channels appear to be under negative selection. A majority of the diversifying sites in the ω-hexatoxins are concentrated on the molecular surface of the toxins, thereby facilitating neofunctionalisation leading to new toxin pharmacology.
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T
2017-01-01
Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Hwang, Dae-Sik; Lee, Bo-Young; Kim, Hui-Su; Lee, Min Chul; Kyung, Do-Hyun; Om, Ae-Son; Rhee, Jae-Sung; Lee, Jae-Seong
2014-11-18
Nuclear receptors (NRs) are a large superfamily of proteins defined by a DNA-binding domain (DBD) and a ligand-binding domain (LBD). They function as transcriptional regulators to control expression of genes involved in development, homeostasis, and metabolism. The number of NRs differs from species to species, because of gene duplications and/or lineage-specific gene losses during metazoan evolution. Many NRs in arthropods interact with the ecdysteroid hormone and are involved in ecdysone-mediated signaling in arthropods. The nuclear receptor superfamily complement has been reported in several arthropods, including crustaceans, but not in copepods. We identified the entire NR repertoire of the copepod Tigriopus japonicus, which is an important marine model species for ecotoxicology and environmental genomics. Using whole genome and transcriptome sequences, we identified a total of 31 nuclear receptors in the genome of T. japonicus. Nomenclature of the nuclear receptors was determined based on the sequence similarities of the DNA-binding domain (DBD) and ligand-binding domain (LBD). The 7 subfamilies of NRs separate into five major clades (subfamilies NR1, NR2, NR3, NR4, and NR5/6). Although the repertoire of NR members in, T. japonicus was similar to that reported for other arthropods, there was an expansion of the NR1 subfamily in Tigriopus japonicus. The twelve unique nuclear receptors identified in T. japonicus are members of NR1L. This expansion may be a unique lineage-specific feature of crustaceans. Interestingly, E78 and HR83, which are present in other arthropods, were absent from the genomes of T. japonicus and two congeneric copepod species (T. japonicus and Tigriopus californicus), suggesting copepod lineage-specific gene loss. We identified all NR receptors present in the copepod, T. japonicus. Knowledge of the copepod nuclear receptor repertoire will contribute to a better understanding of copepod- and crustacean-specific NR evolution.
Directory of Open Access Journals (Sweden)
Bettinotti Maria
2004-03-01
Full Text Available Abstract Genes in the Leukocyte Antigen 6 (Ly-6 superfamily encode glycosyl-phosphatidylinositol (GPI anchored glycoproteins (gp with conserved domains of 70 to 100 amino acids and 8 to 10 cysteine residues. Murine Ly-6 genes encode important lymphocyte and hematopoietic stem cell antigens. Recently, a new member of the human Ly-6 gene superfamily has been described, CD177. CD177 is polymorphic and has at least two alleles, PRV-1 and NB1. CD177 was first described as PRV-1, a gene that is overexpressed in neutrophils from approximately 95% of patients with polycythemia vera and from about half of patients with essential thrombocythemia. CD177 encodes NB1 gp, a 58–64 kD GPI gp that is expressed by neutrophils and neutrophil precursors. NB1 gp carries Human Neutrophil Antigen (HNA-2a. Investigators working to identify the gene encoding NB1 gp called the CD177 allele they described NB1. NB1 gp is unusual in that neutrophils from some healthy people lack the NB1 gp completely and in most people NB1 gp is expressed by a subpopulation of neutrophils. The function of NB1 gp and the role of CD177 in the pathogenesis and clinical course of polycythemia vera and essential thrombocythemia are not yet known. However, measuring neutrophil CD177 mRNA levels has become an important marker for diagnosing the myeloproliferative disorders polycythemia vera and essential thrombocythemia.
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Nitric oxide synthase gene G298 allele
International Nuclear Information System (INIS)
Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar
2004-01-01
Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
Directory of Open Access Journals (Sweden)
Ying Liu
2016-01-01
Full Text Available Expansins are important components of plant cell walls, which are involved in the process of cell wall loosening under low extracellular pH. By using a combinational method for homology search and protein domain analysis, a total of 42 expansin genes were identified from Medicago truncatula genome in this study. They were divided into four families, based on sequence alignment and phylogenetic analysis. Gene duplication events were identified in the expansins superfamily, especially in the extension of α-expansin family. By analysis of RNA-sequencing data from National Center for Biotechnology Information, the expansin (EXP genes expressed during tissues development were characterized. Meanwhile, lots of cis-acting regulatory DNA elements in the EXP superfamily were identified, which were mainly related to plant growth and development processes. The results presented in this study are expected to facilitate further research works on this gene superfamily and provide new insights about the molecular mechanisms of expansins in M. truncatula.
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Inference of functional properties from large-scale analysis of enzyme superfamilies.
Brown, Shoshana D; Babbitt, Patricia C
2012-01-02
As increasingly large amounts of data from genome and other sequencing projects become available, new approaches are needed to determine the functions of the proteins these genes encode. We show how large-scale computational analysis can help to address this challenge by linking functional information to sequence and structural similarities using protein similarity networks. Network analyses using three functionally diverse enzyme superfamilies illustrate the use of these approaches for facile updating and comparison of available structures for a large superfamily, for creation of functional hypotheses for metagenomic sequences, and to summarize the limits of our functional knowledge about even well studied superfamilies.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Inference of Functional Properties from Large-scale Analysis of Enzyme Superfamilies*
Brown, Shoshana D.; Babbitt, Patricia C.
2012-01-01
As increasingly large amounts of data from genome and other sequencing projects become available, new approaches are needed to determine the functions of the proteins these genes encode. We show how large-scale computational analysis can help to address this challenge by linking functional information to sequence and structural similarities using protein similarity networks. Network analyses using three functionally diverse enzyme superfamilies illustrate the use of these approaches for facile updating and comparison of available structures for a large superfamily, for creation of functional hypotheses for metagenomic sequences, and to summarize the limits of our functional knowledge about even well studied superfamilies. PMID:22069325
Directory of Open Access Journals (Sweden)
Harshavardhanan Vijayakumar
2016-07-01
Full Text Available Plants, as sessile organisms, can suffer serious growth and developmental consequences under cold stress conditions. Glutathione transferases (GSTs, EC 2.5.1.18 are ubiquitous and multifunctional conjugating proteins, which play a major role in stress responses by preventing oxidative damage by reactive oxygen species (ROS. Currently, understanding of their function(s during different biochemical and signaling pathways under cold stress condition remain unclear. In this study, using combined computational strategy, we identified 65 Brassica oleracea glutathione transferases (BoGST and characterized them based on evolutionary analysis into 11 classes. Inter-species and intra-species duplication was evident between BoGSTs and Arabidopsis GSTs. Based on localization analyses, we propose possible pathways in which GST genes are involved during cold stress. Further, expression analysis of the predicted putative functions for GST genes were investigated in two cold contrasting genotypes (cold tolerance and susceptible under cold condition, most of these genes were highly expressed at 6 h and 1 h in the cold tolerant (CT and cold susceptible (CS lines, respectively. Overall, BoGSTU19, BoGSTU24, BoGSTF10 are candidate genes highly expressed in B. oleracea. Further investigation of GST superfamily in B. oleracea will aid in understanding complex mechanism underlying cold tolerance in plants.
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Cloning and characterization of ATP synthase CF1 α gene from ...
African Journals Online (AJOL)
ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...
Anantharaman, Vivek; Aravind, L
2003-01-01
Peptidoglycan is hydrolyzed by a diverse set of enzymes during bacterial growth, development and cell division. The N1pC/P60 proteins define a family of cell-wall peptidases that are widely represented in various bacterial lineages. Currently characterized members are known to hydrolyze D-gamma-glutamyl-meso-diaminopimelate or N-acetylmuramate-L-alanine linkages. Detailed analysis of the N1pC/P60 peptidases showed that these proteins define a large superfamily encompassing several diverse groups of proteins. In addition to the well characterized P60-like proteins, this superfamily includes the AcmB/LytN and YaeF/YiiX families of bacterial proteins, the amidase domain of bacterial and kinetoplastid glutathionylspermidine synthases (GSPSs), and several proteins from eukaryotes, phages, poxviruses, positive-strand RNA viruses, and certain archaea. The eukaryotic members include lecithin retinol acyltransferase (LRAT), nematode developmental regulator Egl-26, and candidate tumor suppressor H-rev107. These eukaryotic proteins, along with the bacterial YaeF/poxviral G6R family, show a circular permutation of the catalytic domain. We identified three conserved residues, namely a cysteine, a histidine and a polar residue, that are involved in the catalytic activities of this superfamily. Evolutionary analysis of this superfamily shows that it comprises four major families, with diverse domain architectures in each of them. Several related, but distinct, catalytic activities, such as murein degradation, acyl transfer and amide hydrolysis, have emerged in the N1pC/P60 superfamily. The three conserved catalytic residues of this superfamily are shown to be equivalent to the catalytic triad of the papain-like thiol peptidases. The predicted structural features indicate that the N1pC/P60 enzymes contain a fold similar to the papain-like peptidases, transglutaminases and arylamine acetyltransferases.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...
The aldo-keto reductase superfamily homepage.
Hyndman, David; Bauman, David R; Heredia, Vladi V; Penning, Trevor M
2003-02-01
The aldo-keto reductases (AKRs) are one of the three enzyme superfamilies that perform oxidoreduction on a wide variety of natural and foreign substrates. A systematic nomenclature for the AKR superfamily was adopted in 1996 and was updated in September 2000 (visit www.med.upenn.edu/akr). Investigators have been diligent in submitting sequences of functional proteins to the Web site. With the new additions, the superfamily contains 114 proteins expressed in prokaryotes and eukaryotes that are distributed over 14 families (AKR1-AKR14). The AKR1 family contains the aldose reductases, the aldehyde reductases, the hydroxysteroid dehydrogenases and steroid 5beta-reductases, and is the largest. Other families of interest include AKR6, which includes potassium channel beta-subunits, and AKR7 the aflatoxin aldehyde reductases. Two new families include AKR13 (yeast aldose reductase) and AKR14 (Escherichia coli aldehyde reductase). Crystal structures of many AKRs and their complexes with ligands are available in the PDB and accessible through the Web site. Each structure has the characteristic (alpha/beta)(8)-barrel motif of the superfamily, a conserved cofactor binding site and a catalytic tetrad, and variable loop structures that define substrate specificity. Although the majority of AKRs are monomeric proteins of about 320 amino acids in length, the AKR2, AKR6 and AKR7 family may form multimers. To expand the nomenclature to accommodate multimers, we recommend that the composition and stoichiometry be listed. For example, AKR7A1:AKR7A4 (1:3) would designate a tetramer of the composition indicated. The current nomenclature is recognized by the Human Genome Project (HUGO) and the Web site provides a link to genomic information including chromosomal localization, gene boundaries, human ESTs and SNPs and much more.
Nikolaidis, Nikolas; Nei, Masatoshi
2004-03-01
We have identified the Hsp70 gene superfamily of the nematode Caenorhabditis briggsae and investigated the evolution of these genes in comparison with Hsp70 genes from C. elegans, Drosophila, and yeast. The Hsp70 genes are classified into three monophyletic groups according to their subcellular localization, namely, cytoplasm (CYT), endoplasmic reticulum (ER), and mitochondria (MT). The Hsp110 genes can be classified into the polyphyletic CYT group and the monophyletic ER group. The different Hsp70 and Hsp110 groups appeared to evolve following the model of divergent evolution. This model can also explain the evolution of the ER and MT genes. On the other hand, the CYT genes are divided into heat-inducible and constitutively expressed genes. The constitutively expressed genes have evolved more or less following the birth-and-death process, and the rates of gene birth and gene death are different between the two nematode species. By contrast, some heat-inducible genes show an intraspecies phylogenetic clustering. This suggests that they are subject to sequence homogenization resulting from gene conversion-like events. In addition, the heat-inducible genes show high levels of sequence conservation in both intra-species and inter-species comparisons, and in most cases, amino acid sequence similarity is higher than nucleotide sequence similarity. This indicates that purifying selection also plays an important role in maintaining high sequence similarity among paralogous Hsp70 genes. Therefore, we suggest that the CYT heat-inducible genes have been subjected to a combination of purifying selection, birth-and-death process, and gene conversion-like events.
International Nuclear Information System (INIS)
Rothenberg, M.; Hanson, M.R.
1988-01-01
A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
Alencar, Valquíria Campos; Jabes, Daniela Leite; Menegidio, Fabiano Bezerra; Sassaki, Guilherme Lanzi; de Souza, Lucas Rodrigo; Puzer, Luciano; Meneghetti, Maria Cecília Zorél; Lima, Marcelo Andrade; Tersariol, Ivarne Luis Dos Santos; de Oliveira, Regina Costa; Nunes, Luiz R
2017-02-07
Xylella fastidiosa is a plant-infecting bacillus, responsible for many important crop diseases, such as Pierce's disease of vineyards, citrus variegated chlorosis, and coffee leaf scorch (CLS), among others. Recent genomic comparisons involving two CLS-related strains, belonging to X. fastidiosa subsp. pauca, revealed that one of them carries a frameshift mutation that inactivates a gene encoding an oxidoreductase of the short-chain dehydrogenase/reductase (SDR) superfamily, which may play important roles in determining structural variations in bacterial glycans and glycoconjugates. However, the exact nature of this SDR has been a matter of controversy, as different annotations of X. fastidiosa genomes have implicated it in distinct reactions. To confirm the nature of this mutated SDR, a comparative analysis was initially performed, suggesting that it belongs to a subgroup of SDR decarboxylases, representing a UDP-xylose synthase (Uxs). Functional assays, using a recombinant derivative of this enzyme, confirmed its nature as XfUxs, and carbohydrate composition analyses, performed with lipopolysaccharide (LPS) molecules obtained from different strains, indicate that inactivation of the X. fastidiosa uxs gene affects the LPS structure among CLS-related X. fastidiosa strains. Finally, a comparative sequence analysis suggests that this mutation is likely to result in a morphological and evolutionary hallmark that differentiates two subgroups of CLS-related strains, which may influence interactions between these bacteria and their plant and/or insect hosts.
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Relationship between Apolipoprotein Superfamily and Parkinson's Disease
Directory of Open Access Journals (Sweden)
Lin Li
2017-01-01
Conclusions: The Apo superfamily has been proved to be closely involved in the initiation, progression, and prognosis of PD. Apos and their genes are of great value in predicting the susceptibility of PD and hopeful to become the target of medical intervention to prevent the onset of PD or slow down the progress. Therefore, further large-scale studies are warranted to elucidate the precise mechanisms of Apos in PD.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Directory of Open Access Journals (Sweden)
R. Vasudevan
2014-06-01
Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.
Directory of Open Access Journals (Sweden)
Xiudao Yu
2013-10-01
Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.
Directory of Open Access Journals (Sweden)
Xiaoming Song
2016-08-01
Full Text Available The AP2/ERF superfamily, one of the most important transcription factor families, plays crucial roles in response to biotic and abiotic stresses. So far, a comprehensive evolutionary inference of its origination and expansion has not been available. Here, we identified 515 AP2/ERF genes in B. napus, a neo-tetraploid forming ~7500 years ago, and found that 82.14% of them were duplicated in the tetraploidization. A prominent subgenome bias was revealed in gene expression, tissue-specific, and gene conversion. Moreover, a large-scale analysis across plants and alga suggested that this superfamily could have been originated from AP2 family, expanding to form other families (ERF, and RAV. This process was accompanied by duplicating and/or alternative deleting AP2 domain, intragenic domain sequence conversion, and/or by acquiring other domains, resulting in copy number variations, alternatively contributing to functional innovation. We found that significant positive selection occurred at certain critical nodes during the evolution of land plants, possibly responding to changing environment. In conclusion, the present research revealed origination, functional innovation, and evolutionary trajectory of the AP2/ERF superfamily, contributing to understanding their roles in plant stress tolerance.
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT
Directory of Open Access Journals (Sweden)
Mariateresa eVolpicella
2016-03-01
Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.
[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].
Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V
2014-01-01
Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
Spatial and temporal expression of immunoglobulin superfamily member 1 in the rat
Joustra, Sjoerd D.; Meijer, Onno C.; Heinen, Charlotte A.; Mol, Isabel M.; Laghmani, El Houari; Sengers, Rozemarijn M. A.; Carreno, Gabriela; van Trotsenburg, A. S. Paul; Biermasz, Nienke R.; Bernard, Daniel J.; Wit, Jan M.; Oostdijk, Wilma; van Pelt, Ans M. M.; Hamer, Geert; Wagenaar, Gerry T. M.
2015-01-01
Loss-of-function mutations in the immunoglobulin superfamily member 1 (IGSF1) gene cause an X-linked syndrome of central hypothyroidism, macroorchidism, variable prolactin and GH deficiency, delayed pubertal testosterone rise, and obesity. To understand the pathophysiology of this syndrome,
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Comparative analysis of cation/proton antiporter superfamily in plants.
Ye, Chu-Yu; Yang, Xiaohan; Xia, Xinli; Yin, Weilun
2013-06-01
The cation/proton antiporter superfamily is associated with the transport of monovalent cations across membranes. This superfamily was annotated in the Arabidopsis genome and some members were functionally characterized. In the present study, a systematic analysis of the cation/proton antiporter genes in diverse plant species was reported. We identified 240 cation/proton antiporters in alga, moss, and angiosperm. A phylogenetic tree was constructed showing these 240 members are separated into three families, i.e., Na(+)/H(+) exchangers, K(+) efflux antiporters, and cation/H(+) exchangers. Our analysis revealed that tandem and/or segmental duplications contribute to the expansion of cation/H(+) exchangers in the examined angiosperm species. Sliding window analysis of the nonsynonymous/synonymous substitution ratios showed some differences in the evolutionary fate of cation/proton antiporter paralogs. Furthermore, we identified over-represented motifs among these 240 proteins and found most motifs are family specific, demonstrating diverse evolution of the cation/proton antiporters among three families. In addition, we investigated the co-expressed genes of the cation/proton antiporters in Arabidopsis thaliana. The results showed some biological processes are enriched in the co-expressed genes, suggesting the cation/proton antiporters may be involved in these biological processes. Taken together, this study furthers our knowledge on cation/proton antiporters in plants. Copyright © 2013 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo
2016-01-01
identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...
Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong
2016-02-10
In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.
Phi Class of Glutathione S-transferase Gene Superfamily Widely Exists in Nonplant Taxonomic Groups.
Munyampundu, Jean-Pierre; Xu, You-Ping; Cai, Xin-Zhong
2016-01-01
Glutathione S-transferases (GSTs) constitute a superfamily of enzymes involved in detoxification of noxious compounds and protection against oxidative damage. GST class Phi (GSTF), one of the important classes of plant GSTs, has long been considered as plant specific but was recently found in basidiomycete fungi. However, the range of nonplant taxonomic groups containing GSTFs remains unknown. In this study, the distribution and phylogenetic relationships of nonplant GSTFs were investigated. We identified GSTFs in ascomycete fungi, myxobacteria, and protists Naegleria gruberi and Aureococcus anophagefferens. GSTF occurrence in these bacteria and protists correlated with their genome sizes and habitats. While this link was missing across ascomycetes, the distribution and abundance of GSTFs among ascomycete genomes could be associated with their lifestyles to some extent. Sequence comparison, gene structure, and phylogenetic analyses indicated divergence among nonplant GSTFs, suggesting polyphyletic origins during evolution. Furthermore, in silico prediction of functional partners suggested functional diversification among nonplant GSTFs.
Directory of Open Access Journals (Sweden)
Mariela V Catone
Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.
Machielsen, M.P.; Uria, A.R.; Kengen, S.W.M.; Oost, van der J.
2006-01-01
The gene encoding a novel alcohol dehydrogenase that belongs to the aldo-keto reductase superfamily has been identified in the hyperthermophilic archaeon Pyrococcus furiosus. The gene, referred to as adhD, was functionally expressed in Escherichia coli and subsequently purified to homogeneity. The
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhihua Hua
Full Text Available The emergence of multigene families has been hypothesized as a major contributor to the evolution of complex traits and speciation. To help understand how such multigene families arose and diverged during plant evolution, we examined the phylogenetic relationships of F-Box (FBX genes, one of the largest and most polymorphic superfamilies known in the plant kingdom. FBX proteins comprise the target recognition subunit of SCF-type ubiquitin-protein ligases, where they individually recruit specific substrates for ubiquitylation. Through the extensive analysis of 10,811 FBX loci from 18 plant species, ranging from the alga Chlamydomonas reinhardtii to numerous monocots and eudicots, we discovered strikingly diverse evolutionary histories. The number of FBX loci varies widely and appears independent of the growth habit and life cycle of land plants, with a little as 198 predicted for Carica papaya to as many as 1350 predicted for Arabidopsis lyrata. This number differs substantially even among closely related species, with evidence for extensive gains/losses. Despite this extraordinary inter-species variation, one subset of FBX genes was conserved among most species examined. Together with evidence of strong purifying selection and expression, the ligases synthesized from these conserved loci likely direct essential ubiquitylation events. Another subset was much more lineage specific, showed more relaxed purifying selection, and was enriched in loci with little or no evidence of expression, suggesting that they either control more limited, species-specific processes or arose from genomic drift and thus may provide reservoirs for evolutionary innovation. Numerous FBX loci were also predicted to be pseudogenes with their numbers tightly correlated with the total number of FBX genes in each species. Taken together, it appears that the FBX superfamily has independently undergone substantial birth/death in many plant lineages, with its size and rapid
Directory of Open Access Journals (Sweden)
Leila ePazouki
2015-03-01
Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.
Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2017-08-09
Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
DEFF Research Database (Denmark)
Liepman, Aaron H; Nairn, C Joseph; Willats, William G T
2007-01-01
from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...
Directory of Open Access Journals (Sweden)
Gnanasambandan Ramanathan
2017-01-01
Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori
2016-11-18
Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
The evolution of function in strictosidine synthase-like proteins.
Hicks, Michael A; Barber, Alan E; Giddings, Lesley-Ann; Caldwell, Jenna; O'Connor, Sarah E; Babbitt, Patricia C
2011-11-01
The exponential growth of sequence data provides abundant information for the discovery of new enzyme reactions. Correctly annotating the functions of highly diverse proteins can be difficult, however, hindering use of this information. Global analysis of large superfamilies of related proteins is a powerful strategy for understanding the evolution of reactions by identifying catalytic commonalities and differences in reaction and substrate specificity, even when only a few members have been biochemically or structurally characterized. A comparison of >2500 sequences sharing the six-bladed β-propeller fold establishes sequence, structural, and functional links among the three subgroups of the functionally diverse N6P superfamily: the arylesterase-like and senescence marker protein-30/gluconolactonase/luciferin-regenerating enzyme-like (SGL) subgroups, representing enzymes that catalyze lactonase and related hydrolytic reactions, and the so-called strictosidine synthase-like (SSL) subgroup. Metal-coordinating residues were identified as broadly conserved in the active sites of all three subgroups except for a few proteins from the SSL subgroup, which have been experimentally determined to catalyze the quite different strictosidine synthase (SS) reaction, a metal-independent condensation reaction. Despite these differences, comparison of conserved catalytic features of the arylesterase-like and SGL enzymes with the SSs identified similar structural and mechanistic attributes between the hydrolytic reactions catalyzed by the former and the condensation reaction catalyzed by SS. The results also suggest that despite their annotations, the great majority of these >500 SSL sequences do not catalyze the SS reaction; rather, they likely catalyze hydrolytic reactions typical of the other two subgroups instead. This prediction was confirmed experimentally for one of these proteins. Copyright © 2011 Wiley-Liss, Inc.
Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.
2012-01-01
The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...
Li, Xiaoqin; Guo, Rongrong; Li, Jun; Singer, Stacy D; Zhang, Yucheng; Yin, Xiangjing; Zheng, Yi; Fan, Chonghui; Wang, Xiping
2013-10-01
Aldehyde dehydrogenases (ALDHs) represent a protein superfamily encoding NAD(P)(+)-dependent enzymes that oxidize a wide range of endogenous and exogenous aliphatic and aromatic aldehydes. In plants, they are involved in many biological processes and play a role in the response to environmental stress. In this study, a total of 39 ALDH genes from ten families were identified in the apple (Malus × domestica Borkh.) genome. Synteny analysis of the apple ALDH (MdALDH) genes indicated that segmental and tandem duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of these gene families in apple. Moreover, synteny analysis between apple and Arabidopsis demonstrated that several MdALDH genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes appeared before the divergence of lineages that led to apple and Arabidopsis. In addition, phylogenetic analysis, as well as comparisons of exon-intron and protein structures, provided further insight into both their evolutionary relationships and their putative functions. Tissue-specific expression analysis of the MdALDH genes demonstrated diverse spatiotemporal expression patterns, while their expression profiles under abiotic stress and various hormone treatments indicated that many MdALDH genes were responsive to high salinity and drought, as well as different plant hormones. This genome-wide identification, as well as characterization of evolutionary relationships and expression profiles, of the apple MdALDH genes will not only be useful for the further analysis of ALDH genes and their roles in stress response, but may also aid in the future improvement of apple stress tolerance. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
DEFF Research Database (Denmark)
Costa, M C; Helweg-Larsen, J; Lundgren, Bettina
2003-01-01
The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...
Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes
Directory of Open Access Journals (Sweden)
Bin Wang
2010-07-01
Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Yan, Fan; Di, Shaokang; Takahashi, Ryoji
2015-08-01
The R gene of soybean, presumably encoding a MYB transcription factor, controls seed coat color. The gene consists of multiple alleles, R (black), r-m (black spots and (or) concentric streaks on brown seed), and r (brown seed). This study was conducted to determine the structure of the MYB transcription factor gene in a near-isogenic line (NIL) having r-m allele. PCR amplification of a fragment of the candidate gene Glyma.09G235100 generated a fragment of about 1 kb in the soybean cultivar Clark, whereas a fragment of about 14 kb in addition to fragments of 1 and 1.4 kb were produced in L72-2040, a Clark 63 NIL with the r-m allele. Clark 63 is a NIL of Clark with the rxp and Rps1 alleles. A DNA fragment of 13 060 bp was inserted in the intron of Glyma.09G235100 in L72-2040. The fragment had the CACTA motif at both ends, imperfect terminal inverted repeats (TIR), inverse repetition of short sequence motifs close to the 5' and 3' ends, and a duplication of three nucleotides at the site of integration, indicating that it belongs to a CACTA-superfamily transposable element. We designated the element as Tgm11. Overall nucleotide sequence, motifs of TIR, and subterminal repeats were similar to those of Tgm1 and Tgs1, suggesting that these elements comprise a family.
Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)
Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru
2018-04-01
Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.
Directory of Open Access Journals (Sweden)
Zhu Chen
Full Text Available Recent genomic sequencing of the foxtail millet, an abiotic, stress-tolerant crop, has provided a great opportunity for novel gene discovery and functional analysis of this popularly-grown grass. However, few stress-mediated gene families have been studied. Aldehyde dehydrogenases (ALDHs comprise a gene superfamily encoding NAD (P +-dependent enzymes that play the role of "aldehyde scavengers", which indirectly detoxify cellular ROS and reduce the effect of lipid peroxidation meditated cellular toxicity under various environmental stresses. In the current paper, we identified a total of 20 ALDH genes in the foxtail millet genome using a homology search and a phylogenetic analysis and grouped them into ten distinct families based on their amino acid sequence identity. Furthermore, evolutionary analysis of foxtail millet reveals that both tandem and segmental duplication contributed significantly to the expansion of its ALDH genes. The exon-intron structures of members of the same family in foxtail millet or the orthologous genes in rice display highly diverse distributions of their exonic and intronic regions. Also, synteny analysis shows that the majority of foxtail millet and rice ALDH gene homologs exist in the syntenic blocks between the two, implying that these ALDH genes arose before the divergence of cereals. Semi-quantitative and real-time quantitative PCR data reveals that a few SiALDH genes are expressed in an organ-specific manner and that the expression of a number of foxtail millet ALDH genes, such as, SiALDH7B1, SiALDH12A1 and SiALDH18B2 are up-regulated by osmotic stress, cold, H2O2, and phytohormone abscisic acid (ABA. Furthermore, the transformation of SiALDH2B2, SiALDH10A2, SiALDH5F1, SiALDH22A1, and SiALDH3E2 into Escherichia coli (E.coli was able to improve their salt tolerance. Taken together, our results show that genome-wide identification characteristics and expression analyses provide unique opportunities for assessing
Chen, Zhu; Chen, Ming; Xu, Zhao-shi; Li, Lian-cheng; Chen, Xue-ping; Ma, You-zhi
2014-01-01
Recent genomic sequencing of the foxtail millet, an abiotic, stress-tolerant crop, has provided a great opportunity for novel gene discovery and functional analysis of this popularly-grown grass. However, few stress-mediated gene families have been studied. Aldehyde dehydrogenases (ALDHs) comprise a gene superfamily encoding NAD (P) +-dependent enzymes that play the role of "aldehyde scavengers", which indirectly detoxify cellular ROS and reduce the effect of lipid peroxidation meditated cellular toxicity under various environmental stresses. In the current paper, we identified a total of 20 ALDH genes in the foxtail millet genome using a homology search and a phylogenetic analysis and grouped them into ten distinct families based on their amino acid sequence identity. Furthermore, evolutionary analysis of foxtail millet reveals that both tandem and segmental duplication contributed significantly to the expansion of its ALDH genes. The exon-intron structures of members of the same family in foxtail millet or the orthologous genes in rice display highly diverse distributions of their exonic and intronic regions. Also, synteny analysis shows that the majority of foxtail millet and rice ALDH gene homologs exist in the syntenic blocks between the two, implying that these ALDH genes arose before the divergence of cereals. Semi-quantitative and real-time quantitative PCR data reveals that a few SiALDH genes are expressed in an organ-specific manner and that the expression of a number of foxtail millet ALDH genes, such as, SiALDH7B1, SiALDH12A1 and SiALDH18B2 are up-regulated by osmotic stress, cold, H2O2, and phytohormone abscisic acid (ABA). Furthermore, the transformation of SiALDH2B2, SiALDH10A2, SiALDH5F1, SiALDH22A1, and SiALDH3E2 into Escherichia coli (E.coli) was able to improve their salt tolerance. Taken together, our results show that genome-wide identification characteristics and expression analyses provide unique opportunities for assessing the functional
Directory of Open Access Journals (Sweden)
Meng eWang
2013-05-01
Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Noar, Roslyn D; Daub, Margaret E
2016-01-01
Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Directory of Open Access Journals (Sweden)
Roslyn D Noar
Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Evolutionary history and stress regulation of the lectin superfamily in higher plants
Directory of Open Access Journals (Sweden)
Ramachandran Srinivasan
2010-03-01
Full Text Available Abstract Background Lectins are a class of carbohydrate-binding proteins. They play roles in various biological processes. However, little is known about their evolutionary history and their functions in plant stress regulation. The availability of full genome sequences from various plant species makes it possible to perform a whole-genome exploration for further understanding their biological functions. Results Higher plant genomes encode large numbers of lectin proteins. Based on their domain structures and phylogenetic analyses, a new classification system has been proposed. In this system, 12 different families have been classified and four of them consist of recently identified plant lectin members. Further analyses show that some of lectin families exhibit species-specific expansion and rapid birth-and-death evolution. Tandem and segmental duplications have been regarded as the major mechanisms to drive lectin expansion although retrogenes also significantly contributed to the birth of new lectin genes in soybean and rice. Evidence shows that lectin genes have been involved in biotic/abiotic stress regulations and tandem/segmental duplications may be regarded as drivers for plants to adapt various environmental stresses through duplication followed by expression divergence. Each member of this gene superfamily may play specialized roles in a specific stress condition and function as a regulator of various environmental factors such as cold, drought and high salinity as well as biotic stresses. Conclusions Our studies provide a new outline of the plant lectin gene superfamily and advance the understanding of plant lectin genes in lineage-specific expansion and their functions in biotic/abiotic stress-related developmental processes.
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Directory of Open Access Journals (Sweden)
Resnanti Utami Handayani
2014-07-01
Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.
Immunoglobulin superfamily members encoded by viruses and their multiple roles in immune evasion.
Farré, Domènec; Martínez-Vicente, Pablo; Engel, Pablo; Angulo, Ana
2017-05-01
Pathogens have developed a plethora of strategies to undermine host immune defenses in order to guarantee their survival. For large DNA viruses, these immune evasion mechanisms frequently rely on the expression of genes acquired from host genomes. Horizontally transferred genes include members of the immunoglobulin superfamily, whose products constitute the most diverse group of proteins of vertebrate genomes. Their promiscuous immunoglobulin domains, which comprise the building blocks of these molecules, are involved in a large variety of functions mediated by ligand-binding interactions. The flexible structural nature of the immunoglobulin domains makes them appealing targets for viral capture due to their capacity to generate high functional diversity. Here, we present an up-to-date review of immunoglobulin superfamily gene homologs encoded by herpesviruses, poxviruses, and adenoviruses, that include CD200, CD47, Fc receptors, interleukin-1 receptor 2, interleukin-18 binding protein, CD80, carcinoembryonic antigen-related cell adhesion molecules, and signaling lymphocyte activation molecules. We discuss their distinct structural attributes, binding properties, and functions, shaped by evolutionary pressures to disarm specific immune pathways. We include several novel genes identified from extensive genome database surveys. An understanding of the properties and modes of action of these viral proteins may guide the development of novel immune-modulatory therapeutic tools. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika
2017-12-01
An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.
DEFF Research Database (Denmark)
Steenholdt, C; Enevold, C; Ainsworth, M A
2012-01-01
Single nucleotide polymorphisms (SNPs) in TNF receptor superfamily (TNFRSF) 1A and 1B, and Fas ligand (FASLG) genes, have been associated with responsiveness to infliximab (IFX) in Crohn's disease.......Single nucleotide polymorphisms (SNPs) in TNF receptor superfamily (TNFRSF) 1A and 1B, and Fas ligand (FASLG) genes, have been associated with responsiveness to infliximab (IFX) in Crohn's disease....
Directory of Open Access Journals (Sweden)
Dullat Harpreet K
2011-03-01
Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.
Stability for Function Trade-Offs in the Enolase Superfamily 'Catalytic Module'
Energy Technology Data Exchange (ETDEWEB)
Nagatani, R.A.; Gonzalez, A.; Shoichet, B.K.; Brinen, L.S.; Babbitt, P.C.; /UC, San Francisco /SLAC, SSRL
2007-07-12
Enzyme catalysis reflects a dynamic interplay between charged and polar active site residues that facilitate function, stabilize transition states, and maintain overall protein stability. Previous studies show that substituting neutral for charged residues in the active site often significantly stabilizes a protein, suggesting a stability trade-off for functionality. In the enolase superfamily, a set of conserved active site residues (the ''catalytic module'') has repeatedly been used in nature in the evolution of many different enzymes for the performance of unique overall reactions involving a chemically diverse set of substrates. This catalytic module provides a robust solution for catalysis that delivers the common underlying partial reaction that supports all of the different overall chemical reactions of the superfamily. As this module has been so broadly conserved in the evolution of new functions, we sought to investigate the extent to which it follows the stability-function trade-off. Alanine substitutions were made for individual residues, groups of residues, and the entire catalytic module of o-succinylbenzoate synthase (OSBS), a member of the enolase superfamily from Escherichia coli. Of six individual residue substitutions, four (K131A, D161A, E190A, and D213A) substantially increased protein stability (by 0.46-4.23 kcal/mol), broadly consistent with prediction of a stability-activity trade-off. The residue most conserved across the superfamily, E190, is by far the most destabilizing. When the individual substitutions were combined into groups (as they are structurally and functionally organized), nonadditive stability effects emerged, supporting previous observations that residues within the module interact as two functional groups within a larger catalytic system. Thus, whereas the multiple-mutant enzymes D161A/E190A/D213A and K131A/K133A/D161A/E190A/D213A/K235A (termed 3KDED) are stabilized relative to the wild-type enzyme (by 1
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.
2000-01-01
The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were
Evolutionarily conserved substrate substructures for automated annotation of enzyme superfamilies.
Directory of Open Access Journals (Sweden)
Ranyee A Chiang
2008-08-01
Full Text Available The evolution of enzymes affects how well a species can adapt to new environmental conditions. During enzyme evolution, certain aspects of molecular function are conserved while other aspects can vary. Aspects of function that are more difficult to change or that need to be reused in multiple contexts are often conserved, while those that vary may indicate functions that are more easily changed or that are no longer required. In analogy to the study of conservation patterns in enzyme sequences and structures, we have examined the patterns of conservation and variation in enzyme function by analyzing graph isomorphisms among enzyme substrates of a large number of enzyme superfamilies. This systematic analysis of substrate substructures establishes the conservation patterns that typify individual superfamilies. Specifically, we determined the chemical substructures that are conserved among all known substrates of a superfamily and the substructures that are reacting in these substrates and then examined the relationship between the two. Across the 42 superfamilies that were analyzed, substantial variation was found in how much of the conserved substructure is reacting, suggesting that superfamilies may not be easily grouped into discrete and separable categories. Instead, our results suggest that many superfamilies may need to be treated individually for analyses of evolution, function prediction, and guiding enzyme engineering strategies. Annotating superfamilies with these conserved and reacting substructure patterns provides information that is orthogonal to information provided by studies of conservation in superfamily sequences and structures, thereby improving the precision with which we can predict the functions of enzymes of unknown function and direct studies in enzyme engineering. Because the method is automated, it is suitable for large-scale characterization and comparison of fundamental functional capabilities of both characterized
Evolutionarily conserved substrate substructures for automated annotation of enzyme superfamilies.
Chiang, Ranyee A; Sali, Andrej; Babbitt, Patricia C
2008-08-01
The evolution of enzymes affects how well a species can adapt to new environmental conditions. During enzyme evolution, certain aspects of molecular function are conserved while other aspects can vary. Aspects of function that are more difficult to change or that need to be reused in multiple contexts are often conserved, while those that vary may indicate functions that are more easily changed or that are no longer required. In analogy to the study of conservation patterns in enzyme sequences and structures, we have examined the patterns of conservation and variation in enzyme function by analyzing graph isomorphisms among enzyme substrates of a large number of enzyme superfamilies. This systematic analysis of substrate substructures establishes the conservation patterns that typify individual superfamilies. Specifically, we determined the chemical substructures that are conserved among all known substrates of a superfamily and the substructures that are reacting in these substrates and then examined the relationship between the two. Across the 42 superfamilies that were analyzed, substantial variation was found in how much of the conserved substructure is reacting, suggesting that superfamilies may not be easily grouped into discrete and separable categories. Instead, our results suggest that many superfamilies may need to be treated individually for analyses of evolution, function prediction, and guiding enzyme engineering strategies. Annotating superfamilies with these conserved and reacting substructure patterns provides information that is orthogonal to information provided by studies of conservation in superfamily sequences and structures, thereby improving the precision with which we can predict the functions of enzymes of unknown function and direct studies in enzyme engineering. Because the method is automated, it is suitable for large-scale characterization and comparison of fundamental functional capabilities of both characterized and uncharacterized
Lane, Courtney E; Benton, Michael G
2015-12-01
A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying
2016-12-28
The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.
International Nuclear Information System (INIS)
Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.
2006-01-01
The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians
DEFF Research Database (Denmark)
Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh
2008-01-01
of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...
Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei
2013-01-01
Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-10-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.
DEFF Research Database (Denmark)
Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri
2014-01-01
BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...
Wu, S-F; Yu, H-Y; Jiang, T-T; Gao, C-F; Shen, J-L
2015-08-01
G protein-coupled receptors (GPCRs) are the largest and most versatile superfamily of cell membrane proteins, which mediate various physiological processes including reproduction, development and behaviour. The diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae), is one of the most notorious insect pests, preferentially feeding on cruciferous plants. P. xylostella is not only one of the world's most widespread lepidopteran insects, but has also developed resistance to nearly all classes of insecticides. Although the mechanisms of insecticide resistance have been studied extensively in many insect species, few investigations have been carried out on GPCRs in P. xylostella. In the present study, we identified 95 putative GPCRs in the P. xylostella genome. The identified GPCRs were compared with their homologues in Bombyx mori and Drosophila melanogaster. Our results suggest that GPCRs in different insect species may have evolved by a birth-and-death process. One of the differences among compared insects is the duplication of short neuropeptide F receptor and adipokinetic hormone receptors in P. xylostella and B. mori. Another divergence is the decrease in quantity and diversity of the stress-tolerance gene, Mth, in P. xylostella. The evolution by the birth-and-death process is probably involved in adaptation to the feeding behaviour, reproduction and stress responses of P. xylostella. Some of the genes identified in the present study could be potential targets for the development of novel pesticides. © 2015 The Royal Entomological Society.
Main trends of karyotype evolution in the superfamily Chalcidoidea (Hymenoptera
Directory of Open Access Journals (Sweden)
Vladimir Gokhman
2009-08-01
Full Text Available An overview of karyotype evolution in the superfamily Chalcidoidea is given. Structural types of chromosome sets in the superfamily are listed. Main pathways of karyotypic change in the Chalcidoidea are outlined. The chromosome set containing eleven subtelo- or acrocentrics is considered as an ancestral karyotype for the superfamily. Multiple independent reductions in n values through chromosomal fusions presumably occurred in various groups of chalcid families.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Phylogenomic analysis of the GIY-YIG nuclease superfamily
Directory of Open Access Journals (Sweden)
Bujnicki Janusz M
2006-04-01
Full Text Available Abstract Background The GIY-YIG domain was initially identified in homing endonucleases and later in other selfish mobile genetic elements (including restriction enzymes and non-LTR retrotransposons and in enzymes involved in DNA repair and recombination. However, to date no systematic search for novel members of the GIY-YIG superfamily or comparative analysis of these enzymes has been reported. Results We carried out database searches to identify all members of known GIY-YIG nuclease families. Multiple sequence alignments together with predicted secondary structures of identified families were represented as Hidden Markov Models (HMM and compared by the HHsearch method to the uncharacterized protein families gathered in the COG, KOG, and PFAM databases. This analysis allowed for extending the GIY-YIG superfamily to include members of COG3680 and a number of proteins not classified in COGs and to predict that these proteins may function as nucleases, potentially involved in DNA recombination and/or repair. Finally, all old and new members of the GIY-YIG superfamily were compared and analyzed to infer the phylogenetic tree. Conclusion An evolutionary classification of the GIY-YIG superfamily is presented for the very first time, along with the structural annotation of all (subfamilies. It provides a comprehensive picture of sequence-structure-function relationships in this superfamily of nucleases, which will help to design experiments to study the mechanism of action of known members (especially the uncharacterized ones and will facilitate the prediction of function for the newly discovered ones.
Two different groups of signal sequence in M-superfamily conotoxins.
Wang, Qi; Jiang, Hui; Han, Yu-Hong; Yuan, Duo-Duo; Chi, Cheng-Wu
2008-04-01
M-superfamily conotoxins can be divided into four branches (M-1, M-2, M-3 and M-4) according to the number of amino acid residues in the third Cys loop. In general, it is widely accepted that the conotoxin signal peptides of each superfamily are strictly conserved. Recently, we cloned six cDNAs of novel M-superfamily conotoxins from Conus leopardus, Conus marmoreus and Conus quercinus, belonging to either M-1 or M-3 branch. These conotoxins, judging from the putative peptide sequences deducted from cDNAs, are rich in acidic residues and share highly conserved signal and pro-peptide region. However, they are quite different from the reported conotoxins of M-2 and M-4 branches even in their signal peptides, which in general are considered highly conserved for each superfamily of conotoxins. The signal sequences of M-1 and M-3 conotoxins composed of 24 residues start with MLKMGVVL-, while those of M-2 and M-4 conotoxins composed of 25 residues start with MMSKLGVL-. It is another example that different types of signal peptides can exist within a superfamily besides the I-conotoxin superfamily. In addition to the different disulfide connectivity of M-1 conotoxins from that of M-4 or M-2 conotoxins, the sequence alignment, preferential Cys codon usage and phylogenetic tree analysis suggest that M-1 and M-3 conotoxins have much closer relationship, being different from the conotoxins of other two branches (M-4 and M-2) of M-superfamily.
Kazmierczak, Marcin; Zhang, Xiaofei; Chen, Bihan; Mulkey, Daniel K.; Shi, Yingtang; Wagner, Paul G.; Pivaroff-Ward, Kendra; Sassic, Jessica K.; Bayliss, Douglas A.
2013-01-01
The Ether-a-go-go (EAG) superfamily of voltage-gated K+ channels consists of three functionally distinct gene families (Eag, Elk, and Erg) encoding a diverse set of low-threshold K+ currents that regulate excitability in neurons and muscle. Previous studies indicate that external acidification inhibits activation of three EAG superfamily K+ channels, Kv10.1 (Eag1), Kv11.1 (Erg1), and Kv12.1 (Elk1). We show here that Kv10.2, Kv12.2, and Kv12.3 are similarly inhibited by external protons, suggesting that high sensitivity to physiological pH changes is a general property of EAG superfamily channels. External acidification depolarizes the conductance–voltage (GV) curves of these channels, reducing low threshold activation. We explored the mechanism of this high pH sensitivity in Kv12.1, Kv10.2, and Kv11.1. We first examined the role of acidic voltage sensor residues that mediate divalent cation block of voltage activation in EAG superfamily channels because protons reduce the sensitivity of Kv12.1 to Zn2+. Low pH similarly reduces Mg2+ sensitivity of Kv10.1, and we found that the pH sensitivity of Kv11.1 was greatly attenuated at 1 mM Ca2+. Individual neutralizations of a pair of EAG-specific acidic residues that have previously been implicated in divalent block of diverse EAG superfamily channels greatly reduced the pH response in Kv12.1, Kv10.2, and Kv11.1. Our results therefore suggest a common mechanism for pH-sensitive voltage activation in EAG superfamily channels. The EAG-specific acidic residues may form the proton-binding site or alternatively are required to hold the voltage sensor in a pH-sensitive conformation. The high pH sensitivity of EAG superfamily channels suggests that they could contribute to pH-sensitive K+ currents observed in vivo. PMID:23712551
Kazmierczak, Marcin; Zhang, Xiaofei; Chen, Bihan; Mulkey, Daniel K; Shi, Yingtang; Wagner, Paul G; Pivaroff-Ward, Kendra; Sassic, Jessica K; Bayliss, Douglas A; Jegla, Timothy
2013-06-01
The Ether-a-go-go (EAG) superfamily of voltage-gated K(+) channels consists of three functionally distinct gene families (Eag, Elk, and Erg) encoding a diverse set of low-threshold K(+) currents that regulate excitability in neurons and muscle. Previous studies indicate that external acidification inhibits activation of three EAG superfamily K(+) channels, Kv10.1 (Eag1), Kv11.1 (Erg1), and Kv12.1 (Elk1). We show here that Kv10.2, Kv12.2, and Kv12.3 are similarly inhibited by external protons, suggesting that high sensitivity to physiological pH changes is a general property of EAG superfamily channels. External acidification depolarizes the conductance-voltage (GV) curves of these channels, reducing low threshold activation. We explored the mechanism of this high pH sensitivity in Kv12.1, Kv10.2, and Kv11.1. We first examined the role of acidic voltage sensor residues that mediate divalent cation block of voltage activation in EAG superfamily channels because protons reduce the sensitivity of Kv12.1 to Zn(2+). Low pH similarly reduces Mg(2+) sensitivity of Kv10.1, and we found that the pH sensitivity of Kv11.1 was greatly attenuated at 1 mM Ca(2+). Individual neutralizations of a pair of EAG-specific acidic residues that have previously been implicated in divalent block of diverse EAG superfamily channels greatly reduced the pH response in Kv12.1, Kv10.2, and Kv11.1. Our results therefore suggest a common mechanism for pH-sensitive voltage activation in EAG superfamily channels. The EAG-specific acidic residues may form the proton-binding site or alternatively are required to hold the voltage sensor in a pH-sensitive conformation. The high pH sensitivity of EAG superfamily channels suggests that they could contribute to pH-sensitive K(+) currents observed in vivo.
Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny
2016-03-09
Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W
2015-03-31
Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043
Schindler, Daniel; Nowrousian, Minou
2014-07-01
Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....
MetaSINEs: Broad Distribution of a Novel SINE Superfamily in Animals.
Nishihara, Hidenori; Plazzi, Federico; Passamonti, Marco; Okada, Norihiro
2016-02-12
SINEs (short interspersed elements) are transposable elements that typically originate independently in each taxonomic clade (order/family). However, some SINE families share a highly similar central sequence and are thus categorized as a SINE superfamily. Although only four SINE superfamilies (CORE-SINEs, V-SINEs, DeuSINEs, and Ceph-SINEs) have been reported so far, it is expected that new SINE superfamilies would be discovered by deep exploration of new SINEs in metazoan genomes. Here we describe 15 SINEs, among which 13 are novel, that have a similar 66-bp central region and therefore constitute a new SINE superfamily, MetaSINEs. MetaSINEs are distributed from fish to cnidarians, suggesting their common evolutionary origin at least 640 Ma. Because the 3' tails of MetaSINEs are variable, these SINEs most likely survived by changing their partner long interspersed elements for retrotransposition during evolution. Furthermore, we examined the presence of members of other SINE superfamilies in bivalve genomes and characterized eight new SINEs belonging to the CORE-SINEs, V-SINEs, and DeuSINEs, in addition to the MetaSINEs. The broad distribution of bivalve SINEs suggests that at least three SINEs originated in the common ancestor of Bivalvia. Our comparative analysis of the central domains of the SINEs revealed that, in each superfamily, only a restricted region is shared among all of its members. Because the functions of the central domains of the SINE superfamilies remain unknown, such structural information of SINE superfamilies will be useful for future experimental and comparative analyses to reveal why they have been retained in metazoan genomes during evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J
1999-01-01
Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....
Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou
2017-09-18
The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450
Directory of Open Access Journals (Sweden)
Sophia S Wang
Full Text Available A promoter polymorphism in the pro-inflammatory cytokine tumor necrosis factor (TNF (TNF G-308A is associated with increased non-Hodgkin lymphoma (NHL risk. The protein product, TNF-alpha, activates the nuclear factor kappa beta (NF-kappaB transcription factor, and is critical for inflammatory and apoptotic responses in cancer progression. We hypothesized that the TNF and NF-kappaB pathways are important for NHL and that gene variations across the pathways may alter NHL risk.We genotyped 500 tag single nucleotide polymorphisms (SNPs from 48 candidate gene regions (defined as 20 kb 5', 10 kb 3' in the TNF and TNF receptor superfamilies and the NF-kappaB and related transcription factors, in 1946 NHL cases and 1808 controls pooled from three independent population-based case-control studies. We obtained a gene region-level summary of association by computing the minimum p-value ("minP test". We used logistic regression to compute odds ratios and 95% confidence intervals for NHL and four major NHL subtypes in relation to SNP genotypes and haplotypes. For NHL, the tail strength statistic supported an overall relationship between the TNF/NF-kappaB pathway and NHL (p = 0.02. We confirmed the association between TNF/LTA on chromosome 6p21.3 with NHL and found the LTA rs2844484 SNP most significantly and specifically associated with the major subtype, diffuse large B-cell lymphoma (DLBCL (p-trend = 0.001. We also implicated for the first time, variants in NFKBIL1 on chromosome 6p21.3, associated with NHL. Other gene regions identified as statistically significantly associated with NHL included FAS, IRF4, TNFSF13B, TANK, TNFSF7 and TNFRSF13C. Accordingly, the single most significant SNPs associated with NHL were FAS rs4934436 (p-trend = 0.0024, IRF4 rs12211228 (p-trend = 0.0026, TNFSF13B rs2582869 (p-trend = 0.0055, TANK rs1921310 (p-trend = 0.0025, TNFSF7 rs16994592 (p-trend = 0.0024, and TNFRSF13C rs6002551 (p-trend = 0.0074. All associations were
International Nuclear Information System (INIS)
Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano
2014-01-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal
Energy Technology Data Exchange (ETDEWEB)
Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)
2014-07-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.
Energy Technology Data Exchange (ETDEWEB)
Mushegian, Arcady R., E-mail: mushegian2@gmail.com [Division of Molecular and Cellular Biosciences, National Science Foundation, 4201 Wilson Boulevard, Arlington, VA 22230 (United States); Elena, Santiago F., E-mail: sfelena@ibmcp.upv.es [Instituto de Biología Molecular y Celular de Plantas, CSIC-UPV, 46022 València (Spain); The Santa Fe Institute, Santa Fe, NM 87501 (United States)
2015-02-15
Homologs of Tobacco mosaic virus 30K cell-to-cell movement protein are encoded by diverse plant viruses. Mechanisms of action and evolutionary origins of these proteins remain obscure. We expand the picture of conservation and evolution of the 30K proteins, producing sequence alignment of the 30K superfamily with the broadest phylogenetic coverage thus far and illuminating structural features of the core all-beta fold of these proteins. Integrated copies of pararetrovirus 30K movement genes are prevalent in euphyllophytes, with at least one copy intact in nearly every examined species, and mRNAs detected for most of them. Sequence analysis suggests repeated integrations, pseudogenizations, and positive selection in those provirus genes. An unannotated 30K-superfamily gene in Arabidopsis thaliana genome is likely expressed as a fusion with the At1g37113 transcript. This molecular background of endopararetrovirus gene products in plants may change our view of virus infection and pathogenesis, and perhaps of cellular homeostasis in the hosts. - Highlights: • Sequence region shared by plant virus “30K” movement proteins has an all-beta fold. • Most euphyllophyte genomes contain integrated copies of pararetroviruses. • These integrated virus genomes often include intact movement protein genes. • Molecular evidence suggests that these “30K” genes may be selected for function.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Directory of Open Access Journals (Sweden)
Shu-Ting Pan
2016-06-01
Full Text Available The human cytochrome P450 (CYP superfamily consisting of 57 functional genes is the most important group of Phase I drug metabolizing enzymes that oxidize a large number of xenobiotics and endogenous compounds, including therapeutic drugs and environmental toxicants. The CYP superfamily has been shown to expand itself through gene duplication, and some of them become pseudogenes due to gene mutations. Orthologs and paralogs are homologous genes resulting from speciation or duplication, respectively. To explore the evolutionary and functional relationships of human CYPs, we conducted this bioinformatic study to identify their corresponding paralogs, homologs, and orthologs. The functional implications and implications in drug discovery and evolutionary biology were then discussed. GeneCards and Ensembl were used to identify the paralogs of human CYPs. We have used a panel of online databases to identify the orthologs of human CYP genes: NCBI, Ensembl Compara, GeneCards, OMA (“Orthologous MAtrix” Browser, PATHER, TreeFam, EggNOG, and Roundup. The results show that each human CYP has various numbers of paralogs and orthologs using GeneCards and Ensembl. For example, the paralogs of CYP2A6 include CYP2A7, 2A13, 2B6, 2C8, 2C9, 2C18, 2C19, 2D6, 2E1, 2F1, 2J2, 2R1, 2S1, 2U1, and 2W1; CYP11A1 has 6 paralogs including CYP11B1, 11B2, 24A1, 27A1, 27B1, and 27C1; CYP51A1 has only three paralogs: CYP26A1, 26B1, and 26C1; while CYP20A1 has no paralog. The majority of human CYPs are well conserved from plants, amphibians, fishes, or mammals to humans due to their important functions in physiology and xenobiotic disposition. The data from different approaches are also cross-validated and validated when experimental data are available. These findings facilitate our understanding of the evolutionary relationships and functional implications of the human CYP superfamily in drug discovery.
A global view of structure-function relationships in the tautomerase superfamily.
Davidson, Rebecca; Baas, Bert-Jan; Akiva, Eyal; Holliday, Gemma L; Polacco, Benjamin J; LeVieux, Jake A; Pullara, Collin R; Zhang, Yan Jessie; Whitman, Christian P; Babbitt, Patricia C
2018-02-16
The tautomerase superfamily (TSF) consists of more than 11,000 nonredundant sequences present throughout the biosphere. Characterized members have attracted much attention because of the unusual and key catalytic role of an N-terminal proline. These few characterized members catalyze a diverse range of chemical reactions, but the full scale of their chemical capabilities and biological functions remains unknown. To gain new insight into TSF structure-function relationships, we performed a global analysis of similarities across the entire superfamily and computed a sequence similarity network to guide classification into distinct subgroups. Our results indicate that TSF members are found in all domains of life, with most being present in bacteria. The eukaryotic members of the cis -3-chloroacrylic acid dehalogenase subgroup are limited to fungal species, whereas the macrophage migration inhibitory factor subgroup has wide eukaryotic representation (including mammals). Unexpectedly, we found that 346 TSF sequences lack Pro-1, of which 85% are present in the malonate semialdehyde decarboxylase subgroup. The computed network also enabled the identification of similarity paths, namely sequences that link functionally diverse subgroups and exhibit transitional structural features that may help explain reaction divergence. A structure-guided comparison of these linker proteins identified conserved transitions between them, and kinetic analysis paralleled these observations. Phylogenetic reconstruction of the linker set was consistent with these findings. Our results also suggest that contemporary TSF members may have evolved from a short 4-oxalocrotonate tautomerase-like ancestor followed by gene duplication and fusion. Our new linker-guided strategy can be used to enrich the discovery of sequence/structure/function transitions in other enzyme superfamilies. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.
Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M
2008-07-01
Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.
2013-01-01
The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112
MetaSINEs: Broad Distribution of a Novel SINE Superfamily in Animals
Nishihara, Hidenori; Plazzi, Federico; Passamonti, Marco; Okada, Norihiro
2016-01-01
SINEs (short interspersed elements) are transposable elements that typically originate independently in each taxonomic clade (order/family). However, some SINE families share a highly similar central sequence and are thus categorized as a SINE superfamily. Although only four SINE superfamilies (CORE-SINEs, V-SINEs, DeuSINEs, and Ceph-SINEs) have been reported so far, it is expected that new SINE superfamilies would be discovered by deep exploration of new SINEs in metazoan genomes. Here we de...
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
Evolution and Diversity of the Ras Superfamily of Small GTPases in Prokaryotes
Wuichet, Kristin; Søgaard-Andersen, Lotte
2015-01-01
The Ras superfamily of small GTPases are single domain nucleotide-dependent molecular switches that act as highly tuned regulators of complex signal transduction pathways. Originally identified in eukaryotes for their roles in fundamental cellular processes including proliferation, motility, polarity, nuclear transport, and vesicle transport, recent studies have revealed that single domain GTPases also control complex functions such as cell polarity, motility, predation, development and antibiotic resistance in bacteria. Here, we used a computational genomics approach to understand the abundance, diversity, and evolution of small GTPases in prokaryotes. We collected 520 small GTPase sequences present in 17% of 1,611 prokaryotic genomes analyzed that cover diverse lineages. We identified two discrete families of small GTPases in prokaryotes that show evidence of three distinct catalytic mechanisms. The MglA family includes MglA homologs, which are typically associated with the MglB GTPase activating protein, whereas members of the Rup (Ras superfamily GTPase of unknown function in prokaryotes) family are not predicted to interact with MglB homologs. System classification and genome context analyses support the involvement of small GTPases in diverse prokaryotic signal transduction pathways including two component systems, laying the foundation for future experimental characterization of these proteins. Phylogenetic analysis of prokaryotic and eukaryotic GTPases supports that the last universal common ancestor contained ancestral MglA and Rup family members. We propose that the MglA family was lost from the ancestral eukaryote and that the Ras superfamily members in extant eukaryotes are the result of vertical and horizontal gene transfer events of ancestral Rup GTPases. PMID:25480683
Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K
1999-03-01
The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.
Energy Technology Data Exchange (ETDEWEB)
Yew,W.; Fedorov, A.; Fedorov, E.; Rakus, J.; Pierce, R.; Almo, S.; Gerlt, J.
2006-01-01
Many members of the mechanistically diverse enolase superfamily have unknown functions. In this report the authors use both genome (operon) context and screening of a library of acid sugars to assign the L-fuconate dehydratase (FucD) function to a member of the mandelate racemase (MR) subgroup of the superfamily encoded by the Xanthomonas campestris pv. campestris str. ATCC 33913 genome (GI: 21233491). Orthologues of FucD are found in both bacteria and eukaryotes, the latter including the rTS beta protein in Homo sapiens that has been implicated in regulating thymidylate synthase activity. As suggested by sequence alignments and confirmed by high-resolution structures in the presence of active site ligands, FucD and MR share the same active site motif of functional groups: three carboxylate ligands for the essential Mg2+ located at the ends of th third, fourth, and fifth-strands in the (/)7-barrel domain (Asp 248, Glu 274, and Glu 301, respectively), a Lys-x-Lys motif at the end of the second-strand (Lys 218 and Lys 220), a His-Asp dyad at the end of the seventh and sixth-strands (His 351 and Asp 324, respectively), and a Glue at the end of the eighth-strand (Glu 382). The mechanism of the FucD reaction involves initial abstraction of the 2-proton by Lys 220, acid catalysis of the vinylogous-elimination of the 3-OH group by His 351, and stereospecific ketonization of the resulting 2-keto-3-deoxy-L-fuconate product. Screening of the library of acid sugars revealed substrate and functional promiscuity: In addition to L-fuconate, FucD also catalyzes the dehydration of L-galactonate, D-arabinonate, D-altronate, L-talonate, and D-ribonate. The dehydrations of L-fuconate, L-galactonate, and D-arabinonate are initiated by abstraction of the 2-protons by Lys 220. The dehydrations of L-talonate and D-ribonate are initiated by abstraction of the 2-protons by His 351; however, protonation of the enediolate intermediates by the conjugate acid of Lys 220 yields L
Energy Technology Data Exchange (ETDEWEB)
Nguyen,T.; Brown, S.; Fedorov, A.; Fedorov, E.; Babbitt, P.; Almo, S.; Raushel, F.
2008-01-01
The amidohydrolase superfamily is a functionally diverse set of enzymes that catalyzes predominantly hydrolysis reactions involving sugars, nucleic acids, amino acids, and organophosphate esters. One of the most divergent members of this superfamily, uronate isomerase from Escherichia coli, catalyzes the isomerization of d-glucuronate to d-fructuronate and d-galacturonate to d-tagaturonate and is the only uronate isomerase in this organism. A gene encoding a putative uronate isomerase in Bacillus halodurans (Bh0705) was identified based on sequence similarity to uronate isomerases from other organisms. Kinetic evidence indicates that Bh0705 is relatively specific for the isomerization of d-glucuronate to d-fructuronate, confirming this functional assignment. Despite a low sequence identity to all other characterized uronate isomerases, phylogenetic and network-based analysis suggests that a second gene in this organism, Bh0493, is also a uronate isomerase, although it is an outlier in the group, with <20% sequence identity to any other characterized uronate isomerase from another species. The elucidation of the X-ray structure at a resolution of 2.0 Angstroms confirms that Bh0493 is a member of the amidohydrolase superfamily with conserved residues common to other members of the uronate isomerase family. Functional characterization of this protein shows that unlike Bh0705, Bh0493 can utilize both d-glucuronate and d-galacturonate as substrates. In B. halodurans, Bh0705 is found in an operon for the metabolism of d-glucuronate, whereas Bh0493 is in an operon for the metabolism of d-galacturonate. These results provide the first identification of a uronate isomerase that operates in a pathway distinct from that for d-glucuronate. While most organisms that contain this pathway have only one gene for a uronate isomerase, sequence analysis and operon context show that five other organisms also appear to have two genes and one organism appears to have three genes for
Directory of Open Access Journals (Sweden)
Lin-Hui Gao
2018-01-01
Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.
Keanekaragaman Jenis Kupu-Kupu Superfamili Papilionoidae di Banyuwindu, Limbangan Kendal
Directory of Open Access Journals (Sweden)
Ratna Oqtafiana
2013-03-01
Full Text Available Kupu-kupu turut memberi andil dalam mempertahankan keseimbangan ekosistem dan memperkaya keanekaragaman hayati. Tujuan dari penelitian ini adalah untuk mengetahui keanekaragaman jenis kupu-kupu superfamili Papilionoidae di Dukuh Banyuwindu Desa Limbangan Kecamatan Limbangan Kabupaten Kendal khususnya di habitat hutan sekunder, permukiman, Daerah Aliran Sungai (DAS dan persawahan.Populasi dalam penelitian ini adalah semua jenis kupu-kupu superfamili Papilionoidae yang ada di Banyuwindu, Limbangan Kendal. Sampel penelitian ini adalah jenis kupu-kupu superfamili Papilionoidae yang teramati di Banyuwindu Limbangan Kendal khususnya di habitat hutan sekunder, permukiman, DAS dan persawahan. Penelitian dilakukan dengan metode Indeks Point Abudance (IPA atau metode titik hitung.Hasil penelitian ditemukan sebanyak 62 jenis kupu-kupu superfamili Papilionoidae yang terdiri dari 737 individu yang tergolong kedalam empat famili yaitu Papilionidae, Pieridae, Lycaenidae dan Nymphalidae. Hasil analisis indeks keanekaragaman jenis berkisar antara 2,74-3,09, indeks kemerataan jenis berkisar antara 0,86-0,87 dan memiliki dominansi berkisar antara 0,07-0,09. Indeks keanekaragaman jenis dan indeks kemerataan jenis tertinggi tercatat pada habitat permukiman yaitu 3,09 dan 0,87 dan memiliki dominansi 0,07 sedangkan terendah tercatat pada habitat persawahan yaitu 2,74 dan 0,86 dan memiliki dominansi 0,07.Butterfly also contribute in maintaining the ecological balance and enrich biodiversity. The aim of this research was to determine the diversity of butterflies’ superfamily Papilionoidae in Banyuwindu Hamlet Limbangan Sub district Kendal Regency, especially in the secondary forest habitat, settlements, river flow area (RFA and rice field. The population in this research were all kinds of butterflies’ Papilionoidae superfamily in Banyuwindu, Limbangan Kendal. The sample was kind of butterfly superfamily Papilionoidae that observed in Banyuwindu Limbangan Kendal
Designer TGFβ superfamily ligands with diversified functionality.
Directory of Open Access Journals (Sweden)
George P Allendorph
Full Text Available Transforming Growth Factor--beta (TGFβ superfamily ligands, including Activins, Growth and Differentiation Factors (GDFs, and Bone Morphogenetic Proteins (BMPs, are excellent targets for protein-based therapeutics because of their pervasiveness in numerous developmental and cellular processes. We developed a strategy termed RASCH (Random Assembly of Segmental Chimera and Heteromer, to engineer chemically-refoldable TGFβ superfamily ligands with unique signaling properties. One of these engineered ligands, AB208, created from Activin-βA and BMP-2 sequences, exhibits the refolding characteristics of BMP-2 while possessing Activin-like signaling attributes. Further, we find several additional ligands, AB204, AB211, and AB215, which initiate the intracellular Smad1-mediated signaling pathways more strongly than BMP-2 but show no sensitivity to the natural BMP antagonist Noggin unlike natural BMP-2. In another design, incorporation of a short N-terminal segment from BMP-2 was sufficient to enable chemical refolding of BMP-9, without which was never produced nor refolded. Our studies show that the RASCH strategy enables us to expand the functional repertoire of TGFβ superfamily ligands through development of novel chimeric TGFβ ligands with diverse biological and clinical values.
Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major
Directory of Open Access Journals (Sweden)
Smrati Mishra
Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.
Directory of Open Access Journals (Sweden)
Mallika V
2010-03-01
Full Text Available Type III Polyketide synthases (PKS are family of proteins considered to have significant role in the biosynthesis of various polyketides in plants, fungi and bacteria. As these proteins show positive effects to human health, more researches are going on regarding this particular protein. Developing a tool to identify the probability of sequence, being a type III polyketide synthase will minimize the time consumption and manpower efforts. In this approach, we have designed and implemented PKSIIIpred, a high performance prediction server for type III PKS where the classifier is Support Vector Machine (SVM. Based on the limited training dataset, the tool efficiently predicts the type III PKS superfamily of proteins with high sensitivity and specificity. PKSIIIpred is available at http://type3pks.in/prediction/. We expect that this tool may serve as a useful resource for type III PKS researchers. Currently work is being progressed for further betterment of prediction accuracy by including more sequence features in the training dataset.
Directory of Open Access Journals (Sweden)
T. Angeline
2011-01-01
Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.
Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major
Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling
2016-01-01
Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk
2014-02-01
Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei
Directory of Open Access Journals (Sweden)
Yue Ming
2009-06-01
Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud
2007-10-01
Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.
Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.
2013-01-01
Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150
Isolation of a novel LPS-induced component of the ML superfamily in Ciona intestinalis.
Vizzini, Aiti; Bonura, Angela; Longo, Valeria; Sanfratello, Maria Antonietta; Parrinello, Daniela; Cammarata, Matteo; Colombo, Paolo
2015-11-01
ML superfamily represents a group of proteins playing important roles in lipid metabolism and innate immune response. In this study, we report the identification of the first component of the ML superfamily in the invertebrate Ciona intestinalis by means of a subtractive hybridization strategy. Sequence homology and phylogenetic analysis showed that this protein forms a specific clade with vertebrate components of the Niemann-Pick type C2 protein and, for this reason, it has been named Ci-NPC2. The putative Ci-NPC2 is a 150 amino acids long protein with a short signal peptide, seven cysteine residues, three putative lipid binding site and a three-dimensional model showing a characteristic β-strand structure. Gene expression analysis demonstrated that the Ci-NPC2 protein is positively upregulated after LPS inoculum with a peak of expression 1 h after challenge. Finally, in-situ hybridization demonstrated that the Ci-NPC2 protein is preferentially expressed in hemocytes inside the vessel lumen. Copyright © 2015 Elsevier Ltd. All rights reserved.
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim
2005-06-01
Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.
Analysis of genetic variation of inducible nitric oxide synthase and ...
African Journals Online (AJOL)
The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...
Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.
Jain, Parul; Tar'an, Bunyamin
2014-11-01
Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.
Furnham, Nicholas; Dawson, Natalie L; Rahman, Syed A; Thornton, Janet M; Orengo, Christine A
2016-01-29
Enzymes, as biological catalysts, form the basis of all forms of life. How these proteins have evolved their functions remains a fundamental question in biology. Over 100 years of detailed biochemistry studies, combined with the large volumes of sequence and protein structural data now available, means that we are able to perform large-scale analyses to address this question. Using a range of computational tools and resources, we have compiled information on all experimentally annotated changes in enzyme function within 379 structurally defined protein domain superfamilies, linking the changes observed in functions during evolution to changes in reaction chemistry. Many superfamilies show changes in function at some level, although one function often dominates one superfamily. We use quantitative measures of changes in reaction chemistry to reveal the various types of chemical changes occurring during evolution and to exemplify these by detailed examples. Additionally, we use structural information of the enzymes active site to examine how different superfamilies have changed their catalytic machinery during evolution. Some superfamilies have changed the reactions they perform without changing catalytic machinery. In others, large changes of enzyme function, in terms of both overall chemistry and substrate specificity, have been brought about by significant changes in catalytic machinery. Interestingly, in some superfamilies, relatives perform similar functions but with different catalytic machineries. This analysis highlights characteristics of functional evolution across a wide range of superfamilies, providing insights that will be useful in predicting the function of uncharacterised sequences and the design of new synthetic enzymes. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2
Directory of Open Access Journals (Sweden)
Bhubalan, K.
2010-01-01
Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Isolation of developing secondary xylem specific cellulose synthase ...
Indian Academy of Sciences (India)
The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
Diversity, classification and function of the plant protein kinase superfamily
Lehti-Shiu, Melissa D.; Shiu, Shin-Han
2012-01-01
Eukaryotic protein kinases belong to a large superfamily with hundreds to thousands of copies and are components of essentially all cellular functions. The goals of this study are to classify protein kinases from 25 plant species and to assess their evolutionary history in conjunction with consideration of their molecular functions. The protein kinase superfamily has expanded in the flowering plant lineage, in part through recent duplications. As a result, the flowering plant protein kinase r...
Directory of Open Access Journals (Sweden)
Bin Tang
2018-01-01
Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Peng, Fred Y; Weselake, Randall J
2013-05-01
The plant-specific B3 superfamily of transcription factors has diverse functions in plant growth and development. Using a genome-wide domain analysis, we identified 92, 187, 58, 90, 81, 55, and 77 B3 transcription factor genes in the sequenced genome of Arabidopsis, Brassica rapa, castor bean (Ricinus communis), cocoa (Theobroma cacao), soybean (Glycine max), maize (Zea mays), and rice (Oryza sativa), respectively. The B3 superfamily has substantially expanded during the evolution in eudicots particularly in Brassicaceae, as compared to monocots in the analysis. We observed domain duplication in some of these B3 proteins, forming more complex domain architectures than currently understood. We found that the length of B3 domains exhibits a large variation, which may affect their exact number of α-helices and β-sheets in the core structure of B3 domains, and possibly have functional implications. Analysis of the public microarray data indicated that most of the B3 gene pairs encoding Arabidopsis-rice orthologs are preferentially expressed in different tissues, suggesting their different roles in these two species. Using ESTs in crops, we identified many B3 genes preferentially expressed in reproductive tissues. In a sequence-based quantitative trait loci analysis in rice and maize, we have found many B3 genes associated with traits such as grain yield, seed weight and number, and protein content. Our results provide a framework for future studies into the function of B3 genes in different phases of plant development, especially the ones related to traits in major crops.
Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele
2015-08-01
Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Yang, Ji; Gu, Hongya; Yang, Ziheng
2004-01-01
Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.
Directory of Open Access Journals (Sweden)
Andrade-Navarro Miguel A
2007-11-01
Full Text Available Abstract Background Genetic variants in the FTO (fat mass and obesity associated gene have been associated with an increased risk of obesity. However, the function of its protein product has not been experimentally studied and previously reported sequence similarity analyses suggested the absence of homologs in existing protein databases. Here, we present the first detailed computational analysis of the sequence and predicted structure of the protein encoded by FTO. Results We performed a sequence similarity search using the human FTO protein as query and then generated a profile using the multiple sequence alignment of the homologous sequences. Profile-to-sequence and profile-to-profile based comparisons identified remote homologs of the non-heme dioxygenase family. Conclusion Our analysis suggests that human FTO is a member of the non-heme dioxygenase (Fe(II- and 2-oxoglutarate-dependent dioxygenases superfamily. Amino acid conservation patterns support this hypothesis and indicate that both 2-oxoglutarate and iron should be important for FTO function. This computational prediction of the function of FTO should suggest further steps for its experimental characterization and help to formulate hypothesis about the mechanisms by which it relates to obesity in humans.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
International Nuclear Information System (INIS)
Ge Shimei; Xie Baoen; Chen Sanfeng
2006-01-01
The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis
Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep
2015-10-01
GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Directory of Open Access Journals (Sweden)
Jackson Brian C
2011-10-01
Full Text Available Abstract The secretoglobins (SCGBs comprise a family of small, secreted proteins found in animals exclusively of mammalian lineage. There are 11 human SCGB genes and five pseudogenes. Interestingly, mice have 68 Scgb genes, four of which are highly orthologous to human SCGB genes; the remainder represent an 'evolutionary bloom' and make up a large gene family represented by only six counterparts in humans. SCGBs are found in high concentrations in many mammalian secretions, including fluids of the lung, lacrimal gland, salivary gland, prostate and uterus. Whereas the biological activities of most individual SCGBs have not been fully characterised, what already has been discovered suggests that this family has an important role in the modulation of inflammation, tissue repair and tumorigenesis. In mice, the large Scgb1b and Scgb2b gene families encode the androgen-binding proteins, which have been shown to play a role in mate selection. Although much has been learned about SCGBs in recent years, clearly more research remains to be done to allow a better understanding of the roles of these proteins in human health and disease. Such information is predicted to reveal valuable novel drug targets for the treatment of inflammation, as well as designing biomarkers that might identify tissue damage or cancer.
Directory of Open Access Journals (Sweden)
Hiroaki Iwasaka
2018-04-01
Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.
Directory of Open Access Journals (Sweden)
S.N. Koval
2017-08-01
Full Text Available Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH and should be considered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL, enzyme aldosterone synthase (AS, which takes a direct part in the formation of this hormone, as well as gene polymorphisms of AS, which have not only molecular genetic, but also differential diagnostic and therapeutic significance for secondary forms of arterial hypertension, abdominal obesity (AO, metabolic syndrome (MS, adrenal pathology and other endocrine disorders. AL is a steroid (mineralocorticoid hormone of the adrenal cortex, which is synthesized from cholesterol (CH, mainly in the glomerular zone of the adrenal glands, is released under the action of angiotensin II (A II and potassium ions (K+. AL activity is mediated through the corresponding mineralocorticoid receptors (MKR. The particular importance in AH and MS development belongs to AL activation and MKR density in adipocytes, this phenomenon is accompanied by increased expression of pro-inflammatory cytokines, leptin, an adipogenic effect, and the inhibition of MCR activity is accompanied by increased production of adiponectin, which is more pronounced in patients with AH. Aldosterone synthase, a mitochondrial human enzyme encoded by the CYP11B2 gene (cytochrome P450, family 11, subfamily B, polypeptide 2 is located on the 8th chromosome. AS belongs to the superfamily of cytochrome P450 and regulates the synthesis of AL hormone. The CYP11B2 gene encodes the key enzyme for the synthesis of AL 18-hydroxylase. In scientific papers, single nucleotide polymorphism (SNP of AS gene is often studied, such as 5312T, Intron 2, Lys-173/Arg; T-344C, 3097 C/A. 227 SNP of the AS gene were identified in different
Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji
2014-11-01
We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kock, K; Ahlers, C; Schmale, H
1994-05-01
The rat von Ebner's gland protein 1 (VEGP 1) is a secretory protein, which is abundantly expressed in the small acinar von Ebner's salivary glands of the tongue. Based on the primary structure of this protein we have previously suggested that it is a member of the lipocalin superfamily of lipophilic-ligand carrier proteins. Although the physiological role of VEGP 1 is not clear, it might be involved in sensory or protective functions in the taste epithelium. Here, we report the purification of VEGP 1 and of a closely related secretory polypeptide, VEGP 2, the isolation of a cDNA clone encoding VEGP 2, and the isolation and structural characterization of the genes for both proteins. Protein purification by gel-filtration and anion-exchange chromatography using Mono Q revealed the presence of two different immunoreactive VEGP species. N-terminal sequence determination of peptide fragments isolated after protease Asp-N digestion allowed the identification of a new VEGP, named VEGP 2, in addition to the previously characterized VEGP 1. The complete VEGP 2 sequence was deduced from a cDNA clone isolated from a von Ebner's gland cDNA library. The VEGP 2 cDNA encodes a protein of 177 amino acids and is 94% identical to VEGP 1. DNA sequence analysis of the rat VEGP 1 and 2 genes isolated from rat genomic libraries revealed that both span about 4.5 kb and contain seven exons. The VEGP 1 and 2 genes are non-allelic distinct genes in the rat genome and probably arose by gene duplication. The high degree of nucleotide sequence identity in introns A-C (94-100%) points to a recent gene conversion event that included the 5' part of the genes. The genomic organization of the rat VEGP genes closely resembles that found in other lipocalins such as beta-lactoglobulin, mouse urinary proteins (MUPs) and prostaglandin D synthase, and therefore provides clear evidence that VEGPs belong to this superfamily of proteins.
Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak
2015-01-01
Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
Akiva, Eyal; Copp, Janine N; Tokuriki, Nobuhiko; Babbitt, Patricia C
2017-11-07
Insight regarding how diverse enzymatic functions and reactions have evolved from ancestral scaffolds is fundamental to understanding chemical and evolutionary biology, and for the exploitation of enzymes for biotechnology. We undertook an extensive computational analysis using a unique and comprehensive combination of tools that include large-scale phylogenetic reconstruction to determine the sequence, structural, and functional relationships of the functionally diverse flavin mononucleotide-dependent nitroreductase (NTR) superfamily (>24,000 sequences from all domains of life, 54 structures, and >10 enzymatic functions). Our results suggest an evolutionary model in which contemporary subgroups of the superfamily have diverged in a radial manner from a minimal flavin-binding scaffold. We identified the structural design principle for this divergence: Insertions at key positions in the minimal scaffold that, combined with the fixation of key residues, have led to functional specialization. These results will aid future efforts to delineate the emergence of functional diversity in enzyme superfamilies, provide clues for functional inference for superfamily members of unknown function, and facilitate rational redesign of the NTR scaffold. Copyright © 2017 the Author(s). Published by PNAS.
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yonghai Fan
2017-12-01
Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.
Directory of Open Access Journals (Sweden)
Jianrong Wang
2014-12-01
Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk
2011-07-01
Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Systematic classification of the His-Me finger superfamily.
Jablonska, Jagoda; Matelska, Dorota; Steczkiewicz, Kamil; Ginalski, Krzysztof
2017-11-16
The His-Me finger endonucleases, also known as HNH or ββα-metal endonucleases, form a large and diverse protein superfamily. The His-Me finger domain can be found in proteins that play an essential role in cells, including genome maintenance, intron homing, host defense and target offense. Its overall structural compactness and non-specificity make it a perfectly-tailored pathogenic module that participates on both sides of inter- and intra-organismal competition. An extremely low sequence similarity across the superfamily makes it difficult to identify and classify new His-Me fingers. Using state-of-the-art distant homology detection methods, we provide an updated and systematic classification of His-Me finger proteins. In this work, we identified over 100 000 proteins and clustered them into 38 groups, of which three groups are new and cannot be found in any existing public domain database of protein families. Based on an analysis of sequences, structures, domain architectures, and genomic contexts, we provide a careful functional annotation of the poorly characterized members of this superfamily. Our results may inspire further experimental investigations that should address the predicted activity and clarify the potential substrates, to provide more detailed insights into the fundamental biological roles of these proteins. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
Challis, Gregory L.; Stanley-Wall, Nicola R.; Coulthurst, Sarah J.
2012-01-01
There is a continuing need to discover new bioactive natural products, such as antibiotics, in genetically-amenable micro-organisms. We observed that the enteric insect pathogen, Serratia marcescens Db10, produced a diffusible compound that inhibited the growth of Bacillis subtilis and Staphyloccocus aureus. Mapping the genetic locus required for this activity revealed a putative natural product biosynthetic gene cluster, further defined to a six-gene operon named alb1–alb6. Bioinformatic analysis of the proteins encoded by alb1–6 predicted a hybrid non-ribosomal peptide synthetase-polyketide synthase (NRPS-PKS) assembly line (Alb4/5/6), tailoring enzymes (Alb2/3) and an export/resistance protein (Alb1), and suggested that the machinery assembled althiomycin or a related molecule. Althiomycin is a ribosome-inhibiting antibiotic whose biosynthetic machinery had been elusive for decades. Chromatographic and spectroscopic analyses confirmed that wild type S. marcescens produced althiomycin and that production was eliminated on disruption of the alb gene cluster. Construction of mutants with in-frame deletions of specific alb genes demonstrated that Alb2–Alb5 were essential for althiomycin production, whereas Alb6 was required for maximal production of the antibiotic. A phosphopantetheinyl transferase enzyme required for althiomycin biosynthesis was also identified. Expression of Alb1, a predicted major facilitator superfamily efflux pump, conferred althiomycin resistance on another, sensitive, strain of S. marcescens. This is the first report of althiomycin production outside of the Myxobacteria or Streptomyces and paves the way for future exploitation of the biosynthetic machinery, since S. marcescens represents a convenient and tractable producing organism. PMID:23028578
Genetics and physiology of cell wall polysaccharides in the model C4 grass, Setaria viridis spp.
Ermawar, Riksfardini A; Collins, Helen M; Byrt, Caitlin S; Henderson, Marilyn; O'Donovan, Lisa A; Shirley, Neil J; Schwerdt, Julian G; Lahnstein, Jelle; Fincher, Geoffrey B; Burton, Rachel A
2015-10-02
Setaria viridis has emerged as a model species for the larger C4 grasses. Here the cellulose synthase (CesA) superfamily has been defined, with an emphasis on the amounts and distribution of (1,3;1,4)-β-glucan, a cell wall polysaccharide that is characteristic of the grasses and is of considerable value for human health. Orthologous relationship of the CesA and Poales-specific cellulose synthase-like (Csl) genes among Setaria italica (Si), Sorghum bicolor (Sb), Oryza sativa (Os), Brachypodium distachyon (Bradi) and Hordeum vulgare (Hv) were compared using bioinformatics analysis. Transcription profiling of Csl gene families, which are involved in (1,3;1,4)-β-glucan synthesis, was performed using real-time quantitative PCR (Q-PCR). The amount of (1,3;1,4)-β-glucan was measured using a modified Megazyme assay. The fine structures of the (1,3;1,4)-β-glucan, as denoted by the ratio of cellotriosyl to cellotetraosyl residues (DP3:DP4 ratio) was assessed by chromatography (HPLC and HPAEC-PAD). The distribution and deposition of the MLG was examined using the specific antibody BG-1 and captured using fluorescence and transmission electron microscopy (TEM). The cellulose synthase gene superfamily contains 13 CesA and 35 Csl genes in Setaria. Transcript profiling of CslF, CslH and CslJ gene families across a vegetative tissue series indicated that SvCslF6 transcripts were the most abundant relative to all other Csl transcripts. The amounts of (1,3;1,4)-β-glucan in Setaria vegetative tissues ranged from 0.2% to 2.9% w/w with much smaller amounts in developing grain (0.003% to 0.013% w/w). In general, the amount of (1,3;1,4)-β-glucan was greater in younger than in older tissues. The DP3:DP4 ratios varied between tissue types and across developmental stages, and ranged from 2.4 to 3.0:1. The DP3:DP4 ratios in developing grain ranged from 2.5 to 2.8:1. Micrographs revealing the distribution of (1,3;1,4)-β-glucan in walls of different cell types and the data were
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Directory of Open Access Journals (Sweden)
Lydia J R Hunter
Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus
Transient receptor potential channel superfamily: Role in lower urinary tract function.
Ogawa, Teruyuki; Imamura, Tetsuya; Nakazawa, Masaki; Hiragata, Shiro; Nagai, Takashi; Minagawa, Tomonori; Yokoyama, Hitoshi; Ishikawa, Masakuni; Domen, Takahisa; Ishizuka, Osamu
2015-11-01
Lower urinary tract symptoms associated with neurogenic bladder and overactive bladder syndrome are mediated in part by members of the transient receptor potential channel superfamily. The best studied member of this superfamily is the vanilloid receptor. Other transient receptor potential channels, such as the melastatin receptor and the ankyrin receptor, are also active in the pathogenesis of lower urinary tract dysfunction. However, the detailed mechanisms by which the transient receptor potential channels contribute to lower urinary tract symptoms are still not clear, and the therapeutic benefits of modulating transient receptor potential channel activity have not been proved in the clinical setting. In the present review, to better understand the pathophysiology and therapeutic potential for lower urinary tract symptoms, we summarize the presence and role of different members of the transient receptor potential channel superfamily in the lower urinary tract. © 2015 The Japanese Urological Association.
Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek
2014-01-01
Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...
International Nuclear Information System (INIS)
Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua
2013-01-01
1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.
Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae
2017-11-15
Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd
Directory of Open Access Journals (Sweden)
Mei Lan Jin
2017-11-01
Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
RASOnD - A comprehensive resource and search tool for RAS superfamily oncogenes from various species
Directory of Open Access Journals (Sweden)
Singh Tej P
2011-07-01
Full Text Available Abstract Background The Ras superfamily plays an important role in the control of cell signalling and division. Mutations in the Ras genes convert them into active oncogenes. The Ras oncogenes form a major thrust of global cancer research as they are involved in the development and progression of tumors. This has resulted in the exponential growth of data on Ras superfamily across different public databases and in literature. However, no dedicated public resource is currently available for data mining and analysis on this family. The present database was developed to facilitate straightforward accession, retrieval and analysis of information available on Ras oncogenes from one particular site. Description We have developed the RAS Oncogene Database (RASOnD as a comprehensive knowledgebase that provides integrated and curated information on a single platform for oncogenes of Ras superfamily. RASOnD encompasses exhaustive genomics and proteomics data existing across diverse publicly accessible databases. This resource presently includes overall 199,046 entries from 101 different species. It provides a search tool to generate information about their nucleotide and amino acid sequences, single nucleotide polymorphisms, chromosome positions, orthologies, motifs, structures, related pathways and associated diseases. We have implemented a number of user-friendly search interfaces and sequence analysis tools. At present the user can (i browse the data (ii search any field through a simple or advance search interface and (iii perform a BLAST search and subsequently CLUSTALW multiple sequence alignment by selecting sequences of Ras oncogenes. The Generic gene browser, GBrowse, JMOL for structural visualization and TREEVIEW for phylograms have been integrated for clear perception of retrieved data. External links to related databases have been included in RASOnD. Conclusions This database is a resource and search tool dedicated to Ras oncogenes. It has
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Sun, Miao-Miao; Han, Liang; Zhang, Fu-Kai; Zhou, Dong-Hui; Wang, Shu-Qing; Ma, Jun; Zhu, Xing-Quan; Liu, Guo-Hua
2018-01-01
Marshallagia marshalli (Nematoda: Trichostrongylidae) infection can lead to serious parasitic gastroenteritis in sheep, goat, and wild ruminant, causing significant socioeconomic losses worldwide. Up to now, the study concerning the molecular biology of M. marshalli is limited. Herein, we sequenced the complete mitochondrial (mt) genome of M. marshalli and examined its phylogenetic relationship with selected members of the superfamily Trichostrongyloidea using Bayesian inference (BI) based on concatenated mt amino acid sequence datasets. The complete mt genome sequence of M. marshalli is 13,891 bp, including 12 protein-coding genes, 22 transfer RNA genes, and 2 ribosomal RNA genes. All protein-coding genes are transcribed in the same direction. Phylogenetic analyses based on concatenated amino acid sequences of the 12 protein-coding genes supported the monophylies of the families Haemonchidae, Molineidae, and Dictyocaulidae with strong statistical support, but rejected the monophyly of the family Trichostrongylidae. The determination of the complete mt genome sequence of M. marshalli provides novel genetic markers for studying the systematics, population genetics, and molecular epidemiology of M. marshalli and its congeners.
Functional diversity of the superfamily of K⁺ transporters to meet various requirements.
Diskowski, Marina; Mikusevic, Vedrana; Stock, Charlott; Hänelt, Inga
2015-09-01
The superfamily of K+ transporters unites proteins from plants, fungi, bacteria, and archaea that translocate K+ and/or Na+ across membranes. These proteins are key components in osmotic regulation, pH homeostasis, and resistance to high salinity and dryness. The members of the superfamily are closely related to K+ channels such as KcsA but also show several striking differences that are attributed to their altered functions. This review highlights these functional differences, focusing on the bacterial superfamily members KtrB, TrkH, and KdpA. The functional variations within the family and comparison to MPM-type K+ channels are discussed in light of the recently solved structures of the Ktr and Trk systems.
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor
2018-04-01
Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan
2018-05-11
Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type
Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder
2017-11-03
Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.
Directory of Open Access Journals (Sweden)
Linjie Wang
Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.
Abraham, Anup; Chandler, Douglas E
2017-10-01
Proteins of the CAP superfamily play numerous roles in reproduction, innate immune responses, cancer biology, and venom toxicology. Here we document the breadth of the CAP (Cysteine-RIch Secretory Protein (CRISP), Antigen 5, and Pathogenesis-Related) protein superfamily and trace the major events in its evolution using amino acid sequence homology and the positions of exon/intron borders within their genes. Seldom acknowledged in the literature, we find that many of the CAP subfamilies present in mammals, where they were originally characterized, have distinct homologues in the invertebrate phyla. Early eukaryotic CAP genes contained only one exon inherited from prokaryotic predecessors and as evolution progressed an increasing number of introns were inserted, reaching 2-5 in the invertebrate world and 5-15 in the vertebrate world. Focusing on the CRISP subfamily, we propose that these proteins evolved in three major steps: (1) origination of the CAP/PR/SCP domain in bacteria, (2) addition of a small Hinge domain to produce the two-domain SCP-like proteins found in roundworms and anthropoids, and (3) addition of an Ion Channel Regulatory domain, borrowed from invertebrate peptide toxins, to produce full length, three-domain CRISP proteins, first seen in insects and later to diversify into multiple subtypes in the vertebrate world.
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
Enzyme That Makes You Cry-Crystal Structure of Lachrymatory Factor Synthase from Allium cepa.
Silvaroli, Josie A; Pleshinger, Matthew J; Banerjee, Surajit; Kiser, Philip D; Golczak, Marcin
2017-09-15
The biochemical pathway that gives onions their savor is part of the chemical warfare against microbes and animals. This defense mechanism involves formation of a volatile lachrymatory factor (LF) ((Z)-propanethial S-oxide) that causes familiar eye irritation associated with onion chopping. LF is produced in a reaction catalyzed by lachrymatory factor synthase (LFS). The principles by which LFS facilitates conversion of a sulfenic acid substrate into LF have been difficult to experimentally examine owing to the inherent substrate reactivity and lability of LF. To shed light on the mechanism of LF production in the onion, we solved crystal structures of LFS in an apo-form and in complex with a substrate analogue, crotyl alcohol. The enzyme closely resembles the helix-grip fold characteristic for plant representatives of the START (star-related lipid transfer) domain-containing protein superfamily. By comparing the structures of LFS to that of the abscisic acid receptor, PYL10, a representative of the START protein superfamily, we elucidated structural adaptations underlying the catalytic activity of LFS. We also delineated the architecture of the active site, and based on the orientation of the ligand, we propose a mechanism of catalysis that involves sequential proton transfer accompanied by formation of a carbanion intermediate. These findings reconcile chemical and biochemical information regarding thioaldehyde S-oxide formation and close a long-lasting gap in understanding of the mechanism responsible for LF production in the onion.
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia
2016-11-01
Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan
2016-01-01
The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
of endothelial nitric oxide synthase gene and serum level of vascular ...
African Journals Online (AJOL)
uwerhiavwe
Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
The CSLA and CSLC Families: Recent Advances and Future Perspectives
Directory of Open Access Journals (Sweden)
Aaron Howard Liepman
2012-05-01
Full Text Available The CELLULOSE SYNTHASE (CESA superfamily of proteins contains several sub-families of closely related CELLULOSE SYNTHASE-LIKE (CSL sequences, Among these, the CSLA and CSLC families are closely related to each other and are the most evolutionarily divergent from the CESA family. Significant progress has been made with the functional characterization of CSLA and CSLC genes, which have been shown to encode enzymes with 1,4-B-glycan synthase activities involved in the biosynthesis of mannan and possibly xyloglucan backbones, respectively. This review examines recent work on the CSLA and CSLC families from evolutionary, molecular, and biochemical perspectives. We pose a series of questions, whose answers likely will provide further insight about the specific functions of members of the CSLA and CSLC families and about plant polysaccharide biosynthesis is general.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D
2001-09-01
The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by
International Nuclear Information System (INIS)
Bera, Asim K.; Atanasova, Vesna; Gamage, Swarna; Robinson, Howard; Parsons, James F.
2010-01-01
The structure of EhpF from P. agglomerans has been solved alone and in complex with phenazine-1,6-dicarboxylate. Apo EhpF was solved and refined in two different space groups at 1.95 and 2.3 Å resolution and the EhpF–phenazine-1,6-dicarboxylate complex structure was determined at 2.8 Å resolution. The structure of EhpF, a 41 kDa protein that functions in the biosynthetic pathway leading to the broad-spectrum antimicrobial compound d-alanylgriseoluteic acid (AGA), is reported. A cluster of approximately 16 genes, including ehpF, located on a 200 kbp plasmid native to certain strains of Pantoea agglomerans encodes the proteins that are required for the conversion of chorismic acid to AGA. Phenazine-1,6-dicarboxylate has been identified as an intermediate in AGA biosynthesis and deletion of ehpF results in accumulation of this compound in vivo. The crystallographic data presented here reveal that EhpF is an atypical member of the acyl-CoA synthase or ANL superfamily of adenylating enzymes. These enzymes typically catalyze two-step reactions involving adenylation of a carboxylate substrate followed by transfer of the substrate from AMP to coenzyme A or another phosphopantetheine. EhpF is distinguished by the absence of the C-terminal domain that is characteristic of enzymes from this family and is involved in phosphopantetheine binding and in the second half of the canonical two-step reaction that is typically observed. Based on the structure of EhpF and a bioinformatic analysis, it is proposed that EhpF and EhpG convert phenazine-1,6-dicarboxylate to 6-formylphenazine-1-carboxylate via an adenylyl intermediate
International Nuclear Information System (INIS)
Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra
2008-01-01
The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative
An orphan viral TNF receptor superfamily member identified in lymphocystis disease virus.
Pontejo, Sergio M; Sánchez, Carolina; Martín, Rocío; Mulero, Victoriano; Alcami, Antonio; Alejo, Alí
2013-06-07
Lymphocystis disease virus (LCDV) is a large icosahedral dsDNA-containing virus of the Lymphocystivirus genus within the Iridoviridae family that can cause disease in more than 140 marine and freshwater fish species. While several isolates have been charcaterized and classified into distinct genotypes the complete genomic sequence is currently only available from two species, the LCDV-1, isolated from flounder (Platichtys flesus) in Europe and the LCDV-C, isolated from Japanese cultured flounder (Paralichthys olivaceus) in China. Analysis of the genome of LCDV-C showed it to encode a protein named LDVICp016 with similarities to the Tumour necrosis factor receptor (TNFR) superfamily with immunomodulatory potential. We have expressed and purified the recombinant protein LDVICp016 and screened for potential interaction partners using surface plasmon resonance. Commercially available human and mouse members of the TNF superfamily (TNFSF), along with a representative set of fish-derived TNFSF were tested.We have found the LDVICp016 protein to be secreted and we have identified a second viral TNFR encoded by ORF 095 of the same virus. None of the 42 tested proteins were found to interact with LDVICp016. We show that LDVICp016 is a secreted protein belonging to the TNF receptor family that may be part of a larger gene family in Lymphocystiviruses. While the ligand of this protein remains unknown, possibly due to the species specific nature of this interaction, further investigations into the potential role of this protein in the blockade of immune responses in its fish host are required.
Directory of Open Access Journals (Sweden)
Roman eGangl
2015-09-01
Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.
New O-superfamily conotoxins from Conus striatus inhabited near Chinese Hainan Island
Institute of Scientific and Technical Information of China (English)
无
2000-01-01
Conotoxins are short peptide-toxins with specific targets and large diversity.They are useful in analgesia,neuroprotection,detection of some kinds of deseases,and receptor and ion channel study.In order to explore the conotoxin resourses of Chinese oceans,rapid amplification of 3' cDNA ends (RACE) method was utilized to systemically analyze the O-superfamily conotoxin content of Conus striatus inhabited near Chinese Hainan Island.Six new O-superfamily conopeptides were identified,one of which is highly homologous to MVIIA,an N-type calcium channel antagonist.
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Directory of Open Access Journals (Sweden)
Marquez Rodolfo
2004-09-01
Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.
Bacterial Multidrug Efflux Pumps of the Major Facilitator Superfamily as Targets for Modulation.
Kumar, Sanath; He, Guixin; Kakarla, Prathusha; Shrestha, Ugina; Ranjana, K C; Ranaweera, Indrika; Willmon, T Mark; Barr, Sharla R; Hernandez, Alberto J; Varela, Manuel F
2016-01-01
Causative agents of infectious disease that are multidrug resistant bacterial pathogens represent a serious public health concern due to the increasingly difficult nature of achieving efficacious clinical treatments. Of the various acquired and intrinsic antimicrobial agent resistance determinants, integral-membrane multidrug efflux pumps of the major facilitator superfamily constitute a major mechanism of bacterial resistance. The major facilitator superfamily (MFS) encompasses thousands of known related secondary active and passive solute transporters, including multidrug efflux pumps, from bacteria to humans. This review article addresses recent developments involving the targeting by various modulators of bacterial multidrug efflux pumps from the major facilitator superfamily. It is currently of tremendous interest to modulate bacterial multidrug efflux pumps in order to eventually restore the clinical efficacy of therapeutic agents against recalcitrant bacterial infections. Such MFS multidrug efflux pumps are good targets for modulation.
Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai
2017-02-01
Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Svrbicka, Alexandra; Toth Hervay, Nora; Gbelska, Yvetta
2016-03-01
Boron is an essential micronutrient for living cells, yet its excess causes toxicity. To date, the mechanisms of boron toxicity are poorly understood. Recently, the ScATR1 gene has been identified encoding the main boron efflux pump in Saccharomyces cerevisiae. In this study, we analyzed the ScATR1 ortholog in Kluyveromyces lactis--the KNQ1 gene, to understand whether it participates in boron stress tolerance. We found that the KNQ1 gene, encoding a permease belonging to the major facilitator superfamily, is required for K. lactis boron tolerance. Deletion of the KNQ1 gene led to boron sensitivity and its overexpression increased K. lactis boron tolerance. The KNQ1 expression was induced by boron and the intracellular boron concentration was controlled by Knq1p. The KNQ1 promoter contains two putative binding motifs for the AP-1-like transcription factor KlYap1p playing a central role in oxidative stress defense. Our results indicate that the induction of the KNQ1 expression requires the presence of KlYap1p and that Knq1p like its ortholog ScAtr1p in S. cerevisiae functions as a boron efflux pump providing boron resistance in K. lactis.
International Nuclear Information System (INIS)
Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand
2008-01-01
Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses
Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R
1994-01-01
We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...
DEFF Research Database (Denmark)
Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva
2005-01-01
The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...
Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante
2015-11-01
Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
Nuclear Receptors in atherosclerosis: a superfamily with many 'Goodfellas'
Kurakula, Kondababu; Hamers, Anouk A. J.; de Waard, Vivian; de Vries, Carlie J. M.
2013-01-01
Nuclear Receptors form a superfamily of 48 transcription factors that exhibit a plethora of functions in steroid hormone signaling, regulation of metabolism, circadian rhythm and cellular differentiation. In this review, we describe our current knowledge on the role of Nuclear Receptors in
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx
2007-08-01
To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.
Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.
2006-01-01
Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.
2017-01-01
Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be considered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu
2008-08-01
Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.
Enzyme That Makes You Cry–Crystal Structure of Lachrymatory Factor Synthase from Allium cepa
Energy Technology Data Exchange (ETDEWEB)
Silvaroli, Josie A. [Department; Pleshinger, Matthew J. [Department; College of Wooster, Wooster, Ohio, United States; Banerjee, Surajit [Department; Northeastern; Kiser, Philip D. [Department; Research; Cleveland; Golczak, Marcin [Department; Cleveland
2017-07-26
The biochemical pathway that gives onions their savor is part of the chemical warfare against microbes and animals. This defense mechanism involves formation of a volatile lachrymatory factor (LF) ((Z)-propanethial S-oxide) that causes familiar eye irritation associated with onion chopping. LF is produced in a reaction catalyzed by lachrymatory factor synthase (LFS). The principles by which LFS facilitates conversion of a sulfenic acid substrate into LF have been difficult to experimentally examine owing to the inherent substrate reactivity and lability of LF. To shed light on the mechanism of LF production in the onion, we solved crystal structures of LFS in an apo-form and in complex with a substrate analogue, crotyl alcohol. The enzyme closely resembles the helix-grip fold characteristic for plant representatives of the START (star-related lipid transfer) domain-containing protein superfamily. By comparing the structures of LFS to that of the abscisic acid receptor, PYL10, a representative of the START protein superfamily, we elucidated structural adaptations underlying the catalytic activity of LFS. We also delineated the architecture of the active site, and based on the orientation of the ligand, we propose a mechanism of catalysis that involves sequential proton transfer accompanied by formation of a carbanion intermediate. These findings reconcile chemical and biochemical information regarding thioaldehyde S-oxide formation and close a long-lasting gap in understanding of the mechanism responsible for LF production in the onion.
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
Perera, Varahenage R.; Lapek, John D.; Newton, Gerald L.; Gonzalez, David J.; Pogliano, Kit
2018-01-01
Bacillithiol is a low molecular weight thiol found in Firmicutes that is analogous to glutathione, which is absent in these bacteria. Bacillithiol transferases catalyze the transfer of bacillithiol to various substrates. The S-transferase-like (STL) superfamily contains over 30,000 putative members, including bacillithiol transferases. Proteins in this family are extremely divergent and are related by structural rather than sequence similarity, leaving it unclear if all share the same biochemical activity. Bacillus subtilis encodes eight predicted STL superfamily members, only one of which has been shown to be a bacillithiol transferase. Here we find that the seven remaining proteins show varying levels of metal dependent bacillithiol transferase activity. We have renamed the eight enzymes BstA-H. Mass spectrometry and gene expression studies revealed that all of the enzymes are produced to varying levels during growth and sporulation, with BstB and BstE being the most abundant and BstF and BstH being the least abundant. Interestingly, several bacillithiol transferases are induced in the mother cell during sporulation. A strain lacking all eight bacillithiol transferases showed normal growth in the presence of stressors that adversely affect growth of bacillithiol-deficient strains, such as paraquat and CdCl2. Thus, the STL bacillithiol transferases represent a new group of proteins that play currently unknown, but potentially significant roles in bacillithiol-dependent reactions. We conclude that these enzymes are highly divergent, perhaps to cope with an equally diverse array of endogenous or exogenous toxic metabolites and oxidants. PMID:29451913
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Directory of Open Access Journals (Sweden)
Linda Koshy
2008-01-01
Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.
Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-07-01
The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.
Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi
2016-12-01
To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.
Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun
2017-09-01
Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.
Self-Assembly in the Ferritin Nano-Cage Protein Superfamily
Directory of Open Access Journals (Sweden)
Yu Zhang
2011-08-01
Full Text Available Protein self-assembly, through specific, high affinity, and geometrically constraining protein-protein interactions, can control and lead to complex cellular nano-structures. Establishing an understanding of the underlying principles that govern protein self-assembly is not only essential to appreciate the fundamental biological functions of these structures, but could also provide a basis for their enhancement for nano-material applications. The ferritins are a superfamily of well studied proteins that self-assemble into hollow cage-like structures which are ubiquitously found in both prokaryotes and eukaryotes. Structural studies have revealed that many members of the ferritin family can self-assemble into nano-cages of two types. Maxi-ferritins form hollow spheres with octahedral symmetry composed of twenty-four monomers. Mini-ferritins, on the other hand, are tetrahedrally symmetric, hollow assemblies composed of twelve monomers. This review will focus on the structure of members of the ferritin superfamily, the mechanism of ferritin self-assembly and the structure-function relations of these proteins.
Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.
Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi
2007-11-01
Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.
Directory of Open Access Journals (Sweden)
G. V. Matyushin
2017-01-01
Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group. In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men, this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Quiles-Puchalt, Nuria; Tormo-Más, María Ángeles; Campoy, Susana; Toledo-Arana, Alejandro; Monedero, Vicente; Lasa, Íñigo; Novick, Richard P.; Christie, Gail E.; Penadés, José R.
2013-01-01
The propagation of bacteriophages and other mobile genetic elements requires exploitation of the phage mechanisms involved in virion assembly and DNA packaging. Here, we identified and characterized four different families of phage-encoded proteins that function as activators required for transcription of the late operons (morphogenetic and lysis genes) in a large group of phages infecting Gram-positive bacteria. These regulators constitute a super-family of proteins, here named late transcriptional regulators (Ltr), which share common structural, biochemical and functional characteristics and are unique to this group of phages. They are all small basic proteins, encoded by genes present at the end of the early gene cluster in their respective phage genomes and expressed under cI repressor control. To control expression of the late operon, the Ltr proteins bind to a DNA repeat region situated upstream of the terS gene, activating its transcription. This involves the C-terminal part of the Ltr proteins, which control specificity for the DNA repeat region. Finally, we show that the Ltr proteins are the only phage-encoded proteins required for the activation of the packaging and lysis modules. In summary, we provide evidence that phage packaging and lysis is a conserved mechanism in Siphoviridae infecting a wide variety of Gram-positive bacteria. PMID:23771138
Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.
2015-01-01
Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the
O.I. Kadykova; P.P. Kravchun
2016-01-01
The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
DEFF Research Database (Denmark)
Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure
2001-01-01
no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.
Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice
2018-01-06
The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.
Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan
2009-09-23
Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.
Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.
Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François
2018-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.
Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.
Directory of Open Access Journals (Sweden)
Imke Schmitt
Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.
Multi-substrate terpene synthases: their occurrence and physiological significance
Directory of Open Access Journals (Sweden)
Leila Pazouki
2016-07-01
Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.
2013-01-01
Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205
Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg
2013-05-16
The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.
Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing
2009-05-13
One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert
2017-04-01
Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.
Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard
2011-01-01
Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 su...
Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook
2008-01-01
FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
Eom, Dae Seok; Inoue, Shinya; Patterson, Larissa B; Gordon, Tiffany N; Slingwine, Rebecca; Kondo, Shigeru; Watanabe, Masakatsu; Parichy, David M
2012-01-01
The zebrafish adult pigment pattern has emerged as a useful model for understanding the development and evolution of adult form as well as pattern-forming mechanisms more generally. In this species, a series of horizontal melanophore stripes arises during the larval-to-adult transformation, but the genetic and cellular bases for stripe formation remain largely unknown. Here, we show that the seurat mutant phenotype, consisting of an irregular spotted pattern, arises from lesions in the gene encoding Immunoglobulin superfamily member 11 (Igsf11). We find that Igsf11 is expressed by melanophores and their precursors, and we demonstrate by cell transplantation and genetic rescue that igsf11 functions autonomously to this lineage in promoting adult stripe development. Further analyses of cell behaviors in vitro, in vivo, and in explant cultures ex vivo demonstrate that Igsf11 mediates adhesive interactions and that mutants for igsf11 exhibit defects in both the migration and survival of melanophores and their precursors. These findings identify the first in vivo requirements for igsf11 as well as the first instance of an immunoglobulin superfamily member functioning in pigment cell development and patterning. Our results provide new insights into adult pigment pattern morphogenesis and how cellular interactions mediate pattern formation.
Directory of Open Access Journals (Sweden)
Dae Seok Eom
Full Text Available The zebrafish adult pigment pattern has emerged as a useful model for understanding the development and evolution of adult form as well as pattern-forming mechanisms more generally. In this species, a series of horizontal melanophore stripes arises during the larval-to-adult transformation, but the genetic and cellular bases for stripe formation remain largely unknown. Here, we show that the seurat mutant phenotype, consisting of an irregular spotted pattern, arises from lesions in the gene encoding Immunoglobulin superfamily member 11 (Igsf11. We find that Igsf11 is expressed by melanophores and their precursors, and we demonstrate by cell transplantation and genetic rescue that igsf11 functions autonomously to this lineage in promoting adult stripe development. Further analyses of cell behaviors in vitro, in vivo, and in explant cultures ex vivo demonstrate that Igsf11 mediates adhesive interactions and that mutants for igsf11 exhibit defects in both the migration and survival of melanophores and their precursors. These findings identify the first in vivo requirements for igsf11 as well as the first instance of an immunoglobulin superfamily member functioning in pigment cell development and patterning. Our results provide new insights into adult pigment pattern morphogenesis and how cellular interactions mediate pattern formation.
Exploring and Expanding the Fatty-Acid-Binding Protein Superfamily in Fasciola Species.
Morphew, Russell M; Wilkinson, Toby J; Mackintosh, Neil; Jahndel, Veronika; Paterson, Steve; McVeigh, Paul; Abbas Abidi, Syed M; Saifullah, Khalid; Raman, Muthusamy; Ravikumar, Gopalakrishnan; LaCourse, James; Maule, Aaron; Brophy, Peter M
2016-09-02
The liver flukes Fasciola hepatica and F. gigantica infect livestock worldwide and threaten food security with climate change and problematic control measures spreading disease. Fascioliasis is also a foodborne disease with up to 17 million humans infected. In the absence of vaccines, treatment depends on triclabendazole (TCBZ), and overuse has led to widespread resistance, compromising future TCBZ control. Reductionist biology from many laboratories has predicted new therapeutic targets. To this end, the fatty-acid-binding protein (FABP) superfamily has proposed multifunctional roles, including functions intersecting vaccine and drug therapy, such as immune modulation and anthelmintic sequestration. Research is hindered by a lack of understanding of the full FABP superfamily complement. Although discovery studies predicted FABPs as promising vaccine candidates, it is unclear if uncharacterized FABPs are more relevant for vaccine formulations. We have coupled genome, transcriptome, and EST data mining with proteomics and phylogenetics to reveal a liver fluke FABP superfamily of seven clades: previously identified clades I-III and newly identified clades IV-VII. All new clade FABPs were analyzed using bioinformatics and cloned from both liver flukes. The extended FABP data set will provide new study tools to research the role of FABPs in parasite biology and as therapy targets.
Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay
2012-12-01
Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.
Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan
2017-01-01
Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.
Energy Technology Data Exchange (ETDEWEB)
Richard L. Blanton
2004-02-19
OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.
Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles
2003-01-01
Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1999-01-01
Four cDNAs encoding phosphoribosyl diphosphate (PRPP) synthase were isolated from a spinach (Spinacia oleracea) cDNA library by complementation of an Escherichia coli Δprs mutation. The four gene products produced PRPP in vitro from ATP and ribose-5-phosphate. Two of the enzymes (isozymes 1 and 2...
International Nuclear Information System (INIS)
Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat
2011-01-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate
Energy Technology Data Exchange (ETDEWEB)
Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)
2011-12-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk
Traverso, Lucila; Lavore, Andrés; Sierra, Ivana; Palacio, Victorio; Martinez-Barnetche, Jesús; Latorre-Estivalis, José Manuel; Mougabure-Cueto, Gaston; Francini, Flavio; Lorenzo, Marcelo G; Rodríguez, Mario Henry; Ons, Sheila; Rivera-Pomar, Rolando V
2017-02-01
Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs), Cytochromes P450 (CYPs) and Carboxyl/Cholinesterases (CCEs). Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease. The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms on the high
Directory of Open Access Journals (Sweden)
Lucila Traverso
2017-02-01
Full Text Available Triatomine insects are vectors of Trypanosoma cruzi, a protozoan parasite that is the causative agent of Chagas' disease. This is a neglected disease affecting approximately 8 million people in Latin America. The existence of diverse pyrethroid resistant populations of at least two species demonstrates the potential of triatomines to develop high levels of insecticide resistance. Therefore, the incorporation of strategies for resistance management is a main concern for vector control programs. Three enzymatic superfamilies are thought to mediate xenobiotic detoxification and resistance: Glutathione Transferases (GSTs, Cytochromes P450 (CYPs and Carboxyl/Cholinesterases (CCEs. Improving our knowledge of key triatomine detoxification enzymes will strengthen our understanding of insecticide resistance processes in vectors of Chagas' disease.The discovery and description of detoxification gene superfamilies in normalized transcriptomes of three triatomine species: Triatoma dimidiata, Triatoma infestans and Triatoma pallidipennis is presented. Furthermore, a comparative analysis of these superfamilies among the triatomine transcriptomes and the genome of Rhodnius prolixus, also a triatomine vector of Chagas' disease, and other well-studied insect genomes was performed. The expression pattern of detoxification genes in R. prolixus transcriptomes from key organs was analyzed. The comparisons reveal gene expansions in Sigma class GSTs, CYP3 in CYP superfamily and clade E in CCE superfamily. Moreover, several CYP families identified in these triatomines have not yet been described in other insects. Conversely, several groups of insecticide resistance related enzymes within each enzyme superfamily are reduced or lacking in triatomines. Furthermore, our qRT-PCR results showed an increase in the expression of a CYP4 gene in a T. infestans population resistant to pyrethroids. These results could point to an involvement of metabolic detoxification mechanisms
Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby
2013-09-06
Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular
Kuznetsova, Ekaterina; Nocek, Boguslaw; Brown, Greg; Makarova, Kira S; Flick, Robert; Wolf, Yuri I; Khusnutdinova, Anna; Evdokimova, Elena; Jin, Ke; Tan, Kemin; Hanson, Andrew D; Hasnain, Ghulam; Zallot, Rémi; de Crécy-Lagard, Valérie; Babu, Mohan; Savchenko, Alexei; Joachimiak, Andrzej; Edwards, Aled M; Koonin, Eugene V; Yakunin, Alexander F
2015-07-24
The haloacid dehalogenase (HAD)-like enzymes comprise a large superfamily of phosphohydrolases present in all organisms. The Saccharomyces cerevisiae genome encodes at least 19 soluble HADs, including 10 uncharacterized proteins. Here, we biochemically characterized 13 yeast phosphatases from the HAD superfamily, which includes both specific and promiscuous enzymes active against various phosphorylated metabolites and peptides with several HADs implicated in detoxification of phosphorylated compounds and pseudouridine. The crystal structures of four yeast HADs provided insight into their active sites, whereas the structure of the YKR070W dimer in complex with substrate revealed a composite substrate-binding site. Although the S. cerevisiae and Escherichia coli HADs share low sequence similarities, the comparison of their substrate profiles revealed seven phosphatases with common preferred substrates. The cluster of secondary substrates supporting significant activity of both S. cerevisiae and E. coli HADs includes 28 common metabolites that appear to represent the pool of potential activities for the evolution of novel HAD phosphatases. Evolution of novel substrate specificities of HAD phosphatases shows no strict correlation with sequence divergence. Thus, evolution of the HAD superfamily combines the conservation of the overall substrate pool and the substrate profiles of some enzymes with remarkable biochemical and structural flexibility of other superfamily members. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
TNF and TNF Receptor Superfamily Members in HIV infection: New Cellular Targets for Therapy?
Directory of Open Access Journals (Sweden)
Amit Kumar
2013-01-01
Full Text Available Tumor necrosis factor (TNF and TNF receptors (TNFR superfamily members are engaged in diverse cellular phenomena such as cellular proliferation, morphogenesis, apoptosis, inflammation, and immune regulation. Their role in regulating viral infections has been well documented. Viruses have evolved with numerous strategies to interfere with TNF-mediated signaling indicating the importance of TNF and TNFR superfamily in viral pathogenesis. Recent research reports suggest that TNF and TNFRs play an important role in the pathogenesis of HIV. TNFR signaling modulates HIV replication and HIV proteins interfere with TNF/TNFR pathways. Since immune activation and inflammation are the hallmark of HIV infection, the use of TNF inhibitors can have significant impact on HIV disease progression. In this review, we will describe how HIV infection is modulated by signaling mediated through members of TNF and TNFR superfamily and in turn how these latter could be targeted by HIV proteins. Finally, we will discuss the emerging therapeutics options based on modulation of TNF activity that could ultimately lead to the cure of HIV-infected patients.
Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K
1989-11-01
Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.
Habenicht, A; Quesada, A; Cerff, R
1997-10-01
A cDNA-library has been constructed from Nicotiana plumbaginifolia seedlings, and the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase (GapN, EC 1.2.1.9) was isolated by plaque hybridization using the cDNA from pea as a heterologous probe. The cDNA comprises the entire GapN coding region. A putative polyadenylation signal is identified. Phylogenetic analysis based on the deduced amino acid sequences revealed that the GapN gene family represents a separate ancient branch within the aldehyde dehydrogenase superfamily. It can be shown that the GapN gene family and other distinct branches of the superfamily have its phylogenetic origin before the separation of primary life-forms. This further demonstrates that already very early in evolution, a broad diversification of the aldehyde dehydrogenases led to the formation of the superfamily.
Directory of Open Access Journals (Sweden)
Mu eLi
2016-02-01
Full Text Available Chitin synthases (CHSs are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene
Lunkenbein, S.; Coiner, H.; Vos, de C.H.; Schaart, J.G.; Boone, M.J.; Krens, F.A.; Schwab, W.; Salentijn, E.M.J.
2006-01-01
An octaploid (Fragaria × ananassa cv. Calypso) genotype of strawberry was transformed with an antisense chalcone synthase (CHS) gene construct using a ripening related CHS cDNA from Fragaria × ananassa cv. Elsanta under the control of the constitutive CaMV 35S promoter via Agrobacterium tumefaciens.
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Sierra M Li
Full Text Available Monoallelic expression is an integral component of regulation of a number of essential genes and gene families. To probe for allele-specific expression in cells of CNS origin, we used next-generation sequencing (RNA-seq to analyze four clonal neural stem cell (NSC lines derived from Mus musculus C57BL/6 (B6×Mus musculus molossinus (JF1 adult female mice. We established a JF1 cSNP library, then ascertained transcriptome-wide expression from B6 vs. JF1 alleles in the NSC lines. Validating the assay, we found that 262 of 268 X-linked genes evaluable in at least one cell line showed monoallelic expression (at least 85% expression of the predominant allele, p-value<0.05. For autosomal genes 170 of 7,198 genes (2.4% of the total showed monoallelic expression in at least 2 evaluable cell lines. The group included eight known imprinted genes with the expected pattern of allele-specific expression. Among the other autosomal genes with monoallelic expression were five members of the glutathione transferase gene superfamily, which processes xenobiotic compounds as well as carcinogens and cancer therapeutic agents. Monoallelic expression within this superfamily thus may play a functional role in the response to diverse and potentially lethal exogenous factors, as is the case for the immunoglobulin and olfactory receptor superfamilies. Other genes and gene families showing monoallelic expression include the annexin gene family and the Thy1 gene, both linked to inflammation and cancer, as well as genes linked to alcohol dependence (Gabrg1 and epilepsy (Kcnma1. The annotated set of genes will provide a resource for investigation of mechanisms underlying certain cases of these and other major disorders.
Targeting of the tumor necrosis factor receptor superfamily for cancer immunotherapy
Bremer, Edwin
2013-01-01
The tumor necrosis factor (TNF) ligand and cognate TNF receptor superfamilies constitute an important regulatory axis that is pivotal for immune homeostasis and correct execution of immune responses. TNF ligands and receptors are involved in diverse biological processes ranging from the selective
Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei
2015-04-01
Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
Phuong, Mark A; Mahardika, Gusti N
2018-05-01
To expand our capacity to discover venom sequences from the genomes of venomous organisms, we applied targeted sequencing techniques to selectively recover venom gene superfamilies and nontoxin loci from the genomes of 32 cone snail species (family, Conidae), a diverse group of marine gastropods that capture their prey using a cocktail of neurotoxic peptides (conotoxins). We were able to successfully recover conotoxin gene superfamilies across all species with high confidence (> 100× coverage) and used these data to provide new insights into conotoxin evolution. First, we found that conotoxin gene superfamilies are composed of one to six exons and are typically short in length (mean = ∼85 bp). Second, we expanded our understanding of the following genetic features of conotoxin evolution: 1) positive selection, where exons coding the mature toxin region were often three times more divergent than their adjacent noncoding regions, 2) expression regulation, with comparisons to transcriptome data showing that cone snails only express a fraction of the genes available in their genome (24-63%), and 3) extensive gene turnover, where Conidae species varied from 120 to 859 conotoxin gene copies. Finally, using comparative phylogenetic methods, we found that while diet specificity did not predict patterns of conotoxin evolution, dietary breadth was positively correlated with total conotoxin gene diversity. Overall, the targeted sequencing technique demonstrated here has the potential to radically increase the pace at which venom gene families are sequenced and studied, reshaping our ability to understand the impact of genetic changes on ecologically relevant phenotypes and subsequent diversification.
Directory of Open Access Journals (Sweden)
Deqiang Tai
Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.
Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja
2017-07-01
The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.
Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C
2015-07-28
Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.
International Nuclear Information System (INIS)
Christie, J.M.; Jenkins, G.I.
1996-01-01
UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species
Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi
2016-07-01
Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.
Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru
2012-11-01
5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...
Directory of Open Access Journals (Sweden)
Raúl González
2015-08-01
Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Pejcha, Robert; Ludwig, Martha L. (Michigan)
2010-03-08
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
International Nuclear Information System (INIS)
Pejcha, Robert; Ludwig, Martha L.
2005-01-01
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Directory of Open Access Journals (Sweden)
Robert Pejchal
2005-02-01
Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Directory of Open Access Journals (Sweden)
Aarón Barraza
2016-11-01
Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.
Directory of Open Access Journals (Sweden)
Vittoria Roncalli
Full Text Available Detoxification is a fundamental cellular stress defense mechanism, which allows an organism to survive or even thrive in the presence of environmental toxins and/or pollutants. The glutathione S-transferase (GST superfamily is a set of enzymes involved in the detoxification process. This highly diverse protein superfamily is characterized by multiple gene duplications, with over 40 GST genes reported in some insects. However, less is known about the GST superfamily in marine organisms, including crustaceans. The availability of two de novo transcriptomes for the copepod, Calanus finmarchicus, provided an opportunity for an in depth study of the GST superfamily in a marine crustacean. The transcriptomes were searched for putative GST-encoding transcripts using known GST proteins from three arthropods as queries. The identified transcripts were then translated into proteins, analyzed for structural domains, and annotated using reciprocal BLAST analysis. Mining the two transcriptomes yielded a total of 41 predicted GST proteins belonging to the cytosolic, mitochondrial or microsomal classes. Phylogenetic analysis of the cytosolic GSTs validated their annotation into six different subclasses. The predicted proteins are likely to represent the products of distinct genes, suggesting that the diversity of GSTs in C. finmarchicus exceeds or rivals that described for insects. Analysis of relative gene expression in different developmental stages indicated low levels of GST expression in embryos, and relatively high expression in late copepodites and adult females for several cytosolic GSTs. A diverse diet and complex life history are factors that might be driving the multiplicity of GSTs in C. finmarchicus, as this copepod is commonly exposed to a variety of natural toxins. Hence, diversity in detoxification pathway proteins may well be key to their survival.
Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F
2014-10-01
A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells.
DEFF Research Database (Denmark)
Shaheen, Aqsa; Ismat, Fouzia; Iqbal, Mazhar
2015-01-01
Multidrug resistance mediated by efflux pumps is a well-known phenomenon in infectious bacteria. Although much work has been carried out to characterize multidrug efflux pumps in Gram-negative and Gram-positive bacteria, such information is still lacking for many deadly pathogens. The aim...... of this study was to gain insight into the substrate specificity of previously uncharacterized transporters of Salmonella Typhi to identify their role in the development of multidrug resistance. S. Typhi genes encoding putative members of the major facilitator superfamily were cloned and expressed in the drug......-hypersensitive Escherichia coli strain KAM42, and tested for transport of 25 antibacterial compounds, including representative antibiotics of various classes, antiseptics, dyes and detergents. Of the 15 tested putative transporters, STY0901, STY2458 and STY4874 exhibited a drug-resistance phenotype. Among these, STY4874...
Energy Technology Data Exchange (ETDEWEB)
Rakus,J.; Fedorov, A.; Fedorov, E.; Glasner, M.; Vick, J.; Babbitt, P.; Almo, S.; Gerlt, J.
2007-01-01
The d-mannonate dehydratase (ManD) function was assigned to a group of orthologous proteins in the mechanistically diverse enolase superfamily by screening a library of acid sugars. Structures of the wild type ManD from Novosphingobium aromaticivorans were determined at pH 7.5 in the presence of Mg2+ and also in the presence of Mg2+ and the 2-keto-3-keto-d-gluconate dehydration product; the structure of the catalytically active K271E mutant was determined at pH 5.5 in the presence of the d-mannonate substrate. As previously observed in the structures of other members of the enolase superfamily, ManD contains two domains, an N-terminal a+{beta} capping domain and a ({beta}/a)7{beta}-barrel domain. The barrel domain contains the ligands for the essential Mg2+, Asp 210, Glu 236, and Glu 262, at the ends of the third, fourth, and fifth {beta}-strands of the barrel domain, respectively. However, the barrel domain lacks both the Lys acid/base catalyst at the end of the second {beta}-strand and the His-Asp dyad acid/base catalyst at the ends of the seventh and sixth {beta}-strands, respectively, that are found in many members of the superfamily. Instead, a hydrogen-bonded dyad of Tyr 159 in a loop following the second {beta}-strand and Arg 147 at the end of the second {beta}-strand are positioned to initiate the reaction by abstraction of the 2-proton. Both Tyr 159 and His 212, at the end of the third {beta}-strand, are positioned to facilitate both syn-dehydration and ketonization of the resulting enol intermediate to yield the 2-keto-3-keto-d-gluconate product with the observed retention of configuration. The identities and locations of these acid/base catalysts as well as of cationic amino acid residues that stabilize the enolate anion intermediate define a new structural strategy for catalysis (subgroup) in the mechanistically diverse enolase superfamily. With these differences, we provide additional evidence that the ligands for the essential Mg2+ are the only
DEFF Research Database (Denmark)
Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong
2017-01-01
Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... prediction program, UTR designer, and modified using the CRISPR/Cas9 genome editing method to reduce its expression level. E. coli strains with decreased citrate synthase expression produced more butanol and the citrate synthase activity was correlated with butanol production. These results demonstrate...
Meijers, J. C.; Chung, D. W.
1991-01-01
Protein C inhibitor (plasminogen activator inhibitor-3) is a plasma glycoprotein and a member of the serine proteinase inhibitor superfamily. In the present study, the human gene for protein C inhibitor was isolated and characterized from three independent phage that contained overlapping inserts
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.
Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng
2017-03-01
Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
Komonyi, Orban; Schauer, Tamas; Papai, Gabor; Deak, Peter; Boros, Imre M
2009-03-15
Although telomere formation occurs through a different mechanism in Drosophila compared with other organisms, telomere associations result from mutations in homologous genes, indicating the involvement of similar pathways in chromosome end protection. We report here that mutations of the Drosophila melanogaster gene CG31241 lead to high frequency chromosome end fusions. CG31241 is a bicistronic gene that encodes trimethylguanosine synthase (TGS1), which forms the m3G caps of noncoding small RNAs, and a novel protein, DTL. We show that although TGS1 has no role in telomere protection, DTL is localized at specific sites, including the ends of polytene chromosomes, and its loss results in telomere associations. Mutations of ATM- and Rad3-related (ATR) kinase suppress telomere fusions in the absence of DTL. Thus, genetic interactions place DTL in an ATR-related pathway in telomere protection. In contrast to ATR kinase, mutations of ATM (ataxia telangiectasia mutated) kinase, which acts in a partially overlapping pathway of telomere protection, do not suppress formation of telomere associations in the absence of DTL. Thus, uncovering the role of DTL will help to dissect the evolutionary conserved pathway(s) controlling ATM-ATR-related telomere protection.
DEFF Research Database (Denmark)
Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.
2005-01-01
A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...
A burst of ABC genes in the genome of the polyphagous spider mite Tetranychus urticae
Dermauw, W.; Osborne, E.J.; Clark, R.M.; Grbić, M.; Tirry, L.; Van Leeuwen, T.
2013-01-01
Background: The ABC (ATP-binding cassette) gene superfamily is widespread across all living species. The majority of ABC genes encode ABC transporters, which are membrane-spanning proteins capable of transferring substrates across biological membranes by hydrolyzing ATP. Although ABC transporters
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper
2007-01-01
Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...
Singh, Dinkar; Yadav, Narendra Singh; Tiwari, Vivekanand; Agarwal, Pradeep K; Jha, Bhavanath
2016-01-01
About 1000 salt-responsive ESTs were identified from an extreme halophyte Salicornia brachiata. Among these, a novel salt-inducible gene SbSLSP (Salicornia brachiata SNARE-like superfamily protein), showed up-regulation upon salinity and dehydration stress. The presence of cis-regulatory motifs related to abiotic stress in the putative promoter region supports our finding that SbSLSP gene is inducible by abiotic stress. The SbSLSP protein showed a high sequence identity to hypothetical/uncharacterized proteins from Beta vulgaris, Spinacia oleracea, Eucalyptus grandis, and Prunus persica and with SNARE-like superfamily proteins from Zostera marina and Arabidopsis thaliana. Bioinformatics analysis predicted a clathrin adaptor complex small-chain domain and N-myristoylation site in the SbSLSP protein. Subcellular localization studies indicated that the SbSLSP protein is mainly localized in the plasma membrane. Using transgenic tobacco lines, we establish that overexpression of SbSLSP resulted in elevated tolerance to salt and drought stress. The improved tolerance was confirmed by alterations in a range of physiological parameters, including high germination and survival rate, higher leaf chlorophyll contents, and reduced accumulation of Na(+) ion and reactive oxygen species (ROS). Furthermore, overexpressing lines also showed lower water loss, higher cell membrane stability, and increased accumulation of proline and ROS-scavenging enzymes. Overexpression of SbSLSP also enhanced the transcript levels of ROS-scavenging and signaling enzyme genes. This study is the first investigation of the function of the SbSLSP gene as a novel determinant of salinity/drought tolerance. The results suggest that SbSLSP could be a potential candidate to increase salinity and drought tolerance in crop plants for sustainable agriculture in semi-arid saline soil.
Directory of Open Access Journals (Sweden)
Dinkar eSingh
2016-06-01
Full Text Available About 1000 salt-responsive ESTs were identified from an extreme halophyte Salicornia brachiata. Among these, a novel salt-inducible gene SbSLSP, (Salicornia brachiata SNARE-like superfamily protein showed up-regulation upon salinity and dehydration stress. The presence of cis-regulatory motifs related to abiotic stress in the putative promoter region supports our finding that SbSLSP gene is inducible by abiotic stress. The SbSLSP protein showed a high sequence identity to hypothetical/uncharacterised proteins from Beta vulgaris, Spinacia oleracea, Eucalyptus grandis and Prunus persica and with SNARE-like superfamily proteins from Zostera marina and Arabidopsis thaliana. Bioinformatics analysis predicted a clathrin adaptor complex small-chain domain and N-myristoylation site in the SbSLSP protein. Subcellular localisation studies indicated that the SbSLSP protein is mainly localised in the plasma membrane. Using transgenic tobacco lines, we establish that overexpression of SbSLSP resulted in elevated tolerance to salt and drought stress. The improved tolerance was confirmed by alterations in a range of physiological parameters, including high germination and survival rate, higher leaf chlorophyll contents, and reduced accumulation of Na+ ion and reactive oxygen species (ROS. Furthermore, overexpressing lines also showed lower water loss, higher cell membrane stability and increased accumulation of proline and ROS-scavenging enzymes. Overexpression of SbSLSP also enhanced the transcript levels of ROS-scavenging and signalling enzyme genes. This study is the first investigation of the function of the SbSLSP gene as a novel determinant of salinity/drought tolerance. The results suggest that SbSLSP could be a potential candidate to increase salinity and drought tolerance in crop plants for sustainable agriculture in semi-arid saline soil.
DEFF Research Database (Denmark)
Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K
2017-01-01
BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Chalcone synthase genes from milk thistle (Silybum marianum)
Indian Academy of Sciences (India)
... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...
Directory of Open Access Journals (Sweden)
Michelle F. Valentine
2017-05-01
Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.
Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.
2017-01-01
Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
International Nuclear Information System (INIS)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He; Su, Xiao-Dong
2006-01-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni 2+ -chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2 1 , with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°
Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish
2011-01-01
Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032
Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang
2017-12-01
Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.
Exploring the role of cellular homologous of the 30K-superfamily of plant virus movement proteins.
Carrasco, José L; Sánchez-Navarro, Jesús A; Elena, Santiago F
2018-02-21
Genes orthologous to the 30K-superfamily of movement proteins (MP) from plant viruses have been recently discovered by bioinformatics analyses as integrated elements in the genome of most vascular plants. However, their functional relevance for plants is still unclear. Here, we undertake some preliminary steps into the functional characterization of one of these putative MP genes found in Arabidopsis thaliana. We found that the AtMP gene is expressed at different stages of the plant development, with accumulation being highest in flowers but lowest in mature siliques. We also found down-regulation of the gene may result in a small delay in plant development and in an exacerbation of the negative effect of salinity in germination efficiency. We have also explored whether changes in expression of the endogenous AtMP have any effect on susceptibility to infection with several viruses, and found that the infectivity of tobacco rattle tobravirus was strongly dependent on the expression of the endogenous AtMP. Finally, we have cloned the endogenous MP from four different plant species into an expression vector that allows for specifically assessing their activity as cell-to-cell movement proteins and have shown that though some may still retain the ancestral activity, they do so in a quite inefficient manner, thus suggesting they have acquired a novel function during adaptation to the host genome. Copyright © 2018 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Haussühl, K.; Rohde, W.; Weissenböck, G.
1996-01-01
Four chalcone synthase (CHS; EC 2.3.1.74) clones from rye were isolated and characterized. Two of these clones were used for analysis of CHS gene activities in response to ultraviolet and visible radiation in the coleoptile and the primary leaf of the rye seedling. The time-dependence of CHS gene activation and the spatial distribution of CHS were studied by investigation of enzyme activities and CHS mRNA levels, including in situ RNA hybridization. In the primary leaf strong induction of CHS gene activity was localized in the epidermal layers and only marginally found in the mesophyll. The coleoptile showed an even higher response to UV irradiation, but CHS gene activity was evenly distributed throughout the tissues. It is suggested that, in addition to its function as a mechanical protection for the primary leaf during seed germination and seedling emergence through the soil, the coleoptile may also protect the emerging seedling from harmful radiation
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.
Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E
2016-11-01
Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.
Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong
2016-09-01
Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.
Directory of Open Access Journals (Sweden)
Holly J Atkinson
Full Text Available The dramatic increase in heterogeneous types of biological data--in particular, the abundance of new protein sequences--requires fast and user-friendly methods for organizing this information in a way that enables functional inference. The most widely used strategy to link sequence or structure to function, homology-based function prediction, relies on the fundamental assumption that sequence or structural similarity implies functional similarity. New tools that extend this approach are still urgently needed to associate sequence data with biological information in ways that accommodate the real complexity of the problem, while being accessible to experimental as well as computational biologists. To address this, we have examined the application of sequence similarity networks for visualizing functional trends across protein superfamilies from the context of sequence similarity. Using three large groups of homologous proteins of varying types of structural and functional diversity--GPCRs and kinases from humans, and the crotonase superfamily of enzymes--we show that overlaying networks with orthogonal information is a powerful approach for observing functional themes and revealing outliers. In comparison to other primary methods, networks provide both a good representation of group-wise sequence similarity relationships and a strong visual and quantitative correlation with phylogenetic trees, while enabling analysis and visualization of much larger sets of sequences than trees or multiple sequence alignments can easily accommodate. We also define important limitations and caveats in the application of these networks. As a broadly accessible and effective tool for the exploration of protein superfamilies, sequence similarity networks show great potential for generating testable hypotheses about protein structure-function relationships.
Atkinson, Holly J; Morris, John H; Ferrin, Thomas E; Babbitt, Patricia C
2009-01-01
The dramatic increase in heterogeneous types of biological data--in particular, the abundance of new protein sequences--requires fast and user-friendly methods for organizing this information in a way that enables functional inference. The most widely used strategy to link sequence or structure to function, homology-based function prediction, relies on the fundamental assumption that sequence or structural similarity implies functional similarity. New tools that extend this approach are still urgently needed to associate sequence data with biological information in ways that accommodate the real complexity of the problem, while being accessible to experimental as well as computational biologists. To address this, we have examined the application of sequence similarity networks for visualizing functional trends across protein superfamilies from the context of sequence similarity. Using three large groups of homologous proteins of varying types of structural and functional diversity--GPCRs and kinases from humans, and the crotonase superfamily of enzymes--we show that overlaying networks with orthogonal information is a powerful approach for observing functional themes and revealing outliers. In comparison to other primary methods, networks provide both a good representation of group-wise sequence similarity relationships and a strong visual and quantitative correlation with phylogenetic trees, while enabling analysis and visualization of much larger sets of sequences than trees or multiple sequence alignments can easily accommodate. We also define important limitations and caveats in the application of these networks. As a broadly accessible and effective tool for the exploration of protein superfamilies, sequence similarity networks show great potential for generating testable hypotheses about protein structure-function relationships.
Díaz-Sánchez, Violeta; Avalos, Javier; Limón, M Carmen
2012-10-01
Fusarins are a class of mycotoxins of the polyketide family produced by different Fusarium species, including the gibberellin-producing fungus Fusarium fujikuroi. Based on sequence comparisons between polyketide synthase (PKS) enzymes for fusarin production in other Fusarium strains, we have identified the F. fujikuroi orthologue, called fusA. The participation of fusA in fusarin biosynthesis was demonstrated by targeted mutagenesis. Fusarin production is transiently stimulated by nitrogen availability in this fungus, a regulation paralleled by the fusA mRNA levels in the cell. Illumination of the cultures results in a reduction of the fusarin content, an effect partially explained by a high sensitivity of these compounds to light. Mutants of the fusA gene exhibit no external phenotypic alterations, including morphology and conidiation, except for a lack of the characteristic yellow and/or orange pigmentation of fusarins. Moreover, the fusA mutants are less efficient than the wild type at degrading cellophane on agar cultures, a trait associated with pathogenesis functions in Fusarium oxysporum. The fusA mutants, however, are not affected in their capacities to grow on plant tissues.
Directory of Open Access Journals (Sweden)
Yulia Sokurenko
2016-01-01
Full Text Available The N1/T1 RNase superfamily comprises enzymes with well-established antitumor effects, such as ribotoxins secreted by fungi, primarily by Aspergillus and Penicillium species, and bacterial RNase secreted by B. pumilus (binase and B. amyloliquefaciens (barnase. RNase is regarded as an alternative to classical chemotherapeutic agents due to its selective cytotoxicity towards tumor cells. New RNase with a high degree of structural similarity with binase (73% and barnase (74% was isolated and purified from Bacillus licheniformis (balifase, calculated molecular weight 12421.9 Da, pI 8.91. The protein sample with enzymatic activity of 1.5 × 106 units/A280 was obtained. The physicochemical properties of balifase are similar to those of barnase. However, in terms of its gene organization and promoter activity, balifase is closer to binase. The unique feature of balifase gene organization consists in the fact that genes of RNase and its inhibitor are located in one operon. Similarly to biosynthesis of binase, balifase synthesis is induced under phosphate starvation; however, in contrast to binase, balifase does not form dimers under natural conditions. We propose that the highest stability of balifase among analyzed RNase types allows the protein to retain its structure without oligomerization.
Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un
2012-12-05
Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.
Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N
2014-09-01
Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.
Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S
2008-02-01
This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.
Schoonbeek, H.; Nistelrooy, van J.G.M.; Waard, de M.A.
2003-01-01
The role of multiple ATP-binding cassette (ABC) and major facilitator superfamily (MFS) transporter genes from the plant pathogenic fungus Botrytis cinerea in protection against natural fungitoxic compounds was studied by expression analysis and phenotyping of gene-replacement mutants. The
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This study was conducted in the Medical Genetics Center, Ain-Shams University hospitals, on a total of 170 mothers of children, diagnosed with ...
Directory of Open Access Journals (Sweden)
Vannozzi Alessandro
2012-08-01
Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be
Bifunctional effects of fucoidan on the expression of inducible nitric oxide synthase
International Nuclear Information System (INIS)
Yang, Jin Won; Yoon, Se Young; Oh, Soo Jin; Kim, Sang Kyum; Kang, Keon Wook
2006-01-01
Algal fucoidan is a marine sulfated polysaccharide with a wide variety of biological activities including anti-thrombotic and anti-inflammatory effects. This study evaluated the effect of fucoidan on the expression of inducible nitric oxide synthase (iNOS) in a macrophage cell line, RAW264.7. Low concentration range of fucoidan (10 μg/ml) increased the basal expression level of iNOS in quiescent macrophages. However, we found for the first time that fucoidan inhibited the release of nitric oxide (NO) in RAW264.7 cells stimulated with lipopolysaccharide (LPS). Western blot analysis revealed that fucoidan suppressed the LPS-induced expression of the inducible nitric oxide synthase (iNOS) gene. Moreover, the activation of both nuclear factor-κB (NF-κB) and activator protein 1 (AP-1) are key steps in the transcriptional activation of the iNOS gene. Here, it was revealed that fucoidan selectively suppressed AP-1 activation, and that the activation of AP-1 appears to be essential for the induction of iNOS in activated macrophages. This inhibitory effect on AP-1 activation by fucoidan might be associated with its NO blocking and anti-inflammatory effects
DEFF Research Database (Denmark)
Zhang, Chuanhui; Jiang, Dong; Liu, Fulai
2010-01-01
with the temporally change patterns of starch synthase activities and relative gene expression levels. For instance, activities of soluble and granule-bound starch synthases (designated SSS and GBSS) peaked at 20 and 24 DAF. Genes encoding isoforms of starch synthases expressed at different grain filling periods...
Comparative analysis of cystatin superfamily in platyhelminths.
Directory of Open Access Journals (Sweden)
Aijiang Guo
Full Text Available The cystatin superfamily is comprised of cysteine proteinase inhibitors and encompasses at least 3 subfamilies: stefins, cystatins and kininogens. In this study, the platyhelminth cystatin superfamily was identified and grouped into stefin and cystatin subfamilies. The conserved domain of stefins (G, QxVxG was observed in all members of platyhelminth stefins. The three characteristics of cystatins, the cystatin-like domain (G, QxVxG, PW, a signal peptide, and one or two conserved disulfide bonds, were observed in platyhelminths, with the exception of cestodes, which lacked the conserved disulfide bond. However, it is noteworthy that cestode cystatins had two tandem repeated domains, although the second tandem repeated domain did not contain a cystatin-like domain, which has not been previously reported. Tertiary structure analysis of Taenia solium cystatin, one of the cestode cystatins, demonstrated that the N-terminus of T. solium cystatin formed a five turn α-helix, a five stranded β-pleated sheet and a hydrophobic edge, similar to the structure of chicken cystatin. Although no conserved disulfide bond was found in T. solium cystatin, the models of T. solium cystatin and chicken cystatin corresponded at the site of the first disulfide bridge of the chicken cystatin. However, the two models were not similar regarding the location of the second disulfide bridge of chicken cystatin. These results showed that T. solium cystatin and chicken cystatin had similarities and differences, suggesting that the biochemistry of T. solium cystatin could be similar to chicken cystatin in its inhibitory function and that it may have further functional roles. The same results were obtained for other cestode cystatins. Phylogenetic analysis showed that cestode cystatins constituted an independent clade and implied that cestode cystatins should be considered to have formed a new clade during evolution.
The ATPase of the phi29 DNA packaging motor is a member of the hexameric AAA+ superfamily.
Schwartz, Chad; De Donatis, Gian Marco; Fang, Huaming; Guo, Peixuan
2013-08-15
The AAA+ superfamily of proteins is a class of motor ATPases performing a wide range of functions that typically exist as hexamers. The ATPase of phi29 DNA packaging motor has long been a subject of debate in terms of stoichiometry and mechanism of action. Here, we confirmed the stoichiometry of phi29 motor ATPase to be a hexamer and provide data suggesting that the phi29 motor ATPase is a member of the classical hexameric AAA+ superfamily. Native PAGE, EMSA, capillary electrophoresis, ATP titration, and binomial distribution assay show that the ATPase is a hexamer. Mutations in the known Walker motifs of the ATPase validated our previous assumptions that the protein exists as another member of this AAA+ superfamily. Our data also supports the finding that the phi29 DNA packaging motor uses a revolution mechanism without rotation or coiling (Schwartz et al., this issue). Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Zhang, Weixin; Kou, Yanbo; Xu, Jintao; Cao, Yanli; Zhao, Guolei; Shao, Jing; Wang, Hai; Wang, Zhixing; Bao, Xiaoming; Chen, Guanjun; Liu, Weifeng
2013-01-01
Proper perception of the extracellular insoluble cellulose is key to initiating the rapid synthesis of cellulases by cellulolytic Trichoderma reesei. Uptake of soluble oligosaccharides derived from cellulose hydrolysis represents a potential point of control in the induced cascade. In this study, we identified a major facilitator superfamily sugar transporter Stp1 capable of transporting cellobiose by reconstructing a cellobiose assimilation system in Saccharomyces cerevisiae. The absence of Stp1 in T. reesei resulted in differential cellulolytic response to Avicel versus cellobiose. Transcriptional profiling revealed a different expression profile in the Δstp1 strain from that of wild-type strain in response to Avicel and demonstrated that Stp1 somehow repressed induction of the bulk of major cellulase and hemicellulose genes. Two other putative major facilitator superfamily sugar transporters were, however, up-regulated in the profiling. Deletion of one of them identified Crt1 that was required for growth and enzymatic activity on cellulose or lactose, but was not required for growth or hemicellulase activity on xylan. The essential role of Crt1 in cellulase induction did not seem to rely on its transporting activity because the overall uptake of cellobiose or sophorose by T. reesei was not compromised in the absence of Crt1. Phylogenetic analysis revealed that orthologs of Crt1 exist in the genomes of many filamentous ascomycete fungi capable of degrading cellulose. These data thus shed new light on the mechanism by which T. reesei senses and transmits the cellulose signal and offers potential strategies for strain improvement. PMID:24085297
Energy Technology Data Exchange (ETDEWEB)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He, E-mail: liangyh@pku.edu.cn; Su, Xiao-Dong [National Laboratory of Protein Engineering and Plant Genetic Engineering, Peking University, Beijing 100871 (China); Department of Biochemistry and Molecular Biology, College of Life Sciences, Peking University, Beijing 100871 (China)
2006-10-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.
Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong
2018-07-01
The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.
Moghadam, Ali Asghar; Ebrahimie, Eemaeil; Taghavi, Seyed Mohsen; Niazi, Ali; Babgohari, Mahbobeh Zamani; Deihimi, Tahereh; Djavaheri, Mohammad; Ramezani, Amin
2013-07-01
A small number of stress-responsive genes, such as those of the mitochondrial F1F0-ATP synthase complex, are encoded by both the nucleus and mitochondria. The regulatory mechanism of these joint products is mysterious. The expression of 6-kDa subunit (MtATP6), a relatively uncharacterized nucleus-encoded subunit of F0 part, was measured during salinity stress in salt-tolerant and salt-sensitive cultivated wheat genotypes, as well as in the wild wheat genotypes, Triticum and Aegilops using qRT-PCR. The MtATP6 expression was suddenly induced 3 h after NaCl treatment in all genotypes, indicating an early inducible stress-responsive behavior. Promoter analysis showed that the MtATP6 promoter includes cis-acting elements such as ABRE, MYC, MYB, GTLs, and W-boxes, suggesting a role for this gene in abscisic acid-mediated signaling, energy metabolism, and stress response. It seems that 6-kDa subunit, as an early response gene and nuclear regulatory factor, translocates to mitochondria and completes the F1F0-ATP synthase complex to enhance ATP production and maintain ion homeostasis under stress conditions. These communications between nucleus and mitochondria are required for inducing mitochondrial responses to stress pathways. Dual targeting of 6-kDa subunit may comprise as a mean of inter-organelle communication and save energy for the cell. Interestingly, MtATP6 showed higher and longer expression in the salt-tolerant wheat and the wild genotypes compared to the salt-sensitive genotype. Apparently, salt-sensitive genotypes have lower ATP production efficiency and weaker energy management than wild genotypes; a stress tolerance mechanism that has not been transferred to cultivated genotypes.
Identification and phylogenetic analysis of a novel starch synthase in maize
Directory of Open Access Journals (Sweden)
Hanmei eLiu
2015-11-01
Full Text Available Starch is an important reserve of carbon and energy in plants, providing the majority of calories in the human diet and animal feed. Its synthesis is orchestrated by several key enzymes, and the amount and structure of starch, affecting crop yield and quality, are determined mainly by starch synthase (SS activity. To date, five SS isoforms, including SSI-IV and Granule Bound Starch Synthase (GBSS have been identified and their physiological functions have been well characterized. Here, we report the identification of a new SS isoform in maize, designated SSV. By searching sequenced genomes, SSV has been found in all green plants with conserved sequences and gene structures. Our phylogenetic analysis based on 780 base pairs has suggested that SSIV and SSV resulted from a gene duplication event, which may have occurred before the algae formation. An expression profile analysis of SSV in maize has indicated that ZmSSV is mainly transcribed in the kernel and ear leaf during the grain filling stage, which is partly similar to other SS isoforms. Therefore, it is likely that SSV may play an important role in starch biosynthesis. Subsequent analysis of SSV function may facilitate understanding the mechanism of starch granules formation, number and structure.
CTP limitation increases expression of CTP synthase in Lactococcus lactis
DEFF Research Database (Denmark)
Jørgensen, C.M.; Hammer, Karin; Martinussen, Jan
2003-01-01
CTP synthase is encoded by the pyrG gene and catalyzes the conversion of UTP to CTP. A Lactococcus lactis pyrG mutant with a cytidine requirement was constructed, in which beta-galactosidase activity in a pyrG-lacLM transcriptional fusion was used to monitor gene expression of pyrG. A 10-fold...... decrease in the CTP pool induced by cytidine limitation was found to immediately increase expression of the L. lactis pyrG gene. The final level of expression of pyrG is 37-fold higher than the uninduced level. CTP limitation has pronounced effects on central cellular metabolism, and both RNA and protein...... for regulation of the pyrG gene. It is possible to fold the pyrG leader in an alternative structure that would prevent the formation of the terminator. We suggest a model for pyrG regulation in L. lactis, and probably in other gram-positive bacteria as well, in which pyrG expression is directly dependent...
Directory of Open Access Journals (Sweden)
Fei eZhou
2015-04-01
Full Text Available The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA, we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD and constant dark (DD conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V
2017-01-01
Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.
Zhang, Lu; Wang, Huijuan; Chen, Jianyi; Shen, Qida; Wang, Shigui; Xu, Hongxing; Tang, Bin
2017-01-01
RNA interference has been used to study insects' gene function and regulation. Glycogen synthase (GS) and glycogen phosphorylase (GP) are two key enzymes in carbohydrates' conversion in insects. Glycogen content and GP and GS gene expression in several tissues and developmental stages of the Brown planthopper Nilaparvata lugens Stål (Hemiptera: Delphacidae) were analyzed in the present study, using quantitative reverse-transcription polymerase chain reaction to determine their response to double-stranded trehalases (dsTREs), trehalose-6-phosphate synthases (dsTPSs), and validamycin injection. The highest expression of both genes was detected in the wing bud, followed by leg and head tissues, and different expression patterns were shown across the developmental stages analyzed. Glycogen content significantly decreased 48 and 72 h after dsTPSs injection and 48 h after dsTREs injection. GP expression increased 48 h after dsTREs and dsTPSs injection and significantly decreased 72 h after dsTPSs, dsTRE1-1, and dsTRE1-2 injection. GS expression significantly decreased 48 h after dsTPS2 and dsTRE2 injection and 72 h after dsTRE1-1 and dsTRE1-2 injection. GP and GS expression and glycogen content significantly decreased 48 h after validamycin injection. The GP activity significantly decreased 48 h after validamycin injection, while GS activities of dsTPS1 and dsTRE2 injection groups were significantly higher than that of double-stranded GFP (dsGFP) 48 h after injection, respectively. Thus, glycogen is synthesized, released, and degraded across several insect tissues according to the need to maintain stable trehalose levels. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.
Directory of Open Access Journals (Sweden)
Broglie Karen E
2008-09-01
Full Text Available Abstract Background Starch is of great importance to humans as a food and biomaterial, and the amount and structure of starch made in plants is determined in part by starch synthase (SS activity. Five SS isoforms, SSI, II, III, IV and Granule Bound SSI, have been identified, each with a unique catalytic role in starch synthesis. The basic mode of action of SSs is known; however our knowledge of several aspects of SS enzymology at the structural and mechanistic level is incomplete. To gain a better understanding of the differences in SS sequences that underscore their specificity, the previously uncharacterised SSIVb from wheat was cloned and extensive bioinformatics analyses of this and other SSs sequences were done. Results The wheat SSIV cDNA is most similar to rice SSIVb with which it shows synteny and shares a similar exon-intron arrangement. The wheat SSIVb gene was preferentially expressed in leaf and was not regulated by a circadian clock. Phylogenetic analysis showed that in plants, SSIV is closely related to SSIII, while SSI, SSII and Granule Bound SSI clustered together and distinctions between the two groups can be made at the genetic level and included chromosomal location and intron conservation. Further, identified differences at the amino acid level in their glycosyltransferase domains, predicted secondary structures, global conformations and conserved residues might be indicative of intragroup functional associations. Conclusion Based on bioinformatics analysis of the catalytic region of 36 SSs and 3 glycogen synthases (GSs, it is suggested that the valine residue in the highly conserved K-X-G-G-L motif in SSIII and SSIV may be a determining feature of primer specificity of these SSs as compared to GBSSI, SSI and SSII. In GBSSI, the Ile485 residue may partially explain that enzyme's unique catalytic features. The flexible 380s Loop in the starch catalytic domain may be important in defining the specificity of action for each
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Directory of Open Access Journals (Sweden)
Khalil Zaynali
2010-06-01
Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.
Directory of Open Access Journals (Sweden)
Nevzat Selim Gokay
2016-01-01
Full Text Available The objective of this study was to investigate the effects of selective inducible nitric oxide synthase and neuronal nitric oxide synthase inhibitors on cartilage regeneration. The study involved 27 Wistar rats that were divided into five groups. On Day 1, both knees of 3 rats were resected and placed in a formalin solution as a control group. The remaining 24 rats were separated into 4 groups, and their right knees were surgically damaged. Depending on the groups, the rats were injected with intra-articular normal saline solution, neuronal nitric oxide synthase inhibitor 7-nitroindazole (50 mg/kg, inducible nitric oxide synthase inhibitor amino-guanidine (30 mg/kg, or nitric oxide precursor L-arginine (200 mg/kg. After 21 days, the right and left knees of the rats were resected and placed in formalin solution. The samples were histopathologically examined by a blinded evaluator and scored on 8 parameters. Although selective neuronal nitric oxide synthase inhibition exhibited significant (P=0.044 positive effects on cartilage regeneration following cartilage damage, it was determined that inducible nitric oxide synthase inhibition had no statistically significant effect on cartilage regeneration. It was observed that the nitric oxide synthase activation triggered advanced arthrosis symptoms, such as osteophyte formation. The fact that selective neuronal nitric oxide synthase inhibitors were observed to have mitigating effects on the severity of the damage may, in the future, influence the development of new agents to be used in the treatment of cartilage disorders.
Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae
2014-03-01
Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.
Giampieri, Francesca; Gasparrini, Massimiliano; Forbes-Hernandez, Tamara Y; Mazzoni, Luca; Capocasa, Franco; Sabbadini, Silvia; Alvarez-Suarez, Josè M; Afrin, Sadia; Rosati, Carlo; Pandolfini, Tiziana; Molesini, Barbara; Sánchez-Sevilla, José F; Amaya, Iraida; Mezzetti, Bruno; Battino, Maurizio
2018-01-24
Food fortification through the increase and/or modulation of bioactive compounds has become a major goal for preventing several diseases, including cancer. Here, strawberry lines of cv. Calypso transformed with a construct containing an anthocyanidin synthase (ANS) gene were produced to study the effects on anthocyanin biosynthesis, metabolism, and transcriptome. Three strawberry ANS transgenic lines (ANS L5, ANS L15, and ANS L18) were analyzed for phytochemical composition and total antioxidant capacity (TAC), and their fruit extracts were assessed for cytotoxic effects on hepatocellular carcinoma. ANS L18 fruits had the highest levels of total phenolics and flavonoids, while those of ANS L15 had the highest anthocyanin concentration; TAC positively correlated with total polyphenol content. Fruit transcriptome was also specifically affected in the polyphenol biosynthesis and in other related metabolic pathways. Fruit extracts of all lines exerted cytotoxic effects in a dose/time-dependent manner, increasing cellular apoptosis and free radical levels and impairing mitochondrial functionality.
Directory of Open Access Journals (Sweden)
Garry Robert F
2008-02-01
Full Text Available Abstract Background Members of the Baculoviridae encode two types of proteins that mediate virus:cell membrane fusion and penetration into the host cell. Alignments of primary amino acid sequences indicate that baculovirus fusion proteins of group I nucleopolyhedroviruses (NPV form the GP64 superfamily. The structure of these viral penetrenes has not been determined. The GP64 superfamily includes the glycoprotein (GP encoded by members of the Thogotovirus genus of the Orthomyxoviridae. The entry proteins of other baculoviruses, group II NPV and granuloviruses, are class I penetrenes. Results Class III penetrenes encoded by members of the Rhabdoviridae and Herpesviridae have an internal fusion domain comprised of beta sheets, other beta sheet domains, an extended alpha helical domain, a membrane proximal stem domain and a carboxyl terminal anchor. Similar sequences and structural/functional motifs that characterize class III penetrenes are located collinearly in GP64 of group I baculoviruses and related glycoproteins encoded by thogotoviruses. Structural models based on a prototypic class III penetrene, vesicular stomatitis virus glycoprotein (VSV G, were established for Thogoto virus (THOV GP and Autographa california multiple NPV (AcMNPV GP64 demonstrating feasible cysteine linkages. Glycosylation sites in THOV GP and AcMNPV GP64 appear in similar model locations to the two glycosylation sites of VSV G. Conclusion These results suggest that proteins in the GP64 superfamily are class III penetrenes.
Omar, Aimi Farehah; Ismail, Ismanizan
2016-11-01
Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.
Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily
Directory of Open Access Journals (Sweden)
Marc Lenoir
2015-10-01
Full Text Available The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH and Tec homology (TH domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.
Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily.
Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael
2015-10-23
The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer.
Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K
2014-01-01
Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.
Roy Choudhury, Swarup; Roy, Sujit; Das, Ranjan; Sengupta, Dibyendu N
2008-12-01
Sucrose phosphate synthase (SPS) (EC 2.3.1.14) is the key regulatory component in sucrose formation in banana (Musa acuminata subgroup Cavendish, cv Giant governor) fruit during ripening. This report illustrates differential transcriptional responses of banana SPS gene following ethylene, auxin, wounding, low temperature and different photoperiods during ripening in banana fruit. Whereas ethylene strongly stimulated SPS transcript accumulation, auxin and cold treatment only marginally increased the abundance of SPS mRNA level, while wounding negatively regulated SPS gene expression. Conversely, SPS transcript level was distinctly increased by constant exposure to white light. Protein level, enzymatic activity of SPS and sucrose synthesis were substantially increased by ethylene and increased exposure to white light conditions as compared to other treatments. To further study the transcriptional regulation of SPS in banana fruit, the promoter region of SPS gene was cloned and some cis-acting regulatory elements such as a reverse GCC-box ERE, two ARE motifs (TGTCTC), one LTRE (CCGAA), a GAGA-box (GAGA...) and a GATA-box LRE (GATAAG) were identified along with the TATA and CAAT-box. DNA-protein interaction studies using these cis-elements indicated a highly specific cis-trans interaction in the banana nuclear extract. Furthermore, we specifically studied the light responsive characteristics of GATA-box containing synthetic as well as native banana SPS promoter. Transient expression assays using banana SPS promoter have also indicated the functional importance of the SPS promoter in regulating gene expression. Together, these results provide insights into the transcriptional regulation of banana SPS gene in response to phytohormones and other environmental factors during fruit ripening.
CTP synthase forms cytoophidia in the cytoplasm and nucleus
International Nuclear Information System (INIS)
Gou, Ke-Mian; Chang, Chia-Chun; Shen, Qing-Ji; Sung, Li-Ying; Liu, Ji-Long
2014-01-01
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus
CTP synthase forms cytoophidia in the cytoplasm and nucleus
Energy Technology Data Exchange (ETDEWEB)
Gou, Ke-Mian [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); State Key Laboratory for Agrobiotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193 (China); Chang, Chia-Chun [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Shen, Qing-Ji [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom); Sung, Li-Ying, E-mail: liyingsung@ntu.edu.tw [Institute of Biotechnology, National Taiwan University, Taipei, Taiwan, ROC (China); Agricultural Biotechnology Research Center, Academia Sinica, Taipei 115, Taiwan, ROC (China); Liu, Ji-Long, E-mail: jilong.liu@dpag.ox.ac.uk [MRC Functional Genomics Unit, Department of Physiology, Anatomy and Genetics, University of Oxford, Oxford OX1 3PT (United Kingdom)
2014-04-15
CTP synthase is an essential metabolic enzyme responsible for the de novo synthesis of CTP. Multiple studies have recently showed that CTP synthase protein molecules form filamentous structures termed cytoophidia or CTP synthase filaments in the cytoplasm of eukaryotic cells, as well as in bacteria. Here we report that CTP synthase can form cytoophidia not only in the cytoplasm, but also in the nucleus of eukaryotic cells. Both glutamine deprivation and glutamine analog treatment promote formation of cytoplasmic cytoophidia (C-cytoophidia) and nuclear cytoophidia (N-cytoophidia). N-cytoophidia are generally shorter and thinner than their cytoplasmic counterparts. In mammalian cells, both CTP synthase 1 and CTP synthase 2 can form cytoophidia. Using live imaging, we have observed that both C-cytoophidia and N-cytoophidia undergo multiple rounds of fusion upon glutamine analog treatment. Our study reveals the coexistence of cytoophidia in the cytoplasm and nucleus, therefore providing a good opportunity to investigate the intracellular compartmentation of CTP synthase. - Highlights: • CTP synthase forms cytoophidia not only in the cytoplasm but also in the nucleus. • Glutamine deprivation and Glutamine analogs promotes cytoophidium formation. • N-cytoophidia exhibit distinct morphology when compared to C-cytoophidia. • Both CTP synthase 1 and CTP synthase 2 form cytoophidia in mammalian cells. • Fusions of cytoophidia occur in the cytoplasm and nucleus.
Directory of Open Access Journals (Sweden)
Wen-Qin Bai
Full Text Available Bioactive gibberellins (GAs comprise an important class of natural plant growth regulators and play essential roles in cotton fiber development. To date, the molecular base of GAs' functions in fiber development is largely unclear. To address this question, the endogenous bioactive GA levels in cotton developing fibers were elevated by specifically up-regulating GA 20-oxidase and suppressing GA 2-oxidase via transgenic methods. Higher GA levels in transgenic cotton fibers significantly increased micronaire values, 1000-fiber weight, cell wall thickness and cellulose contents of mature fibers. Quantitative RT-PCR and biochemical analysis revealed that the transcription of sucrose synthase gene GhSusA1 and sucrose synthase activities were significantly enhanced in GA overproducing transgenic fibers, compared to the wild-type cotton. In addition, exogenous application of bioactive GA could promote GhSusA1 expression in cultured fibers, as well as in cotton hypocotyls. Our results suggested that bioactive GAs promoted secondary cell wall deposition in cotton fibers by enhancing sucrose synthase expression.
CD147 Immunoglobulin Superfamily Receptor Function and Role in Pathology
Iacono, Kathryn T.; Brown, Amy L.; Greene, Mark I.; Saouaf, Sandra J.
2007-01-01
The immunoglobulin superfamily member CD147 plays an important role in fetal, neuronal, lymphocyte and extracellular matrix development. Here we review the current understanding of CD147 expression and protein interactions with regard to CD147 function and its role in pathologic conditions including heart disease, Alzheimer’s disease, stroke and cancer. A model linking hypoxic conditions found within the tumor microenvironment to up-regulation of CD147 expression and tumor progression is intr...
Glycogen synthase activation by sugars in isolated hepatocytes.
Ciudad, C J; Carabaza, A; Bosch, F; Gòmez I Foix, A M; Guinovart, J J
1988-07-01
We have investigated the activation by sugars of glycogen synthase in relation to (i) phosphorylase a activity and (ii) changes in the intracellular concentration of glucose 6-phosphate and adenine nucleotides. All the sugars tested in this work present the common denominator of activating glycogen synthase. On the other hand, phosphorylase a activity is decreased by mannose and glucose, unchanged by galactose and xylitol, and increased by tagatose, glyceraldehyde, and fructose. Dihydroxyacetone exerts a biphasic effect on phosphorylase. These findings provide additional evidence proving that glycogen synthase can be activated regardless of the levels of phosphorylase a, clearly establishing that a nonsequential mechanism for the activation of glycogen synthase occurs in liver cells. The glycogen synthase activation state is related to the concentrations of glucose 6-phosphate and adenine nucleotides. In this respect, tagatose, glyceraldehyde, and fructose deplete ATP and increase AMP contents, whereas glucose, mannose, galactose, xylitol, and dihydroxyacetone do not alter the concentration of these nucleotides. In addition, all these sugars, except glyceraldehyde, increase the intracellular content of glucose 6-phosphate. The activation of glycogen synthase by sugars is reflected in decreases on both kinetic constants of the enzyme, M0.5 (for glucose 6-phosphate) and S0.5 (for UDP-glucose). We propose that hepatocyte glycogen synthase is activated by monosaccharides by a mechanism triggered by changes in glucose 6-phosphate and adenine nucleotide concentrations which have been described to modify glycogen synthase phosphatase activity. This mechanism represents a metabolite control of the sugar-induced activation of hepatocyte glycogen synthase.
Directory of Open Access Journals (Sweden)
Abercrombie Jason M
2011-07-01
Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression
Gunasekera, Angelo; Alvarez, Francisco J; Douglas, Lois M; Wang, Hong X; Rosebrock, Adam P; Konopka, James B
2010-10-01
The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism.
Directory of Open Access Journals (Sweden)
Dejan Bregar
2018-02-01
Full Text Available Increasing evidence suggests that endothelin and nitric oxide synthase genes and their products exert biological effects on the vasculature via the nitric oxide or endothelin pathway. The aim of the study was to evaluate the association of rs10507875 and rs869109213 (alone or in interaction with diabetic retinopathy (DR in subjects with type 2 diabetes mellitus (T2DM. We genotyped the single nucleotide polymorphism rs10507875 of the endothelin receptor B gene (EDNRB and variable number tandem repeats rs869109213 of the nitric oxide synthase 3 gene (NOS3 in 270 Slovenian patients with DR and T2DM and 256 controls with T2DM without clinical signs of DR. The genotyping was performed using either real-time polymerase chain reaction (PCR or standard PCR. We found a significant association between the genotypes of NOS3 rs869109213 polymorphism and the risk of DR in the co-dominant model (4a4b genotype; 1.99-fold increased risk [1.09-3.65]; 95% confidence interval [CI]; p = 0.02, co-dominant model (4a4a genotype; 4.16-fold increased risk [1.03-16.74]; 95% CI; p = 0.04, and dominant model (4a4a and 4a4b genotypes; 2.22-fold increased risk [1.26-3.92]; 95% CI; p = 0.01 compared to the 4b4b genotype. Moreover, the joint effect of the two polymorphisms on DR risk was greater than the individual effect of each polymorphism in the analyzed genetic models. Additionally, adjusted odds ratio showed an increased risk in dominant × dominant (4.15-fold [1.40-12.26]; 95% CI; p = 0.01 and recessive × dominant (2.24-fold [1.25-4.01]; 95% CI; p = 0.02 genotype combinations of the two polymorphisms. In conclusion, our results indicate that NOS3 rs869109213 polymorphism alone or in a combination with EDNRB rs10507875 polymorphism may be associated with DR in Slovenian patients with T2DM.
Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping
2012-12-01
Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All
Jiménez-Ortigosa, Cristina; Aimanianda, Vishukumar; Muszkieta, Laetitia; Mouyna, Isabelle; Alsteens, David; Pire, Stéphane; Beau, Remi; Krappmann, Sven; Beauvais, Anne; Dufrêne, Yves F.
2012-01-01
Aspergillus fumigatus has two chitin synthases (CSMA and CSMB) with a myosin motor-like domain (MMD) arranged in a head-to-head configuration. To understand the function of these chitin synthases, single and double csm mutant strains were constructed and analyzed. Although there was a slight reduction in mycelial growth of the mutants, the total chitin synthase activity and the cell wall chitin content were similar in the mycelium of all of the mutants and the parental strain. In the conidia, chitin content in the ΔcsmA strain cell wall was less than half the amount found in the parental strain. In contrast, the ΔcsmB mutant strain and, unexpectedly, the ΔcsmA/ΔcsmB mutant strain did not show any modification of chitin content in their conidial cell walls. In contrast to the hydrophobic conidia of the parental strain, conidia of all of the csm mutants were hydrophilic due to the presence of an amorphous material covering the hydrophobic surface-rodlet layer. The deletion of CSM genes also resulted in an increased susceptibility of resting and germinating conidia to echinocandins. These results show that the deletion of the CSMA and CSMB genes induced a significant disorganization of the cell wall structure, even though they contribute only weakly to the overall cell wall chitin synthesis. PMID:22964252
Threonine phosphorylation of rat liver glycogen synthase
International Nuclear Information System (INIS)
Arino, J.; Arro, M.; Guinovart, J.J.
1985-01-01
32 P-labeled glycogen synthase specifically immunoprecipitated from 32 P-phosphate incubated rat hepatocytes contains, in addition to [ 32 P] phosphoserine, significant levels of [ 32 P] phosphothreonine. When the 32 P-immunoprecipitate was cleaved with CNBr, the [ 32 P] phosphothreonine was recovered in the large CNBr fragment (CB-2, Mapp 28 Kd). Homogeneous rat liver glycogen synthase was phosphorylated by all the protein kinases able to phosphorylate CB-2 in vitro. After analysis of the immunoprecipitated enzyme for phosphoaminoacids, it was observed that only casein kinase II was able to phosphorylate on threonine and 32 P-phosphate was only found in CB-2. These results demonstrate that rat liver glycogen synthase is phosphorylated at threonine site(s) contained in CB-2 and strongly indicate that casein kinase II may play a role in the ''in vivo'' phosphorylation of liver glycogen synthase. This is the first protein kinase reported to phosphorylate threonine residues in liver glycogen synthase
Directory of Open Access Journals (Sweden)
Hildgund Schrempf
2010-09-01
Full Text Available A new assay system for chitin has been developed. It comprises the chitin-binding protein ChbB in fusion with a His-tag as well as with a Strep-tag, the latter of which was chemically coupled to horseradish peroxidase. With the resulting complex, minimal quantities of chitin are photometrically detectable. In addition, the assay allows rapid scoring of the activity of chitin-synthases. As a result, a refined procedure for the rapid purification of yeast chitosomes (nano-machineries for chitin biosynthesis has been established. Immuno-electronmicroscopical studies of purified chitosomes, gained from a yeast strain carrying a chitin-synthase gene fused to that for GFP (green-fluorescence protein, has led to the in situ localization of chitin-synthase-GFP molecules within chitosomes.
International Nuclear Information System (INIS)
Soliman, S.E.T.; Zaater, M.K.
2010-01-01
Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant
Ensembler: Enabling High-Throughput Molecular Simulations at the Superfamily Scale.
Directory of Open Access Journals (Sweden)
Daniel L Parton
2016-06-01
Full Text Available The rapidly expanding body of available genomic and protein structural data provides a rich resource for understanding protein dynamics with biomolecular simulation. While computational infrastructure has grown rapidly, simulations on an omics scale are not yet widespread, primarily because software infrastructure to enable simulations at this scale has not kept pace. It should now be possible to study protein dynamics across entire (superfamilies, exploiting both available structural biology data and conformational similarities across homologous proteins. Here, we present a new tool for enabling high-throughput simulation in the genomics era. Ensembler takes any set of sequences-from a single sequence to an entire superfamily-and shepherds them through various stages of modeling and refinement to produce simulation-ready structures. This includes comparative modeling to all relevant PDB structures (which may span multiple conformational states of interest, reconstruction of missing loops, addition of missing atoms, culling of nearly identical structures, assignment of appropriate protonation states, solvation in explicit solvent, and refinement and filtering with molecular simulation to ensure stable simulation. The output of this pipeline is an ensemble of structures ready for subsequent molecular simulations using computer clusters, supercomputers, or distributed computing projects like Folding@home. Ensembler thus automates much of the time-consuming process of preparing protein models suitable for simulation, while allowing scalability up to entire superfamilies. A particular advantage of this approach can be found in the construction of kinetic models of conformational dynamics-such as Markov state models (MSMs-which benefit from a diverse array of initial configurations that span the accessible conformational states to aid sampling. We demonstrate the power of this approach by constructing models for all catalytic domains in the human
TGF-β superfamily signaling in testis formation and early male germline development.
Young, Julia C; Wakitani, Shoichi; Loveland, Kate L
2015-09-01
The TGF-β ligand superfamily contains at least 40 members, many of which are produced and act within the mammalian testis to facilitate formation of sperm. Their progressive expression at key stages and in specific cell types determines the fertility of adult males, influencing testis development and controlling germline differentiation. BMPs are essential for the interactive instructions between multiple cell types in the early embryo that drive initial specification of gamete precursors. In the nascent foetal testis, several ligands including Nodal, TGF-βs, Activins and BMPs, serve as key masculinizing switches by regulating male germline pluripotency, somatic and germline proliferation, and testicular vascularization and architecture. In postnatal life, local production of these factors determine adult testis size by regulating Sertoli cell multiplication and differentiation, in addition to specifying germline differentiation and multiplication. Because TGF-β superfamily signaling is integral to testis formation, it affects processes that underlie testicular pathologies, including testicular cancer, and its potential to contribute to subfertility is beginning to be understood. Copyright © 2015 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Brinch-Pedersen, H.; Galili, G.; Sørensen, K.
1996-01-01
In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...
Directory of Open Access Journals (Sweden)
Olga Y. Yurkevich
2017-08-01
Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.
DEFF Research Database (Denmark)
Christoffersen, Mette; Tybjærg-Hansen, Anne
2015-01-01
PURPOSE OF REVIEW: To summarize recent findings from genome-wide association studies (GWAS), whole-exome sequencing of patients with familial hypercholesterolemia and 'exome chip' studies pointing to novel genes in LDL metabolism. RECENT FINDINGS: The genetic loci for ATP-binding cassette......-exome sequencing and 'exome chip' studies have additionally suggested several novel genes in LDL metabolism including insulin-induced gene 2, signal transducing adaptor family member 1, lysosomal acid lipase A, patatin-like phospholipase domain-containing protein 5 and transmembrane 6 superfamily member 2. Most...... of these findings still require independent replications and/or functional studies to confirm the exact role in LDL metabolism and the clinical implications for human health. SUMMARY: GWAS, exome sequencing studies, and recently 'exome chip' studies have suggested several novel genes with effects on LDL cholesterol...
Listeria arpJ gene modifies T helper type 2 subset differentiation.
Kanoh, Makoto; Maruyama, Saho; Shen, Hua; Matsumoto, Akira; Shinomiya, Hiroto; Przybilla, Karin; Gouin, Edith; Cossart, Pascale; Goebel, Werner; Asano, Yoshihiro
2015-07-15
Although the T-cell subset differentiation pathway has been characterized extensively from the view of host gene regulation, the effects of genes of the pathogen on T-cell subset differentiation during infection have yet to be elucidated. Especially, the bacterial genes that are responsible for this shift have not yet been determined. Utilizing a single-gene-mutation Listeria panel, we investigated genes involved in the host-pathogen interaction that are required for the initiation of T-cell subset differentiation in the early phase of pathogen infection. We demonstrate that the induction of T helper types 1 and 2 (Th1 and Th2) subsets are separate phenomena and are mediated by distinct Listeria genes. We identified several candidate Listeria genes that appear to be involved in the host-Listeria interaction. Among them, arpJ is the strongest candidate gene for inhibiting Th2 subset induction. Furthermore, the analysis utilizing arpJ-deficient Listeria monocytogenes (Lm) revealed that the tumor necrosis factor (TNF) superfamily (Tnfsf) 9-TNF receptor superfamily (Tnfrsf) 9 interaction inhibits the Th2 response during Lm infection. arpJ is the candidate gene for inhibiting Th2 T-cell subset induction. The arpJ gene product influences the expression of Tnfsf/Tnfrsf on antigen-presenting cells and inhibits the Th2 T-cell subset differentiation during Listeria infection. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Matsunaga, James; Barocchi, Michele A.; Croda, Julio; Young, Tracy A.; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A.; Reis, Mitermayer G.; Riley, Lee W.; Haake, David A.; Ko, Albert I.
2005-01-01
Summary Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudo-gene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019
Czech Academy of Sciences Publication Activity Database
Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.
2004-01-01
Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery
Directory of Open Access Journals (Sweden)
Piyatrakul Piyanuch
2012-12-01
Full Text Available Abstract Background Ethylene production and signalling play an important role in somatic embryogenesis, especially for species that are recalcitrant in in vitro culture. The AP2/ERF superfamily has been identified and classified in Hevea brasiliensis. This superfamily includes the ERFs involved in response to ethylene. The relative transcript abundance of ethylene biosynthesis genes and of AP2/ERF genes was analysed during somatic embryogenesis for callus lines with different regeneration potential, in order to identify genes regulated during that process. Results The analysis of relative transcript abundance was carried out by real-time RT-PCR for 142 genes. The transcripts of ERFs from group I, VII and VIII were abundant at all stages of the somatic embryogenesis process. Forty genetic expression markers for callus regeneration capacity were identified. Fourteen markers were found for proliferating calli and 35 markers for calli at the end of the embryogenesis induction phase. Sixteen markers discriminated between normal and abnormal embryos and, lastly, there were 36 markers of conversion into plantlets. A phylogenetic analysis comparing the sequences of the AP2 domains of Hevea and Arabidopsis genes enabled us to predict the function of 13 expression marker genes. Conclusions This first characterization of the AP2/ERF superfamily in Hevea revealed dramatic regulation of the expression of AP2/ERF genes during the somatic embryogenesis process. The gene expression markers of proliferating callus capacity to regenerate plants by somatic embryogenesis should make it possible to predict callus lines suitable to be used for multiplication. Further functional characterization of these markers opens up prospects for discovering specific AP2/ERF functions in the Hevea species for which somatic embryogenesis is difficult.
Harada, Taro; Murakoshi, Yuino; Torii, Yuka; Tanase, Koji; Onozaki, Takashi; Morita, Shigeto; Masumura, Takehiro; Satoh, Shigeru
2011-04-01
Carnation (Dianthus caryophyllus) flowers exhibit climacteric ethylene production followed by petal wilting, a senescence symptom. DcACS1, which encodes 1-aminocyclopropane-1-carboxylate synthase (ACS), is a gene involved in this phenomenon. We determined the genomic DNA structure of DcACS1 by genomic PCR. In the genome of 'Light Pink Barbara', we found two distinct nucleotide sequences: one corresponding to the gene previously shown as DcACS1, designated here as DcACS1a, and the other novel one designated as DcACS1b. It was revealed that both DcACS1a and DcACS1b have five exons and four introns. These two genes had almost identical nucleotide sequences in exons, but not in some introns and 3'-UTR. Analysis of transcript accumulation revealed that DcACS1b is expressed in senescing petals as well as DcACS1a. Genomic PCR analysis of 32 carnation cultivars showed that most cultivars have only DcACS1a and some have both DcACS1a and DcACS1b. Moreover, we found two DcACS1 orthologous genes with different nucleotide sequences from D. superbus var. longicalycinus, and designated them as DsuACS1a and DsuACS1b. Petals of D. superbus var. longicalycinus produced ethylene in response to exogenous ethylene, accompanying accumulation of DsuACS1 transcripts. These data suggest that climacteric ethylene production in flowers was genetically established before the cultivation of carnation.
Moll, Stefanie; Anke, Sven; Kahmann, Uwe; Hänsch, Robert; Hartmann, Thomas; Ober, Dietrich
2002-01-01
Pyrrolizidine alkaloids (PAs) are constitutive plant defense compounds with a sporadic taxonomic occurrence. The first committed step in PA biosynthesis is catalyzed by homospermidine synthase (HSS). Recent evidence confirmed that HSS evolved by gene duplication from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of the eukaryotic translation initiation factor 5A. To better understand the evolutionary relationship between these two enzymes, which are involved in completely different biological processes, we studied their tissue-specific expression. RNA-blot analysis, reverse transcriptase-PCR, and immunolocalization techniques demonstrated that DHS is constitutively expressed in shoots and roots of Senecio vernalis (Asteraceae), whereas HSS expression is root specific and restricted to distinct groups of endodermis and neighboring cortex cells located opposite to the phloem. All efforts to detect DHS by immunolocalization failed, but studies with promoter-β-glucuronidase fusions confirmed a general expression pattern, at least in young seedlings of tobacco (Nicotiana tabacum). The expression pattern for HSS differs completely from its ancestor DHS due to the adaptation of HSS to the specific requirements of PA biosynthesis. PMID:12226485
CAR gene cluster and transcript levels of carotenogenic genes in Rhodotorula mucilaginosa.
Landolfo, Sara; Ianiri, Giuseppe; Camiolo, Salvatore; Porceddu, Andrea; Mulas, Giuliana; Chessa, Rossella; Zara, Giacomo; Mannazzu, Ilaria
2018-01-01
A molecular approach was applied to the study of the carotenoid biosynthetic pathway of Rhodotorula mucilaginosa. At first, functional annotation of the genome of R. mucilaginosa C2.5t1 was carried out and gene ontology categories were assigned to 4033 predicted proteins. Then, a set of genes involved in different steps of carotenogenesis was identified and those coding for phytoene desaturase, phytoene synthase/lycopene cyclase and carotenoid dioxygenase (CAR genes) proved to be clustered within a region of ~10 kb. Quantitative PCR of the genes involved in carotenoid biosynthesis showed that genes coding for 3-hydroxy-3-methylglutharyl-CoA reductase and mevalonate kinase are induced during exponential phase while no clear trend of induction was observed for phytoene synthase/lycopene cyclase and phytoene dehydrogenase encoding genes. Thus, in R. mucilaginosa the induction of genes involved in the early steps of carotenoid biosynthesis is transient and accompanies the onset of carotenoid production, while that of CAR genes does not correlate with the amount of carotenoids produced. The transcript levels of genes coding for carotenoid dioxygenase, superoxide dismutase and catalase A increased during the accumulation of carotenoids, thus suggesting the activation of a mechanism aimed at the protection of cell structures from oxidative stress during carotenoid biosynthesis. The data presented herein, besides being suitable for the elucidation of the mechanisms that underlie carotenoid biosynthesis, will contribute to boosting the biotechnological potential of this yeast by improving the outcome of further research efforts aimed at also exploring other features of interest.
Glycogen synthase kinase 3: more than a namesake.
Rayasam, Geetha Vani; Tulasi, Vamshi Krishna; Sodhi, Reena; Davis, Joseph Alex; Ray, Abhijit
2009-03-01
Glycogen synthase kinase 3 (GSK3), a constitutively acting multi-functional serine threonine kinase is involved in diverse physiological pathways ranging from metabolism, cell cycle, gene expression, development and oncogenesis to neuroprotection. These diverse multiple functions attributed to GSK3 can be explained by variety of substrates like glycogen synthase, tau protein and beta catenin that are phosphorylated leading to their inactivation. GSK3 has been implicated in various diseases such as diabetes, inflammation, cancer, Alzheimer's and bipolar disorder. GSK3 negatively regulates insulin-mediated glycogen synthesis and glucose homeostasis, and increased expression and activity of GSK3 has been reported in type II diabetics and obese animal models. Consequently, inhibitors of GSK3 have been demonstrated to have anti-diabetic effects in vitro and in animal models. However, inhibition of GSK3 poses a challenge as achieving selectivity of an over achieving kinase involved in various pathways with multiple substrates may lead to side effects and toxicity. The primary concern is developing inhibitors of GSK3 that are anti-diabetic but do not lead to up-regulation of oncogenes. The focus of this review is the recent advances and the challenges surrounding GSK3 as an anti-diabetic therapeutic target.
Gunasekera, Angelo; Alvarez, Francisco J.; Douglas, Lois M.; Wang, Hong X.; Rosebrock, Adam P.; Konopka, James B.
2010-01-01
The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism. PMID:20675577
Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak
Directory of Open Access Journals (Sweden)
Marić Slađana
2005-01-01
Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.
International Nuclear Information System (INIS)
Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.
1988-01-01
Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria
Goo, Stephen M.; Cho, Soochin
2013-01-01
The ribonuclease (RNase) A superfamily is a vertebrate-specific gene family. Because of a massive expansion that occurred during the early mammalian evolution, extant mammals in general have much more RNase genes than nonmammalian vertebrates. Mammalian RNases have been associated with diverse physiological functions including digestion, cytotoxicity, angiogenesis, male reproduction, and host defense. However, it is still uncertain when their expansion occurred and how a wide array of functions arose during their evolution. To answer these questions, we generate a compendium of all RNase genes identified in 20 complete mammalian genomes including the platypus, Ornithorhynchus anatinus. Using this, we delineate 13 ancient RNase gene lineages that arose before the divergence between the monotreme and the other mammals (∼220 Ma). These 13 ancient gene lineages are differentially retained in the 20 mammals, and the rate of protein sequence evolution is highly variable among them, which suggest that they have undergone extensive functional diversification. In addition, we identify 22 episodes of recent expansion of RNase genes, many of which have signatures of adaptive functional differentiation. Exemplifying this, bursts of gene duplication occurred for the RNase1, RNase4, and RNase5 genes of the little brown bat (Myotis lucifugus), which might have contributed to the species’ effective defense against heavier pathogen loads caused by its communal roosting behavior. Our study illustrates how host-defense systems can generate new functions efficiently by employing a multigene family, which is crucial for a host organism to adapt to its ever-changing pathogen environment. PMID:24162010
Clinical significance of Phosphatidyl Inositol Synthase overexpression in oral cancer
International Nuclear Information System (INIS)
Kaur, Jatinder; Sawhney, Meenakshi; DattaGupta, Siddartha; Shukla, Nootan K; Srivastava, Anurag; Ralhan, Ranju
2010-01-01
We reported increased levels of Phosphatidyl Inositol synthase (PI synthase), (enzyme that catalyses phosphatidyl inositol (PI) synthesis-implicated in intracellular signaling and regulation of cell growth) in smokeless tobacco (ST) exposed oral cell cultures by differential display. This study determined the clinical significance of PI synthase overexpression in oral squamous cell carcinoma (OSCC) and premalignant lesions (leukoplakia), and identified the downstream signaling proteins in PI synthase pathway that are perturbed by smokeless tobacco (ST) exposure. Tissue microarray (TMA) Immunohistochemistry, Western blotting, Confocal laser scan microscopy, RT-PCR were performed to define the expression of PI synthase in clinical samples and in oral cell culture systems. Significant increase in PI synthase immunoreactivity was observed in premalignant lesions and OSCCs as compared to oral normal tissues (p = 0.000). Further, PI synthase expression was significantly associated with de-differentiation of OSCCs, (p = 0.005) and tobacco consumption (p = 0.03, OR = 9.0). Exposure of oral cell systems to smokeless tobacco (ST) in vitro confirmed increase in PI synthase, Phosphatidylinositol 3-kinase (PI3K) and cyclin D1 levels. Collectively, increased PI synthase expression was found to be an early event in oral cancer and a target for smokeless tobacco
Plasmodium falciparum dolichol phosphate mannose synthase represents a novel clade
International Nuclear Information System (INIS)
Shams-Eldin, Hosam; Santos de Macedo, Cristiana; Niehus, Sebastian; Dorn, Caroline; Kimmel, Juergen; Azzouz, Nahid; Schwarz, Ralph T.
2008-01-01
Dolichol phosphate mannose synthase (DPM) catalyzes the reaction between dolichol phosphate (Dol-P) and guanosine diphosphate mannose (GDP-Man) to form dolichol-phosphate-mannose (Dol-P-Man). This molecule acts as mannose donor for N-glycosylation and glycosylphosphatidylinositol (GPI) biosynthesis. The Plasmodium falciparum DPM1 (Pfdpm1) possesses a single predicted transmembrane region near the N-, but not the C-terminus. Here we show that the cloned Pfdpm1 gene failed to complement a Saccharomyces cerevisiae mutant indicating that the parasite gene does not belong to the baker's yeast group, as was previously assumed. Furthermore, Pfdpm1 was unable to complement a mouse mutant deficient in DPM but efficiently complements the Schizosaccharomyces pombe fission yeast mutant, indicating a difference between fission yeast and mammalian DPM genes. Therefore, we reanalyzed the hydrophobicity scales of all known DPMs and consequently reclassify the DPM clade into six major novel subgroups. Furthermore, we show that Pfdpm1 represents a unique enzyme among these subgroups
SVM-Fold: a tool for discriminative multi-class protein fold and superfamily recognition.
Melvin, Iain; Ie, Eugene; Kuang, Rui; Weston, Jason; Stafford, William Noble; Leslie, Christina
2007-05-22
Predicting a protein's structural class from its amino acid sequence is a fundamental problem in computational biology. Much recent work has focused on developing new representations for protein sequences, called string kernels, for use with support vector machine (SVM) classifiers. However, while some of these approaches exhibit state-of-the-art performance at the binary protein classification problem, i.e. discriminating between a particular protein class and all other classes, few of these studies have addressed the real problem of multi-class superfamily or fold recognition. Moreover, there are only limited software tools and systems for SVM-based protein classification available to the bioinformatics community. We present a new multi-class SVM-based protein fold and superfamily recognition system and web server called SVM-Fold, which can be found at http://svm-fold.c2b2.columbia.edu. Our system uses an efficient implementation of a state-of-the-art string kernel for sequence profiles, called the profile kernel, where the underlying feature representation is a histogram of inexact matching k-mer frequencies. We also employ a novel machine learning approach to solve the difficult multi-class problem of classifying a sequence of amino acids into one of many known protein structural classes. Binary one-vs-the-rest SVM classifiers that are trained to recognize individual structural classes yield prediction scores that are not comparable, so that standard "one-vs-all" classification fails to perform well. Moreover, SVMs for classes at different levels of the protein structural hierarchy may make useful predictions, but one-vs-all does not try to combine these multiple predictions. To deal with these problems, our method learns relative weights between one-vs-the-rest classifiers and encodes information about the protein structural hierarchy for multi-class prediction. In large-scale benchmark results based on the SCOP database, our code weighting approach
Dohmen, Serge E.; Verhagen, Onno J. H. M.; Muit, Jessica; Ligthart, Peter C.; van der Schoot, C. Ellen
2006-01-01
BACKGROUND: Antibodies produced against the D antigen make use of IGHV genes restricted to the IGHV3 superfamily. These findings are based on the IGHV gene analysis in anti-D-producing B cells from hyperimmunized donors, however, and therefore the restriction might be due to the hyperimmunization.
Heinz, Eva; Lithgow, Trevor
2014-01-01
Members of the Omp85/TpsB protein superfamily are ubiquitously distributed in Gram-negative bacteria, and function in protein translocation (e.g., FhaC) or the assembly of outer membrane proteins (e.g., BamA). Several recent findings are suggestive of a further level of variation in the superfamily, including the identification of the novel membrane protein assembly factor TamA and protein translocase PlpD. To investigate the diversity and the causal evolutionary events, we undertook a comprehensive comparative sequence analysis of the Omp85/TpsB proteins. A total of 10 protein subfamilies were apparent, distinguished in their domain structure and sequence signatures. In addition to the proteins FhaC, BamA, and TamA, for which structural and functional information is available, are families of proteins with so far undescribed domain architectures linked to the Omp85 β-barrel domain. This study brings a classification structure to a dynamic protein superfamily of high interest given its essential function for Gram-negative bacteria as well as its diverse domain architecture, and we discuss several scenarios of putative functions of these so far undescribed proteins. PMID:25101071
Robinson, Serina L; Badalamenti, Jonathan P; Dodge, Anthony G; Tassoulas, Lambros J; Wackett, Lawrence P
2018-03-12
Biuret is a minor component of urea fertilizer and an intermediate in s-triazine herbicide biodegradation. The microbial metabolism of biuret has never been comprehensively studied. Here, we enriched and isolated bacteria from a potato field that grew on biuret as a sole nitrogen source. We sequenced the genome of the fastest-growing isolate, Herbaspirillum sp. BH-1 and identified genes encoding putative biuret hydrolases (BHs). We purified and characterized a functional BH enzyme from Herbaspirillum sp. BH-1 and two other bacteria from divergent phyla. The BH enzymes reacted exclusively with biuret in the range of 2-11 µmol min -1 mg -1 protein. We then constructed a global protein superfamily network to map structure-function relationships in the BH subfamily and used this to mine > 7000 genomes. High-confidence BH sequences were detected in Actinobacteria, Alpha- and Beta-proteobacteria, and some fungi, archaea and green algae, but not animals or land plants. Unexpectedly, no cyanuric acid hydrolase homologs were detected in > 90% of genomes with BH homologs, suggesting BHs may have arisen independently of s-triazine ring metabolism. This work links genotype to phenotype by enabling accurate genome-mining to predict microbial utilization of biuret. Importantly, it advances understanding of the microbial capacity for biuret biodegradation in agricultural systems. © 2018 Society for Applied Microbiology and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Toub Omid
2010-10-01
Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information
Directory of Open Access Journals (Sweden)
ML Rossi
2009-06-01
Full Text Available Unstable angina and myocardial infarction are the clinical manifestations of the abrupt thrombotic occlusion of an epicardial coronary artery as a result of spontaneous atherosclerotic plaque rupture or fissuring, and the exposure of highly thrombogenic material to blood. It has been demonstrated that the proliferation of vascular smooth muscle cells (VSMCs and impaired bioavailabilty of nitric oxide (NO are among the most important mechanisms involved in the progression of atherosclerosis. It has also been suggested that a NO imbalance in coronary arteries may be involved in myocardial ischemia as a result of vasomotor dysfunction triggering plaque rupture and the thrombotic response. We used 5’ nuclease assays (TaqMan™ PCRs to study gene expression in coronary plaques collected by means of therapeutic directional coronary atherectomy from 15 patients with stable angina (SA and 15 with acute coronary syndromes (ACS without ST elevation. Total RNA was extracted from the 30 plaques and the cDNA was amplified in order to determine endothelial nitric oxide synthase (eNOS gene expression. Analysis of the results showed that the expression of eNOS was significantly higher (p<0.001 in the plaques from the ACS patients. Furthermore, isolated VSMCs from ACS and SA plaques confirmed the above pattern even after 25 plating passages. In situ RT-PCR was also carried out to co-localize the eNOS messengers and the VSMC phenotype.
Directory of Open Access Journals (Sweden)
Ritland Carol
2009-08-01
Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene
Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg
2009-08-06
Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The
Baudino, S.; Hansen, S.; Brettschneider, R.; Hecht, V.F.G.; Dresselhaus, T.; Lörz, H.; Dumas, C.; Rogowsky, P.M.
2001-01-01
Genes encoding two novel members of the leucine-rich repeat receptor-like kinase (LRR-RLK) superfamily have been isolated from maize (Zea mays L.). These genes have been named ZmSERK1 and ZmSERK2 since features such as a putative leucine zipper (ZIP) and five leucine rich repeats in the
Directory of Open Access Journals (Sweden)
Aleksander F Sikorski
2007-01-01
Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.
International Nuclear Information System (INIS)
Chu, F.K.; Maley, F.; Martinez, J.; Maley, G.F.
1987-01-01
Southern hybridization analyses of procaryotic DNA from Escherchia coli, λ bacteriophage, and T1 to T7 phages were carried out. The hybridization probes used consisted of DNA restriction fragments derived from the T4 phage intron-containing thymidylate synthase gene (td) and short synthetic oligodeoxynucleotides defining specific exon and intron regions of the gene. It was shown that intact as well as restricted DNA from the T-even phages hybridized not only to both T4 phage td intron- and exon-specific probes but also to probes defining the td 5' (exon I-intron) and 3' (intron-exon II) presplice junctions. These data strongly suggest that, analogous to the T4 phage, only the T2 and T6 phages among the procaryotes tested contain interrupted td genes. The td intervening sequence in each phage is roughly 1 kilobase pair (kb) in size and interrupts the td gene at a site analogous to that in the T4 phage. This was confirmed by data from Northern (RNA) hybridization analysis of td-specific in vitro transcripts of these phage DNAs. [α- 32 P]GTP in vitro labeling of total RNA from T4 phage-infected cells produced five species of labeled RNAs that were 1, 0.9, 0.83, 0.75, and 0.6 kb in size. Only the 1-, 0.9-, and 0.75-kb species were labeled in RNA from T2- or T6-infected cells. The commonly present 1-kb RNA is the excised td intron, which exists in both linear and circular forms in the respective T-even-phage-infected cells, while the 0.6-kb RNA unique to T4 may be the excised intron derived from the ribonucleotide reductase small subunit gene (nrdB) of the phage. The remaining labeled RNA species are likely candidates for other self-splicing introns
Gene structure, phylogeny and expression profile of the sucrose ...
Indian Academy of Sciences (India)
Gene structure, phylogeny and expression profile of the sucrose synthase gene family in .... 24, 701–713. Bate N. and Twell D. 1998 Functional architecture of a late pollen .... Manzara T. and Gruissem W. 1988 Organization and expression.
Maruri-López, Israel; Rodríguez-Kessler, Margarita; Rodríguez-Hernández, Aída Araceli; Becerra-Flora, Alicia; Olivares-Grajales, Juan Elías; Jiménez-Bremont, Juan Francisco
2014-05-01
Polyamines are low molecular weight aliphatic compounds involved in various biochemical, cellular and physiological processes in all organisms. In plants, genes involved in polyamine biosynthesis and catabolism are regulated at transcriptional, translational, and posttranslational level. In this research, we focused on the characterization of a PEST sequence (rich in proline, glutamic acid, serine, and threonine) of the maize spermine synthase 1 (ZmSPMS1). To this aim, 123 bp encoding 40 amino acids of the C-terminal region of the ZmSPMS1 enzyme containing the PEST sequence were fused to the GUS reporter gene. This fusion was evaluated in Arabidopsis thaliana transgenic lines and onion monolayers transient expression system. The ZmSPMS1 PEST sequence leads to specific degradation of the GUS reporter protein. It is suggested that the 26S proteasome may be involved in GUS::PEST fusion degradation in both onion and Arabidopsis. The PEST sequences appear to be present in plant spermine synthases, mainly in monocots. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Shen, Qinqin; Li, Lixia; Jiang, Yu; Wang, Qiang
2016-01-01
To characterize the ent-copalyl diphosphate (ent-CPP) synthase involved in the biosynthetic pathway of andrographolides in a medicinal plant, Andrographis paniculata. The ent-CPP synthase (ent-CPS) gene was cloned from A. paniculata and its encoded ApCPS was demonstrated to react with (E,E,E)-geranylgeranyl diphosphate to form ent-CPP through recombinant expression in Escherichia coli. Site-directed mutagenesis of the Asp to Ala in the conserved DXDD motif of ApCPS resulted in loss of function. One Arg is located in the conserved position close to DXDD motif indicating the involvement of ApCPS in specialized metabolism. In addition, RT-PCR analysis revealed that ApCPS was expressed in all tissues of A. paniculata at all growth stages, which is consistent with andrographolides accumulating in these organs. Methyl jasmonate induced ApCPS gene expression, matching inducible accumulation of andrographolides in vivo. ApCPS is the first ent-CPS characterized in A. paniculata and is suggested to be involved in biosynthesis of andrographolides that have high pharmaceutical values.
2013-01-01
Background Aspartic proteases (APs) are a large family of proteolytic enzymes found in almost all organisms. In plants, they are involved in many biological processes, such as senescence, stress responses, programmed cell death, and reproduction. Prior to the present study, no grape AP gene(s) had been reported, and their research on woody species was very limited. Results In this study, a total of 50 AP genes (VvAP) were identified in the grape genome, among which 30 contained the complete ASP domain. Synteny analysis within grape indicated that segmental and tandem duplication events contributed to the expansion of the grape AP family. Additional analysis between grape and Arabidopsis demonstrated that several grape AP genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grape and Arabidopsis. Phylogenetic relationships of the 30 VvAPs with the complete ASP domain and their Arabidopsis orthologs, as well as their gene and protein features were analyzed and their cellular localization was predicted. Moreover, expression profiles of VvAP genes in six different tissues were determined, and their transcript abundance under various stresses and hormone treatments were measured. Twenty-seven VvAP genes were expressed in at least one of the six tissues examined; nineteen VvAPs responded to at least one abiotic stress, 12 VvAPs responded to powdery mildew infection, and most of the VvAPs responded to SA and ABA treatments. Furthermore, integrated synteny and phylogenetic analysis identified orthologous AP genes between grape and Arabidopsis, providing a unique starting point for investigating the function of grape AP genes. Conclusions The genome-wide identification, evolutionary and expression analyses of grape AP genes provide a framework for future analysis of AP genes in defining their roles during stress response. Integrated synteny and phylogenetic analyses provide novel insight into the
Reduced ceramide synthase 2 activity causes progressive myoclonic epilepsy
DEFF Research Database (Denmark)
Mosbech, Mai-Britt; Olsen, Anne S B; Neess, Ditte
2014-01-01
between genes involved in SL metabolism and epilepsy. METHODS: We used quantitative real-time PCR, Western blotting, and enzymatic assays to determine the mRNA, protein, and activity levels of ceramide synthase 2 (CERS2) in fiibroblasts isolated from parental control subjects and from a patient diagnosed...... with progressive myoclonic epilepsy (PME). Mass spectrometry and fluorescence microscopy were used to examine the effects of reduced CERS2 activity on cellular lipid composition and plasma membrane functions. RESULTS: We identify a novel 27 kb heterozygous deletion including the CERS2 gene in a proband diagnosed...... with PME. Compared to parental controls, levels of CERS2 mRNA, protein, and activity were reduced by ˜50% in fibroblasts isolated from this proband, resulting in significantly reduced levels of ceramides and sphingomyelins containing the very long-chain fatty acids C24:0 and C26:0. The change in SL...
International Nuclear Information System (INIS)
Staiger, D.; Kaulen, H.; Schell, J.
1989-01-01
In the chalcone synthase gene of Antirrhinum majus (snapdragon), 150 base pairs of the 5' flanking region contain cis-acting signals for UV light-induced expression. A nuclear factor, designated CG-1, specifically recognizes a hexameric motif with internal dyad symmetry, CACGTG, located within this light-responsive sequence. Binding of CG-1 is influenced by C-methylation of the CpG dinucleotide in the recognition sequence. CG-1 is a factor found in a variety of dicotyledonous plant species including Nicotiana tabacum, A. majus, Petunia hybrida, Arabidopsis thaliana, and Glycine max. CACGTG motifs contained within trans-acting factor recognition sites in various other plant promoters can interact with CG-1. In addition, the binding site of the human adenovirus major late transcription factor USF can compete for CG-1 binding to the chalcone synthase promoter. This suggests an evolutionary conservation of trans-acting factor recognition sites involved in divergent mechanisms of gene control. (author)
A dual role for a polyketide synthase in dynemicin enediyne and anthraquinone biosynthesis
Cohen, Douglas R.; Townsend, Craig A.
2018-02-01
Dynemicin A is a member of a subfamily of enediyne antitumour antibiotics characterized by a 10-membered carbocycle fused to an anthraquinone, both of polyketide origin. Sequencing of the dynemicin biosynthetic gene cluster in Micromonospora chersina previously identified an enediyne polyketide synthase (PKS), but no anthraquinone PKS, suggesting gene(s) for biosynthesis of the latter were distant from the core dynemicin cluster. To identify these gene(s), we sequenced and analysed the genome of M. chersina. Sequencing produced a short list of putative PKS candidates, yet CRISPR-Cas9 mutants of each locus retained dynemicin production. Subsequently, deletion of two cytochromes P450 in the dynemicin cluster suggested that the dynemicin enediyne PKS, DynE8, may biosynthesize the anthraquinone. Together with 18O-labelling studies, we now present evidence that DynE8 produces the core scaffolds of both the enediyne and anthraquinone, and provide a working model to account for their formation from the programmed octaketide of the enediyne PKS.
Czech Academy of Sciences Publication Activity Database
Yurchenko, T.; Ševčíková, T.; Strnad, Hynek; Butenko, A.; Eliáš, M.
2016-01-01
Roč. 6, č. 11 (2016), č. článku 160249. ISSN 2046-2441 R&D Projects: GA ČR GA13-33039S; GA MŠk(CZ) ED2.1.00/19.0388; GA MŠk(CZ) LO1208 EU Projects: European Commission 642575 Institutional support: RVO:68378050 Keywords : Eustigmatophyceae * horizontal gene transfer * plastid genome * secondary metabolism * sugar phosphate cyclase superfamily * UbiA superfamily Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.481, year: 2016
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel Edmundo; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-11-01
Sucrose is synthesized from UDP-Glc and Fru-6-phosphate via the activity of sucrose-phosphate synthase (SPS) enzymes, which produce Suc-6-phosphate. Suc-6-phosphate is rapidly dephosphorylated by phosphatases to produce Suc and inorganic phosphate. Arabidopsis has four sps genes encoding SPS enzymes. Of these enzymes, AtSPS1F and AtSPS2F have been grouped with other dicotyledonous SPS enzymes, while AtSPS3F and AtSPS4F are included in groups with both dicotyledonous and monocotyledonous SPS enzymes. In this work, we generated Arabidopsis thaliana transformants containing the promoter region of each sps gene fused to gfp::uidA reporter genes. A detailed characterization of expression conferred by the sps promoters in organs and tissues was performed. We observed expression of AtSPS1F, AtSPS2F and AtSPS3F in the columella roots of the plants that support sucrose synthesis. Hence, these findings support the idea that sucrose synthesis occurs in the columella cells, and suggests that sucrose has a role in this tissue. In addition, the expression of AtSPS4F was identified in embryos and suggests its participation in this developmental stage. Quantitative transcriptional analysis of A. thaliana plants grown in media with different osmotic potential showed that AtSPS2F and AtSPS4F respond to osmotic stress. Copyright © 2017 Elsevier B.V. All rights reserved.
Terpene synthases from Cannabis sativa.
Booth, Judith K; Page, Jonathan E; Bohlmann, Jörg
2017-01-01
Cannabis (Cannabis sativa) plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS) were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E)-β-ocimene, (-)-limonene, (+)-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.
International Nuclear Information System (INIS)
Zhang, Jinyong; Zhang, Xiaoli; Mao, Xuhu; Zou, Quanming; Li, Defeng
2011-01-01
Octaprenyl pyrophosphate synthase from H. pylori has been expressed, purified and crystallized, and a diffraction data set was collected to 2.00 Å resolution. Octaprenyl pyrophosphate synthase (OPPs) is involved in the synthesis of the side chains of ubiquinone and menaquinone and catalyzes consecutive condensation reactions of farnesyl pyrophosphate with isopentenyl pyrophosphate to generate polyprenyl pyrophosphate and pyrophosphate. In order to investigate the roles played by OPPs in the metabolism of ubiquinone and menaquinone and the enzymatic mechanisms of these enzymes, analysis of the structure–function relationship of OPPs from Helicobacter pylori was initiated. The gene for OPPs was cloned, the protein was expressed, purified and crystallized and a diffraction data set was collected to 2.00 Å resolution. The crystals belonged to space group P4 1 2 1 2 or P4 3 2 1 2, with unit-cell parameters a = b = 109.33, c = 103.41 Å
Ye, Yanfang; Fujii, Makoto; Hirata, Aiko; Kawamukai, Makoto; Shimoda, Chikashi; Nakamura, Taro
2007-09-01
Both farnesyl diphosphate synthase (FPS) and geranylgeranyl diphosphate synthase (GGPS) are key enzymes in the synthesis of various isoprenoid-containing compounds and proteins. Here, we describe two novel Schizosaccharomyces pombe genes, fps1(+) and spo9(+), whose products are similar to FPS in primary structure, but whose functions differ from one another. Fps1 is essential for vegetative growth, whereas, a spo9 null mutant exhibits temperature-sensitive growth. Expression of fps1(+), but not spo9(+), suppresses the lethality of a Saccharomyces cerevisiae FPS-deficient mutant and also restores ubiquinone synthesis in an Escherichia coli ispA mutant, which lacks FPS activity, indicating that S. pombe Fps1 in fact functions as an FPS. In contrast to a typical FPS gene, no apparent GGPS homologues have been found in the S. pombe genome. Interestingly, although neither fps1(+) nor spo9(+) expression alone in E. coli confers clear GGPS activity, coexpression of both genes induces such activity. Moreover, the GGPS activity is significantly reduced in the spo9 mutant. In addition, the spo9 mutation perturbs the membrane association of a geranylgeranylated protein, but not that of a farnesylated protein. Yeast two-hybrid and coimmunoprecipitation analyses indicate that Fps1 and Spo9 physically interact. Thus, neither Fps1 nor Spo9 alone functions as a GGPS, but the two proteins together form a complex with GGPS activity. Because spo9 was originally identified as a sporulation-deficient mutant, we show here that expansion of the forespore membrane is severely inhibited in spo9Delta cells. Electron microscopy revealed significant accumulation membrane vesicles in spo9Delta cells. We suggest that lack of GGPS activity in a spo9 mutant results in impaired protein prenylation in certain proteins responsible for secretory function, thereby inhibiting forespore membrane formation.
Keeling, Christopher I.; Dullat, Harpreet K.; Yuen, Mack; Ralph, Steven G.; Jancsik, Sharon; Bohlmann, Jörg
2010-01-01
The biosynthesis of the tetracyclic diterpene ent-kaurene is a critical step in the general (primary) metabolism of gibberellin hormones. ent-Kaurene is formed by a two-step cyclization of geranylgeranyl diphosphate via the intermediate ent-copalyl diphosphate. In a lower land plant, the moss Physcomitrella patens, a single bifunctional diterpene synthase (diTPS) catalyzes both steps. In contrast, in angiosperms, the two consecutive cyclizations are catalyzed by two distinct monofunctional enzymes, ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS). The enzyme, or enzymes, responsible for ent-kaurene biosynthesis in gymnosperms has been elusive. However, several bifunctional diTPS of specialized (secondary) metabolism have previously been characterized in gymnosperms, and all known diTPSs for resin acid biosynthesis in conifers are bifunctional. To further understand the evolution of ent-kaurene biosynthesis as well as the evolution of general and specialized diterpenoid metabolisms in gymnosperms, we set out to determine whether conifers use a single bifunctional diTPS or two monofunctional diTPSs in the ent-kaurene pathway. Using a combination of expressed sequence tag, full-length cDNA, genomic DNA, and targeted bacterial artificial chromosome sequencing, we identified two candidate CPS and KS genes from white spruce (Picea glauca) and their orthologs in Sitka spruce (Picea sitchensis). Functional characterization of the recombinant enzymes established that ent-kaurene biosynthesis in white spruce is catalyzed by two monofunctional diTPSs, PgCPS and PgKS. Comparative analysis of gene structures and enzyme functions highlights the molecular evolution of these diTPSs as conserved between gymnosperms and angiosperms. In contrast, diTPSs for specialized metabolism have evolved differently in angiosperms and gymnosperms. PMID:20044448