WorldWideScience

Sample records for synthase gene polymorphisms

  1. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  2. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained from the ... (Serrano et al., 2004),. Behcet's disease (Karasneh et al., 2005), diabetes (Monti ... EDTA-treated peripheral venous blood using the salting-out method. (Miller et al., 1988).

  3. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    Background: Previous studies indicated an association between endothelial nitric oxide synthase (eNOS) activity and maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated with recurrent spontaneous abortions (RSAs). Aim: The aim was to investigate ...

  4. 5,10-Methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) gene polymorphisms and adult meningioma risk.

    Science.gov (United States)

    Zhang, Jun; Zhou, Yan-Wen; Shi, Hua-Ping; Wang, Yan-Zhong; Li, Gui-Ling; Yu, Hai-Tao; Xie, Xin-You

    2013-11-01

    The causes of meningiomas are not well understood. Folate metabolism gene polymorphisms have been shown to be associated with various human cancers. It is still controversial and ambiguous between the functional polymorphisms of folate metabolism genes 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTRR), and methionine synthase reductase (MTR) and risk of adult meningioma. A population-based case–control study involving 600 meningioma patients (World Health Organization [WHO] Grade I, 391 cases; WHO Grade II, 167 cases; WHO Grade III, 42 cases) and 600 controls was done for the MTHFR C677T and A1298C, MTRR A66G, and MTR A2756G variants in Chinese Han population. The folate metabolism gene polymorphisms were determined by using a polymerase chain reaction–restriction fragment length polymorphism assay. Meningioma cases had a significantly lower frequency of MTHFR 677 TT genotype [odds ratio (OR) = 0.49, 95 % confidence interval (CI) 0.33–0.74; P = 0.001] and T allele (OR = 0.80, 95 % CI 0.67–0.95; P = 0.01) than controls. A significant association between risk of meningioma and MTRR 66 GG (OR = 1.41, 95 % CI 1.02–1.96; P = 0.04) was also observed. When stratifying by the WHO grade of meningioma, no association was found. Our study suggested that MTHFR C677T and MTRR A66G variants may affect the risk of adult meningioma in Chinese Han population.

  5. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  6. Clinical aspects of endothelial NO-synthase gene polymorphism in professional sportsmen (literature review

    Directory of Open Access Journals (Sweden)

    S. N. Malakhova

    2016-08-01

    Full Text Available The article deals the questions of properties and biological role of nitric oxide molecule, which is characterized with vasodilating, stress limiting and neurotransmitter properties, and participates in reactions of oxidative stress, glutamate and calcium cascade and inflammation. Researches of the relationship of endothelial NO-synthase and the risk of cardiovascular, ischemic and respiratory diseases in population of untrained persons and athletes continue. The aim of this study was to establish, according to the literature, the present state of the influence of endothelial NO-synthase gene polymorphism on the formation of the physical qualities of strength, endurance and speed in professional athletes, its changes and influence on functional state of athlete. At the present stage of development of medical genetics it is proved, that the implementation of the action of each individual isoform of the enzyme NO-synthase is caused by the presence of polymorphism. The most studied are the T-786С polymorphism of the eNOS gene promoter, G894T (Glu298Asp polymorphism of the 7th exon, 4a/b–4th intron of eNOS, but their influence is not definitively proven, and is caused by the presence of homo- or heterozygotes. Genetic researches among professional athletes prove the significant role of nitric oxide system in enhancing of physical working capacity, but do not allow evaluating the characteristics of this effect, taking into account multi-directional training process and the level of sports qualification, as well as predicting future professional success and the preservation of the proper functioning of the cardiovascular, respiratory and other body systems. Conclusions. Thus, contemporary researches allow stating that oxide synthesis has a leading role in the functioning of the organism, and in particular athletes, but do not allow assessing its effects on the body of athletes of different sports qualification. It is proved that polymorphism of the

  7. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  8. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.

    2004-01-01

    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  9. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Constitutive nitric oxide synthase gene polymorphisms and house dust mite respiratory allergy in an Algerian patient group.

    Science.gov (United States)

    Djidjik, R; Ghaffor, M; Brun, M; Gharnaout, M; Salah, S S; Boukouaci, W; Djidjik, H; Benyounes, A; Koumaravelou, K; Krishnamoorthy, R; Abbadi, M C; Charron, D; Tamouza, R

    2008-02-01

    Genetic polymorphisms in neuronal nitric oxide synthase (NOS1) and calmodulin-dependent endothelial NOS (NOS3) genes are known to influence the course of allergic respiratory disorders. We investigated the role of NOS1 -84 G-->A and NOS3 -786 T-->C, 894 G-->T and 27 base pair (bp) repeat polymorphisms in 125 patients suffering from asthma and/or rhinitis and monosensitized against Dermatophagoides pteronyssinus (Dpter) and 111 controls from Algeria. We found a higher frequency of the -786 C NOS3 allele in patients than in controls [corrected P value (Pc) = 0.04], especially in female cases (Pc = 0.02) and that the 'ab' genotype of the 27-bp polymorphism was significantly associated with specific immunoglobulin E production against Dpter (P = 0.006). This study brings further support for the participation of NOS3 gene polymorphism in the pathogenesis of respiratory allergic disorders.

  11. Endothelial nitric oxide synthase gene polymorphisms (G894T) in diabetes mellitus in Egypt

    OpenAIRE

    El-baz1 ; Farouk2; Tag Eldin2; Ezat2

    2010-01-01

    Objective: Diabetic nephropathy (DN) is one of the major microvascular complications of diabetes. Genetic predisposition has been implicated in DN. The eNOS protein synthesizes nitric oxide constitutively via a reaction including the conversion of L-arginine to L-citrulline, which involves the transfer of five electrons provided by nicotinamide adenine dinucleotide phosphate The aim of this study is to evaluate the association of G894T polymorphisms of endothelial nitric oxide synthase(eNOS) ...

  12. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    Science.gov (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  13. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

    Directory of Open Access Journals (Sweden)

    Linda Koshy

    2008-01-01

    Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

  14. Endothelial nitric oxide synthase gene polymorphisms and risk of erectile dysfunction: An updated meta-analysis of genetic association studies.

    Science.gov (United States)

    Yao, Han-Xin; Ma, Fu-Zhe; Tan, Yu-Ying; Liu, Ling-Yun

    2018-04-11

    Endothelial nitric oxide synthase (eNOS) polymorphisms have been implicated as risk factors for erectile dysfunction (ED), but the results of genetic association studies are inconclusive. We performed a meta-analysis of published studies investigating the association between ED and three eNOS polymorphisms, intron 4 VNTR, G894T and T786C in humans. The PubMed, Web of Science, CNKI and Google Scholar databases were searched for relevant studies published up to November 2017. Association studies with case-control design were included. For each study with genotype information we calculated odds ratios (OR) and 95% confidence intervals (CI). The search identified 13 eligible studies. The G894T and T786C polymorphisms showed a significant association with ED risk in Caucasians (GT + TT versus GG for G894T: OR = 2.13, 95% CI = 1.08-4.19; CC versus CT + TT for T786C: OR = 3.29, 95% CI = 2.30-4.72) and Asians (GT + TT versus GG for G894T: OR = 2.08, 95% CI = 1.53-2.84; CC + CT versus TT for T786C: OR = 3.13, 95% CI = 1.35-7.25). In addition, the intron 4 VNTR polymorphism was associated with ED risk only among Caucasian subjects (aa versus bb + ab: OR = 2.38, 95% CI = 1.15-4.93). We found no evidence of publication bias. The robustness of overall analyses was ensured in sensitivity analyses excluding studies deviating from Hardy-Weinberg equilibrium. Our findings suggest that common genetic polymorphisms in the eNOS gene contribute to risk of ED, presumably by effects on eNOS activity and NO availability. Copyright © 2018. Published by Elsevier Ltd.

  15. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  16. ALLELE STATUS OF ALDOSTERONE SYNTHASE (CYP11B2 GENE POLYMORPHISM AND CARDIAC REMODELING AFTER ST SEGMENT ELEVATION MYOCARDIAL INFARCTION

    Directory of Open Access Journals (Sweden)

    Petyunina O. V.

    2017-12-01

    Full Text Available Aldosterone plays an important role in the development of reparative and reactive fibrosis and cardiac remodeling (CR after myocardial infarction. The objective of the study is to investigate the structural and functional parameters of the myocardium, heart rate variability (HRV, exercise intolerance, levels of sST2 in association with polymorphism of CYP11B2 gene of aldosterone-synthase in ST-myocardial infarction (STEMI patients during a 6-months follow-up period. 85 STEMI patients were enrolled: 68 (80 % male and 17 (20 % female, mean age was 58,94 ± 10,16 years. Examinations were performed twice: during 1–3 days after PCI with infarct-related artery stenting and included clinical assessment, ultrasound diagnostic, immunofermentative blood analyses (sST2, polymerase chain reaction in real time (polymorphism –T344C of the CYP11B2 gene. After 6-months of observation, 57 patients were reexamined – clinical assessment, ultrasound diagnostic, HRV were performed. CYP11B2 TT-genotype in 6 months after STEMI is associated with a maladaptive character of after infarction remodeling.

  17. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular damage in hypertensive subjects: an Italian case-control study

    Directory of Open Access Journals (Sweden)

    Pizzo Federica

    2008-05-01

    Full Text Available Abstract Background Nitric oxide (NO synthesized by endothelial nitric oxide synthase (eNOS plays an important role in regulation of endothelial function and in the control of blood pressure. However, the results from some studies on the association between three clinically relevant eNOS gene polymorphisms (G894T, T786C and intron 4b/a and essential hypertension are unclear. We designed a case-control study to evaluate the influence of eNOS polymorphisms on target organ damage in 127 hypertensives and 67 normotensives. Clinical evaluation, biochemical parameters, Urinary Albumin Excretion (UAE and echocardiogram were performed to characterize target organ damage. eNOS polymorphism were recognized by PCR method. Results The distribution of eNOS genotypes was similar in hypertensives and normotensives but 4aa was present in the 2.5% of hypertensives and completely absent in normotensives. Subjects with 4bb, G894T, and T786C genotypes showed an increased prevalence of target organ damage. Moreover prevalence of G894T and introne 4 variants was significantly higher in hypertensives than in normotensives both with cardiovascular damage. Logistic regression analysis didn't show any association between eNOS polymorphisms, Body Mass Index (BMI, hypertension, gender and cardiovascular damage. Only the age (OR 1.11; IC 95% 1.06–1.18 was predictive of cardiovascular damage in our population. Conclusion Our results seem to indicate a lack of association with eNOS variants and cardiovascular damage onset.

  18. Molecular typing using polymorphisms of the polyketide synthase gene (PKS1) of strains in Japan morphologically identified as Fonsecaea pedrosoi.

    Science.gov (United States)

    Ushigami, Tsuyoshi; Anzawa, Kazushi; Mochizuki, Takashi

    2017-01-01

    Fonsecaea pedrosoi sensu lato is a major causative agent of dematiaceous fungal infection in Japan. Recent sequence analysis of the internal transcribed spacer (ITS) regions of the ribosomal RNA gene has shown that this species can be separated into three species: F. pedrosoi sensu stricto, F. monophora and F. nubica. The cell walls of dematiaceous fungi including the genus Fonsecaea contain melanin, which is important for their virulence. Polyketide synthase (PKS1) is an enzyme required for melanin synthesis. This study analyzed the phylogeny of strains of F. pedrosoi sensu lato isolated in Japan by sequencing the PKS1 gene and ITS regions and identifying molecular polymorphism. Sixty strains morphologically identified as F. pedrosoi isolated worldwide, including 37 strains isolated in Japan, were analyzed. ITS regions of the ribosomal RNA gene and part of the PKS1 gene region were amplified, yielding sequences of approximately 600 and 450 bp, respectively. Polymerase chain reaction products were sequenced, and cluster analysis was performed. The proposed phylogenetic tree based on PKS1 sequences closely matched that based on the ITS regions. Sequencing of both regions showed that the isolates from Japan belonged to the clade of F. monophora. Molecular variations of these Japanese strains were evaluated by assessing both ITS and PKS1 sequences. The 37 isolates could be divided into at least seven molecular subtypes. The combination of these two molecular markers provides a most robust method for intraspecies subtyping and further epidemiological study of F. monophora. © 2016 Japanese Dermatological Association.

  19. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  20. Impact of the Xba1-polymorphism of the human muscle glycogen synthase gene on parameters of the insulin resistance syndrome in a Danish twin population

    DEFF Research Database (Denmark)

    Fenger, M; Poulsen, P; Beck-Nielsen, H

    2000-01-01

    : The Xba1-polymorphism of the human muscle glycogen synthase gene is correlated to insulin resistance and to diastolic blood pressure. The polymorphism does not involve any known transcription factor or any structural change in GYS1, and these correlations are therefore most probably caused by linkage......AIMS: To establish the impact on the insulin resistance syndrome of the intron 14 Xba1-polymorphism in human muscle glycogen synthase (GYS1). METHODS: Parameters related to the insulin resistance syndrome were measured in 244 monozygotic twins and 322 dizygotic twins with or without impaired...... and the remainder had the genotype A1A2. No A2A2-genotypes were detected. In 11 genotypic discordant dizygotic twin pairs the insulin resistance was significantly increased in the twins carrying the A1A2 genotype regardless of sex (HOMA index 1.81 (A1A1) vs. 2.57 (A1A2), P

  1. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review)

    OpenAIRE

    Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.

    2017-01-01

    Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...

  2. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    International Nuclear Information System (INIS)

    Soliman, S.E.T.; Zaater, M.K.

    2010-01-01

    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  3. Association of endothelial nitric oxide synthase gene polymorphism with the risk of Henoch-Schönlein purpura/Henoch-Schönlein purpura nephritis.

    Science.gov (United States)

    Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei

    2015-04-01

    Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.

  4. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases.

    Science.gov (United States)

    Diler, S B; Öden, A

    2016-02-01

    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  5. The joint effect of the endothelin receptor B gene (EDNRB polymorphism rs10507875 and nitric oxide synthase 3 gene (NOS3 polymorphism rs869109213 in Slovenian patients with type 2 diabetes mellitus and diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Dejan Bregar

    2018-02-01

    Full Text Available Increasing evidence suggests that endothelin and nitric oxide synthase genes and their products exert biological effects on the vasculature via the nitric oxide or endothelin pathway. The aim of the study was to evaluate the association of rs10507875 and rs869109213 (alone or in interaction with diabetic retinopathy (DR in subjects with type 2 diabetes mellitus (T2DM. We genotyped the single nucleotide polymorphism rs10507875 of the endothelin receptor B gene (EDNRB and variable number tandem repeats rs869109213 of the nitric oxide synthase 3 gene (NOS3 in 270 Slovenian patients with DR and T2DM and 256 controls with T2DM without clinical signs of DR. The genotyping was performed using either real-time polymerase chain reaction (PCR or standard PCR. We found a significant association between the genotypes of NOS3 rs869109213 polymorphism and the risk of DR in the co-dominant model (4a4b genotype; 1.99-fold increased risk [1.09-3.65]; 95% confidence interval [CI]; p = 0.02, co-dominant model (4a4a genotype; 4.16-fold increased risk [1.03-16.74]; 95% CI; p = 0.04, and dominant model (4a4a and 4a4b genotypes; 2.22-fold increased risk [1.26-3.92]; 95% CI; p = 0.01 compared to the 4b4b genotype. Moreover, the joint effect of the two polymorphisms on DR risk was greater than the individual effect of each polymorphism in the analyzed genetic models. Additionally, adjusted odds ratio showed an increased risk in dominant × dominant (4.15-fold [1.40-12.26]; 95% CI; p = 0.01 and recessive × dominant (2.24-fold [1.25-4.01]; 95% CI; p = 0.02 genotype combinations of the two polymorphisms. In conclusion, our results indicate that NOS3 rs869109213 polymorphism alone or in a combination with EDNRB rs10507875 polymorphism may be associated with DR in Slovenian patients with T2DM.

  6. Haplotype association and synergistic effect of human aldosterone synthase (CYP11B2) gene polymorphisms causing susceptibility to essential hypertension in Indian patients.

    Science.gov (United States)

    Vamsi, Uppuluri Mohana; Swapna, Nagalingam; Padma, Gunda; Vishnupriya, Satti; Padma, Tirunilai

    Aldosterone synthase (CYP11B2) is a key enzyme involved in the terminal steps of aldosterone biosynthesis. Genetic variability in CYP11B2 gene has been associated with heterogeneous aldosterone production, which can affect sodium homeostasis and thereby regulation of blood pressure. Hence, the present study was aimed to explore the single-locus variations, haplotype and epistasis patterns of CYP11B2 (C-344T, intron-2 gene conversion and Lys173Arg) gene polymorphisms, and the risk contributed by them to the development of essential hypertension (EHT). A total of 279 hypertensive patients and 200 normotensive controls were enrolled in this study. C-344T and Lys173Arg polymorphisms of CYP11B2 gene were genotyped by PCR-RFLP method and intron-2 gene conversion (IC) polymorphism by allele-specific PCR analysis. Single-locus analysis revealed significant association of CYP11B2 C-344T and Lys173Arg polymorphisms with EHT (p < 0.05). Considering the sexes, Lys173 allele was found to be at risk for hypertension in males (OR 1.40; 95% CI = 1.01-1.96). Unphased haplotype analysis revealed H1 (T-Conv-Lys; p = 0.0017) to have significant risk for EHT, while haplotype H4 (T-Wt-Arg) had a significant protective effect. Multifactor dimensionality reduction (MDR) interaction analysis found the overall best model with C-344T and IC polymorphisms exhibiting strong synergistic effect. The present study revealed a strong synergistic effect of CYP11B2 C-344T and IC polymorphisms causing susceptibility to EHT and haplotype H1 (-344T-Conv-Lys173) as the risk-conferring factor for hypertension predisposition.

  7. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

    2011-01-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  8. Relationship between endothelial nitric oxide synthase gene ...

    African Journals Online (AJOL)

    Introduction: Endothelial nitric oxide synthase (eNOS), the enzyme in charge of nitric oxide production, plays a crucial role in vascular biology. However, the impact of single nucleotide polymorphisms (SNPs) affecting the gene encoding for eNOS (eNOS) on coronary artery diseases remains under debate and no data were ...

  9. Association of Glu298Asp Polymorphism of Endothelial NO Synthase Gene with Metabolic Syndrome Development: a Pilot Study.

    Science.gov (United States)

    Fattakhov, N S; Skuratovskaya, D A; Vasilenko, M A; Kirienkova, E V; Zatolokin, P A; Mironyuk, N I; Litvinova, L S

    2017-03-01

    We studied association of single nucleotide polymorphism Glu298Asp (rs1799983) of the NOS3 gene with the risk of metabolic syndrome in the Slavic population. Blood samples were obtained from 128 patients with metabolic syndrome and 100 healthy individuals. Polymorphism Glu298Asp of the NOS3 gene was genotyped by allele-specific PCR. Allele Asp (OR=1.95, 95%CI 1.29-2.95, p=0.007) and genotype Asp/Asp (OR=2.56, 95%CI 0.98-6.72, p=0.04) were associated with the risk of metabolic syndrome in Slavic population. Patients with metabolic syndrome carrying genotype Asp/Asp had higher serum endothelin-1 level in comparison with Glu/Asp and Glu/Glu carriers.

  10. Analysis of T-786C and 4a/b endothelial nitric oxide synthase gene polymorphisms in retinopathy of prematurity

    Directory of Open Access Journals (Sweden)

    Pantelić Jelica R.

    2016-01-01

    Full Text Available Retinopathy of prematurity (ROP is a vascular proliferative disorder of retina, that causes visual impairment in premature children. Beside well known risk factors such as short gestational age, low birth weight and early oxygen exposure, genetic susceptibility is considered as a risk factor for development of the disease. The aim of our study was to explore the association of T-786C and 4a/b eNOS gene polymorphisms with the development of severe ROP. Study included 174 preterm infants, 84 with ROP and 90 as a control group. No differences have been observed in genotypes and alleles distributions of eNOS T-786C and eNOS 4a/b polymorphisms between two analyzed groups. There was significant difference in female infants by dominant model for 4a/b genotypes (4bb/4ba+4aa. Namely, female infants in ROP group were more frequently carriers of 4ba and 4aa genotypes than female infants in control group (p=0.037. Analysis of association between 4a/b eNOS polymorphism and ROP among preterm infants have not shown statistically significant association (p=0.288. Gestational age values by recessive model (4bb+4ba/4aa were significantly lower in infants with 4aa genotype (t=2.034 p=0.044. Almost all detected 4aa genotypes were present in the group of infants with gestational age under 30 weeks (p=0.032, but multivariate linear regression analysis does not show association of 4a/b genotypes with gestational age of premature infants. According to results of the present study T-786C and 4a/b polymorphisms of the eNOS gene may not be the risk factors for the manifestation of severe ROP in Serbian infants. [Projekat Ministarstva nauke Republike Srbije, br. 175091

  11. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review

    Directory of Open Access Journals (Sweden)

    S.N. Koval

    2017-08-01

    Full Text Available Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL, enzyme aldosterone synthase (AS, which takes a direct part in the formation of this hormone, as well as gene polymorphisms of AS, which have not only molecular genetic, but also differential diagnostic and therapeutic significance for secondary forms of arterial hypertension, abdominal obesity (AO, metabolic syndrome (MS, adrenal pathology and other endocrine disorders. AL is a steroid (mineralocorticoid hormone of the adrenal cortex, which is synthesized from cholesterol (CH, mainly in the glomerular zone of the adrenal glands, is released under the action of angiotensin II (A II and potassium ions (K+. AL acti­vity is mediated through the corresponding mineralocorticoid receptors (MKR. The particular importance in AH and MS development belongs to AL activation and MKR density in adipocytes, this phenomenon is accompanied by increased expression of pro-inflammatory cytokines, leptin, an adipogenic effect, and the inhibition of MCR activity is accompanied by increased production of adiponectin, which is more pronounced in patients with AH. Aldosterone synthase, a mitochondrial human enzyme encoded by the CYP11B2 gene (cytochrome P450, family 11, subfamily B, polypeptide 2 is located on the 8th chromosome. AS belongs to the superfamily of cytochrome P450 and regulates the synthesis of AL hormone. The CYP11B2 gene encodes the key enzyme for the synthesis of AL 18-hydroxylase. In scientific papers, single nucleotide polymorphism (SNP of AS gene is often studied, such as 5312T, Intron 2, Lys-173/Arg; T-344C, 3097 C/A. 227 SNP of the AS gene were identified in different

  12. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    Science.gov (United States)

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  13. Effect modification by delta-aminolevulinic acid dehydratase, vitamin D receptor, and nitric oxide synthase gene polymorphisms on associations between patella lead and renal function in lead workers.

    Science.gov (United States)

    Weaver, Virginia M; Lee, Byung-Kook; Todd, Andrew C; Ahn, Kyu-Dong; Shi, Weiping; Jaar, Bernard G; Kelsey, Karl T; Lustberg, Mark E; Silbergeld, Ellen K; Parsons, Patrick J; Wen, Jiayu; Schwartz, Brian S

    2006-09-01

    Genetic polymorphisms that affect lead toxicokinetics or toxicodynamics may be important modifiers of risk for adverse outcomes in lead-exposed populations. We recently reported associations between higher patella lead, which is hypothesized to represent a lead pool that is both bioavailable and cumulative, and adverse renal outcomes in current and former Korean lead workers. In the present study, we assessed effect modification by polymorphisms in the genes encoding for delta-aminolevulinic acid dehydratase (ALAD), the vitamin D receptor (VDR), and endothelial nitric oxide synthase on those associations. Similar analyses were conducted with three other lead biomarkers. Renal function was assessed via blood urea nitrogen, serum creatinine, measured and calculated creatinine clearances, urinary N-acetyl-beta-D-glucosaminidase, and retinol-binding protein. Mean (SD) blood, patella, tibia, and dimercaptosuccinic acid-chelatable lead values were 30.9 (16.7) microg/dl, 75.1 (101.1)and 33.6 (43.4) microg Pb/g bone mineral, and 0.63 (0.75) microg Pb/mg creatinine, respectively, in 647 lead workers. Little evidence of effect modification by genotype on associations between patella lead and renal outcomes was observed. The VDR polymorphism did modify associations between the other lead biomarkers and the serum creatinine and calculated creatinine clearance. Higher lead dose was associated with worse renal function in participants with the variant B allele. Models in two groups, dichotomized by median age, showed that this effect was present in the younger half of the population. Limited evidence of effect modification by ALAD genotype was observed; higher blood lead levels were associated with higher calculated creatinine clearance among participants with the ALAD(1-2) genotype. In conclusion, VDR and/or ALAD genotypes modified associations between all the lead biomarkers, except patella lead, and the renal outcomes.

  14. Single nucleotide polymorphisms in a cellulose synthase gene (PtoCesA3) are associated with growth and wood properties in Populus tomentosa.

    Science.gov (United States)

    Xu, Baohua; Tian, Jiaxing; Du, Qingzhang; Gong, Chenrui; Pan, Wei; Zhang, Deqiang

    2014-12-01

    In plants, the composition and organization of the cell wall determine cell shape, enable cell expansion, and affect the properties of woody tissues. Cellulose synthase (CesA) genes encode the enzymes involved in the synthesis of cellulose which is the major component of plant primary and secondary cell walls. Here, we isolated a full-length PtoCesA3 cDNA from the stem cambium tissue of Populus tomentosa. Tissue-specific expression profiling showed that PtoCesA3 is highly expressed during primary cell wall formation. Estimation of single nucleotide polymorphism (SNP) diversity and linkage disequilibrium (LD) revealed that PtoCesA3 harbors high SNP diversity (π(T) = 0.00995 and θ(w) = 0.0102) and low LD (r(2) ≥ 0.1, within 1,280 bp). Association analysis in a P. tomentosa association population (460 individuals) showed that seven SNPs (false discovery rate Q wood properties, explaining 4.09-7.02% of the phenotypic variance. All significant marker-trait associations were validated in at least one of the three smaller subsets (climatic regions) while five associations were repeated in the linkage population. Variation in RNA transcript abundance among genotypic classes of significant loci was also confirmed in the association or linkage populations. Identification of PtoCesA3 and examining its allelic polymorphisms using association studies open an avenue to understand the mechanism of cellulose synthesis in the primary cell wall and its effects on the properties of woody tissues.

  15. Analysis of prostaglandin-endoperoxide synthase-2 gene polymorphisms and risk of cervical cancer in an East Indian population: A case–control study

    Directory of Open Access Journals (Sweden)

    Dipanshu Sur

    2017-01-01

    Conclusions: PTGS-2 genotype rs689466:—1195A/G gene polymorphism demonstrated strongly associated with cervical cancer disease. However, exon1-+837T > C polymorphism was not associated with cancer risk in East Indian women. Further studies evaluating the role of PTGS-2 gene polymorphisms in ethnically diverse populations and a larger cohort may help in understanding the etiopathogenesis of cervical cancer in women worldwide.

  16. The Polymorphisms in Methylenetetrahydrofolate Reductase, Methionine Synthase, Methionine Synthase Reductase, and the Risk of Colorectal Cancer

    Science.gov (United States)

    Zhou, Daijun; Mei, Qiang; Luo, Han; Tang, Bo; Yu, Peiwu

    2012-01-01

    Polymorphisms in genes involved in folate metabolism may modulate the risk of colorectal cancer (CRC), but data from published studies are conflicting. The current meta-analysis was performed to address a more accurate estimation. A total of 41 (17,552 cases and 26,238 controls), 24(8,263 cases and 12,033 controls), 12(3,758 cases and 5,646 controls), and 13 (5,511 cases and 7,265 controls) studies were finally included for the association between methylenetetrahydrofolate reductase (MTHFR) C677T and A1289C, methione synthase reductase (MTRR) A66G, methionine synthase (MTR) A2756G polymorphisms and the risk of CRC, respectively. The data showed that the MTHFR 677T allele was significantly associated with reduced risk of CRC (OR = 0.93, 95%CI 0.90-0.96), while the MTRR 66G allele was significantly associated with increased risk of CRC (OR = 1.11, 95%CI 1.01-1.18). Sub-group analysis by ethnicity revealed that MTHFR C677T polymorphism was significantly associated with reduced risk of CRC in Asians (OR = 0.80, 95%CI 0.72-0.89) and Caucasians (OR = 0.84, 95%CI 0.76-0.93) in recessive genetic model, while the MTRR 66GG genotype was found to significantly increase the risk of CRC in Caucasians (GG vs. AA: OR = 1.18, 95%CI 1.03-1.36). No significant association was found between MTHFR A1298C and MTR A2756G polymorphisms and the risk of CRC. Cumulative meta-analysis showed no particular time trend existed in the summary estimate. Probability of publication bias was low across all comparisons illustrated by the funnel plots and Egger's test. Collectively, this meta-analysis suggested that MTHFR 677T allele might provide protection against CRC in worldwide populations, while MTRR 66G allele might increase the risk of CRC in Caucasians. Since potential confounders could not be ruled out completely, further studies were needed to confirm these results. PMID:22719222

  17. Polymorphism at the 3'-UTR of the thymidylate synthase gene: A potential predictor for outcomes in Caucasian patients with esophageal adenocarcinoma treated with preoperative chemoradiation

    International Nuclear Information System (INIS)

    Liao Zhongxing; Liu Hongji; Swisher, Stephen G.; Wang Luo; Wu, Tsung-Teh; Correa, Arlene M.; Roth, Jack A.; Cox, James D.; Komaki, Ritsuko; Ajani, Jaffer A.; Wei Qingyi

    2006-01-01

    Purpose: To test the hypothesis that TS3'UTR polymorphisms predict outcomes in 146 Caucasian patients with esophageal adenocarcinoma treated with preoperative 5-fluorouracil-based chemoradiation. Methods and Materials: DNA was extracted from hematoxylin-and-eosin stained histologic slides of normal esophageal or gastric mucosa sections from paraffin blocks of esophagectomy specimens. Genotypes of the TS3'UTR polymorphism were determined by polymerase chain reaction for a 6-bp insertion. The genotype groups (0bp/0bp, 6bp/0bp, and 6bp/6bp) were compared for clinical features and overall survival, recurrence-free-survival, locoregional control (LRC), and distant metastasis control. Multivariable Cox regression analyses were performed to find independent predictors for the stated outcomes. Results: There was a trend of association between 6bp/6bp genotype and a decreased risk of local regional recurrence (hazards ratio = 0.211, 95% confidence interval = 0.041-1.095, p = 0.06) compared with other genotypes. There was a trend that patients with 6bp/6bp genotype had a higher 3-year probability of LRC compared with patients with the other two genotypes combined (p = 0.07); however, the difference was not statistically significant. Conclusions: The null hypotheses were not rejected in this study, probably owing to small sample size or the single gene examined. Prospective studies with adequate statistical power analyzing a family of genes involved in the 5-fluorouracil metabolism are needed to assess genetic determinants of treatment-related outcomes in esophageal adenocarcinoma

  18. Endothelial nitric oxide synthase gene polymorphism (Glu298Asp and development of pre-eclampsia: a case-control study and a meta-analysis

    Directory of Open Access Journals (Sweden)

    Sahemey Manpreet K

    2006-03-01

    Full Text Available Abstract Background Pre-eclampsia is thought to have an important genetic component. Recently, pre-eclampsia has been associated in some studies with carriage of a common eNOS gene Glu298Asp polymorphism, a variant that leads to the replacement of glutamic acid by aspartic acid at codon 298. Method Healthy women with singleton pregnancies were recruited from 7 district general hospitals in London, UK. Women at high risk of pre-eclampsia were screened by uterine artery Doppler velocimetry at 22–24 weeks of gestation and maternal blood was obtained to genotype the eNOS Glu298Asp polymorphism. Odds ratios (OR and 95%CI, using logistic regression methods, were obtained to evaluate the association between the Glu298Asp polymorphism and pre-eclampsia. A meta-analysis was then undertaken of all published studies up to November 2005 examining the association of eNOS Glu298Asp genotype and pre-eclampsia. Results 89 women with pre-eclampsia and 349 controls were included in the new study. The Glu298Asp polymorphism in a recessive model was not significantly associated with pre-eclampsia (adjusted-OR: 0.83 [95%CI: 0.30–2.25]; p = 0.7. In the meta-analysis, under a recessive genetic model (1129 cases & 2384 controls women homozygous for the Asp298 allele were not at significantly increased risk of pre-eclampsia (OR: 1.28 [95%CI: 0.76–2.16]; p = 0.34. A dominant model (1334 cases & 2894 controls was associated with no increase of risk of pre-eclampsia for women carriers of the Asp298 allele (OR: 1.12 [95%CI: 0.84–1.49]; p = 0.42. Conclusion From the data currently available, the eNOS Glu298Asp polymorphism is not associated with a significant increased risk of pre-eclampsia. However, published studies have been underpowered, much larger studies are needed to confirm or refute a realistic genotypic risk of disease, but which might contribute to many cases of pre-eclampsia in the population.

  19. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  20. Expression of Deinococcus geothermalis trehalose synthase gene ...

    African Journals Online (AJOL)

    A novel trehalose synthase gene from Deinococcus geothermalis (DSMZ 11300) containing 1692 bp reading-frame encoding 564 amino acids was amplified using polymerase chain reaction (PCR). The gene was ligated into pET30Ek/LIC vector and expressed after isopropyl β-D-thiogalactopyranoside induction in ...

  1. Polymorphism in the Methylenetetrahydrofolate Reductase and Thymidylate Synthase Gene Predicts for Response to Fluorouracil-based Chemotherapy in Advanced Gastric Cancer Patients

    Directory of Open Access Journals (Sweden)

    Jianwei Lu

    2013-03-01

    Full Text Available Objective: Fluorouracil (5-FU is widely used in the treatment of gastric cancer. Methylenetetrahydrofolate reductase (MTHFR and thymidylate synthetase (TS are important targets of many antimetabolites, including 5-FU. The relationship between polymorphism in the MTHFR (C677T, A1298C and TS (5`-TUR, 3`-UTR genotypes and sensitivity of gastric cancer to 5-FU-based chemotherapy is investigated in the present study. Methods: 173 patients with advanced gastric cancer were analyzed. All patients were treated with 5-FU-based chemotherapy (FOLFOX, FP and DCF regimen. DNA from peripheral blood leukocytes was obtained before the treatment. All genotypes were detected by PCR-RFLP. 12 germline polymorphisms within 2 genes were analyzed. The genotypes of MTHFR C677T, A1298C and TS 3`-TUR were analyzed in 173 patients while TS 5`-TUR in 135 patients. Results: The overall response rate (RR was 35.8%. The RR of the DCF regimen group was significantly higher than that of the FP and FOLFOX regimen groups (55.8% vs. 27.1%, 31.1%; P=0.006. The RR of the MTHFR C677T T/T genotype was significantly higher than that of the C/ C and C/T genotypes (73.3% vs. 28.0%; P=0.000. In MTHFR A1298C, a higher RR was observed in A/A genotype compared with the C/C and A/C genotypes (41.8% vs. 21.6%, P=0.011. The RR of -6/-6 bp and -6/+6 bp genotypes in TS 3`UTR was significantly higher than that of +6/+6 bp genotype (40.3% vs. 17.6%, P=0.014. There was no difference in RR according to TS 5`UTR polymorphism (2R/2R and 2R/3R: 41.7% vs. 3R/3R: 36.8%, P=0.487. The RR of MTHFR C677T T/T genotypes in FOLFOX or FP regimens was significantly higher than that of C/C and C/T genotypes (P=0.008, P=0.000 while no difference in DCF regimen. The RR of DCF regimen wassignificantly higher than that of FOLFOX and FP regimens in C/T and C/C genotypes (P=0.000. The MTHFR C677T T/T genotypes had a significantly higher incidence of grade 3/4 emesis (66.7% and stomatitis (30.0% than patients with C/T or

  2. CLYBL is a polymorphic human enzyme with malate synthase and β-methylmalate synthase activity

    Science.gov (United States)

    Strittmatter, Laura; Li, Yang; Nakatsuka, Nathan J.; Calvo, Sarah E.; Grabarek, Zenon; Mootha, Vamsi K.

    2014-01-01

    CLYBL is a human mitochondrial enzyme of unknown function that is found in multiple eukaryotic taxa and conserved to bacteria. The protein is expressed in the mitochondria of all mammalian organs, with highest expression in brown fat and kidney. Approximately 5% of all humans harbor a premature stop polymorphism in CLYBL that has been associated with reduced levels of circulating vitamin B12. Using comparative genomics, we now show that CLYBL is strongly co-expressed with and co-evolved specifically with other components of the mitochondrial B12 pathway. We confirm that the premature stop polymorphism in CLYBL leads to a loss of protein expression. To elucidate the molecular function of CLYBL, we used comparative operon analysis, structural modeling and enzyme kinetics. We report that CLYBL encodes a malate/β-methylmalate synthase, converting glyoxylate and acetyl-CoA to malate, or glyoxylate and propionyl-CoA to β-methylmalate. Malate synthases are best known for their established role in the glyoxylate shunt of plants and lower organisms and are traditionally described as not occurring in humans. The broader role of a malate/β-methylmalate synthase in human physiology and its mechanistic link to vitamin B12 metabolism remain unknown. PMID:24334609

  3. Relevancia funcional de los polimorfismos del gen de la enzima óxido nítrico sintasa endotelial Functional relevance of polymorphisms of endothelial nitric oxide synthase gene

    Directory of Open Access Journals (Sweden)

    Norma Cecilia Serrano

    2010-04-01

    Full Text Available El óxido nítrico (NO juega un papel importante en la regulación de la homeostasis vascular. La producción endotelial de NO está regulada por la óxido nítrico sintasa endotelial (NOSe, por lo tanto variaciones genéticas en el gen NOS3 podrían influir en la producción de NO. Tres polimorfismos (Glu298Asp, intrón-4 y -786T>C en el gen NOS3, han sido asociados de forma inconsistente con enfermedades cardiovasculares (ECV. Estas variantes genéticas se han asociado con disminución de RNAm, concentración séricas bajas de nitritos/nitratos y disminución de la reactividad endotelial. A pesar de la amplia investigación de estos polimorfismos en ECV y de las aproximaciones para evaluar el papel funcional, no existe evidencia suficiente que permita esclarecer el papel causal y funcional de dichos polimorfismos sobre la enfermedad. Se requiere de nuevas estrategias que permitan seleccionar polimorfismos funcionales para determinar el riesgo atribuido al genotipo sobre la enfermedad. En la presente revisión se discute el posible efecto sobre la expresión de la actividad de la NOSe de esto tres polimorfismos genéticos descritos como de alta relevancia clínica en enfermedades cardiovasculares. Salud UIS 2010; 42: 66-77Nitric oxide (NO plays an important role on vascular homeostasis regulation. NO endothelial production is regulated by endothelial nitric-oxide synthase (eNOS, reason for which genetic variations in NOS3 gene could influence NO production. Three polymorphisms (Glu298Asp, intron-4, and -786T>C in NOS3 gene have been inconsistently associated with cardiovascular diseases (CVD. These genetic variables have been linked to diminishment mRNA, nitrites/nitrate low serum levels, and low endothelial reactivity. Despite wide research on these polymorphisms in CVD and several approaches to evaluate their functional role, not enough evidence is available to clarify their functional and causal participation over the disease. New strategies

  4. Methylenetetrahydrofolate reductase (MTHFR) gene polymorphism ...

    African Journals Online (AJOL)

    Administrator

    2011-10-19

    Oct 19, 2011 ... Polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene are associated with abortion, early embryo loss and recurrent spontaneous abortion in human. However, information on the association between MTHFR polymorphism and cow abortion is scarce. In the present study, the effects.

  5. Methylenetetrahydrofolate reductase (MTHFR) gene polymorphism ...

    African Journals Online (AJOL)

    Polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) gene are associated with abortion, early embryo loss and recurrent spontaneous abortion in human. However, information on the association between MTHFR polymorphism and cow abortion is scarce. In the present study, the effects of MTHFR ...

  6. Role of Polymorphisms of Inducible Nitric Oxide Synthase and Endothelial Nitric Oxide Synthase in Idiopathic Environmental Intolerances

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2015-01-01

    Full Text Available Oxidative stress and inflammation play a pathogenetic role in idiopathic environmental intolerances (IEI, namely, multiple chemical sensitivity (MCS, fibromyalgia (FM, and chronic fatigue syndrome (CFS. Given the reported association of nitric oxide synthase (NOS gene polymorphisms with inflammatory disorders, we aimed to investigate the distribution of NOS2A −2.5 kb (CCTTTn as well as Ser608Leu and NOS3 −786T>C variants and their correlation with nitrite/nitrate levels, in a study cohort including 170 MCS, 108 suspected MCS (SMCS, 89 FM/CFS, and 196 healthy subjects. Patients and controls had similar distributions of NOS2A Ser608Leu and NOS3 −786T>C polymorphisms. Interestingly, the NOS3 −786TT genotype was associated with increased nitrite/nitrate levels only in IEI patients. We also found that the NOS2A −2.5 kb (CCTTT11 allele represents a genetic determinant for FM/CFS, and the (CCTTT16 allele discriminates MCS from SMCS patients. Instead, the (CCTTT8 allele reduces by three-, six-, and tenfold, respectively, the risk for MCS, SMCS, and FM/CFS. Moreover, a short number of (CCTTT repeats is associated with higher concentrations of nitrites/nitrates. Here, we first demonstrate that NOS3 −786T>C variant affects nitrite/nitrate levels in IEI patients and that screening for NOS2A −2.5 kb (CCTTTn polymorphism may be useful for differential diagnosis of various IEI.

  7. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  8. THE POLYMORPHISM OF THE SUS4 SUCROSE SYNTHASE DOMAIN SEQUENCES IN RUSSIAN, BELORUSSIAN AND KAZAKH POTATO CULTIVARS

    Directory of Open Access Journals (Sweden)

    M. A. Slugina

    2016-01-01

    Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.

  9. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  10. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... cancer (Lee et al., 2009) and diabetes (Monti et al.,. 2003), possibly, are linked with periodontal disease. Available data, however, provide evidence that the deve- lopment of periodontal diseases is complex, is regulated by multiple genetic pathways and is modified by several exogenous factors. Berdeli et ...

  11. Divinyl ether synthase gene and protein, and uses thereof

    Science.gov (United States)

    Howe, Gregg A [East Lansing, MI; Itoh, Aya [Tsuruoka, JP

    2011-09-13

    The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.

  12. Methylenetetrahydrofolate reductase and methionine synthase polymorphisms and risk of bladder cancer in a Tunisian population.

    Science.gov (United States)

    Ouerhani, Slah; Oliveira, Elisabete; Marrakchi, Raja; Ben Slama, Mohamed R; Sfaxi, Mohamed; Ayed, Mohsen; Chebil, Mohamed; Amorim, António; El Gaaied, Amel Benammar; Prata, Maria João

    2007-07-01

    Folate insufficiency can induce carcinogenesis by decreasing DNA methylation. It is well known that DNA hypomethylation is a common feature in a number of cancers. Methylenetetrahydrofolate reductase (MTHFR) and methionine synthase (MS) are enzymes that play central roles in the folate metabolic pathway. Two common polymorphisms in the MTHFR gene (C677T and A1298C) and one in the MS gene (A2756G) are associated with decreased enzymatic activity. In this work, we have conducted a case-control study to assess the role of these three polymorphisms in bladder cancer development in North Tunisia. For MS A2756G, gene and genotypic distributions differed significantly between cases and controls. Furthermore, individuals carrying at least one copy of the variant allele presented a 2.33 times increased risk of developing bladder cancer than their control group [P = 0.001, odds ratio (OR) = 2.33; 95% confidence interval (CI) 1.34-4.06]. Statistically significant odds ratios were also found in patients heterozygous for MTHFR A1298C, who have a 1.8-fold higher risk of developing bladder cancer (P = 0.03, OR = 1.86; CI 95% 1.04-3.33). While the isolated polymorphism C677T did not appear to influence bladder cancer susceptibility, results suggest that it might act with an additive contribution determined by variation at MTHFR A1298C. Identical cumulative effect was detected for the MTHFR A1298C and MS 2756 genotypes. Patients harboring at least one mutant allele for each of the three positions analyzed showed a 4.76-fold increased risk of developing bladder cancer in comparison to their reference group (P = 0.02, OR = 4.76; CI 95% 1.26-17.98).

  13. Influence of thiopurine methyltransferase gene polymorphism on ...

    Indian Academy of Sciences (India)

    Azza A. G. Tantawy

    2017-11-28

    Nov 28, 2017 ... Thiopurine methyltransferase (TPMT) gene polymorphism regulates thiopurine therapeutic efficacy and toxicity. The ... assessment, haematological panel investigations and TPMT gene polymorphism for G238C, G460A and A719G alleles assessment .... TPMT polymorphism in Egyptian cancer patients.

  14. Polymorphism of xenobiotic metabolizm genes

    International Nuclear Information System (INIS)

    Freidin, M. B.; Ten, I. A.; Sevostiyanova, N. v.; Kokorina, Y. I.; Slominskaya, F. M.; Tereshchenko, I. V.; Kolomiets, S. A.; Takhanov, R. M.

    2004-01-01

    The genes of xenobiotic metabolism enzymes genes, also called biotransformation genes or environmental genes seems to be an important factor of individual susceptibility of common diseases of different genesis including cancer. At the present time, a systematic accumulation of information on the role of these genes polymorphism in predisposition to different disorders is carried out worldwide. To investigate a significance of biotransformation genes for cancer disorders in West Siberia region, we studies a polymorphism of genes CYP2C19 (Small-RFLP, 1 and 2 alleles in exone 5), GSTTI, GSTMI (null and normal alleles in both genes) in 47 lung cancer (LC) patients, 269 women with breast cancer (BC), and 130 controls from Tomsk, Russia. All participants were Russians. The frequency of GSTM1 null genotype in LC patients was significantly higher than that in controls (0.608?0.071 vs. 0.162?0-032; p<1x10-7 by Fisher exact test), whereas the frequency of null genotype in BC women was significantly lower in comparison with control women (0.545?0.039 vs. 0.747?0.053: p=0.005 by Fisher exact test). The latter circumstance seems to be unexpected because a priori one suggest that just null genotype of GSTM1 is of a pathological nature. Frequencies of null genotypes of GSTN1 in LC patients and GSTT1 in BC women corresponded to those in controls. In LC patients frequencies of CYP2C19 alleles did not differ significantly from values control sample, whereas in BC women the frequency of CYP2C19 2 allele was higher than that in control (0.340?0.20 vs. 0.182?0.034, p=4,9x10-4 by Fisher exact test). This allele encodes a truncated non-functional protein being a major cause of poor metabolism of some drugs. Thus, the data obtained allow us to conclude that polymorphisms of GSTTi, GSTM1, and CYP2C19 genes are associated with cancer disorders in Russians from West Siberia Even so, their pathogenetic meaning is specific with respect the type of malignant pathology. (Author)

  15. Endothelial nitric oxide synthase single nucleotide polymorphism and left ventricular function in early chronic kidney disease.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Chronic kidney disease (CKD is associated with accelerated cardiovascular disease and heart failure. Endothelial nitric oxide synthase (eNOS Glu298Asp single nucleotide polymorphism (SNP genotype has been associated with a worse phenotype amongst patients with established heart failure and in patients with progression of their renal disease. The association of a cardiac functional difference in non-dialysis CKD patients with no known previous heart failure, and eNOS gene variant is investigated.140 non-dialysis CKD patients, who had cardiac magnetic resonance (CMR imaging and tissue doppler echocardiography as part of two clinical trials, were genotyped for eNOS Glu298Asp SNP retrospectively.The median estimated glomerular filtration rate (eGFR was 50 mls/min and left ventricular ejection fraction (LVEF was 74% with no overt diastolic dysfunction in this cohort. There were significant differences in LVEF across eNOS genotypes with GG genotype being associated with a worse LVEF compared to other genotypes (LVEF: GG 71%, TG 76%, TT 73%, p = 0.006. After multivariate analysis, (adjusting for age, eGFR, baseline mean arterial pressure, contemporary CMR heart rate, total cholesterol, high sensitive C-reactive protein, body mass index and gender GG genotype was associated with a worse LVEF, and increased LV end-diastolic and systolic index (p = 0.004, 0.049 and 0.009 respectively.eNOS Glu298Asp rs1799983 polymorphism in CKD patients is associated with relevant sub-clinical cardiac remodelling as detected by CMR. This gene variant may therefore represent an important genetic biomarker, and possibly highlight pathways for intervention, in these patients who are at particular risk of worsening cardiac disease as their renal dysfunction progresses.

  16. Glutamate synthase: An archaeal horizontal gene transfer?

    Indian Academy of Sciences (India)

    (GOGAT) which is a key enzyme in ammonia assimilation in bacteria, algae and plants. It catalyzes the reductive transamidation of amido nitrogen from glutamine to 2-oxoglutarate to form two molecules of glutamate (Temple et al 1998). Glutamate synthases differ according to their molecular weights, subunit compositions, ...

  17. Impaired ATP synthase assembly associated with a mutation in the human ATP synthase subunit 6 gene.

    NARCIS (Netherlands)

    Nijtmans, L.G.J.; Henderson, N.S.; Attardi, G.; Holt, L.J.

    2001-01-01

    Mutations in human mitochondrial DNA are a well recognized cause of disease. A mutation at nucleotide position 8993 of human mitochondrial DNA, located within the gene for ATP synthase subunit 6, is associated with the neurological muscle weakness, ataxia, and retinitis pigmentosa (NARP) syndrome.

  18. Influence of thiopurine methyltransferase gene polymorphism on ...

    Indian Academy of Sciences (India)

    Thiopurine methyltransferase (TPMT) gene polymorphism regulates thiopurine therapeutic efficacy and toxicity. The aim of this study was to determine the influence of TPMT gene polymorphism in Egyptian children with acute lymphoblastic leukaemia (ALL). Sixty-four patients with ALL, T lineage (27%) and pre-B phenotype ...

  19. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  20. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  1. Cloning and expression analysis of chalcone synthase gene from ...

    Indian Academy of Sciences (India)

    Chalcone synthase (CHS) catalyses the first committed step of flavonoid biosynthetic pathway. Full-length cDNA, showing homology with plantCHS gene was isolated from leaves of C. forskohlii and named CfCHS (GenBank accession no. KF643243). Theoretical translation of CfCHS nucleotide sequence shows that it ...

  2. Cystathionine β-synthase T833C/844INS68 polymorphism: a family-based study on mentally retarded children

    Directory of Open Access Journals (Sweden)

    Mukhopadhyay Jotideb

    2005-12-01

    Full Text Available Abstract Background Cystathionine β-synthase (CBS mediates conversion of homocysteine to cystathionine and deficiency in enzyme activity may lead to hyperhomocysteinemia/homocystinuria, which are often associated with mental retardation (MR. A large number of polymorphisms have been reported in the CBS gene, some of which impair its activity and among these, a T833C polymorphism in cis with a 68 bp insertion at 844 in the exon 8 is found to be associated with mild hyperhomocysteinemia in different ethnic groups. Methods The present study is aimed at investigating the association between T833C/844ins68 polymorphism and MR. One hundred and ninety MR cases were recruited after psychometric evaluation. Hundred and thirty-eight control subjects, two hundred and sixty-seven parents of MR probands and thirty cardiovascular disorder (CVD patients were included for comparison. Peripheral blood was collected after obtaining informed written consent. The T833C/844ins68 polymorphism was investigated by PCR amplification of genomic DNA and restriction fragment length polymorphism analysis, followed by statistical analysis. Results The genotypic distribution of the polymorphism was within the Hardy-Weinberg equilibrium. A slightly increased genotypic frequency was observed in the Indian control population as compared to other Asian populations. Both haplotype-based haplotype relative risk analysis and transmission disequilibrium test reveled lack of association of the T833C/844ins68 polymorphism with MR; nevertheless, the relative risk calculated was higher (>1 and in a limited number of informative MR families, preferential transmission of the double mutant from heterozygous mothers to the MR probands was noticed (χ2 = 4.00, P Conclusion This is the first molecular genetic study of CBS gene dealing with T833C/844ins68 double mutation in MR subjects. Our preliminary data indicate lack of association between T833C/844ins68 polymorphism with MR. However

  3. gene polymorphism and its serum lev

    Indian Academy of Sciences (India)

    Navya

    Running title: Interleukin-10 gene polymorphism in metabolic syndrome. Keywords: ... polymorphisms, IL-10 -819 C >T and -592C >A were significantly associated with risk of metabolic syndrome. The mutant ..... Upon analysis for correlation of IL-10 serum level with clinico-biochemical characteristics of cases and controls,.

  4. Diversifying selection on flavanone 3-hydroxylase and isoflavone synthase genes in cultivated soybean and its wild progenitors.

    Directory of Open Access Journals (Sweden)

    Hao Cheng

    Full Text Available Soybean isoflavone synthase (IFS and flavanone 3-hydroxylase (F3H are two key enzymes catalyzing the biosynthesis of isoflavonoids and flavonoids, both of which play diverse roles in stress responses. However, little is known about the evolutionary pattern of these genes in cultivated soybean and its wild progenitors. Herein, we investigated the nucleotide polymorphisms in Isoflavone synthase (IFS1, IFS2 and Flavanone 3-hydroxylase (F3H2 genes from 33 soybean accessions, including 17 cultivars (Glycine max and 16 their wild progenitors (Glycine soja. Our data showed that the target genes shared the levels of nucleotide polymorphism with three reference genes involved in plant-microbe interactions, but possessed a much higher nucleotide polymorphism than other reference genes. Moreover, no significant genetic differentiation was found between cultivated soybean and its wild relatives in three target genes, despite of considering bottleneck and founder effect during domestication. These results indicate that IFS and F3H genes could have experienced gene introgressions or diversifying selection events during domestication process. Especially, F3H2 gene appears to evolve under positive selection and enjoy a faster evolutionary rate than IFS1 and IFS2 genes.

  5. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  6. Individualized supplementation of folic acid according to polymorphisms of methylenetetrahydrofolate reductase (MTHFR), methionine synthase reductase (MTRR) reduced pregnant complications.

    Science.gov (United States)

    Li, Xiujuan; Jiang, Jing; Xu, Min; Xu, Mei; Yang, Yan; Lu, Wei; Yu, Xuemei; Ma, Jianlin; Pan, Jiakui

    2015-01-01

    This study aimed to detect the genotype distributions and allele frequencies of methylenetetrahydrofolate reductase (MTHFR) C677T, A1298C and methionine synthase reductase (MTRR) A66G polymorphisms of pregnant women in Jiaodong region in China, and to investigate whether folic acid supplementation affect the pregnancy complications. A total of 7,812 pregnant women from the Jiaodong region in Shandong province in China. By using Taqman-MGB, 2,928 pregnant women (case group) were tested for the genotype distributions and allele frequencies of MTHFR C677T, A1298C and MTRR A66G polymorphisms. Folic acid metabolism ability was ranked at four levels and then pregnant women in different rank group were supplemented with different doses of folic acid. Their pregnancy complications were followed up and compared with 4,884 pregnant women without folic acid supplementation (control group) in the same hospital. The allele frequencies of MTHFR C677T were 49.1 and 50.9%; those of MTHFR A1298C were 80.2 and 19.8%, and those of MTRR A66G were 74.1 and 25.9%. After supplemented with folic acid, the complication rates in different age groups were significantly reduced, especially for gestational diabetes mellitus and hypertension. Periconceptional folic acid supplementation and healthcare following gene polymorphism testing may be a powerful measure to decrease congenital malformations. © 2015 S. Karger AG, Basel.

  7. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-04-06

    Apr 6, 2009 ... necessary to map the ginkgolide pathway at the level of molecular biology. Ginkgolides belong to plant diterpenoids just like the famous anti-tumor ..... A new isopentenyl diphosphate isomerase gene from sweet cloning, characterization and color complementation. Biologia. 63(2): 221-. 226. Liao ZH, Chen ...

  8. Polymorphisms of Saccharomyces cerevisiae genes involved in wine production.

    Science.gov (United States)

    Vigentini, Ileana; Fracassetti, Daniela; Picozzi, Claudia; Foschino, Roberto

    2009-03-01

    The setting up of new molecular methods for Saccharomyces cerevisiae typing is valuable in enology. Actually, the ability to discriminate different strains in wine making can have a benefit both for the control of the fermentation process and for the preservation of wine typicity. This study focused on the screening of single-nucleotide polymorphisms in genes involved in wine production that could evolve rapidly considering the selective pressure of the isolation environment. Preliminary screening of 30 genes in silico was performed, followed by the selection of 10 loci belonging to 8 genes. The sequence analysis showed a low polymorphism and a degree of heterozygosity. However, a new potential molecular target was recognized in the TPS1 gene coding for the trehalose-6-phosphate synthase enzyme involved in the ethanol resistance mechanism. This gene showed a 1.42% sequence diversity with seven different nucleotide substitutions. Moreover, classic techniques were applied to a collection of 50 S. cerevisiae isolates, mostly with enologic origin. Our results confirmed that the wine making was not carried out only by the inoculated commercial starter because indigenous strains of S. cerevisiae present during fermentation were detected. In addition, a high genetic relationship among some commercial cultures was found, highlighting imprecision or fraudulent practices by starter manufacturers.

  9. Cryptic polyketide synthase genes in non-pathogenic Clostridium SPP.

    Directory of Open Access Journals (Sweden)

    Swantje Behnken

    Full Text Available Modular type I polyketide synthases (PKS produce a vast array of bacterial metabolites with highly diverse biological functions. Notably, all known polyketides were isolated from aerobic bacteria, and yet no example has been reported for strict anaerobes. In this study we explored the diversity and distribution of PKS genes in the genus Clostridium. In addition to comparative genomic analyses combined with predictions of modular type I polyketide synthase (PKS gene clusters in sequenced genomes of Clostridium spp., a representative selection of other species inhabiting a variety of ecological niches was investigated by PCR screening for PKS genes. Our data reveal that all studied pathogenic Clostridium spp. are devoid of putative PKS genes. In stark contrast, cryptic PKS genes are widespread in genomes of non-pathogenic Clostridium species. According to phylogenetic analyses, the Clostridium PKS genes have unusual and diverse origins. However, reverse transcription quantitative PCR demonstrates that these genes are silent under standard cultivation conditions, explaining why the related metabolites have been overlooked until now. This study presents clostridia as a putative source for novel bioactive polyketides.

  10. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  11. The multifunctional 6-methylsalicylic acid synthase gene of Penicillium patulum. Its gene structure relative to that of other polyketide synthases.

    Science.gov (United States)

    Beck, J; Ripka, S; Siegner, A; Schiltz, E; Schweizer, E

    1990-09-11

    6-Methylsalicylic acid synthase (MSAS) from Penicillium patulum is a homomultimer of a single, multifunctional protein subunit. The enzyme is induced, at the transcriptional level, during the end of the logarithmic growth phase. After approximately 150-fold purification, a homogeneous enzyme preparation was obtained exhibiting, upon SDS gel electrophoresis, a subunit molecular mass of 188 kDa. By immunological screening of a genomic P. patulum DNA expression library, the MSAS gene together with its flanking sequences was isolated; 7131 base pairs of the cloned genomic DNA were sequenced. Within this sequence the MSAS gene was identified as a 5322-bp-long open reading frame coding for a protein of 1774 amino acids and 190,731 Da molecular mass. Transcriptional initiation and termination sites were determined both by primer extension studies and from cDNA sequences specially prepared for the 5' and 3' portions of the gene. The same cDNA sequences revealed the presence of a 69-bp intron within the N-terminal part of the MSAS gene. The intron contains the canonical GT and AG dinucleotides at its 5'- and 3'-splice junctions. An internal TACTGAC sequence, resembling the TACTAAC consensus element of Saccharomyces cerevisiae introns is suggested to represent the branch point of the lariat splicing intermediate. When compared to other known polyketide synthases, distinct amino acid sequence similarities of limited lengths were observed with some, though not all, of them. A comparatively low degree of similarity was detected to the yeast and Penicillium FAS or to the plant chalcone and resveratrol synthases. In contrast, a significantly higher sequence similarity was found between MSAS and the rat fatty acid synthase, especially at their transacylase, 2-oxoacyl reductase, 2-oxoacyl synthase and acyl carrier protein domains. Besides several dissimilar, interspersed regions probably coding for MSAS- and FAS-specific functions, the sequential order of the similar domains was

  12. Endothelial nitric oxide synthase polymorphisms and adaptation of parasympathetic modulation to exercise training.

    Science.gov (United States)

    Silva, Bruno M; Neves, Fabricia J; Negrão, Marcelo V; Alves, Cleber R; Dias, Rodrigo G; Alves, Guilherme B; Pereira, Alexandre C; Rondon, Maria U; Krieger, José E; Negrão, Carlos E; DA Nóbrega, Antonio Claudio Lucas

    2011-09-01

    There is a large interindividual variation in the parasympathetic adaptation induced by aerobic exercise training, which may be partially attributed to genetic polymorphisms. Therefore, we investigated the association among three polymorphisms in the endothelial nitric oxide gene (-786T>C, 4b4a, and 894G>T), analyzed individually and as haplotypes, and the parasympathetic adaptation induced by exercise training. Eighty healthy males, age 20-35 yr, were genotyped by polymerase chain reaction-restriction fragment length polymorphism analysis, and haplotypes were inferred using the software PHASE 2.1. Autonomic modulation (i.e., HR variability and spontaneous baroreflex sensitivity) and peak oxygen consumption (VO(2peak)) were measured before and after training (running, moderate to severe intensity, three times per week, 60 min·day(-1), during 18 wk). Training increased VO(2peak) (P baroreflex sensitivity after training (change: wild type (-786TT) = 2% ± 89% vs polymorphic (-786TC/CC) = -28% ± 60%, median ± quartile range, P = 0.03), and parasympathetic modulation was marginally reduced in subjects with the 894T polymorphic allele (change: wild type (894GG) = 8% ± 67% vs polymorphic (894GT/TT) = -18% ± 59%, median ± quartile range, P = 0.06). Furthermore, parasympathetic modulation percent change was different between the haplotypes containing wild-type alleles (-786T/4b/894G) and polymorphic alleles at positions -786 and 894 (-786C/4b/894T) (-6% ± 56% vs -41% ± 50%, median ± quartile range, P = 0.04). The polymorphic allele at position -786 and the haplotype containing polymorphic alleles at positions -786 and 894 in the endothelial nitric oxide gene were associated with decreased parasympathetic modulation after exercise training.

  13. The endothelial nitric oxide synthase (eNOS) polymorphism in otitis media with effusion (OME).

    Science.gov (United States)

    Ates, M; Cevik, C; Dokuyucu, R; Berber, O; Colak, S; Izmirli, M

    2017-02-01

    Otitis media with effusion (OME) is the most common disease after viral infections of upper respiratory tract (URTI) in children. Studies indicate the important role of nitric oxide (NO) in the etiology of hearing loss. However, there is no study that focuses on the role of nitric oxide synthase (eNOS) polymorphisms in the cases with OME. The aim of the present study is to evaluate the eNOS polymorphisms in the pediatric patients with OME. Eighty-nine patients who are diagnosed with otitis media with effusion and 85 healthy subjects who are compatible in terms of age and gender were included in the study. All patients in the study were subjected to complete ear, nose, throat (ENT) and audiological examinations. DNA analysis was performed with polymerase chain reaction (PCR) technique from the blood samples. The PCR product was cut by restriction fragment length polymorphism (RFLP) with BanII enzyme and checked by agarose gel electrophoresis. As a result of genetic analysis, there is no significant difference between patients and the controls in terms of eNOS Glu298Asp polymorphism (G/G, G/T, T/T). When these groups were compared in terms of allele distributions, a significant relationship was found between the patients and the controls (P=0.037). To the best of our knowledge, G allele was identified as predisposing to the development of OME and this is the first report indicates the correlation between the eNOS G894T polymorphism and OME in Turkey. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  14. Study of obesity associated proopiomelanocortin gene polymorphism

    African Journals Online (AJOL)

    ... fasting glucose, fasting insulin, homeostasis model assessment for insulin resistance (HOMA-IR) and fasting lipid profiles, and higher frequency of occurrence of non alcoholic fatty liver disease and BED. Allelic frequencies of POMC gene 9 bp insertional polymorphism were comparable in patients and controls (p= 0.956).

  15. genes polymorphism on tacrolimus concentrations and dosage

    African Journals Online (AJOL)

    Marwa Helal

    2016-11-30

    Nov 30, 2016 ... transplant donors and recipients on blood level and dose requirements of oral tacrolimus, to help in designing an .... groups [11]. The aim of this pilot study is to assess the influence of ABCB1. (3435 C>T) and CYP3A5 (6986 A>G) genes polymorphisms of both donors and ..... liver graft rejection [24].

  16. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard

    2005-01-01

    . However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...... the SNPs of dhfr, dhps, and Pfcrt with high specificity. The SSOP-ELISA compared well with a standard PCR-restriction fragment length polymorphism procedure, and gave identical positive results in more than 90% of the P. falciparum slide-positive samples tested. The SSOP-ELISA of all dhfr, dhps, or Pfcrt...

  17. Promotor polymorphisms in leukotriene C4 synthase and risk of ischemic cerebrovascular disease

    DEFF Research Database (Denmark)

    Freiberg, J.J.; Tybjaerg-Hansen, A.; Sillesen, H.

    2008-01-01

    OBJECTIVE: Cysteinyl leukotrienes are involved in inflammation and possibly in early carotid atherosclerosis. We tested the hypothesis that the -444 A/C and -1072 G/A polymorphisms of the leukotriene C(4) synthase associate with risk of ischemic cerebrovascular disease. METHODS AND RESULTS: We...... genotyped 10 592 individuals from the Danish general population, the Copenhagen City Heart Study. During 24 years of follow-up, 557 individuals developed ischemic cerebrovascular disease. The allele frequency was 0.07 for -1072 A and 0.29 for -444 C. Cumulative incidence for ischemic cerebrovascular disease...... was higher for -1072 AA versus GG genotype (log-rank: P=0.002), and lower for -444 CC versus AA genotype (log-rank: P=0.008). Combined genotypes showed corresponding cumulative incidence differences (log-rank: P=0.003). Multifactorially adjusted hazard ratios for ischemic cerebrovascular disease were 2...

  18. Allele specific CAPS marker development and characterization of chalcone synthase gene in Indian mulberry (Morus spp., family Moraceae).

    Science.gov (United States)

    Arora, Vivek; Ghosh, M K; Pal, Soumili; Gangopadhyay, Gaurab

    2017-01-01

    Chalcone synthase (CHS) is an essential enzyme in the phenylpropanoid pathway that catalyzes the first step in flavonoid biosynthesis in plants under diverse environmental stress. We have used CHS as a candidate gene in mulberry and developed Single Nucleotide Polymorphism (SNP) based co-dominant Cleaved Amplified Polymorphic Sequence (CAPS) marker associated with the CHS locus. The segregation pattern of the marker was studied in an F1 population derived from a hybridization program between two mulberry genotypes showing polymorphism for the CHS locus. Differential CHS activity of the recombinants has been correlated with the segregation pattern of the marker. Homology modelling and docking studies are performed for both the identified CHS alleles and correlated with respective CHS activity. Phenotyping of Powdery Mildew infected F1 population indicated a probable association with the CAPS marker.

  19. Allele specific CAPS marker development and characterization of chalcone synthase gene in Indian mulberry (Morus spp., family Moraceae.

    Directory of Open Access Journals (Sweden)

    Vivek Arora

    Full Text Available Chalcone synthase (CHS is an essential enzyme in the phenylpropanoid pathway that catalyzes the first step in flavonoid biosynthesis in plants under diverse environmental stress. We have used CHS as a candidate gene in mulberry and developed Single Nucleotide Polymorphism (SNP based co-dominant Cleaved Amplified Polymorphic Sequence (CAPS marker associated with the CHS locus. The segregation pattern of the marker was studied in an F1 population derived from a hybridization program between two mulberry genotypes showing polymorphism for the CHS locus. Differential CHS activity of the recombinants has been correlated with the segregation pattern of the marker. Homology modelling and docking studies are performed for both the identified CHS alleles and correlated with respective CHS activity. Phenotyping of Powdery Mildew infected F1 population indicated a probable association with the CAPS marker.

  20. Identification and characterization of genetic variation in the folylpolyglutamate synthase gene.

    Science.gov (United States)

    Leil, Tarek A; Endo, Chiaki; Adjei, Araba A; Dy, Grace K; Salavaggione, Oreste E; Reid, Joel R; Ames, Matthew M; Adjei, Alex A

    2007-09-15

    Folylpolyglutamate synthase (FPGS) catalyzes the polyglutamation of folic acid, methotrexate, and pemetrexed to produce highly active metabolites. To characterize genetic variation in the FPGS gene, FPGS, have resequenced the gene in four different ethnic populations. Thirty-four single nucleotide polymorphisms were identified including five nonsynonymous coding single nucleotide polymorphisms that altered the FPGS protein sequence: F13L and V22I polymorphisms in the mitochondrial isoform of FPGS, and R466/424C, A489/447V, and S499/457F polymorphisms, which exist in both the mitochondrial and cytosolic isoforms. When expressed in AuxB1 cells, the A447V cytosolic variant was functionally similar to the wild-type cytosolic (WT Cyt) allozyme, whereas the R424C and S457F cytosolic variants were reduced by approximately 2-fold in protein expression compared with WT Cyt (P glutamate was reduced by 12.3-fold (R424C, P < 0.01) and 6.2-fold (S457F, P < 0.01), whereas the intrinsic clearance of methotrexate was reduced by 4.2-fold (R424C, P < 0.05) and 5.4-fold (S457F, P < 0.05) in these two cytosolic variants when compared with the WT Cyt isoform. Additionally, the in vitro enzyme velocity at saturating pemetrexed concentrations was reduced by 1.6-fold (R424C, P < 0.05) and 2.6-fold (S457F, P < 0.01) compared with WT Cyt. AuxB1 cells harboring these same cytosolic variant allozymes displayed significant increases in the EC(50) for folic acid and in the IC(50) values for both methotrexate and pemetrexed relative to the WT Cyt form of FPGS. These observations suggest that genetic variations in FPGS may alter the efficacy of antifolate therapy in cancer patients.

  1. Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

    Science.gov (United States)

    Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

    2015-02-01

    To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

  2. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  3. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  4. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter r...... in the GLUT4 cDNA was a silent polymorphism at codon 130. Southern blotting of both gene loci did not detect any major abnormalities.(ABSTRACT TRUNCATED AT 250 WORDS)...

  5. Thymidylate synthase genetic polymorphism and plasma total homocysteine level in a group of Turkish patients with rheumatoid arthritis: relationship with disease activity and methotrexate toxicity.

    Science.gov (United States)

    Borman, Pınar; Taşbaş, Özgur; Karabulut, Halil; Tukun, Ajlan; Yorgancıoğlu, Rezan

    2015-01-01

    The polymorphism of thymidylate synthase (TS) gene and homocysteine are reported to have a relationship to methotrexate (MTX) metabolism, with conflicting results. The aim of this study was to determine homocysteine levels and the frequency of TS gene triple repeat (TS3R) and double repeat (TS2R) polymorphisms in a group of Turkish RA patients and evaluate its association with MTX toxicity and disease activity. Sixty-four patients with RA and 31 control subjects with a mean age of 48.7 ± 12.5 and 46.2 ± 13.4 years, were enrolled to the study. Demographic characteristics were obtained and number of patients with MTX-related adverse affects, were recorded in the patient group. The homocysteine levels and TS2R/TS3R polymorphisms of the TS gene were analyzed and the distribution of genotypes according to MTX toxicity and disease activity, were determined. The demographic properties were similar between the patient and control subjects. Folic acid supplementation with a mean dose of 5mg folic acid/week, was present in all patients. Thirty-six of the 64 patients showed adverse effects to MTX treatment. The frequency of TS2R and TS3R polymorphisms were found to be similar in the patient and control groups. TS2R and TS3R gene polymorphisms were found to be similar in patients with and without MTX-related adverse events. The mean homocysteine level was also similar in patients with and without TS gene polymorphism, but was found to be higher (12.45μmol/L vs 10.7μmol/L) in patients with MTX-related side effects than in patients without side effects. The mean level of homocysteine was correlated with levels of ESR in the patient group. In conclusion, homocysteine levels might effect the disease activity and toxicity of MTX but 2R and 3R polymorphisms in the TS gene, were not related with MTX-related toxicity in RA patients receiving folate supplementation. Further studies are needed to illuminate the polymorphisms in other enzymes that might be responsible from the MTX

  6. Association of polymorphisms in folate metabolic genes and ...

    Indian Academy of Sciences (India)

    1996 Human methionine synthase: cDNA cloning and identification of mutations in patients of the cblG com- plementation group of folate/cobalamin disorders. Hum. Mol. Genet. 5, 1867–1874. Marchal C., Redondo M., Reyes-Engel A., Perea-Milla E., Gaitan. M., Machuca J. et al. 2008 Association between polymorphisms.

  7. Association of polymorphisms in one-carbon metabolizing genes with breast cancer risk in Syrian women.

    Science.gov (United States)

    Lajin, Bassam; Alhaj Sakur, Amir; Ghabreau, Lina; Alachkar, Amal

    2012-08-01

    Dietary folate status as well as polymorphisms in one-carbon metabolism genes may affect the risk of breast cancer through aberrant DNA methylation and altered nucleotide synthesis and DNA repair. A large number of studies investigated the role of methylenetetrahydrofolate reductase (MTHFR) and methionine synthase reductase (MTRR) polymorphisms in breast cancer with inconsistent results. Association between multiple polymorphisms in one-carbon metabolism genes and breast cancer was not studied before in an Arab population. The purpose of the present study is to test the hypothesis that polymorphisms in one-carbon metabolism genes are associated with breast cancer susceptibility in Syrian breast cancer women patients. A total of 245 subjects (119 breast cancer women patients and 126 healthy controls) were genotyped for MTHFR C677T and A1298C and MTRR A66G polymorphisms. Association was tested for under numerous genetic models. A statistically significant association was found for MTHFR A1298C polymorphism especially under the allele contrast model (odds ratio (OR) = 1.68, 95% confidence interval (CI) (1.16-2.45), P = 0.006). On the other hand, no significant association was found for MTHFR C677T or MTRR A66G under any of the genetic models tested. The effects of the compound genotypes were also examined. The 66GG genotype was found to be protective against breast cancer when combined with the 677CT or 1298AC genotype (OR = 0.18, 95% CI (0.04-0.82), P = 0.014; OR = 0.3, 95% CI (0.08-1.11), P = 0.058). In conclusion, our study supports the hypothesis that polymorphisms in one-carbon gene metabolisms modulate the risk for breast cancer, particularly the A1298C polymorphism of the MTHFR gene.

  8. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  9. Prevalence of thrombophilic gene polymorphisms (FVL G1691A and ...

    African Journals Online (AJOL)

    Background: Inherited thrombophilia may be caused by mutations, polymorphisms in a variety of genes mainly involved in haemostatic pathways. Aim of the study, was to find the prevalence of thrombophilic gene factor V Leiden (FVL) and methylene tetrahydrofolate reductase (MTHFR) gene polymorphism in patients with ...

  10. Do prion protein gene polymorphisms induce apoptosis in non ...

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... Genetic variations such as single nucleotide polymorphisms (SNPs) in prion protein coding gene, Prnp, greatly affect susceptibility to prion diseases in mammals. Here, the coding region of Prnp was screened for polymorphisms in redeared turtle, Trachemys scripta. Four polymorphisms, L203V, N205I, ...

  11. Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...

    African Journals Online (AJOL)

    Preeclampsia (PE) is the most serious complication of pregnancy that causes maternal and fetal morbidity and mortality. Although the exact pathophysiology of PE is unknown, a large number of studies have shown that abnormalities in nitric oxide (NO) synthesis may contribute to the development of this disorder. There are ...

  12. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    Department of Clinical Pathology, Faculty of Medicine, Cairo University, 1Prenatal diagnosis, 2Molecular genetics, National Research Institute,. Cairo, Egypt. ABSTRACT. Background: Previous studies indicated ... such as luteal insufficiency and infectious diseases have lost much of their previous importance, but some new.

  13. Plasticity and evolution of (+)-3-carene synthase and (-)-sabinene synthase functions of a sitka spruce monoterpene synthase gene family associated with weevil resistance.

    Science.gov (United States)

    Roach, Christopher R; Hall, Dawn E; Zerbe, Philipp; Bohlmann, Jörg

    2014-08-22

    The monoterpene (+)-3-carene is associated with resistance of Sitka spruce against white pine weevil, a major North American forest insect pest of pine and spruce. High and low levels of (+)-3-carene in, respectively, resistant and susceptible Sitka spruce genotypes are due to variation of (+)-3-carene synthase gene copy number, transcript and protein expression levels, enzyme product profiles, and enzyme catalytic efficiency. A family of multiproduct (+)-3-carene synthase-like genes of Sitka spruce include the three (+)-3-carene synthases, PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and the (-)-sabinene synthase PsTPS-sab. Of these, PsTPS-3car2 is responsible for the relatively higher levels of (+)-3-carene in weevil-resistant trees. Here, we identified features of the PsTPS-3car1, PsTPS-3car2, PsTPS-3car3, and PsTPS-sab proteins that determine different product profiles. A series of domain swap and site-directed mutations, supported by structural comparisons, identified the amino acid in position 596 as critical for product profiles dominated by (+)-3-carene in PsTPS-3car1, PsTPS-3car2, and PsTPS-3car3, or (-)-sabinene in PsTPS-sab. A leucine in this position promotes formation of (+)-3-carene, whereas phenylalanine promotes (-)-sabinene. Homology modeling predicts that position 596 directs product profiles through differential stabilization of the reaction intermediate. Kinetic analysis revealed position 596 also plays a role in catalytic efficiency. Mutations of position 596 with different side chain properties resulted in a series of enzymes with different product profiles, further highlighting the inherent plasticity and potential for evolution of alternative product profiles of these monoterpene synthases of conifer defense against insects. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan

    2001-01-01

    of a functional cdd gene encoding cytidine deaminase. A characterization of the enzyme revealed similar properties as found for CTP synthases from other organisms. However, unlike the majority of CTP synthases the lactococcal enzyme can convert dUTP to dCTP, although a half saturation concentration of 0.6 m...

  15. Drug-Gene Interactions between Genetic Polymorphisms and Antihypertensive Therapy

    NARCIS (Netherlands)

    Schelleman, Hedi; Stricker, Bruno H Ch; De Boer, Anthonius; Kroon, Abraham A; Verschuren, Monique W M; Van Duijn, Cornelia M; Psaty, Bruce M; Klungel, Olaf H

    2004-01-01

    Genetic factors may influence the response to antihypertensive medication. A number of studies have investigated genetic polymorphisms as determinants of cardiovascular response to antihypertensive drug therapy. In most candidate gene studies, no such drug-gene interactions were found. However,

  16. Association of genetic polymorphism in GH gene with milk ...

    Indian Academy of Sciences (India)

    Association of genetic polymorphism in GH gene with milk production traits in Beijing Holstein cows ... Keywords. Beijing Holstein cows; growth hormone gene; genetic polymorphism; milk production traits ... I, II, and III). The A/A cows produced milk of higher protein content than of A/B individuals ( < 0.05 only in lactation II).

  17. Apolipoprotein E gene polymorphism in Egyptian acute coronary ...

    African Journals Online (AJOL)

    Background: Apolipoprotein E (apo E) gene polymorphism was found to be associated with coronary artery disease in several studies. In this investigation, we aimed to study the association between apo E gene polymorphism and acute coronary syndrome in Egyptian population. Subjects and methods: The study included ...

  18. Prion protein gene polymorphisms in Turkish native goat breeds

    Indian Academy of Sciences (India)

    HASAN MEYDAN

    Susceptibility to 'scrapie' disease in goats is influenced by polymorphisms of the prion protein (PRNP) gene. The aim of ... [Meydan H., Pehlivan E., Özkan M. M., Yildiz M. A. and Goldmann W. 2017 Prion protein gene polymorphisms in Turkish native goat breeds. ... Anatolia and contribute to the livelihood of resource-poor.

  19. Contribution of genes polymorphism to susceptibility and outcome of ...

    African Journals Online (AJOL)

    Harapan Tumangger

    HMGB1, TLR, PAI-1, DEFB1, HSP and MMP-9 has contribution to susceptibility and outcome of sepsis in some research. .... inflammatory cytokine gene polymorphism to susceptibility and outcome of patients with systemic inflammation and sepsis. 2. Genes polymorphism and sepsis. 2.1. Tumor necrosis factor (TNF) a.

  20. Association of transforming growth factor-ß3 gene polymorphism ...

    African Journals Online (AJOL)

    Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

  1. DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...

    African Journals Online (AJOL)

    The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...

  2. Prion protein gene polymorphisms in Turkish native goat breeds

    Indian Academy of Sciences (India)

    HASAN MEYDAN

    Susceptibility to 'scrapie' disease in goats is influenced by polymorphisms of the prion protein (PRNP) gene. The aim of ... [Meydan H., Pehlivan E., Özkan M. M., Yildiz M. A. and Goldmann W. 2017 Prion protein gene polymorphisms in Turkish native goat breeds. .... C. PCR products were resolved by electrophoresis on 2%.

  3. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Leyva et al. 1995), UV treatments and blue light (Hartmann et al. 1998; Wade et al. 2001; Zhou et al. 2007), elicitor treatments such as salicylic acid and. Keywords. chalcone synthase; real-time PCR; silymarin; anthocyanin; Silybum marianum.

  4. The thymidylate synthase enhancer region (TSER) polymorphism increases the risk of thymic lymphoid hyperplasia in patients with Myasthenia Gravis.

    Science.gov (United States)

    Lopomo, Angela; Ricciardi, Roberta; De Rosa, Anna; Guida, Melania; Maestri, Michelangelo; Lucchi, Marco; Melfi, Franca; Mussi, Alfredo; Migliore, Lucia; Coppedè, Fabio

    2018-02-05

    Myasthenia Gravis (MG) is caused, in approximately 80% of the patients, by autoantibodies against the nicotinic acetylcholine receptor (AChR). The disease is often associated with pathological changes of the thymus: thymic epithelial tumours are present in about 10-20% of the patients, while up to 80% of the patients with early disease onset have thymic hyperplasia. Folate metabolism is required for the production of DNA precursors and for proper DNA methylation reactions, and impaired folate metabolism has been often associated with cellular growth and cancer. We investigated if major polymorphisms of folate-related genes, namely MTHFR c.677C>T, MTR c.2756A>G, MTRR c.66A>G and TYMS TSER (a 28-bp tandem repeat in the 5' promoter enhancer region of TYMS) increase the risk of pathological changes of the thymus in AChR+ MG patients. A total of 526 AChR+ MG patients, including 132 patients with normal (involuted) thymus, 146 patients with thymic hyperplasia, and 248 patients with a thymoma were included in the study. Allele and genotype comparisons were performed among the three study groups, after correcting for multiple testing. The frequency of the TYMS TSER 3R allele was significantly higher in MG patients with thymic hyperplasia (P=0.004), and the TYMS TSER 3R3R genotype was significantly associated with increased risk of thymic hyperplasia [OR 2.71 (95% CI: 1.34-5.47)]. The 3R allele in the thymidylate synthase promoter enhancer region results in increased protein production, required for the synthesis of DNA precursors. The present study suggests that the TYMS TSER 3R allele increases the risk of thymic lymphoid hyperplasia in AChR+ MG patients. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Candidate gene polymorphisms among North Indians and their ...

    Indian Academy of Sciences (India)

    Of the eight genes tested in this study, association with schizophrenia was observed for only two gene polymorphisms, one in the promoter region of the serotonin 2A receptor gene and the other in the tryptophan hydroxylase gene. One new allele for the dopamine transporter gene (with eight repeats, 570-bp size), not ...

  6. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    regions and regions of importance for translation, as well as coding sequences of the two genes, were studied using single-strand conformation polymorphism (SSCP) analysis and DNA sequencing. The genetic analyses were performed in subgroups of 52 Caucasian NIDDM patients and 25 age-matched healthy......To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  7. APOE gene polymorphism analysis in Barranquilla, Colombia.

    Science.gov (United States)

    Ruiz, Martha; Arias, Isis; Rolón, Gloria; Hernández, Enio; Garavito, Pilar; Silvera-Redondo, Carlos

    2016-03-03

    The genetic variability present in the APOE gene polymorphism is considered an important factor associated with predisposition to diseases affecting lipid metabolism, as well as heart diseases and Alzheimer's disease, among others. Understanding it as a risk factor in different populations and ethnic groups is a useful tool.  To analyze the APOE gene polymorphism and determine allelic and genotypic frequencies of a representative sample of population from Barranquilla, Colombia.  We performed a descriptive and comparative study. The sample size was 227 unrelated individuals from Barranquilla, Colombia.  The most frequent allele was the ε3, with 85%, followed by the ε4 allele (13%) and ε2 (1.8%). The genotypes found were: ε3/ε3: 71.8%, ε3/ε4: 24.2%, ε2/ε3: 2.2%, ε2/ε4: 1.3% and ε4/ε4: 0.4%. The ε2/ε2 genotype was not found in this study. The sample exhibited the Hardy-Weinberg equilibrium.  The frequency of the ε3 allele and the ε3/ε3 genotype was similar to that reported in the literature in countries like Brazil, Mexico, Colombia, and in some Colombian Amerindian ethnic groups. The ε2/ε2 genotype was absent. This result is consistent with those found in other population groups worldwide. The frequency of the ε4 allele and the genotypes associated in this population could be related to the presence of diseases such as hypercholesterolemia, myocardial infarction and Alzheimer.

  8. Tumor Necrosis Factor (TNF -308G>A, Nitric Oxide Synthase 3 (NOS3 +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Conflicting data have been reported on the association between tumor necrosis factor (TNF -308G>A and nitric oxide synthase 3 (NOS3 +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF -308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine.We performed an updated meta-analysis for TNF -308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR and 95% confidence intervals (95% CI assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates.Eleven studies in 6682 migraineurs and 22591 controls for TNF -308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the "A" allele of the TNF -308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 - 2.87. The risk of migraine with aura (MA was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the "T" allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 - 3.88.Our findings appear to support the hypothesis that the TNF -308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians.

  9. Prevalence of endothelial nitric oxide synthase (eNOS) gene exon 7 Glu298Asp variant in North Eastern India

    Science.gov (United States)

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

    2011-01-01

    Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032

  10. Characterization of a 1-aminocyclopropane-1-carboxylate synthase gene from loblolly pine (Pinus taeda L.).

    Science.gov (United States)

    Barnes, J R; Lorenz, W W; Dean, J F D

    2008-04-30

    1-Aminocyclopropane-1-carboxylate (ACC) synthase catalyzes what is typically the rate-limiting step in the biosynthesis of ethylene, a gaseous plant growth regulator that plays numerous roles in the growth and development of higher plants. Although ACC synthase genes have been characterized from a wide variety of angiosperm plant species, no ACC synthase genes have been described previously for gymnosperms. Evidence suggests that ethylene helps to regulate wood formation in trees, and may also signal for the metabolic shifts that lead to compression wood formation on the undersides of branches and leaning stems in gymnosperm trees. Since compression wood is an inferior feedstock for the manufacturing of most wood products, a better understanding of the factors influencing its formation could lead to substantial economic benefits. This study describes the isolation and characterization of a putative ACC synthase gene, PtaACS1, from loblolly pine (Pinus taeda L.), an important commercial forest tree species. Also described is an apparent splice variant of PtaACS1 (PtaACS1s) that is missing 138 bp from the 5' end of the transcript, including bases that encode a conserved amino acid residue considered critical for ACC synthase activity. The two sequences share interesting homologies with a group of plant aminotransferases, in addition to ACC synthases, but structural models and the conservation of critical catalytic amino acid residues strongly support PtaACS1 as encoding an active ACC synthase. The two transcripts were differentially expressed in various tissues of loblolly pine, as well as in response to perturbations of pine seedling stems. Transcript levels of this ACC synthase gene increased rapidly in response to bending stress but returned to near starting levels within 30 min. It remains unclear to what extent bending-induced expression of this gene product plays a role in compression wood formation.

  11. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  12. A genetic polymorphism in the sex-linked ATP5A1 gene is associated with individual fitness in Ovenbirds (Seiurus aurocapilla)

    Science.gov (United States)

    Judith D. Toms; Lori S. Eggert; Wayne J. Arendt; John. Faaborg

    2012-01-01

    While testing genetic sexing techniques in Ovenbirds (Seiurus aurocapilla),we found a genetic polymorphism in the ATP5A1 gene in 38% of individuals. The Z ' allele included changes in both intronic and exonic portions of the sequenced region, but there was no evidence that this changed the resulting ATP synthase product. Males that had one or more copies of...

  13. Prothrombotic Gene Polymorphisms in Young Patients with Cerebrovascular Accident

    Directory of Open Access Journals (Sweden)

    Kuyaþ Hekimler Öztürk

    2013-07-01

    Full Text Available Aim: Cerebrovascular diseases are complex multifactorial disorders showing an increased incidence with increasing age and affected by genetic and environmental factors. Although risk factors for cerebrovascular diseases include age, sex, lineage, hypertension, diabetes mellitus, hypercholesterolemia; in young cerebrovascular patients below age 45, genetic factors may also contribute to the etiology. In this retrospective study, prothrombotic gene polymorphisms which are thought to be related with formation of disease in young adults with cerebrovascular accident (CVA were investigated. Material and Method: In the current study, Methylenetetrahydropholate Reductase (MTHFR C677T and A129C; Prothrombin (Factor II G20210A; Factor V Leiden G1691A prothrombotic gene polymorphisms were evaluated for 43 young patients under the age of 45 with cerebrovascular accident history. Result: For 43 young patients with cerebrovascular incident history, the frequency of following polymorphisms were determined as follows; MTHFR C677T polymorphism heterozygous frequency is 46.1%, homozygous frequency is 9.3%; MTHFR A1298C polymorphism heterozygous frequency is 39.47%, homozygous frequency is 26.31%; Prothrombin polymorphism heterozygous and homozygous frequency is 2.3%; FactorV Leiden polymorphism heterozygous frequency is 9.3%. Discussion: After evaluation the experimental results, we believe that MTHFR gene C677T and A1298C polymorphisms might be risk factors in CVAs. It was observed that cigarette usage, hypertension and existence of family story in addition to these polymorphisms increase the available risk.

  14. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    coumaroyl-CoA with three acetyl-CoA units, followed by folding, and initial cyclization; all catalyzed by a single enzyme, chalcone synthase (CHS). Further ring closure catalyzed by chalcone isomerase (CHI) yields naringenin. Coupling follows a ...

  15. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Abstract. Trehalose plays an important role in metabolic regulation and abiotic stress tolerance in plants. Trehalose contents are poten- tially modulated by trehalose-6-phosphate synthase (TPS), which is a key enzyme in the trehalose biosynthetic pathway. Using available wheat expressed sequence tag ...

  16. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  17. [Polymorphism of eNOS and iNOS Genes and Chronic Heart Failure in Patients With Ischemic Heart Disease].

    Science.gov (United States)

    Tepliakov, A T; Shilov, S N; Berezikova, E N; Iakovleva, N F; Maianskaia, S D; Popova, A A; Luksha, E B; Voronina, E N; Torim, Iu Iu; Karpov, R S

    2010-01-01

    URGENCY: Despite substantial progress in the treatment of coronary heart disease (CHD) and chronic heart failure (CHF) prognosis in these conditions remains extremely serious. This warrants their timely prevention and early detection. Aim. To study influence of inducible NO synthase (iNOS) (CCTTT)n, Glu298Asp and diallel polymorphism in the fourth intron (4a/4b polymorphism) of endothelial NO synthase gene (eNOS gene) on the state of endothelial function and risk of development of CHF in patients with CHD. 165 patients with CHD were studied (121 male and 44 female, mean age 56.7 + or - 5.3 years). Vasomotor endothelial function was evaluated using ultrasound method in the reactive hyperemia and trinitroglycerol tests. Genotypes were identified using RFLP analysis of PCR products. Control group consisted of 114 persons (54 male and 60 female, mean age 53.2 + or - 4.9 years). It was determined that the number of repeats of polymorphic locus (CCTTT)n of the iNOS gene and Glu allele of the polymorphic locus Glu298Asp of eNOS gene in the homozygous state were associated with the risk of development of CHD and class of severity of CHF clinical manifestation. In addition Glu allele of the polymorphic locus Glu298Asp of eNOS gene in the homozygous state was associated with the severity and unfavorable development of CHF. The endothelial-dependent dysfunction was more severe in homozygotes of Glu allele of the polymorphic locus Glu298Asp of eNOS gene than in carrier of allele 298Asp. Associations between polymorphic variant of VNTR intron 4 gene eNOS and CHF with the risk of development and endothelial dysfunction were not found. An association between polymorphism of iNOS gene (CCTTT)n, eNOS gene (Glu298Asp) with development of CHD and severity of CHF was shown. The polymorphism of eNOS gene (Glu298Asp) was associated with endothelial dysfunction.

  18. Analysis of bovine growth hormone gene polymorphism of local and ...

    African Journals Online (AJOL)

    Analysis of bovine growth hormone gene polymorphism of local and Holstein cattle breeds in Kerman province of Iran using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) ... African Journal of Biotechnology ... RFLPs in this segment were studied using AluI restriction enzyme.

  19. Association between Tryptophan Hydroxylase 2 Gene Polymorphism and Completed Suicide

    Science.gov (United States)

    Fudalej, Sylwia; Ilgen, Mark; Fudalej, Marcin; Kostrzewa, Grazyna; Barry, Kristen; Wojnar, Marcin; Krajewski, Pawel; Blow, Frederic; Ploski, Rafal

    2010-01-01

    The association between suicide and a single nucleotide polymorphism (rs1386483) was examined in the recently identified tryptophan hydroxylase 2 (TPH2) gene. Blood samples of 143 suicide victims and 162 age- and sex-matched controls were examined. The frequency of the TT genotype in the TPH2 polymorphism was higher in suicide victims than in…

  20. Association of genetic polymorphism in GH gene with milk ...

    Indian Academy of Sciences (India)

    Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various ...

  1. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  2. Polymorphism of growth hormone gene and its association with ...

    African Journals Online (AJOL)

    sunny t

    2016-04-06

    Apr 6, 2016 ... recorded to be more frequent (83.3, 92.86 and 90%) than pattern II (16.7, 7.14 and 10%) in Barki,. Rahmani ... Key words: Sheep, wool, growth hormone (GH) gene, polymorphism, single strand conformation polymorphism. (SSCP). ... electrophoresis and chemical and ribonuclease cleavage,. SSCP has ...

  3. Allelic polymorphism of Makoei sheep leptin gene identified by ...

    African Journals Online (AJOL)

    use

    2011-12-05

    Dec 5, 2011 ... intake, energy expenditure and whole-body energy balance in animals. In the present study, the polymorphism of the leptin gene (LEP) of Makoei sheep was investigated by polymerase chain reaction and single strand conformation polymorphism technique (PCR–SSCP). Genomic DNA was extracted.

  4. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana

    Energy Technology Data Exchange (ETDEWEB)

    Hemleben, V.; Frey, M.; Rall, S.; Koch, M.; Kittel, M.; Kreuzaler, F.; Ragg, H.; Fautz, E.; Hahlbrock, K.

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  5. Studies on the chalcone synthase gene of two higher plants: petroselinum hortense and matthiola incana.

    Science.gov (United States)

    Hemleben, V; Frey, M; Rall, S; Koch, M; Kittel, M; Kreuzaler, F; Ragg, H; Fautz, E; Hahlbrock, K

    1982-01-01

    Two higher plant systems are presented which allow to study coordinated gene expression of the light-induced metabolic pathway of flavonoid biosynthesis: tissue culture cells of Petroselinum hortense (Apiaceae) and different developmental stages of various genotypes of Matthiola incana (Brassicaceae). The gene structure of the chalcone synthase is mainly studied. A cDNA clone (pLF56) of parsley has been constructed and characterized conferring the chalcone synthase gene sequence. Strong cross hybridization between the parsley cDNA and Matthiola DNA allowed to identify a HindIII fragment (6000 bp) identical in size for parsley and different Matthiola wild type lines and a mutant line.

  6. Impact of the PPAR gamma-2 gene polymorphisms on the metabolic ...

    Indian Academy of Sciences (India)

    2016-08-04

    figure 1b). The lean women characterized by C1431C polymorphism had lower blood glucose concentrations (β=−0.2103,. Table 1. Polymorphisms of the PPARG gene investigated in the study. Polymorphism. SNP ID. Gene.

  7. Role of glutathione S-transferase P-1 (GSTP-1 gene polymorphism in COPD patients

    Directory of Open Access Journals (Sweden)

    Tarek F. El-Gazzar

    2016-10-01

    Conclusion: There is a significant association between GSTP1 gene polymorphism and the development of COPD, and smoking have a role in GSTP1 gene polymorphism. The polymorphism has no relation to disease severity.

  8. Polymorphisms in genes RFC-1/CBS as maternal risk factors for Down syndrome in China.

    Science.gov (United States)

    Wang, Shao-shuai; Wang, Chao; Qiao, Fu-yuan; Lv, Juan-juan; Feng, Ling

    2013-08-01

    To explore the relationship between genetic polymorphisms in reduced folate carrier 1 (RFC-1), cystathionine b-synthase (CBS), two key genes in folate metabolism, and the risk of Down syndrome in China. Genomic DNA was isolated from the peripheral lymphocytes of 104 mothers born children with Down syndrome and 184 age-matched control mothers. Polymerase chain reaction and restriction-fragment length polymorphism were used to examine the polymorphisms of RFC-1 A80G, CBS T833C and the relationship between these genotypes and the risk of Down syndrome was analyzed. We found that there were significant differences between RFC-1 G80G, CBS C833C polymorphisms among mothers of children with Down syndrome than among control mothers, with odds ratio of 1.51 (95 % CI 1.05-2.18), 1.53 (95 % CI 1.07-2.18) respectively. The combined presence of RFC1 mutant alleles and the CBS homozygous mutant allele (15/104) was associated with a 4.81-fold increased risk of having a child with Down syndrome (95 % CI 1.82-12.68, P = 0.0007). We concluded that RFC-1 and CBS gene mutation alleles are related to Down syndrome, and women with mutation RFC-1 G80G, CBS C833C OR combined with RFC-1 A80G and CBS 833TT genotype increase the risk of Down syndrome in China.

  9. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutat...

  10. Chemical analysis of a genome wide polyketide synthase gene deletion library in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Larsen, Thomas Ostenfeld; Klejnstrup, Marie Louise; Nielsen, Jakob Blæsbjerg

    to encode polyketide synthases have been individually been deleted. This presentation will highlight our recent linking of secondary metabolites in A. nidulans to genes, and in particular describe some recent work on characterization of ANID_6448 and associated genes responsible for biosynthesis of 3-methyl...

  11. The Serotonin Transporter Gene Polymorphisms and Risk of Ischemic Stroke

    DEFF Research Database (Denmark)

    Mortensen, Janne Kærgård; Kraglund, Kristian Lundsgaard; Johnsen, Søren Paaske

    2018-01-01

    INTRODUCTION: Serotonin is known as a neurotransmitter; however, it also plays an important role in platelet aggregation as it is released upon platelet activation. The serotonin transporter (SERT) is responsible for the uptake of serotonin into platelets. Functional polymorphisms in the SERT gene...... may influence platelet activity, as they result in different levels of transporters and thereby different levels of serotonin in platelets. SERT gene polymorphisms have thus been associated with the risk of myocardial infarction. A similar association may exist between SERT gene polymorphisms...... and stroke. However, to our knowledge, this potential association has not previously been studied. We therefore aimed to investigate the association between polymorphisms in the SERT gene and the risk of ischemic stroke/transitory ischemic attack (TIA). MATERIALS AND METHODS: We conducted a case...

  12. Cytokine gene polymorphisms and their association with cervical ...

    African Journals Online (AJOL)

    Cytokine gene polymorphisms and their association with cervical cancer: A North Indian study. ... Egyptian Journal of Medical Human Genetics ... factors and adhesion molecules promotes tumor progression and involves inflammation, angiogenesis and thrombosis, thus providing optimal conditions for cancer development.

  13. Association of PPARγ gene polymorphisms with osteoarthritis in a ...

    Indian Academy of Sciences (India)

    control study in a southeast Chinese population to determine the association of PPAR gene polymorphisms (rs1801282, rs12629751, rs2292101, rs4135275 and rs1175543) with OA. One-hundred knee OA cases and 100 controls were studied.

  14. Association of ADAM33 gene polymorphisms with adult-onset ...

    Indian Academy of Sciences (India)

    onset asthma and its severity in an Indian adult population. Priya Tripathi, Shally Awasthi, Rajendra Prasad, Nuzhat Husain and Subramaniam Ganesh. J. Genet. 90, 265–273. Figure 1. Gel pictures of five genotyped ADAM33 gene polymorphisms ...

  15. Endothelial Nitric Oxide Synthase Gene Variation Associated With Chronic Kidney Disease After Liver Transplant

    Science.gov (United States)

    Bambha, Kiran; Kim, W. Ray; Rosen, Charles B.; Pedersen, Rachel A.; Rys, Cynthia; Kolbert, Christopher P.; Cunningham, Julie M.; Therneau, Terry M.

    2010-01-01

    OBJECTIVE: To identify single nucleotide polymorphisms (SNPs) associated with risk of developing chronic kidney disease (CKD), a prevalent comorbidity, after liver transplant (LT). PATIENTS AND METHODS: This study consists of a cohort of adult (≥18 years) primary-LT recipients who had normal renal function before LT and who survived 1 year or more after LT at a high-volume US LT program between January 1, 1990, and December 31, 2000. Patients with adequate renal function (estimated glomerular filtration rate, ≥40 mL/min per 1.73 m2 during follow-up; n=308) and patients with incident CKD (estimated glomerular filtration rate, <40 mL/min per 1.73 m2 after LT; n=92) were identified. To investigate the association of 6 candidate genes with post-LT CKD, we selected SNPs that have been associated with renal function in the literature. Hazard ratios were estimated using Cox regression, adjusted for potential confounding variables. RESULTS: The variant allele (298Asp) of the Glu298Asp SNP in the endothelial nitric oxide synthase gene (NOS3) was significantly associated with CKD after LT (P=.05; adjusted for multiple comparisons). The 5-year incidence of CKD was 70% among patients homozygous for the NOS3 variant allele (298Asp) compared with 42% among those not homozygous for the NOS3 variant allele. Specifically, homozygosity for the NOS3 variant allele conferred a 2.5-fold increased risk of developing CKD after LT (P=.005, adjusted for confounding variables). CONCLUSION: Homozygosity for the variant allele of NOS3 (298Asp) is associated with CKD after LT and may be useful for identifying recipients at higher risk of post-LT CKD. PMID:20810793

  16. Study of BMP-15 gene polymorphism in Iranian goats | Deldar ...

    African Journals Online (AJOL)

    Different mutations in the bone morphogenetic protein-15 (BMP-15) and the Growth Differentiation Factor-9 (GDF-9) genes have increased ovulation rate and infertility in a dosage-sensitive manner in sheep. To test the polymorphisms of genes in goat, which have been demonstrated as major genes of fecundity in sheep, ...

  17. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    African Journals Online (AJOL)

    Calpastatin has been known as candidate gene in muscle growth efficiency and meat quality. This gene has been located to chromosome 5 of sheep. In order to evaluate the calpastatin gene polymorphism, random blood sample were collected from 111 Arabic ram sheep from different regions. The DNA extraction was ...

  18. Prevalence of thrombophilic gene polymorphisms (FVL G1691A and ...

    African Journals Online (AJOL)

    Hamdia Ezzat

    2014-02-22

    Feb 22, 2014 ... Abstract Background: Inherited thrombophilia may be caused by mutations, polymorphisms in a variety of genes mainly involved in haemostatic pathways. Aim of the study, was to find the prevalence of thrombophilic gene factor V Leiden (FVL) and methylene tetrahydrofolate reductase (MTHFR) gene ...

  19. Polymorphism of the porcine CGA gene and its association with ...

    African Journals Online (AJOL)

    huis

    specific haplotypes were found and a map of the porcine CGA polymorphisms' evolution history was inferred. ... The common α subunit of these hormones, encoded by the unique, single-copy gene, CGA ... the glycoprotein hormones, especially TSH, their common CGA gene shows to be a promising candidate gene for ...

  20. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  1. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Science.gov (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  2. Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily.

    Science.gov (United States)

    Martin, Diane M; Fäldt, Jenny; Bohlmann, Jörg

    2004-08-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (-)-limonene synthase, (-)-alpha/beta-pinene synthase, and (-)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-alpha-farnesene synthase, and E-alpha-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed.

  3. Identification and functional analysis of the geranylgeranyl pyrophosphate synthase gene (crtE) and phytoene synthase gene (crtB) for carotenoid biosynthesis in Euglena gracilis.

    Science.gov (United States)

    Kato, Shota; Takaichi, Shinichi; Ishikawa, Takahiro; Asahina, Masashi; Takahashi, Senji; Shinomura, Tomoko

    2016-01-05

    Euglena gracilis, a unicellular phytoflagellate within Euglenida, has attracted much attention as a potential feedstock for renewable energy production. In outdoor open-pond cultivation for biofuel production, excess direct sunlight can inhibit photosynthesis in this alga and decrease its productivity. Carotenoids play important roles in light harvesting during photosynthesis and offer photoprotection for certain non-photosynthetic and photosynthetic organisms including cyanobacteria, algae, and higher plants. Although, Euglenida contains β-carotene and xanthophylls (such as zeaxanthin, diatoxanthin, diadinoxanthin and 9'-cis neoxanthin), the pathway of carotenoid biosynthesis has not been elucidated. To clarify the carotenoid biosynthetic pathway in E. gracilis, we searched for the putative E. gracilis geranylgeranyl pyrophosphate (GGPP) synthase gene (crtE) and phytoene synthase gene (crtB) by tblastn searches from RNA-seq data and obtained their cDNAs. Complementation experiments in Escherichia coli with carotenoid biosynthetic genes of Pantoea ananatis showed that E. gracilis crtE (EgcrtE) and EgcrtB cDNAs encode GGPP synthase and phytoene synthase, respectively. Phylogenetic analyses indicated that the predicted proteins of EgcrtE and EgcrtB belong to a clade distinct from a group of GGPP synthase and phytoene synthase proteins, respectively, of algae and higher plants. In addition, we investigated the effects of light stress on the expression of crtE and crtB in E. gracilis. Continuous illumination at 460 or 920 μmol m(-2) s(-1) at 25 °C decreased the E. gracilis cell concentration by 28-40 % and 13-91 %, respectively, relative to the control light intensity (55 μmol m(-2) s(-1)). When grown under continuous light at 920 μmol m(-2) s(-1), the algal cells turned reddish-orange and showed a 1.3-fold increase in the crtB expression. In contrast, EgcrtE expression was not significantly affected by the light-stress treatments examined. We identified genes

  4. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

    Science.gov (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

    2001-09-01

    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  5. Novel description of aldosterone synthase CYP11B2 -344 T>C gene ...

    African Journals Online (AJOL)

    This is a report on population genetics of -344 T>C polymorphism in Amerindians for the first time. The aim was to establish the frequency of this polymorphism present in the 5' promoter region of the CYP11B2 gene in Amerindian (Mayans, Mixtecos, and Teenek) and Mestizo populations from Mexico. It has been associated ...

  6. Association of a Soybean Raffinose Synthase Gene with Low Raffinose and Stachyose Seed Phenotype

    Directory of Open Access Journals (Sweden)

    Emily C. Dierking

    2008-11-01

    Full Text Available Oligosaccharides are an important component of soybean [ (L. Merr.] meal in terms of metabolizable energy for monogastric animals. Sucrose, raffinose, and stachyose are the three main oligosaccharides present in soybean meal. Of the three, only sucrose is nutritionally useful. When raffinose and stachyose are fermented by microbes present in the gut, the results are flatulence and discomfort, which ultimately lead to poor weight gain. The long term objective of this research is ultimately to increase the nutritional value of soybean meal by elevating the metabolizable energy at the expense of raffinose and stachyose through the manipulation of soybean raffinose synthase, the key enzyme for raffinose and stachyose biosynthesis. The objectives of this work were to develop molecular genetic information about soybean raffinose synthases and to evaluate the candidate raffinose synthase genes in a soybean germplasm accession (PI 200508 that contains low levels of raffinose and stachyose. Our results indicate the soybean genome contains at least two expressed genes similar to other characterized raffinose synthases. A novel allele of one of these putative soybean raffinose synthase genes was discovered from the PI 200508 that completely associates with the low raffinose and stachyose phenotype. Molecular marker assays specific for the PI 200508 allele were developed to allow direct selection for the low raffinose and low stachyose phenotype.

  7. ASSOCIATION BETWEEN CYTOKINE GENE POLYMORPHISMS AND RECURRENT MISCARRIAGE

    Directory of Open Access Journals (Sweden)

    L A. Gordeeva

    2017-01-01

    Full Text Available Associations between IL1B (rs1143634, IL1RN (VNTR, intron 2, IL4 (VNTR, intron 3, TNFA (rs1800629, rs361525, IL6 (rs1800795, and IL10 (rs1800896 genetic polymorphisms in women with recurrent miscarriage (RM were analyzed. We studied DNA samples of 112 women with RM and 267 women with physiological pregnancy. The IL1RN, IL4 genotypes were identified by PCR techniques, the IL1B, IL6 gene polymorphisms were defined by means of RFLP approach. To detect TNFA and IL10 gene polymorphisms, TaqMan real-time PCR was used. The results have shown that polymorphic loci of IL1B, IL1RN, IL10, TNFA genes were not associated with RM, and early spontaneous abortion risk. The 2R allele of IL4 gene was found to be associated with higher RM risk (OR = 1.52; 95% CI = [1.08-2.14]; P-value (cor = 0.05, and G allele of IL6 gene was associated with a risk for > 3 early spontaneous abortions (OR = 2.10; 95% CI = [1.24-3.56]; P-value (cor = 0.05, in an additive inheritance model. Upon evaluation of the data obtained, one may conclude that the IL4 (VNTR intron 3 and IL6 (rs1800795 gene polymorphisms could influence the RM development. These results may be useful for assessment of molecular mechanisms underlying early spontaneous abortion.

  8. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  9. Heterologous expression of dammarenediol synthase gene in an engineered Saccharomyces cerevisiae.

    Science.gov (United States)

    Liang, Y-L; Zhao, S-J; Xu, L-X; Zhang, X-Y

    2012-11-01

    Dammarenediol production by an engineered yeast Saccharomyces cerevisiae was investigated. A dammarenediol-producing engineered yeast was constructed by heterologous expression of the dammarenediol synthase gene from Panax ginseng hairy roots through RT-PCR. Fermentation was carried out in a 5-L GRJY-bioreactor with an inoculum size of 1% v/v at 30°C. Dammarenediol detection was performed with silica gel chromatography and HPLC. Determination of dammarenediol synthase activity subcellular distribution was carried out by surveying the enzyme activity in microsomes, lipid particles and total yeast homogenate. When cultured under aerobic conditions, the engineered yeast could produce dammarenediol up to 250μgl(-1). However, when an anaerobic shift strategy was employed, dammarenediol accumulated at a level as twice as that under aerobic condition. The dammarenediol synthase and dammarenediol were mainly localized in lipid particles. Dammarenediol could be heterologously produced in engineered yeast. The heterologously expressed dammarenediol synthase is mainly localized in lipid particles. Anaerobic shift strategy could enhance the dammarenediol level in the engineered yeast. This study showed that the high-value plant product dammarenediol could be produced by heterologous expression of the according gene in yeast. Furthermore, the anaerobic shift strategy could be potentially applied in oxidosqualene-derived compounds production in yeast. Here, the information about subcellular distribution of heterologously expressed dammarenediol synthase in the engineered yeast was also provided. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  10. Methylenetetrahydrofolate Reductase gene polymorphism in children with allergic rhinitis.

    Science.gov (United States)

    Dogru, M; Aydin, H; Aktas, A; Cırık, A A

    2015-01-01

    Methylenetetrahydrofolate Reductase (MTHFR) polymorphisms by impairing folate metabolism may influence the development of allergic diseases. The results of studies evaluating the relationship between MTHFR polymorphisms and atopic disease are controversial. The aim of this study was to investigate the association between the polymorphisms of C677T and A1298C for MTHFR gene and allergic rhinitis (AR) in children. Ninety patients followed up with diagnosis of allergic rhinitis in our clinic and 30 children with no allergic diseases were included in the study. All participants were genotyped for the MTHFR (C677T) and (A1298C) polymorphisms. Vitamin b12, folate and homocysteine levels were measured. The mean age of patients was 9.2±2.9 years; 66.7% of the patients were male. There was no significant difference between patient and control groups regarding gender, age and atopy history of the family (p>0.05). The frequency of homozygotes for MTHFR C677T polymorphism in the patient and control groups was 3.3% and 10%, respectively. The frequency of homozygotes for MTHFR A1298C polymorphism among groups was 26.7% and 16.7%, respectively. The association between allergic rhinitis and polymorphisms of C677T and A1298C for MTHFR gene was not statistically significant in patients compared with controls (p>0.05). There were no statistically significant differences between the patients and the control group in terms of serum vitamin b12, folate and homocysteine levels (p>0.05). We found no evidence for an association between allergic rhinitis and polymorphisms of C677T and A1298C for MTHFR gene in children. Further studies investigating the relationship between MTHFR polymorphism and AR are required. Copyright © 2014 SEICAP. Published by Elsevier Espana. All rights reserved.

  11. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  12. Polymorphism of the prolactin gene and its association with egg ...

    African Journals Online (AJOL)

    As a candidate gene related to egg production, prolactin plays a crucial role in the reproduction of birds. In this study, polymorphism of the prolactin gene was screened in six Chinese native duck breeds (Shanma, Shaoxing, Youma, Jinyun, Jingjiang and the F2 resource population of white Liancheng X white Kaiya) using ...

  13. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  14. Polymorphism of the VEGF gene and its association with growth ...

    African Journals Online (AJOL)

    User

    et al., 2002), prostate cancer (Lin et al., 2003) and breast cancer (Krippl et al., 2003). Thus, variations in this gene may exert vast influences on animal growth. However, to date, no studies on the effects of the polymorphisms of the VEGF gene on the economically important traits in livestock have been published. We.

  15. Association between HLA-DQA1 gene copy number polymorphisms ...

    Indian Academy of Sciences (India)

    2014-04-21

    Apr 21, 2014 ... RESEARCH NOTE. Association between HLA-DQA1 gene copy number polymorphisms and susceptibility to rheumatoid arthritis in. Chinese Han ..... 2009 Combinatorial content of CCL3L and CCL4L gene copy numbers influence HIV-AIDS susceptibility in Ukrainian children. AIDS 23, 679–688. Sirota M.

  16. Polymorphisms of two neuroendocrine–correlated genes associated ...

    African Journals Online (AJOL)

    In this study, insulin-like growth factor binding protein 2 (IGFBP-2) and signal transducers activators of transcription 5b (STAT5b) gene were studied as candidate gene associated with body weight and reproductive traits of the Jinghai Yellow chicken. Single nucleotide polymorphisms (SNPs) of the IGFBP-2 and STAT5b ...

  17. Polymorphism of Calpastatin Gene in Crossbreed Dalagh Sheep ...

    African Journals Online (AJOL)

    Administrator

    2011-09-14

    Sep 14, 2011 ... Calpastatin has a role in meat tenderness after slaughter. Blood samples were ... Key words: Calpastatin gene, polymorphism, crossbreed, Dalagh sheep. ... using primers based on the sequence of the bovine (Roberts et al.,. 1996; Gen bank accession no AF016006.1) and ovine calpastatin genes.

  18. Association of ADAM33 gene polymorphisms with adult-onset ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... Abstract. ADAM33, a member of the ADAM (a disintegrin and metalloprotease) gene family, is an asthma susceptibility gene origi- nally identified by positional cloning. In the present study, we investigated the possible association of five single-nucleotide polymorphisms (SNPs) in the ADAM33 (rs511898, ...

  19. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  20. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  1. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    ... our study mainly analysed the TPS gene family under freezing conditions in winter wheat, and determined that most of the TPS gene expression in winter wheat was induced by freezing conditions, which further suggested that wheat TPS genes were involved in winter wheat freeze-resistance signal transduction pathways ...

  2. Methylenetetrahydrofolate reductase gene polymorphisms in Egyptian Turner Syndrome patients.

    Science.gov (United States)

    Ismail, Manal F; Zarouk, Waheba A; Ruby, Mona O; Mahmoud, Wael M; Gad, Randa S

    2015-01-01

    Folate metabolism dysfunctions can result in DNA hypomethylation and abnormal chromosome segregation. Two common polymorphisms of the methylenetetrahydrofolate reductase (MTHFR) encoding gene (C677T and A1298C) reduce MTHFR activity, but when associated with aneuploidy, the results are conflicting. Turner Syndrome (TS) is an interesting model for investigating the association between MTHFR gene polymorphisms and nondisjunction because of the high frequency of chromosomal mosaicism in this syndrome. To investigate the association of MTHFR gene C677T and A1298C polymorphisms in TS patients and their mothers and to correlate these polymorphisms with maternal risk of TS offspring. MTHFR C677T and A1298C polymorphisms were genotyped in 33 TS patients, their mothers and 15 healthy females with their mothers as controls using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and sequencing technique. Genotype and allele frequencies of both C677T and A1298C were not significantly different between TS cases and controls. There were no significant differences in C677T genotype distribution between the TS mothers and controls (p=1). The MTHFR 1298AA and 1298AC genotypes were significantly increased in TS mothers Vs. control mothers (p=0.002). The C allele frequency of the A1298C polymorphism was significantly different between the TS mothers and controls (p=0.02). The association of A1298C gene polymorphism in TS patients was found to increase with increasing age of both mothers (p=0.026) and fathers (p=0.044) of TS cases. Our findings suggest a strong association between maternal MTHFR A1298C and risk of TS in Egypt.

  3. Interleukin-18 gene promoter polymorphisms and recurrent spontaneous abortion.

    Science.gov (United States)

    Naeimi, Sirous; Ghiam, Alireza Fotouhi; Mojtahedi, Zahra; Dehaghani, Alamtaj Samsami; Amani, Dawar; Ghaderi, Abbas

    2006-01-01

    IL-18 is a multifunctional cytokine capable of inducing either Th1 or Th2 polarization depending on the immunologic milieu. IL-18 is detected at the materno-fetal interface very soon in early pregnancy. Two polymorphisms in the promoter region of the IL-18 gene at positions of -607 and -137 appear to have functional impacts. This study attempts to evaluate the frequency of these two polymorphisms in the IL-18 gene promoter in patients with recurrent spontaneous abortion (RSA) and normal pregnant women. One hundred and two RSA patients and 103 healthy pregnant women were enrolled in this study. Single nucleotide polymorphisms of the IL-18 gene at positions -607 (C/A) and -137 (G/C) were analyzed by the sequence-specific PCR method. There was no significant association between the allele, genotype, and haplotype frequencies of the two single nucleotide polymorphisms (SNPs) in the IL-18 gene promoter and RSA. The results of this study showed that IL-18 gene promoter polymorphisms at positions -607 and -137 did not confer susceptibility to RSA in southern Iranian patients.

  4. Genetic polymorphisms of the TYMS gene are not associated with congenital cardiac septal defects in a Han Chinese population.

    Science.gov (United States)

    Zhao, Jian-Yuan; Sun, Jing-Wei; Gu, Zhuo-Ya; Wang, Jue; Wang, Er-Li; Yang, Xue-Yan; Qiao, Bin; Duan, Wen-Yuan; Huang, Guo-Ying; Wang, Hong-Yan

    2012-01-01

    Clinical research indicates that periconceptional administration of folic acid can reduce the occurrence of congenital cardiac septal defects (CCSDs). The vital roles of folate exhibits in three ways: the unique methyl donor for DNA expression regulation, the de novo biosynthesis of purine and pyrimidine for DNA construction, and the serum homocysteine removal. Thymidylate synthase (TYMS) is the solo catalysis enzyme for the de novo synthesis of dTMP, which is the essential precursor of DNA biosynthesis and repair process. To examine the role of TYMS in Congenital Cardiac Septal Defects (CCSDs) risk, we investigated whether genetic polymorphisms in the TYMS gene associated with the CCSDs in a Han Chinese population. Polymorphisms in the noncoding region of TYMS were identified via direct sequencing in 32 unrelated individuals composed of half CCSDs and half control subjects. Nine SNPs and two insertion/deletion polymorphisms were genotyped from two independent case-control studies involving a total of 529 CCSDs patients and 876 healthy control participants. The associations were examined by both single polymorphism and haplotype tests using logistic regression. We found that TYMS polymorphisms were not related to the altered CCSDs risk, and even to the changed risk of VSDs subgroup, when tested in both studied groups separately or in combination. In the haplotype analysis, there were no haplotypes significantly associated with risks for CCSDs either. Our results show no association between common genetic polymorphisms of the regulatory region of the TYMS gene and CCSDs in the Han Chinese population.

  5. MTHFR Gene C677T Polymorphism in Autism Spectrum Disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Sener

    2014-01-01

    Full Text Available Aim. Autism is a subgroup of autism spectrum disorders, classified as a heterogeneous neurodevelopmental disorder and symptoms occur in the first three years of life. The etiology of autism is largely unknown, but it has been accepted that genetic and environmental factors may both be responsible for the disease. Recent studies have revealed that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. In particular, C677T polymorphism in the MTHFR gene as a possible risk factor for autism is still controversial. We aimed to investigate the possible effect of C677T polymorphism in a Turkish cohort. Methods. Autism patients were diagnosed by child psychiatrists according to DSM-IV and DSM-V criteria. A total of 98 children diagnosed as autistic and 70 age and sex-matched children who are nonautistic were tested for C677T polymorphism. This polymorphism was studied by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP methods. Results. MTHFR 677T-allele frequency was found to be higher in autistic children compared with nonautistic children (29% versus 24%, but it was not found statistically significant. Conclusions. We conclude that other MTHFR polymorphisms such as A1298C or other folate/homocysteine pathway genes may be studied to show their possible role in autism.

  6. Finding protein-coding genes through human polymorphisms.

    Directory of Open Access Journals (Sweden)

    Edward Wijaya

    Full Text Available Human gene catalogs are fundamental to the study of human biology and medicine. But they are all based on open reading frames (ORFs in a reference genome sequence (with allowance for introns. Individual genomes, however, are polymorphic: their sequences are not identical. There has been much research on how polymorphism affects previously-identified genes, but no research has been done on how it affects gene identification itself. We computationally predict protein-coding genes in a straightforward manner, by finding long ORFs in mRNA sequences aligned to the reference genome. We systematically test the effect of known polymorphisms with this procedure. Polymorphisms can not only disrupt ORFs, they can also create long ORFs that do not exist in the reference sequence. We found 5,737 putative protein-coding genes that do not exist in the reference, whose protein-coding status is supported by homology to known proteins. On average 10% of these genes are located in the genomic regions devoid of annotated genes in 12 other catalogs. Our statistical analysis showed that these ORFs are unlikely to occur by chance.

  7. Identification of the conserved coding sequences of three chitin synthase genes in Fonsecaea pedrosoi.

    Science.gov (United States)

    Karuppayil, S M; Peng, M; Mendoza, L; Levins, T A; Szaniszlo, P J

    1996-01-01

    Primers having designs based on highly conserved stretches in the deduced amino acid sequences of chitin synthase (CHS) genes were used in PCR reactions to amplify 600 bp and 366 bp products from the genomic DNA of three major causal agents of chromoblastomycosis. Cloning and sequencing of the PCR products of one of these fungi, Fonsecaea pedrosoi, identified three CHS sequences designated as FpCHS1, FpCHS2 and FpCHS3. FpCHS1 and FpCHS2 were homologous to regions of CHS1 and CHS2 of Saccharomyces cerevisiae, and their derived amino acid sequences fell into chitin synthase classes I and II, respectively. FpCHS3 was homologous to a region of the CAL1/CSD2 gene of S. cerevisiae, which codes for the chitin synthase three (Chs3) enzyme in that fungus. Phylogenetic trees constructed using the deduced amino acid sequences of PCR-amplified CHS products from many fungi clustered F. pedrosoi with other dematiaceous fungi, providing new molecular evidence for the genetic relatedness of these organisms. The identification of these CHS genes in F. pedrosoi will facilitate future studies of the functional roles of chitin synthases in the unique in vivo dimorphism exhibited by chromoblastomycotic fungi.

  8. [Homocysteine levels and polymorphisms of MTHFR and CBS genes in Colombian patients with superficial and deep venous thrombosis].

    Science.gov (United States)

    Ayala, Claudia; García, Reggie; Cruz, Edith; Prieto, Karol; Bermúdez, Marta

    2010-01-01

    Thrombosis develops when the hemostatic system is incorrectly activated due to the unbalance between procoagulant, anticoagulant and fibrinolytic mechanisms allowing the formation of a clot within a blood vessel. The risk factors of this pathology can be acquired or can be genetic. To analyze in a Colombian population with diagnosis of venous thrombosis, lipid profile, glucose and homocystein levels, to calculate the alleles and genotypic frequencies of polymorphisms c.699 C>T, c.1080 C>T, c.844ins68 of the cystathionine ß synthase and the c.677 C>T of the methylenetetrahydrofolate reductase (MTHFR) genes. Thirty three patients and their controls were studied. The biochemical test was carried out by colorimetric methods and immunoassay. In this survey we used the restriction fragments longitude polymorphism (RLFP) technique to identify the polymorphisms mentioned. The association study was performed through the chi square test. We confirmed that gene alterations increase risk for pathology; we found statistically significant differences in the group with hypercholesterolemia in presence of the polymorphism c.699 C>T in the CBS gene, showing a protective effect in the individuals carrying this genetic variation. Likewise, we found a statistical trend for an eventual protective effect of the CBS c.844ins68 polymorphism to venous thrombotic disease. There were not any statistically significant differences in homocystein levels between cases and controls; nevertheless, the variability in the plasma concentrations was greater in the group of cases.

  9. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria

    2008-01-01

    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences....... The present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  10. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria

    2008-01-01

    Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...... disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences....... The present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism...

  11. Haplotype analysis of the germacrene A synthase gene and association with cynaropicrin content and biological activities in Cynara cardunculus.

    Science.gov (United States)

    Ferro, Ana Margarida; Ramos, Patrícia; Guerra, Ângela; Parreira, Paula; Brás, Teresa; Guerreiro, Olinda; Jerónimo, Eliana; Capel, Carmen; Capel, Juan; Yuste-Lisbona, Fernando J; Duarte, Maria F; Lozano, Rafael; Oliveira, M Margarida; Gonçalves, Sónia

    2018-04-01

    Cynara cardunculus: L. represents a natural source of terpenic compounds, with the predominant molecule being cynaropicrin. Cynaropicrin is gaining interest since it has been correlated to anti-hyperlipidaemia, antispasmodic and cytotoxicity activity against leukocyte cancer cells. The objective of this work was to screen a collection of C. cardunculus, from different origins, for new allelic variants in germacrene A synthase (GAS) gene involved in the cynaropicrin biosynthesis and correlate them with improved cynaropicrin content and biological activities. Using high-resolution melting, nine haplotypes were identified. The putative impact of the identified allelic variants in GAS protein was evaluated by bioinformatic tools and polymorphisms that putatively lead to protein conformational changes were described. Additionally, cynaropicrin and main pentacyclic triterpenes contents, and antithrombin, antimicrobial and antiproliferative activities were also determined in C. cardunculus leaf lipophilic-derived extracts. In this work we identified allelic variants with putative impact on GAS protein, which are significantly associated with cynaropicrin content and antiproliferative activity. The results obtained suggest that the identified polymorphisms should be explored as putative genetic markers correlated with biological properties in Cynara cardunculus.

  12. Inflammatory bowel disease: the role of inflammatory cytokine gene polymorphisms

    Directory of Open Access Journals (Sweden)

    Joanna Balding

    2004-01-01

    Full Text Available THE mechanisms responsible for development of inflammatory bowel disease (IBD have not been fully elucidated, although the main cause of disease pathology is attributed to up-regulated inflammatory processes. The aim of this study was to investigate frequencies of polymorphisms in genes encoding pro-inflammatory and anti-inflammatory markers in IBD patients and controls. We determined genotypes of patients with IBD (n=172 and healthy controls (n=389 for polymorphisms in genes encoding various cytokines (interleukin (IL-1β, IL-6, tumour necrosis factor (TNF, IL-10, IL-1 receptor antagonist. Association of these genotypes to disease incidence and pathophysiology was investigated. No strong association was found with occurrence of IBD. Variation was observed between the ulcerative colitis study group and the control population for the TNF-α-308 polymorphism (p=0.0135. There was also variation in the frequency of IL-6-174 and TNF-α-308 genotypes in the ulcerative colitis group compared with the Crohn's disease group (p=0.01. We concluded that polymorphisms in inflammatory genes are associated with variations in IBD phenotype and disease susceptibility. Whether the polymorphisms are directly involved in regulating cytokine production, and consequently pathophysiology of IBD, or serve merely as markers in linkage disequilibrium with susceptibility genes remains unclear.

  13. Cloning and expression analysis of an anthocyanidin synthase gene ...

    Indian Academy of Sciences (India)

    Expression of ANS in leaves, embryo and seed coat was analysed, which provided a ... taneously amplify the 666-bp fragment of actin gene. The. ANS gene expression in leaves, 15 days after pollination ... ANS expression with shading treatment was evaluated by semiquantitive RT-PCR using B. carinata variety 3H008-6.

  14. Polymorphisms in folate metabolism genes are associated with susceptibility to presbycusis.

    Science.gov (United States)

    Manche, Santoshi Kumari; Jangala, Madhavi; Dudekula, Dinesh; Koralla, Meganadh; Akka, Jyothy

    2018-03-01

    Presbycusis or age related hearing loss is caused by several extrinsic and intrinsic factors that damage the auditory system. Gene polymorphisms in folate metabolism were found to play an important role in the etiology of presbycusis. The present study aimed to investigate the role of 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTR) and thymidylate synthase (TYMS) gene polymorphisms in the onset of presbycusis in a South Indian population. A total of 220 subjects confirmed with presbycusis along with 270 age and sex matched healthy controls visiting MAA ENT Hospitals, Hyderabad, India were enrolled for the study. Genotyping of MTHFR C677T (rs180133) and A1298C (rs1801131), MTR A2756G (rs1805087), TSER (rs1801136) and TS1494indel6 bp (rs16430) was carried out using PCR & PCR-RFLP methods. The 'TT' genotype of MTHFR C677T and '152 bp/152 bp' genotype of TS1494indel6 bp showed statistically significant risk for presbycusis while CC genotype of MTHFR A1298C, '2R/2R' genotype of TSER at 3'UTR and 6 bp ins/6 bp ins of TYMS at 5'UTR were found to be protective. The T-A-A haplotype combination of MTHFR C677T, MTHFR A1298C and MTR A2756G as well as 3R- 152 bp of TYMS at 5'UTR and 3'UTR were also found to contribute significant risk for the onset of presbycusis. Further, the combination of SNP loci TSER: TS1494indel6 bp exhibited moderate linkage in presbycusis. The present pilot study identified the significant association of gene variants of MTHFR and TYMS with presbycusis. These findings aid in early diagnosis of hearing loss in the elderly population. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. Serotonin transporter gene (5-HTT) polymorphisms and compulsive buying.

    Science.gov (United States)

    Devor, E J; Magee, H J; Dill-Devor, R M; Gabel, J; Black, D W

    1999-04-16

    We examined a panel of 21 patients diagnosed with compulsive buying for two DNA sequence polymorphisms found in the gene that encodes the serotonin transport (5-HTT). One polymorphism, found in the promoter region of the 5-HTT gene, involves a 44-base pair (bp) deletion, and the other, found in the second intron, is due to variable numbers of a repeat sequence. We also typed a panel of 38 psychiatrically normal controls for both 5-HH markers. When compared to this control panel, no significant differences were seen for either 5-HTT marker among the compulsive buyers.

  16. Identification of new polymorphisms in the CACNA1S gene.

    Science.gov (United States)

    Carsana, Antonella; Fortunato, Giuliana; De Sarno, Claudia; Brancadoro, Virginia; Salvatore, Francesco

    2003-01-01

    We identified four novel polymorphisms in the CACNA1S gene that encodes the alpha1-subunit of the dihydropyridine receptor. Mutations in this gene are associated with two genetic diseases: malignant hyperthermia and hypokalemic periodic paralysis. The nucleotide substitutions c2403T --> C and c5398T --> C did not result in amino acid replacement, the nucleotide substitution c4475C --> A caused the replacement of the Ala1492 with an Asp residue and an A insertion was identified in intron 36. By using methods based on digestion with restriction enzymes we calculated the frequencies of these novel polymorphisms, as well as heterozygosity, in normal subjects from southern Italy.

  17. Gene-gene interactions of fatty acid synthase (FASN) using multifactor-dimensionality reduction method in Korean cattle.

    Science.gov (United States)

    Lee, Jeayoung; Jin, Mehyun; Lee, Yoonseok; Ha, Jaejung; Yeo, Jungsou; Oh, Dongyep

    2014-01-01

    We examined the gene-gene interactions of five exonic single nucleotide polymorphisms (SNPs) in the gene encoding fatty acid synthase using 513 Korean cattle and using the model free and the non-parametrical multifactor dimensionality reduction method for the analysis. The five SNPs of g.12870 T>C, g.13126 T>C, g.15532 C>A, g.16907 T>C and g.17924 G>A associated with a variety of fatty acid compositions and marbling score were used in this study. The two-factor interaction between g.13126 T>C and g.15532 C>A had the highest training-balanced among the five-factor models and a testing-balanced accuracy at 70.18 % on C18:1 with a cross-validation consistency of 10 out of 10. Also, the two-factor interaction between g.13126 T>C and g.15532 C>A had the highest testing-balanced accuracy at 68.59 % with a 10 out of 10 cross-validation consistency, than any other models on MUFA. In MS, a single SNP g.15532 C>A had the best accuracy at 58.85 % and the two-factor interaction model g.12870 T>C and g.15532 C>A had the highest testing-balanced accuracy at 64.00 %. The three-factor interaction model g.12870 T>C, g.13126 T>C and g.15532 C>A was recorded as having a high testing-balanced accuracy of 63.24 %, but it was lower than the two-factor interaction model. We used likelihood ratio tests for interaction, and Chi square tests to validate our results, with all tests showing statistical significance. We also compared this with mean scores between the high-risk trait group and low-risk trait group. The genotypes of TTCA, TTAA and TCAA at g.15532 and g.13126 on C18:1, genotypes TTCC, TTCA, TTAA, TCAA CCAA at g.15532 and g.13126 on MUFA and genotypes CCCC, TCCA, CCCA, TTAA, TCAA and CCAA at g.15532 and g.12870 on MS were recommended for the genetic improvement of beef quality.

  18. Production of taxadiene from cultured ginseng roots transformed with taxadiene synthase gene

    Directory of Open Access Journals (Sweden)

    Mijeong Cha1, Sang Hee Shim1, Sung Hong Kim2, Ok Tae Kim3, Se-Weon Lee4, Suk-Yoon Kwon5 & Kwang-Hyun Baek1,*

    2012-10-01

    Full Text Available Paclitaxel is produced by various species of yew trees and hasbeen extensively used to treat tumors. In our research, ataxadiene synthase (TS gene from Taxus brevifolia was used totransform the roots of cultured ginseng (Panax ginseng C.A.Meyer to produce taxadiene, the unique skeletal precursor totaxol. The TS gene was successfully introduced into theginseng genome, and the de novo formation of taxadiene wasidentified by mass spectroscopy profiling. Without any changein phenotypes or growth difference in a TS-transgenic ginsengline, the transgenic TSS3-2 line accumulated 9.1 μg taxadieneper gram of dry weight. In response to the treatment of methyljasmonate for 3 or 6 days, the accumulation was 14.6 and15.9 μg per g of dry weight, respectively. This is the first reportof the production of taxadiene by engineering ginseng rootswith a taxadiene synthase gene.

  19. Cervical Carcinogenesis and Immune Response Gene Polymorphisms: A Review

    Directory of Open Access Journals (Sweden)

    Akash M. Mehta

    2017-01-01

    Full Text Available The local immune response is considered a key determinant in cervical carcinogenesis after persistent infection with oncogenic, high-risk human papillomavirus (HPV infections. Genetic variation in various immune response genes has been shown to influence risk of developing cervical cancer, as well as progression and survival among cervical cancer patients. We reviewed the literature on associations of immunogenetic single nucleotide polymorphism, allele, genotype, and haplotype distributions with risk and progression of cervical cancer. Studies on HLA and KIR gene polymorphisms were excluded due to the abundance on literature on that subject. We show that multiple genes and loci are associated with variation in risk of cervical cancer. Rather than one single gene being responsible for cervical carcinogenesis, we postulate that variations in the different immune response genes lead to subtle differences in the effectiveness of the antiviral and antitumour immune responses, ultimately leading to differences in risk of developing cervical cancer and progressive disease after HPV infection.

  20. Depressive symptoms in schizophrenia and dopamine and serotonin gene polymorphisms.

    Science.gov (United States)

    Peitl, Vjekoslav; Štefanović, Mario; Karlović, Dalibor

    2017-07-03

    Although depressive symptoms seem to be frequent in schizophrenia they have received significantly less attention than other symptom domains. As impaired serotonergic and dopaminergic neurotransmission is implicated in the pathogenesis of depression and schizophrenia this study sought to investigate the putative association between several functional gene polymorphisms (SERT 5-HTTLPR, MAO-A VNTR, COMT Val158Met and DAT VNTR) and schizophrenia. Other objectives of this study were to closely examine schizophrenia symptom domains by performing factor analysis of the two most used instruments in this setting (Positive and negative syndrome scale - PANSS and Calgary depression rating scale - CDSS) and to examine the influence of investigated gene polymorphisms on the schizophrenia symptom domains, focusing on depressive scores. A total of 591 participants were included in the study (300 schizophrenic patients and 291 healthy volunteers). 192 (64%) of schizophrenic patients had significant depressive symptoms. Genotype distribution revealed no significant differences regarding all investigated polymorphisms except the separate gender analysis for MAO-A gene polymorphism which revealed significantly more allele 3 carriers in schizophrenic males. Factor analysis of the PANSS scale revealed the existence of five separate factors (symptom domains), while the CDSS scale revealed two distinct factors. Several investigated gene polymorphisms (mostly SERT and MAO-A, but also COMT) significantly influenced two factors from the PANSS (aggressive/impulsive and negative symptoms) and one from the CDSS scale (suicidality), respectively. Depressive symptoms in schizophrenic patients may be influenced by functional gene polymorphisms, especially those implicated in serotonergic neurotransmission. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Polymorphism of the DNA Base Excision Repair Genes in Keratoconus

    Science.gov (United States)

    Wojcik, Katarzyna A.; Synowiec, Ewelina; Sobierajczyk, Katarzyna; Izdebska, Justyna; Blasiak, Janusz; Szaflik, Jerzy; Szaflik, Jacek P.

    2014-01-01

    Keratoconus (KC) is a degenerative corneal disorder for which the exact pathogenesis is not yet known. Oxidative stress is reported to be associated with this disease. The stress may damage corneal biomolecules, including DNA, and such damage is primarily removed by base excision repair (BER). Variation in genes encoding BER components may influence the effectiveness of corneal cells to cope with oxidative stress. In the present work we genotyped 5 polymorphisms of 4 BER genes in 284 patients and 353 controls. The A/A genotype of the c.–1370T>A polymorphism of the DNA polymerase γ (POLG) gene was associated with increased occurrence of KC, while the A/T genotype was associated with decreased occurrence of KC. The A/G genotype and the A allele of the c.1196A>G polymorphism of the X-ray repair cross-complementing group 1 (XRCC1) were associated with increased, and the G/G genotype and the G allele, with decreased KC occurrence. Also, the C/T and T as well as C/C genotypes and alleles of the c.580C>T polymorphism of the same gene displayed relationship with KC occurrence. Neither the g.46438521G>C polymorphism of the Nei endonuclease VIII-like 1 (NEIL1) nor the c.2285T>C polymorphism of the poly(ADP-ribose) polymerase-1 (PARP-1) was associated with KC. In conclusion, the variability of the XRCC1 and POLG genes may play a role in KC pathogenesis and determine the risk of this disease. PMID:25356504

  2. Polymorphism of the DNA Base Excision Repair Genes in Keratoconus

    Directory of Open Access Journals (Sweden)

    Katarzyna A. Wojcik

    2014-10-01

    Full Text Available Keratoconus (KC is a degenerative corneal disorder for which the exact pathogenesis is not yet known. Oxidative stress is reported to be associated with this disease. The stress may damage corneal biomolecules, including DNA, and such damage is primarily removed by base excision repair (BER. Variation in genes encoding BER components may influence the effectiveness of corneal cells to cope with oxidative stress. In the present work we genotyped 5 polymorphisms of 4 BER genes in 284 patients and 353 controls. The A/A genotype of the c.–1370T>A polymorphism of the DNA polymerase γ (POLG gene was associated with increased occurrence of KC, while the A/T genotype was associated with decreased occurrence of KC. The A/G genotype and the A allele of the c.1196A>G polymorphism of the X-ray repair cross-complementing group 1 (XRCC1 were associated with increased, and the G/G genotype and the G allele, with decreased KC occurrence. Also, the C/T and T as well as C/C genotypes and alleles of the c.580C>T polymorphism of the same gene displayed relationship with KC occurrence. Neither the g.46438521G>C polymorphism of the Nei endonuclease VIII-like 1 (NEIL1 nor the c.2285T>C polymorphism of the poly(ADP-ribose polymerase-1 (PARP-1 was associated with KC. In conclusion, the variability of the XRCC1 and POLG genes may play a role in KC pathogenesis and determine the risk of this disease.

  3. Polymorphism of the DQA2 gene in goats.

    Science.gov (United States)

    Zhou, H; Hickford, J G H; Fang, Q

    2005-05-01

    Variation in the caprine DQA2 gene was investigated using PCR-single-strand conformational polymorphism (SSCP) and DNA sequencing. Eleven DQA2 alleles were defined by SSCP patterns from 23 goats. All the caprine alleles shared high sequence homology to ovine DQA2 sequences, and exhibited a pattern of polymorphism similar to DQA2 alleles from sheep and cattle but different from caprine DQA1 sequences. Thirty-eight AA positions in the alpha1 domain of caprine DQA2 molecules were polymorphic, and a high degree of polymorphism was observed in the putative antigen-binding region, with 74% of the positions being polymorphic. Phylogenetic analysis of caprine, ovine, and bovine DQA sequences revealed that the caprine DQA2 sequences identified here grouped with ovine DQA2, bovine DQA2, DQA3, and DQA4 sequences but are separate from the group of caprine DQA1 alleles. Nine of the caprine DQA2 sequences were more similar to ovine DQA2 alleles, whereas the remaining two were more closely related to ovine DQA2-like and bovine DQA3 alleles. This finding suggests that the caprine DQA2 sequences may represent two loci, which probably arose by either gene duplication or gene conversion events. Allelic lineages were evident for both DQA2 and DQA2-like loci, supporting the trans-species mode of evolution of major histocompatibilitly complex genes. The high level of polymorphism and similarity between caprine and ovine DQA2 alleles suggests that the DQA2 gene may play an important role in immune responses to shared pathogens.

  4. Association of TRPM Channel Gene Polymorphisms with Systemic Sclerosis.

    Science.gov (United States)

    Oztuzcu, Serdar; Onat, Ahmet M; Pehlivan, Yavuz; Alibaz-Oner, Fatma; Donmez, Salim; Cetin, Gozde Y; Yolbas, Servet; Bozgeyik, Ibrahim; Yilmaz, Neslihan; Ozgen, Metin; Cagatay, Yonca; Kisacik, Bunyamin; Koca, Suleyman S; Pamuk, Omer Nuri; Sayarlioglu, Mehmet; Direskeneli, Haner; Demiryurek, Abdullah T

    2015-01-01

    Systemic sclerosis (SSc) is an inflammatory disease characterized by vascular abnormalities and fibrosis. The aim of the present study was to investigate the possible role of transient receptor potential melastatin (TRPM) channel genes in the susceptibility and phenotype expression of SSc. A total of 339 patients with SSc and 302 healthy controls were studied. Genomic DNA was extracted from leukocytes of the peripheral blood, and 25 single nucleotide polymorphisms in the TRPM channel genes were analyzed by the BioMark HD dynamic array system. There were marked increases in the CC genotype (94.7% vs 81.8%, pTRPM5 rs34551253 (Ala456Thr) polymorphism in SSc patients when compared to controls. TRPM3 gene rs1328142 polymorphism was also markedly associated with disease phenotype. However, no associations with the other 23 polymorphisms studied were found. This is the first study to examine the involvement of TRPM channel gene variations on the risk of SSc incidence. Our results suggest roles of TRPM3 and TRPM5 gene variants in the susceptibility to or clinical expression of SSc in the Turkish population. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  5. Opsin gene polymorphism predicts trichromacy in a cathemeral lemur.

    Science.gov (United States)

    Veilleux, Carrie C; Bolnick, Deborah A

    2009-01-01

    Recent research has identified polymorphic trichromacy in three diurnal strepsirrhines: Coquerel's sifaka (Propithecus coquereli), black and white ruffed lemurs (Varecia variegata), and red ruffed lemurs (V. rubra). Current hypotheses suggest that the transitions to diurnality experienced by Propithecus and Varecia were necessary precursors to their independent acquisitions of trichromacy. Accordingly, cathemeral lemurs are thought to lack the M/L opsin gene polymorphism necessary for trichromacy. In this study, the M/L opsin gene was sequenced in ten cathemeral blue-eyed black lemurs (Eulemur macaco flavifrons). This analysis identified a polymorphism identical to that of other trichromatic strepsirrhines at the critical amino acid position 285 in exon 5 of the M/L opsin gene. Thus, polymorphic trichromacy is likely present in at least one cathemeral Eulemur species, suggesting that strict diurnality is not necessary for trichromacy. The presence of trichromacy in E. m. flavifrons suggests that a re-evaluation of current hypotheses regarding the evolution of strepsirrhine trichromacy may be necessary. Although the M/L opsin polymorphism may have been independently acquired three times in the lemurid-indriid clade, the distribution of opsin alleles in lemurids and indriids may also be consistent with a common origin of trichromacy in the last common ancestor of either the lemurids or the lemurid-indriid clade. (c) 2008 Wiley-Liss, Inc.

  6. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Olga Y. Yurkevich

    2017-08-01

    Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  7. Serotonin transporter (SERT gene polymorphism in Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Mahmut Özkaya

    2004-06-01

    Full Text Available Background: Parkinson disease (PD is the second most common neurodegenerative disorder with a prevalence of about 2% in persons older than 65 years of age. Neurodegenerative process in PD is not restricted to the dopaminergic neurons of the substantia nigra but also affects serotoninergic neurons. It has been shown that PD brains with Lewy bodies in the substantia nigra also had Lewy bodies in the raphe nuclei. The re-uptake of 5HT released into the synaptic cleft is mediated by the 5HT transporter (SERT. The SERT gene has been mapped to the chromosome of 17q11.1-q12 and has two main polymorphisms: intron two VNTR polymorphism and promoter region 44 bp insertion/deletion polymorphism. Objective: In this study we investigated whether two polymorphic regions in the serotonin transporter gene are associated with PD. Material and Method: After obtaining informed consent, blood samples were collected from 76 patients and 54 healthy volunteers. Genomic DNA was extracted from peripheral leucocytes using standard methods. The SERT gene genotypes were determined using polymerase chain reaction (PCR method. Results: Based on the intron 2 VNTR polymorphism of SERT gene, the distribution of 12/12, 12/10 and 10/10 genotypes were found as, 56.6 %, 35.5 %, 7.9 % in patients whereas this genotype distribution in control group was 40.7 %, 46.3 % and 13 %, respectively. According to 5-HTTLPR polymorphism, the distribution of L/L, L/S and S/S genotypes were found as 27.6 % 51.3 % and 21.1 % in patients whereas this genotype distribution in control group was 33.4 %, 50.0 % and 16.6 %, respectively. Despite the fact that the genotype distribution of SERT gene polymorphism in patients and control group seemed to be different from each other, this difference was not found to be statistically significant. Conclusion: This finding suggests that polymorphisms within the SERT gene do not play a major role in PD susceptibility in the Turkish population.

  8. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  9. A PCR marker linked to a THCA synthase polymorphism is a reliable tool to discriminate potentially THC-rich plants of Cannabis sativa L.

    Science.gov (United States)

    Staginnus, Christina; Zörntlein, Siegfried; de Meijer, Etienne

    2014-07-01

    Neither absolute THC content nor morphology allows the unequivocal discrimination of fiber cultivars and drug strains of Cannabis sativa L. unequivocally. However, the CBD/THC ratio remains constant throughout the plant's life cycle, is independent of environmental factors, and considered to be controlled by a single locus (B) with two codominant alleles (B(T) and B(D)). The homozygous B(T)/B(T) genotype underlies the THC-predominant phenotype, B(D)/B(D) is CBD predominant, and an intermediate phenotype is induced by the heterozygous state (B(T)/B(D)). Using PCR-based markers in two segregating populations, we proved that the THCA synthase gene represents the postulated B locus and that specific sequence polymorphisms are absolutely linked either to the THC-predominant or the THC-intermediate chemotype. The absolute linkage provides an excellent reliability of the marker signal in forensic casework. For validation, the species-specific marker system was applied to a large number of casework samples and fiber hemp cultivars. © 2014 American Academy of Forensic Sciences.

  10. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    Analysis of the resultant nucleotide and deduced amino acid sequences led to the identification of two different members of gene family, 1 and 2. Third member, full-length cDNA (3) was isolated by rapid amplification of cDNA ends (RACE), whose open reading frame contained 1239 bp ...

  11. Cloning and expression pattern of chitin synthase (CHS) gene in ...

    African Journals Online (AJOL)

    USER

    2010-08-16

    Aug 16, 2010 ... This study provided an important information for further research on development of RNA interference. (RNAi) technology to control E. ... transcriptional gene silencing; RNAi, RNA interference; RACE, rapid amplification of cDNA .... Alignment showed that the alternately spliced. cDNA sequence of CHS-A in ...

  12. The geranylgeranyl pyrophosphate synthase gene from Ginkgo biloba

    African Journals Online (AJOL)

    polypeptide. Comparative analysis showed that GbGGDPS had a high similarity to other plant GGDPSs. Bioinformatic analysis showed that GbGGDPS was an intron-free gene and its deduced polypeptide contained all the five conserved domains and functional aspartate-rich motifs of the polyprenyltransferases.

  13. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... Jimai 22 were used as an experimental model to analyse the expression patterns of wheat TPS genes .... the Bioanalyzer 2100 algorithm (Agilent Technologies, Palo. Alto, USA); high quality (RNA integrity ... software (Premier Biosoft International, Palo Alto, USA). Sequences and other information of the ...

  14. Association between polymorphisms in Wnt signaling pathway genes and bone mineral density in postmenopausal Korean women.

    Science.gov (United States)

    Lee, Dong-Yun; Kim, Hoon; Ku, Seung Yup; Kim, Seok Hyun; Choi, Young Min; Kim, Jung Gu

    2010-01-01

    The purpose of this study was to investigate the association between single nucleotide polymorphisms in Wnt signal pathway genes and circulating osteoprotegerin (OPG), soluble receptor activator of the nuclear factor-κB ligand (sRANKL) levels, bone turnover markers, and bone mineral density (BMD) in postmenopausal Korean women. Wnt9a c256G>A; low-density lipoprotein receptor-related protein (LRP) 5 c266A>G, c2245C>G, c3893C>T, and c4099G>A; secreted frizzled-related protein (sFRP) 4 c1019G>A; axin II c148C>T and c1615G>A; glycogen synthase kinase binding protein (GBP) c455C>A; β-catenin c94G>T and c101G>T; T-cell factor 1 c663G>T, c734C>T, and c766G>A; and adenomatous polyposis coli c5465T>A polymorphisms were analyzed in 392 postmenopausal Korean women. Serum levels of OPG, sRANKL, and bone turnover markers were measured, and BMDs at the lumbar spine and femoral neck were examined. Wnt9a c256G>A, LRP5 c2245C>G and c4099G>A, axin II c1615G>A, GBP c455C>A, β-catenin c94G>T and c101G>T, and T-cell factor 1 c663G>T and c734C>T single nucleotide polymorphisms were not observed. Among the genes showing polymorphisms, only the sFRP4 c1019G>A polymorphism was associated with BMD. The AA genotype in the sFRP4 c1019G>A polymorphism showed significantly lower lumbar spine BMD and a higher serum bone alkaline phosphatase level than did the GG genotype and showed a 6.39 times higher risk for osteoporosis at the lumbar spine compared with the GG genotype. No significant differences in bone turnover markers, OPG, and sRANKL were detected among the other single genotypes or the LRP haplotype genotype. Our results suggest that the sFRP4 c1019G>A polymorphism may be one of the genetic factors affecting lumbar spine BMD in postmenopausal Korean women.

  15. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  16. Transcriptional Modulation of Squalene Synthase Genes in Barley Treated with PGPR

    Directory of Open Access Journals (Sweden)

    Anam eYousaf

    2015-09-01

    Full Text Available Phytosterol contents and food quality of plant produce is directly associated with transcription of gene Squalene Synthase (SS. In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27±3°C greenhouse conditions in order to modulate expression of SS gene. Plant samples were analysed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of squalene synthase. Results revealed that among four SS genes (i.e. SSA, SS1, SS2 and SS3, the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43% and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes.

  17. Association of polymorphism of the alpha 1-antitrypsin gene with ...

    African Journals Online (AJOL)

    In order to determine the relationship between the polymorphisms of the AAT gene and milk production traits and SCS, the General Linear Model (GLM) procedure from the Statistical Analysis Software was used. SNP5504 affected milk fat percentage, SNP8178 affected milk protein percentage and SNP5609 and SNP5624 ...

  18. Association of IL-6 and MMP-3 gene polymorphisms with ...

    Indian Academy of Sciences (India)

    Recently, several institutions have investigated the associations of MMP-3-1171 5A/6A and IL-6-174-G/C gene polymorphisms with adolescent idiopathic scoliosis (AIS), while reports from different institutions are not consistent. Therefore, we,comprehensively and systematically performed this meta-analysis to detect ...

  19. Association of polymorphism in the alpha-1-antitrypsin gene with ...

    African Journals Online (AJOL)

    Sahand Rayaneh

    2014-06-11

    Jun 11, 2014 ... Association of polymorphism in the alpha-1-antitrypsin gene with milk production traits in ... Abstract. Alpha-1-antitrypsin (A1AT) as a strong protease inhibitor plays a major role in the protection of tissues ..... populations over generations; iii) Different statistical models used to analyse the data. For the traits ...

  20. Interleukin gene polymorphisms and susceptibility to HIV-1 infection

    Indian Academy of Sciences (India)

    Some subjects are repeatedly exposed to human immunodeficiency virus (HIV), yet they remain uninfected. This suggests the existence of host-resistance mechanisms. The current study synthesizes the evidence regarding the association between interleukin (IL) gene polymorphisms and HIV susceptibility. Medline ...

  1. EVALUATION OF CYTOKINE GENE POLYMORPHISM IN B CELL LYMPHOID MALIGNANCIES

    Directory of Open Access Journals (Sweden)

    E. L. Nazarova

    2014-01-01

    Full Text Available Previous studies with some solid tumors has shown that polymorphisms of certain cytokine genes may be used as predictors of clinical outcome in the patients. It seemed important to evaluate potential correlations between production of certain pro- and anti-inflammatory cytokines and co-receptor molecules, and promoter polymorphism of the cytokine genes involved into regulation of cell proliferation, differentiation, apoptosis, lipid metabolism and blood clotting in the patients with hematological malignancies. The article contains our results concerning associations between of IL-1β, -2, -4, -10, -17, TNFα, and allelic polymorphisms of their genes in 62 patients with B cell lymphoid malignancies in an ethnically homogenous group (self-identified as Russians. We have shown that the GА and AA genotypes of the G-308A polymorphism in TNFα gene are significantly associated with increased production of this cytokine, being more common in aggressive non-Hodgkin lymphomas, more rare in multiple myeloma and in indolent non-Hodgkin lymphomas.

  2. Genetic polymorphism in FOXP3 gene: imbalance in regulatory T ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 92; Issue 1. Genetic polymorphism in FOXP3 gene: imbalance in regulatory T-cell role and development of human diseases. Julie Massayo Maeda Oda Bruna Karina Banin Hirata Roberta Losi Guembarovski Maria Angelica Ehara Watanabe. Review Article Volume 92 Issue 1 ...

  3. Do prion protein gene polymorphisms induce apoptosis in non ...

    Indian Academy of Sciences (India)

    2016-01-15

    Jan 15, 2016 ... [Birkan T, Şahin M, Öztel Z and Balcan E 2016 Do prion protein gene polymorphisms induce apoptosis in non-mammals? J. Biosci. 41. 97–107] DOI ... of immune system, neurite outgrowth, oxidative stress and cell death and survival .... in randomly selected visual fields by bright field light and fluorescence ...

  4. Association between vitamin D receptor gene polymorphism (TaqI)

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...

  5. Analysis of single nucleotide polymorphisms of PRNP gene in ...

    Indian Academy of Sciences (India)

    12, 389–394. Del Bo R., Comi G. P., Giorda R., Crimi M., Locatelli F., Martinelli-. Boneschi F. et al. 2003 The 129 codon polymorphism of the prion protein gene influences earlier cognitive performance in. Down syndrome subjects. J. Neurol. 250, 688–692. Indian Genome Variation Consortium 2005 The Indian Genome.

  6. IRGM gene polymorphisms and risk of gastric cancer.

    NARCIS (Netherlands)

    Burada, F.; Plantinga, T.S.; Ioana, M.; Rosentul, D.; Angelescu, C.; Joosten, L.A.B.; Netea, M.G.; Saftoiu, A.

    2012-01-01

    OBJECTIVE: The study aimed to assess the possible association of polymorphisms in the autophagy gene IRGM (rs13361189 and rs4958847) with the risk of gastric cancer. METHODS: A total of 102 patients with gastric adenocarcinoma, 52 with chronic gastritis and 351 healthy controls were included in this

  7. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

  8. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  9. NOD1 gene polymorphisms in relation to aggressive periodontitis

    NARCIS (Netherlands)

    Loos, B.G.; Fiebig, A.; Nothnagel, M.; Jepsen, S.; Groessner-Schreiber, B.; Franke, A.; Jervoe-Storm, P.M.; Schenck, K.; van der Velden, U.; Schreiber, S.

    2009-01-01

    Background: NOD proteins are part of innate immunity mechanisms. They play a role in epithelial barrier functions and inflammatory responses to bacteria. Single nucleotide polymorphisms (SNPs) in the NOD1 gene have proven to be associated with inflammatory bowel disease (IBD) and asthma. Objective:

  10. Polymorphism investigation of calpastatin gene in Zel sheep ...

    African Journals Online (AJOL)

    Meat tenderness is an importantquality characteristicfor which consumersare interested. Calpastatin is the calpain inhibitor enzyme and plays an important role in muscle growth and meat quality. The calpastin gene is located on sheep chromosome 5 and its polymorphisms are associated with economic traits. This study ...

  11. DNA polymorphism of HLA class II genes in alopecia areata

    DEFF Research Database (Denmark)

    Morling, N; Frentz, G; Fugger, L

    1992-01-01

    We investigated the DNA restriction polymorphism (RFLP) of the Major Histocompatibility Complex (MHC) class II genes: HLA-DQA, -DQB, -DPA, and -DPB in 20 Danish patients with alopecia areata (AA) and in healthy Danes. The frequency in AA of the DQB1*0301 and DQw7 associated DQB Bgl/II 4.2 kb...

  12. Detection of polymorphism in booroola gene and growth ...

    African Journals Online (AJOL)

    Purpose: This study was carried out for detection of possible polymorphisms in Booroola gene (FecB) and growth differentiation factor 9 [GDF9] in Lori sheep breed. Methods: Blood samples were taken from the jugular vein of the sheep and their DNA content extracted using modified salting-out method. The quantity and ...

  13. Investigations on possible role of MIF gene polymorphism in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 88; Issue 1. Investigations on possible role of MIF gene polymorphism in progression of chikungunya infection into cases of acute flaccid paralysis and chronic arthropathy. Shweta Ramdas Fulsundar Subarna Roy Sathya Prakash Manimunda Shiv Shankar Singh A. P. Sugunan ...

  14. Association of insertion–deletion polymorphism of ACE gene and ...

    African Journals Online (AJOL)

    Introduction: Alzheimer's disease (AD) is a progressive, neurodegenerative disease. Many studies proposed an association of the insertion (I)/deletion (D) polymorphism (indel) in intron 16 of the gene for angiotensin I-converting enzyme (ACE) on chromosome 17q23 with Alzheimer's disease. ACE indel and related ...

  15. gene polymorphism with oral squamous cell carcinoma in north ...

    Indian Academy of Sciences (India)

    Chand-Bhayal et al. 2012; Saxena et al. 2013; Srivastava et al. 2014; Raeiszadeh et al. 2015). In our study IL10 gene polymorphism is found to be asso- ciated with OSCC in north Indian population. The present findings are in accordance with ...

  16. Tumour necrosis factor-alpha gene polymorphisms in Iranian ...

    African Journals Online (AJOL)

    ... progressive inflammatory destructive process of the bile ducts. This study evaluated the relationship between single-nucleotide polymorphisms in the promoter region of tumour necrosis factor-alpha (TNF-α) gene and bilaiary atresia. Materials and Methods: Genomic deoxyribonucleic acid from 16 patients with established ...

  17. DNA polymorphism of HLA class II genes in alopecia areata

    DEFF Research Database (Denmark)

    Morling, N; Frentz, G; Fugger, L

    1992-01-01

    We investigated the DNA restriction polymorphism (RFLP) of the Major Histocompatibility Complex (MHC) class II genes: HLA-DQA, -DQB, -DPA, and -DPB in 20 Danish patients with alopecia areata (AA) and in healthy Danes. The frequency in AA of the DQB1*0301 and DQw7 associated DQB Bgl/II 4.2 kb frag...

  18. Association between vitamin D receptor gene polymorphism (TaqI ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...

  19. Polymorphisms in human DNA repair genes and head and neck ...

    Indian Academy of Sciences (India)

    DNA damage and cancer risk in several epidemiology. Figure 1. Human XRCC1 protein and gene structure showing protein domains known to interact with other com- ponents of base excision repair and the locations of key polymorphisms. Interacting proteins are defined in the text. (Reprinted with permission from ...

  20. Non-HLA gene polymorphisms and their implications on dengue ...

    African Journals Online (AJOL)

    Harapan Harapan

    2012-09-23

    Sep 23, 2012 ... infection are mannose-binding lectin (MBL), interleukin (IL)-4, IL-6, IL-10, interleukin-1 receptor antagonist (IL-1RA), toll-like .... non-human leukocyte antigen (HLA) gene polymorphisms to susceptibility, protection and ...... [13] Martina BEE, Koraka P, Osterhaus ADME. Dengue virus pathogenesis: an ...

  1. Investigations on possible role of MIF gene polymorphism in ...

    Indian Academy of Sciences (India)

    Baugh J. A. and Bucala R. 2002 Macrophage migration inhibitory factor. Crit. Care Med. 30, 27–35. Baugh J. A., Chitnis S., Donnelly S. C., Monteiro J., Lin X., Plant. B. J. et al. 2002 A functional promoter polymorphism in the macrophage migration inhibitory factor (MIF) gene associated with disease severity in rheumatoid ...

  2. A population frequency analysis of the FABP2 gene polymorphism

    African Journals Online (AJOL)

    salah

    E-mail: ahaleemfd@agu.edu.bh. Key Words: FABP2 gene polymorphism, Egyptians, human population genetics. BACKGROUND. Fatty acid – binding proteins (FABPs) are intracellular proteins found in many tissues. They are involved in fatty acid transfer and metabolism1. The FABPs are a family of 15-kDa proteins which.

  3. Allelic polymorphism of 'Makoei' sheep myostatin gene identified by ...

    African Journals Online (AJOL)

    Administrator

    2011-09-05

    Sep 5, 2011 ... Key words: Myostatin gene, polymerase chain reaction (PCR), single strand conformation polymorphism technique (SSCP), Ovis aries. ..... Kambadur R, Sharmam M, Smith TPL, Bass JJ (1997). Mutations In. Myostatin (GDF8) In Double-Muscled Belgian Blue And Piemontese. Cattle. Genome. Res., 7: ...

  4. Polymorphisms in human DNA repair genes and head and neck ...

    Indian Academy of Sciences (India)

    Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and neck squamous cell carcinoma (HNSCC). Xeroderma pigmentosum group D (XPD) and X-ray repair cross-complementing proteins 1 (XRCC1) and 3 (XRCC3) genes are involved in DNA repair ...

  5. Single nucleotide polymorphisms in ghrelin gene and the resulting ...

    African Journals Online (AJOL)

    Ghrelin is a growth hormone releasing peptide which also affects feed intake in chickens. Ghrelin is encoded by chicken ghrelin gene (cGHRL) found in chromosome 7. Single nucleotide polymorphisms (SNPs) have been reported in cGHRL in Chinese native chickens, but such studies have not been carried out in chickens ...

  6. Do the MTHFR gene polymorphism and Down syndrome pregnancy ...

    African Journals Online (AJOL)

    Background: Down syndrome, the most common trisomy 21 arises from abnormal chromosomal segregation. The etiology includes genetic and acquired factors. The main genetic factor that is well appreciated for onset of Down syndrome pregnancy is MTHFR gene polymorphism. But till date, no final conclusion has arrived ...

  7. Evaluation of Interleukin 8 gene polymorphism for predicting ...

    African Journals Online (AJOL)

    Rajasree Shanmuganathan

    2016-07-09

    Jul 9, 2016 ... Hacking D, Knight JC, Rockett K, Brown H, Frampton J, et al. Increased in vivo transcription of an IL-8 haplotype associated · with respiratory syncytial virus disease-susceptibility. Genes · Immun 2004;5:274–82. 10. Michaud DS, Daugherty SE, Berndt SI, Platz EA, Yeager M, et al. Genetic polymorphisms of ...

  8. Association of GSTP1 gene polymorphisms with performance traits ...

    African Journals Online (AJOL)

    sony

    The genetic variants were determined by PCR-SSCP technique. Two unique SSCP patterns were observed in fragment 1, 3, 5 and 6 of GSTP1 gene. Sequence analysis with reference to GenBank. Acc. no AC_000186.1 revealed polymorphisms at position 210, 746, 2438, 2439, 2443, 2507, 2695 and insertions between ...

  9. Association of IL-6 and MMP-3 gene polymorphisms with ...

    Indian Academy of Sciences (India)

    2011 Mechanism of osteoporosis in adolescent idiopathic scoliosis: experimental scoliosis in pinealectomized chickens. J. Pineal Res. 51, 387–393. Lee J. S., Suh K. T. and Eun I. S. 2010 Polymorphism in interleukin-. 6 gene is associated with bone mineral density in patients with adolescent idiopathic scoliosis. J. Bone ...

  10. Analysis of polymorphisms and selective pressures on ama1 gene ...

    Indian Academy of Sciences (India)

    Polymorphisms occurring in this surface antigen will cause major obstacles in developing effective malaria vaccines based on AMA-1. The objective of this study was to characterize ama1 gene in Plasmodium knowlesi isolates from Sabah. DNA was extracted from blood samples collected from Keningau, Kota Kinabalu and ...

  11. Polymorphism of the prolactin gene and its association with egg ...

    African Journals Online (AJOL)

    p2492989

    birds. In this study, polymorphism of the prolactin gene was screened in six Chinese native duck breeds. (Shanma, Shaoxing, Youma, Jinyun, Jingjiang and the F2 resource population of white Liancheng X white .... fitness test indicated that Shaoxing and Jingjiang ducks were in Hardy-Weinberg equilibrium at this site;.

  12. Evaluation of Interleukin 8 gene polymorphism for predicting ...

    African Journals Online (AJOL)

    Background and aim: Previous studies have observed the association between inflammation and chronic kidney disease (CKD). The role played by Interleukin 8 (IL8) gene polymorphism has not been studied yet. Hence, the present study has been designed as the first attempt to identify the possible associations between ...

  13. Estrogen receptor gene polymorphism in patients with degenerative lumbar scoliosis.

    Science.gov (United States)

    Park, Yang Soo; Suh, Kuen Tak; Shin, Jong Ki; Lee, Jung Sub

    2017-02-01

    To examine the association between development of degenerative lumbar scoliosis (DLS) and sex hormones. We investigated the association between DLS and estrogen receptor alpha (ERα) gene polymorphisms in 184 patients with a diagnosis of DLS, by determining the presences of the Pvu II and Xba I polymorphisms, measuring bone mineral densities at the lumbar spine (LSBMD) and femoral neck (FNBMD), and by investigating biochemical markers of bone turnover and comparing these results with those of 220 healthy normal controls. Genotype frequencies in DLS patients and controls revealed a significant difference for the Pvu II polymorphism only (p = 0.0287). No significant difference was found between the DLS and control groups with respect to the Xba I polymorphism, bone mineral density (BMD), or biochemical markers. Furthermore, no significant association was observed between the Pvu II polymorphism and BMD, lumbar scoliosis, lateral listhesis, or biochemical markers in patients with DLS. These results suggest that the ERα Pvu II polymorphism influences the prevalence of DLS.

  14. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  15. The Serotonin Transporter Gene Polymorphisms and Risk of Ischemic Stroke.

    Science.gov (United States)

    Mortensen, Janne Kaergaard; Kraglund, Kristian Lundsgaard; Johnsen, Søren Paaske; Mors, Ole; Andersen, Grethe; Buttenschøn, Henriette N

    2018-04-03

    Serotonin is known as a neurotransmitter; however, it also plays an important role in platelet aggregation as it is released upon platelet activation. The serotonin transporter (SERT) is responsible for the uptake of serotonin into platelets. Functional polymorphisms in the SERT gene may influence platelet activity, as they result in different levels of transporters and thereby different levels of serotonin in platelets. SERT gene polymorphisms have thus been associated with the risk of myocardial infarction. A similar association may exist between SERT gene polymorphisms and stroke. However, to our knowledge, this potential association has not previously been studied. We therefore aimed to investigate the association between polymorphisms in the SERT gene and the risk of ischemic stroke/transitory ischemic attack (TIA). We conducted a case-control study including 834 consecutively admitted first-ever Caucasian ischemic stroke patients/TIA from Aarhus University Hospital, Denmark and 571 healthy controls. The control group comprised a sample from the Danish working population, who were all employees in the public sector in the Central Denmark Region. Two polymorphisms, the length variation (short = S/long = L) in the serotonin-transporter-linked polymorphic region and a single-nucleotide (A/G) polymorphism (rs25531) were studied. The genotypes were grouped according to the functional activity: SS, SLG and LGLG (low expression), SLA, LGLA (medium expression), and LALA (high expression). Data were analyzed using logistic regression and results presented as OR with 95% CI. The high-expression genotype was associated with a lower risk of ischemic stroke/TIA when compared to both the medium expression genotype (OR 0.72, 95% CI 0.56-0.93) and the low-expression genotype (OR 0.75, 95% CI 0.55-1.01) as well as the combination of the low and medium expression genotypes (OR 0.73, 95% CI 0.58-0.93). The lower OR estimates associated with the high-expression genotype were

  16. Association of Interleukin-4 Receptor Gene Polymorphism with Chronic Periodontitis

    Directory of Open Access Journals (Sweden)

    M. Khoshhal

    2011-10-01

    Full Text Available Introduction & Objective: Periodontitis is a multifactorial disease in which host immune system and genetic factors have an important role in its pathogenesis. Genetic polymorphisms in cytokines and their receptors have been proposed as potential markers for periodontal diseases. The aim of the present study was to evaluate whether IL-4R gene polymorphism is associated with chronic periodontitis (CP or not? Materials & Methods: In this cross sectional study ninety non smoker patients (61 women and 29 men with chronic periodontitis were selected according to established criteria. They were categorized into three groups according to their clinical attachment level (CAL. Mutation at position 375(alanine/glutamine, 411(leucine/serine, 478(serine/proline, 406 (arginine/ cysteine in the IL-4R gene was detected by a polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP method.Results: The distribution of mutations for IL-4 polymorphism at amino acids 375 (P=0.41, 411(P=0.22, 478(P=0.17, 406(P=0.77 were not significantly different among mild, moderate and sever chronic periodontitis patients. Conclusion: This study suggests that there is no correlation between IL-4R polymorphism of chronic periodontitis.(Sci J Hamadan Univ Med Sci 2011;18(3:63-69

  17. Two polymorphisms in the glucocorticoid receptor gene directly affect glucocorticoid-regulated gene expression.

    NARCIS (Netherlands)

    H. Russcher (Henk); P. Smit (Pauline); E.L.T. van den Akker (Erica); E.F.C. van Rossum (Liesbeth); A.O. Brinkmann (Albert); F.H. de Jong (Frank); S.W.J. Lamberts (Steven); J.W. Koper (Jan)

    2005-01-01

    textabstractCONTEXT: Interindividual variation in glucocorticoid (GC)-sensitivity can be partly explained by polymorphisms in the GC receptor (GR) gene. The ER22/23EK and N363S polymorphisms have been described to be associated with lower and higher GC sensitivity, respectively. OBJECTIVE AND

  18. RETRACTED: Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression.

    Science.gov (United States)

    Yang, Chun-Hua; Zhou, Tian-Biao

    2015-12-01

    Jiang, and Hong-Yan Li Relationship between the ACE I/D gene polymorphism and T1DN susceptibility/risk of T1DM developing into T1DN in the Caucasian population Journal of Renin-Angiotensin-Aldosterone System 1470320314563425, first published on February 1, 2015 doi: 10.1177/1470320314563425 Chun-Hua Yang and Tian-Biao Zhou Relationship between the angiotensinogen A1166C gene polymorphism and the risk of diabetes mellitus developing into diabetic nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314566221, first published on February 1, 2015 doi: 10.1177/1470320314566221 Chun-Hua Yang and Tian-Biao Zhou Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression Journal of Renin-Angiotensin-Aldosterone System 1470320314568521, first published on February 3, 2015 doi: 10.1177/1470320314568521 Articles published in an issue Guohui Liu, Tian-Biao Zhou, Zongpei Jiang, and Dongwen Zheng Association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in a Caucasian population Journal of Renin-Angiotensin-Aldosterone System March 2015 16: 165-171, first published on November 14, 2014 doi: 10.1177/1470320314557849 Weiqiang Zhong, Zhongliang Huang, Yong Wu, Zongpei Jiang, and Tian-Biao Zhou Association of aldosterone synthase (CYP11B2) gene polymorphism with IgA nephropathy risk and progression of IgA nephropathy Journal of Renin-Angiotensin-Aldosterone System September 2015 16: 660-665, first published on August 20, 2014 doi: 10.1177/1470320314524011.

  19. Identification of Sporothrix schenckii based on sequences of the chitin synthase 1 gene.

    Science.gov (United States)

    Kano, R; Nakamura, Y; Watanabe, S; Tsujimoto, H; Hasegawa, A

    2001-01-01

    Sporothrix schenckii is pathogenic to human and animals. To detect S. schenckii in the tissue, we designed specific oligonucleotide primers based on the chitin synthase gene. Amplification products were selectively obtained from S. schenckii DNA. Polymerase chain reaction analysis with the primer pair S2-R2 was able to detect 10 pg genomic DNA of S. schenckii with ethidium bromide staining. This detection system will be useful as a microbiological tool for the diagnosis of human and animal sporotrichosis.

  20. Improved pestalotiollide B production by deleting competing polyketide synthase genes in Pestalotiopsis microspora.

    Science.gov (United States)

    Chen, Longfei; Li, Yingying; Zhang, Qian; Wang, Dan; Akhberdi, Oren; Wei, Dongsheng; Pan, Jiao; Zhu, Xudong

    2017-02-01

    Pestalotiollide B, an analog of dibenzodioxocinones which are inhibitors of cholesterol ester transfer proteins, is produced by Pestalotiopsis microspora NK17. To increase the production of pestalotiollide B, we attempted to eliminate competing polyketide products by deleting the genes responsible for their biosynthesis. We successfully deleted 41 out of 48 putative polyketide synthases (PKSs) in the genome of NK17. Nine of the 41 PKS deleted strains had significant increased production of pestalotiollide B (P polyketides.

  1. Polymorphisms in MTHFR, MS and CBS genes and homocysteine levels in a Pakistani population.

    Directory of Open Access Journals (Sweden)

    Mohsin Yakub

    Full Text Available BACKGROUND: Hyperhomocysteinemia (>15 µmol/L is highly prevalent in South Asian populations including Pakistan. In order to investigate the genetic determinants of this condition, we studied 6 polymorphisms in genes of 3 enzymes--methylenetetrahydrofolate reductase (MTHFR; C677T; A1298C, methionine synthase (MS; A2756G, cystathionine-β-synthase (CBS; T833C/844ins68, G919A involved in homocysteine metabolism and investigated their interactions with nutritional and environmental factors in a Pakistani population. METHODOLOGY/PRINCIPAL FINDINGS: In a cross-sectional survey, 872 healthy adults (355 males and 517 females; age 18-60 years were recruited from a low-income urban population in Karachi. Fasting venous blood was obtained and assessed for plasma/serum homocysteine; folate, vitamin B12, pyridoxal phosphate and blood lead. DNA was isolated and genotyping was performed by PCR-RFLP (restriction-fragment-length-polymorphism based assays. The average changes in homocysteine levels for MTHFR 677CT and TT genotypes were positive [β(SE β, 2.01(0.63 and 16.19(1.8 µmol/L, respectively]. Contrary to MTHFR C677T polymorphism, the average changes in plasma homocysteine levels for MS 2756AG and GG variants were negative [β(SE β, -0.56(0.58 and -0.83(0.99 µmol/L, respectively]. The average change occurring for CBS 844ins68 heterozygous genotype (ancestral/insertion was -1.88(0.81 µmol/L. The combined effect of MTHFR C677T, MS A2756G and CBS 844ins68 genotypes for plasma homocysteine levels was additive (p value <0.001. Odds of having hyperhomocysteinemia with MTHFR 677TT genotype was 10-fold compared to MTHFR 677CC genotype [OR (95%CI; 10.17(3.6-28.67]. Protective effect towards hyperhomocysteinemia was observed with heterozygous (ancestral/insertion genotype of CBS 844ins68 compared to homozygous ancestral type [OR (95% CI; 0.58 (0.34-0.99]. Individuals with MTHFR 677CT or TT genotypes were at a greater risk of hyperhomocysteinemia in folate and

  2. Association of eNOS gene intron 4 a/b VNTR polymorphisms in children with nephrotic syndrome.

    Science.gov (United States)

    Dursun, Hasan; Noyan, Aytul; Matyar, Selcuk; Buyukcelik, Mithat; Soran, Mustafa; Cengiz, Nurcan; Bayazit, Aysun K; Seydaoglu, Gulsah; Attila, Gulen; Anarat, Ali

    2013-06-15

    To investigate the association of endothelial nitric oxide synthase gene intron 4 (eNOS4) polymorphisms with nephrotic syndrome, the eNOS4 genotypes were assessed in 161 children with nephrotic syndrome in comparison with 78 healthy subjects. We classified the children with nephritic syndrome into 2 groups: as steroid-sensitive nephrotic syndrome (SSNS) (n=125) and steroid-resistant nephrotic syndrome (SRNS) (n=36). The eNOS4 polymorphisms were analyzed by polymerase chain reaction. The frequencies of eNOS4 aa, ab and bb genotypes were 3%, 31%, and 66% in all the nephrotic syndrome groups, and 1%, 23%, and 76% in the control group (x(2)=2.87, p>0.05). In addition, the frequencies of eNOS4 aa, ab and bb genotypes were 2%, 33%, and 65% in SSNS group, and 5%, 28%, and 67% in the SRNS group (x(2)=1.13, p=0.567). The present study is the first to investigate eNOS4 gene polymorphisms in children with SSNS and SRNS. Our data show that the eNOS4 gene polymorphisms were not associated with the development, frequent relapse and response to steroid in nephritic syndrome. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Polymorphism in Nos2 gene is absent in Prague colony of Dahl/Rapp salt-sensitive and salt-resistant rats

    Czech Academy of Sciences Publication Activity Database

    Hojná, Silvie; Kadlecová, Michaela; Zicha, Josef; Kuneš, Jaroslav

    2005-01-01

    Roč. 54, č. 2 (2005), s. 201-206 ISSN 0862-8408 R&D Projects: GA ČR(CZ) GA305/03/0769; GA MŠk(CZ) LN00A069 Institutional research plan: CEZ:AV0Z50110509 Keywords : salt hypertension * gene polymorphism * nitric oxide synthase Subject RIV: ED - Physiology Impact factor: 1.806, year: 2005

  4. Paraoxnase1 Gene Polymorphism in Childhood Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Al-Eisa, Amal A; Sukumaran, Vazhappilly J; Haider, Mohammad Z

    2016-01-01

    Paraoxonase1 (PON1) is a serum enzyme bound to high-density lipoproteins with antioxidant properties. Molecular studies of PON1 revealed 2 polymorphic sites at amino acids 55 and 192 resulting in 2 different allozymes, the L and M-genotype at residue 55 and A and B at site 192, respectively. We have studied the association between PON1 gene polymorphisms and the minimal change nephrotic syndrome/focal segmental glomerulosclerosis (MCNS/FSGS) types of idiopathic nephrotic syndrome (INS) in Kuwaiti Arab children. The PON1 gene, 55 and 192 polymorphisms were analyzed in 50 children with INS (32 MSCN, 18 FSGS) and compared to 50 controls. Serum creatinine, albumin and lipids were measured in all subjects. The LL genotype was detected in 50% of the INS patients compared to 48% of controls (p = 0.84). The heterozygous LM genotype was detected in 42% of INS patients compared 36% of controls (p = 0.68). The MM-genotype was detected in 8% of INS patients and 16% of controls (p = 0.35). The L-allele frequency in its homozygous and heterozygous forms was found in 71% of INS patients compared to 66% controls (p = 0.54). The L-allele frequency (LM and LL) was significantly higher in FSGS compared to MCNS patients (p = 0.0001) and when compared to controls (p = 0.0007). All patients and controls had the AA form of the 192 PON1 gene polymorphism. Our data demonstrate a strong association between the L-allele of PON1 gene 55 polymorphism with FSGS in Kuwaiti Arab children with INS. PON1 genotyping can help in the early prediction of FSGS, which might guide clinicians to a better therapeutic approach. © 2016 S. Karger AG, Basel.

  5. An Association Study Between Gene Polymorphisms of Folic Acid Metabolism Enzymes and Biochemical and Hormonal Parameters in Acromegaly.

    Science.gov (United States)

    Tetik Vardarlı, Aslı; Zengi, Ayhan; Bozok Çetintaş, Vildan; Karadeniz, Muammer; Tamsel, Sadık; Küçükaslan, Ali Şahin; Köse, Timur; Saygılı, Füsun; Eroglu, Zuhal

    2015-08-01

    Folate metabolism is fundamental to several biological functions and required for cell replication, division, and survival. The mammalian folic acid cycle is highly complex and the enzymes, methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTR), and methionine synthase reductase (MTRR), have crucial roles in this metabolic pathway. The common polymorphisms of the MTHFR (C677T and A1298C), MTRR (A66G), and MTR (A2756G) enzymes are well documented as folate deficiency-related disorders, but their roles have not been examined in acromegalic patients. The aim of this study was to compare the genotypic distribution of these gene polymorphisms between patients with acromegaly and controls and explore whether these polymorphisms were associated with biochemical and hormonal parameters in acromegaly. We examined 91 acromegaly patients and 112 healthy subjects who were compared in terms of age and gender. Blood specimens of the subjects were collected in tubes containing ethylenediaminetetraacetic acid. Genomic DNA was isolated from peripheral blood leukocytes and genotyping of the MTHFR (C677T and A1298C) gene polymorphisms was assessed by melting temperature analyses after real-time polymerase chain reaction (PCR), whereas MTRR A66G and MTR A2756G gene polymorphism analyses were performed by PCR/restriction fragment length polymorphism from the isolated DNA of the subjects. MTHFR-677TT genotype frequency was significantly higher in the acromegaly group than the control group (p=0.017), and a significant increase was found in fibrinogen (p=0.032) levels in 677TT-carrying acromegaly patients. MTRR-66AA genotype was significantly higher in the control group than the acromegaly group (p=0.004). Total cholesterol (p=0.048) and C-reactive protein (p=0.046) levels decreased significantly in 66AA genotypes. Although MTR-2756AG genotype frequency was not different between the control and acromegaly groups, 2756AG genotype-carrying individuals have higher left

  6. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  7. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.

    OpenAIRE

    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M

    1997-01-01

    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  8. gene polymorphisms in Iranian prostate cancer subjects

    African Journals Online (AJOL)

    hope&shola

    2010-10-25

    Oct 25, 2010 ... 1Genetic Research Group, Molecular and Bioinformatics Unit, Department of Biomedical Science, Faculty of Medicine and Health ... GSTM1 (odds ratio 0.54, 95% CI 0.27 - 1.08) genes and higher risk of prostate cancer among Iranian ..... transferase; mechanism and relevance to variations in human risk.

  9. Metabolic gene polymorphism frequencies in control populations

    DEFF Research Database (Denmark)

    Garte, Seymour; Gaspari, Laura; Alexandrie, Anna-Karin

    2001-01-01

    Using the International Project on Genetic Susceptibility to Environmental Carcinogens (GSEC) database containing information on over 15,000 control (noncancer) subjects, the allele and genotype frequencies for many of the more commonly studied metabolic genes (CYP1A1, CYP2E1, CYP2D6, GSTM1, GSTT1...

  10. Metabolic gene polymorphism frequencies in control populations.

    NARCIS (Netherlands)

    Garte, S.; Gaspari, L.; Alexandrie, A.K.; Ambrosone, C.; Autrup, H.; Autrup, J.L.; Baranova, H.; Bathum, L.; Benhamou, S.; Boffetta, P.; Bouchardy, C.; Breskvar, K.; Brockmoller, J.; Cascorbi, I.; Clapper, M.L.; Coutelle, C.; Daly, A.; Dell'Omo, M.; Dolzan, V.; Dresler, C.M.; Fryer, A.; Haugen, A.; Hein, D.W.; Hildesheim, A.; Hirvonen, A.; Hsieh, L.L.; Ingelman-Sundberg, M.; Kalina, I.; Kang, D.; Kihara, M.; Kiyohara, C.; Kremers, P.; Lazarus, P.; Marchand, L. le; Lechner, M.C.; Lieshout, E.M.M. van; London, S.; Manni, J.J.; Maugard, C.M.; Morita, S.; Nazar-Stewart, V.; Noda, K.; Oda, Y.; Parl, F.F.; Pastorelli, R.; Persson, I.; Peters, W.H.M.; Rannug, A.; Rebbeck, T.R.; Risch, A.; Roelandt, L.; Romkes, M.; Ryberg, D.; Salagovic, J.; Schoket, B.; Seidegard, J.; Shields, P.G.; Sim, E.; Sinnet, D.; Strange, R.C.; Stucker, I.; Sugimura, H.; To-Figueras, J.; Vineis, P.; Yu, M.C.; Taioli, E.

    2001-01-01

    Using the International Project on Genetic Susceptibility to Environmental Carcinogens (GSEC) database containing information on over 15,000 control (noncancer) subjects, the allele and genotype frequencies for many of the more commonly studied metabolic genes (CYP1A1, CYP2E1, CYP2D6, GSTM1, GSTT1,

  11. Genetic polymorphism in FOXP3 gene

    Indian Academy of Sciences (India)

    The FOXP3 gene encodes a transcription factor thought to be important for the development and function of regulatory T cells (Treg cells). These cells are involved in the regulation of T cell activation and therefore are essential for normal immune homeostasis. Signals from microenvironment have a profound influence on ...

  12. Polymorphism of exon 3 of the HLA-G gene

    DEFF Research Database (Denmark)

    Hviid, T V; Meldgaard, Michael; Sørensen, S

    1997-01-01

    rate of embryos. HLA-G seems to play an important role in the feto-maternal relationship. The polymorphism of the HLA-G locus is not fully clarified. One study has shown extensive nucleotide sequence variation in the exon 3 (alpha-2 domain) in healthy African Americans. A few studies in other...... populations have only revealed a limited polymorphism. We investigated the polymorphism of the exon 3 of HLA-G by means of Polymerase Chain Reaction (PCR)-Single Strand Conformation Polymorphism (SSCP)- and DNA sequencing analysis in a Danish population. We detected four single-base substitutions in exon 3...... compared to the sequence of HLA-6.0 (G*01011); one of these has not been reported before. We also found a deletion of the first base of codon 130 or the third of codon 129 in a heterozygous individual. This study, together with previous results, suggests that the polymorphism of exon 3 of the HLA-G gene...

  13. Polymorphism of exon 3 of the HLA-G gene

    DEFF Research Database (Denmark)

    Hviid, T V; Meldgaard, Michael; Sørensen, S

    1997-01-01

    populations have only revealed a limited polymorphism. We investigated the polymorphism of the exon 3 of HLA-G by means of Polymerase Chain Reaction (PCR)-Single Strand Conformation Polymorphism (SSCP)- and DNA sequencing analysis in a Danish population. We detected four single-base substitutions in exon 3...... compared to the sequence of HLA-6.0 (G*01011); one of these has not been reported before. We also found a deletion of the first base of codon 130 or the third of codon 129 in a heterozygous individual. This study, together with previous results, suggests that the polymorphism of exon 3 of the HLA-G gene...... rate of embryos. HLA-G seems to play an important role in the feto-maternal relationship. The polymorphism of the HLA-G locus is not fully clarified. One study has shown extensive nucleotide sequence variation in the exon 3 (alpha-2 domain) in healthy African Americans. A few studies in other...

  14. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  16. Polymorphism in ABC transporter genes of Dirofilaria immitis

    Directory of Open Access Journals (Sweden)

    Thangadurai Mani

    2017-08-01

    Full Text Available Dirofilaria immitis, a filarial nematode, causes dirofilariasis in dogs, cats and occasionally in humans. Prevention of the disease has been mainly by monthly use of the macrocyclic lactone (ML endectocides during the mosquito transmission season. Recently, ML resistance has been confirmed in D. immitis and therefore, there is a need to find new classes of anthelmintics. One of the mechanisms associated with ML resistance in nematodes has been the possible role of ATP binding cassette (ABC transporters in reducing drug concentrations at receptor sites. ABC transporters, mainly from sub-families B, C and G, may contribute to multidrug resistance (MDR by active efflux of drugs out of the cell. Gene products of ABC transporters may thus serve as the targets for agents that may modulate susceptibility to drugs, by inhibiting drug transport. ABC transporters are believed to be involved in a variety of physiological functions critical to the parasite, such as sterol transport, and therefore may also serve as the target for drugs that can act as anthelmintics on their own. Knowledge of polymorphism in these ABC transporter genes in nematode parasites could provide useful information for the process of drug design. We have identified 15 ABC transporter genes from sub-families A, B, C and G, in D. immitis, by comparative genomic approaches and analyzed them for polymorphism. Whole genome sequencing data from four ML susceptible (SUS and four loss of efficacy (LOE pooled populations were used for single nucleotide polymorphism (SNP genotyping. Out of 231 SNPs identified in those 15 ABC transporter genes, 89 and 75 of them were specific to the SUS or LOE populations, respectively. A few of the SNPs identified may affect gene expression, protein function, substrate specificity or resistance development and may be useful for transporter inhibitor/anthelmintic drug design, or in order to anticipate resistance development. Keywords: Dirofilaria immitis

  17. Osteocalcin gene polymorphism and bone density in Hungarian athletes.

    Science.gov (United States)

    Bosnyák, Edit; Trájer, Emese; Protzner, Anna; Komka, Zsolt; Györe, István; Szmodis, Márta; Tóth, Miklós

    Osteoporosis, a public health problem, is mainly determined on the basis of bone mineral density (BMD). The rs1800247 polymorphism of the osteocalcin gene is associated with BMD. The results of one recent Polish study led us to the examination of a possible connection between polymorphism and bone ultrasound parameters in the Hungarian population, including elite athletes. A total of 302 subjects participated in the study. Genotype analysis was carried out via a DNA chip, and anthropometric measurements were taken according to the International Biological Program. Sixty-three (63) of the participants were also measured by ultrasound bone densitometer. The genotype frequencies of osteocalcin polymorphism in the total sample were: 59.9% for hh; 36.1% for Hh; and 3.97% for HH. We separated the 63 subjects by the presence or absence of H allele, and there were no significant differences between the two groups, either in the anthropometric, or in the ultrasound parameters. In grouping the sample by genotypes, no differences were detectable in any of the bone characteristics. Compared to the controls, athletes had significantly higher results in all of the bone ultrasound values. The polymorphism of the osteocalcin gene showed no effect on bone quantity in the examined Hungarian population.

  18. Association of GH Gene Polymorphism with Semen Parameters of Boars

    Directory of Open Access Journals (Sweden)

    M. Kmieć

    2007-01-01

    Full Text Available Relations between polymorphism of the Growth Hormone gene and semen characters were analyzed. The DNA for the purpose of examination was isolated from the peripheral blood of 173 boars. In the boar herd under study the frequency of allele occurrence for the GH/MspI was as follows: allele GHA - 0.79 and allele GHB - 0.21. As far as the GH/HaeII polymorphism is concerned, the relevant frequency was as follows: allele GHA - 0.53 and allele GHB - 0.47, respectively. The relationship between the GH genotypes and semen characteristic traits were analyzed. The study showed that boars with GHBGHB genotype of both polymorphous loci of the GH gene produced ejaculates of larger volume, higher percentage, number of normozosperms in the ejaculate and number of insemination as compared to GHA GHA and GHAGHB boars. Our current findings suggested that polymorphism of the GH/MspI and GH/HaeII might have potential effect for reproductive performance traits of boars.

  19. Automating gene library synthesis by structure-based combinatorial protein engineering: examples from plant sesquiterpene synthases.

    Science.gov (United States)

    Dokarry, Melissa; Laurendon, Caroline; O'Maille, Paul E

    2012-01-01

    Structure-based combinatorial protein engineering (SCOPE) is a homology-independent recombination method to create multiple crossover gene libraries by assembling defined combinations of structural elements ranging from single mutations to domains of protein structure. SCOPE was originally inspired by DNA shuffling, which mimics recombination during meiosis, where mutations from parental genes are "shuffled" to create novel combinations in the resulting progeny. DNA shuffling utilizes sequence identity between parental genes to mediate template-switching events (the annealing and extension of one parental gene fragment on another) in PCR reassembly reactions to generate crossovers and hence recombination between parental genes. In light of the conservation of protein structure and degeneracy of sequence, SCOPE was developed to enable the "shuffling" of distantly related genes with no requirement for sequence identity. The central principle involves the use of oligonucleotides to encode for crossover regions to choreograph template-switching events during PCR assembly of gene fragments to create chimeric genes. This approach was initially developed to create libraries of hybrid DNA polymerases from distantly related parents, and later developed to create a combinatorial mutant library of sesquiterpene synthases to explore the catalytic landscapes underlying the functional divergence of related enzymes. This chapter presents a simplified protocol of SCOPE that can be integrated with different mutagenesis techniques and is suitable for automation by liquid-handling robots. Two examples are presented to illustrate the application of SCOPE to create gene libraries using plant sesquiterpene synthases as the model system. In the first example, we outline how to create an active-site library as a series of complex mixtures of diverse mutants. In the second example, we outline how to create a focused library as an array of individual clones to distil minimal combinations of

  20. Surfactant gene polymorphisms and interstitial lung diseases

    Directory of Open Access Journals (Sweden)

    Pantelidis Panagiotis

    2001-11-01

    Full Text Available Abstract Pulmonary surfactant is a complex mixture of phospholipids and proteins, which is present in the alveolar lining fluid and is essential for normal lung function. Alterations in surfactant composition have been reported in several interstitial lung diseases (ILDs. Furthermore, a mutation in the surfactant protein C gene that results in complete absence of the protein has been shown to be associated with familial ILD. The role of surfactant in lung disease is therefore drawing increasing attention following the elucidation of the genetic basis underlying its surface expression and the proof of surfactant abnormalities in ILD.

  1. Effects of paraoxonase 1 gene polymorphisms on heart diseases

    Science.gov (United States)

    Hernández-Díaz, Yazmín; Tovilla-Zárate, Carlos Alfonso; Juárez-Rojop, Isela Esther; González-Castro, Thelma Beatriz; Rodríguez-Pérez, Candelario; López-Narváez, María Lilia; Rodríguez-Pérez, José Manuel; Cámara-Álvarez, José Francisco

    2016-01-01

    Abstract Background: Associations between paraoxonase 1 (PON1) gene polymorphisms and heart diseases (HD) risk remain inconsistent. In order to obtain address this issue we performed a meta-analysis to assess the association between the L55M and Q192R polymorphisms of PON1 gene and heart diseases risk. Methods: Relevant studies were enrolled by searching databases systematically. Odds ratios (ORs) with 95% confidence intervals (CIs) were used to calculate the strength of association. Subgroup analyses were conducted for diagnostic and ethnicity. The heterogeneity among each of the studies was calculated by using Cochran Qtest and the inconsistency index (I2), and Begg's funnel plot and Egger's tests were performed to evaluate publication bias. Result: Sixty four studies involving a total of 19,715 cases and 33,397 controls were included in this meta-analysis. We found that the L55M polymorphism showed a significant association with heart diseases in Europeans (OR 1.44, 95%CI 1.33–1.56) and Asians (OR 1.18, 95%CI 1.03–1.35). This meta-analysis also showed a protective association of Q192R polymorphism with HD in Asian (OR 0.49, 95%CI 0.37–0.66) and African populations (OR 0.67, 95%CI 0.53–0.84). The 192R allele significantly decreased the risk of myocardial infarction (OR 0.75, 95%CI 0.57–0.99) and coronary artery disease (OR 0.91, 95%CI 0.84–0.98); however, individuals with 192Q allele had a markedly increased risk of coronary artery disease development (OR 1.38, 95%CI 1.22–1.56). Conclusion: This study demonstrated that the genetic risk for heart diseases is associated with the PON1 gene polymorphisms. L55M polymorphism is a risk factor and Q192R polymorphism is protective in certain populations. It is worth noting that the 192Q allele may be a risk factor to develop coronary artery disease. PMID:27858903

  2. Yr10 gene polymorphism in bread wheat varieties | Temel | African ...

    African Journals Online (AJOL)

    Yr10 gene polymorphism in bread wheat varieties. A Temel, F Sentürk-Akfirat, F Ertugrul, A Yumurtaci, Y Aydýn, T Talas-Ogras, N Gözükirmizi, N Bolat, Ö Yorgancilar, S Belen, M Yildirim, M Çakmak, E Özdemir, L Çetin, Z Mert, H Sipahi, S Albustan, K Akan, F Düsünceli, AA Uncuoglu3 ...

  3. Nuclear Gene Indicates Coat-Color Polymorphism in Mammoths

    DEFF Research Database (Denmark)

    Römpler, Holger; Rohland, Nadin; Lalueza-Fox, Carles

    2006-01-01

    By amplifying the melanocortin type 1 receptor from the woolly mammoth, we can report the complete nucleotide sequence of a nuclear-encoded gene from an extinct species. We found two alleles and show that one allele produces a functional protein whereas the other one encodes a protein with strong...... reduced activity. This finding suggests that mammoths may have been polymorphic in coat color, with both dark- and light-haired individuals co-occurring....

  4. AT1 Receptor Gene Polymorphisms in relation to Postprandial Lipemia

    Directory of Open Access Journals (Sweden)

    B. Klop

    2012-01-01

    Full Text Available Background. Recent data suggest that the renin-angiotensin system may be involved in triglyceride (TG metabolism. We explored the effect of the common A1166C and C573T polymorphisms of the angiotensin II type 1 receptor (AT1R gene on postprandial lipemia. Methods. Eighty-two subjects measured daytime capillary TG, and postprandial lipemia was estimated as incremental area under the TG curve. The C573T and A1166C polymorphisms of the AT1R gene were determined. Results. Postprandial lipemia was significantly higher in homozygous carriers of the 1166-C allele (9.39±8.36 mM*h/L compared to homozygous carriers of the 1166-A allele (2.02±6.20 mM*h/L (P<0.05. Postprandial lipemia was similar for the different C573T polymorphisms. Conclusion. The 1166-C allele of the AT1R gene seems to be associated with increased postprandial lipemia. These data confirm the earlier described relationships between the renin-angiotensin axis and triglyceride metabolism.

  5. A novel polymorphism of resistin gene and its association with meat ...

    African Journals Online (AJOL)

    Searching for candidate gene polymorphisms and their relationship with meat quality traits is an important issue for Bos taurus industry. In this study, we evaluated polymorphism of resistin (RETN) gene involved in energy metabolism. Using the polymerase chain reaction-single strand conformation polymorphism ...

  6. The phytochelatin synthase gene in date palm (Phoenix dactylifera L.): Phylogeny, evolution and expression.

    Science.gov (United States)

    Zayneb, Chaâbene; Imen, Rekik Hakim; Walid, Kriaa; Grubb, C Douglas; Bassem, Khemakhem; Franck, Vandenbulcke; Hafedh, Mejdoub; Amine, Elleuch

    2017-06-01

    We studied date palm phytochelatin synthase type I (PdPCS1), which catalyzes the cytosolic synthesis of phytochelatins (PCs), a heavy metal binding protein, in plant cells. The gene encoding PdPCS1 (Pdpcs) consists of 8 exons and 7 introns and encodes a protein of 528 amino acids. PCs gene history was studied using Notung phylogeny. During evolution, gene loss from several lineages was predicted including Proteobacteria, Bilateria and Brassicaceae. In addition, eleven gene duplication events appeared toward interior nodes of the reconciled tree and four gene duplication events appeared toward the external nodes. These latter sequences belong to species with a second copy of PCs suggesting that this gene evolved through subfunctionalization. Pdpcs1 gene expression was measured in seedling hypocotyls exposed to Cd, Cu and Cr using quantitative real-time polymerase chain reaction (qPCR). A Pdpcs1 overexpression was evidenced in P. dactylifera seedlings exposed to metals suggesting that 1-the Pdpcs1 gene is functional, 2-there is an implication of the enzyme in metal detoxification mechanisms. Additionally, the structure of PdPCS1 was predicted using its homologue from Nostoc (cyanobacterium, NsPCS) as a template in Discovery studio and PyMol software. These analyses allowed us to identify the phytochelatin synthase type I enzyme in date palm (PdPCS1) via recognition of key consensus amino acids involved in the catalytic mechanism, and to propose a hypothetical binding and catalytic site for an additional substrate binding cavity. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Malassezia Yeast and Cytokine Gene Polymorphism in Atopic Dermatitis

    Science.gov (United States)

    Das, Shukla; Ramachandran, V.G.; Saha, Rumpa; Bhattacharya, S.N.; Dar, Sajad

    2017-01-01

    Introduction Atopic Dermatitis (AD) is a recurrent chronic condition associated with microorganism and their interaction with the susceptible host. Malassezia yeast is a known commensal which is thought to provoke the recurrent episodes of symptoms in atopic dermatitis patients. Malassezia immunomodulatory properties along with defective skin barrier in such host, results in disease manifestation. Here, we studied Single Nucleotide Polymorphism (SNP) in IL10 and IFN γ genes of the host and its relation with susceptibility to Malassezia infection. Aim To isolate Malassezia yeast from AD patients and compare the genetic susceptibility of the host by correlating the cytokine gene polymorphism with the control subjects. Materials and Methods Study was conducted from January 2012 to January 2013. It was a prospective observational study done in Department of Microbiology and Department of Dermatology and Venereology in University College of Medical Sciences and GTB Hospital, Delhi. Sample size comprised of 38 cases each of AD. Skin scrapings were used for fungal culture on Sabouraud Dextrose Agar (SDA) and Modified Dixon Agar (MDA) and isolated were identified as per conventional phenotypic methods. Genomic DNA was extracted from blood samples collected from all study subjects. Cytokine genotyping was carried out by Amplification Refractory Mutations System- Polymerase Chain Reaction (ARMS-PCR) with sequence specific primers. Three SNPs (IL10-1082A/G; IL10-819/592C/T; IFN-γ+874A/T) in two cytokine genes were assessed in all the patients and healthy controls. Statistical Analysis Chi-Square Test or Fisher’s-Exact Test and Bonferroni’s correction. Results In AD group, Malassezia yeasts were cultured in 24 out of 38 samples and thus the identification rate was 63.1 percent as compared to healthy group, 52.6 percent (20/38). Significant difference in allele, or genotype distribution were observed in IL10-819/592C/T and IFN-γ+874A/T gene polymorphism in AD group

  8. Effects of Growth Hormone Gene Polymorphism on Lipogenic Gene Expression Levels in Diaphragm Tissues of Japanese Black Heifers

    Directory of Open Access Journals (Sweden)

    Astrid Ardiyanti

    2012-08-01

    Full Text Available Two SNPs, i.e. L127V and T172M, of bovine growth hormone (GH causing the presence of GH gene haplotypes A, B, and C was previously shown to alter intramuscular fatty acid (FA composition in Japanese Black (JB heifers. To determine the SNP effect on somatotropic hormone concentration and lipogenesis, we measured plasma GH, insulin, and insulin-like growth factor-1 (IGF-1 concentrations. We also measured mRNA levels of fatty acid synthase (FASN, stearoyl-coA desaturase (SCD, and sterol regulatory element binding proteins-1 (SREBP-1 and FA composition in diaphragm tissues. Heifers with genotype CC had the lowest plasma insulin concentration and FASN and SCD mRNA levels among genotypes. FASN mRNA levels in haplotype A tended to positively correlate with saturated FA (SFA content and negatively correlated with C18:2 and unsaturated FA (USFA contents. SCD mRNA levels in haplotype A positively correlated with monounsaturated FA (MUFA contents and negatively correlated with C18:0 content. They also tended to positively correlate with C16:1, C18:1, and USFA contents and USFA/SFA ratio and negatively correlate with SFA content. Taken together, GH gene polymorphism affects the lipogenic genes expression levels and their relationships with fatty acid compositions in diaphragm tissues of JB heifers at 31 months of age.

  9. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  10. Interleukin 18 receptor 1 gene polymorphisms are associated with asthma

    DEFF Research Database (Denmark)

    Zhu, Guohua; Whyte, Moira K B; Vestbo, Jørgen

    2008-01-01

    by genotyping seven SNPs in 294, 342 and 100 families from Denmark, United Kingdom and Norway and conducting family-based association analyses for asthma, atopic asthma and bronchial hyper-reactivity (BHR) phenotypes. Three SNPs in IL18R1 were associated with asthma (0.01131 ...The interleukin 18 receptor (IL18R1) gene is a strong candidate gene for asthma. It has been implicated in the pathophysiology of asthma and maps to an asthma susceptibility locus on chromosome 2q12. The possibility of association between polymorphisms in IL18R1 and asthma was examined...... with atopic asthma (0.00066 asthma (0.00397

  11. Estrogenic receptors a and p gene polymorphisms in postmenopausal osteoporosis

    Directory of Open Access Journals (Sweden)

    K A Maslova

    2008-01-01

    Full Text Available Objective. To assess frequency distribution of estrogenic receptor (ERa and ERfl gene polymorphisms and their influence on bone mineral density (BMD in groups of postmenopausal women with and without osteoporosis (OP. Material and methods. 200 residents of Moscow and Moscow region were divided into two groups considering BMD values according to WHO criteria; OP group and healthy control group Results. Differences of genotype and their combinations frequency distribution between OP and control groups show presence OP risk and protector genotypes. ER gene important role in pathogenesis of postmenopausal osteoporosis and possibility to use these genetic markers for assessment of risk of OP development in Russian population was confirmed.

  12. Do polymorphisms in chemosensory genes matter for human ingestive behavior?

    Science.gov (United States)

    Hayes, John E; Feeney, Emma L; Allen, Alissa L

    2013-12-01

    In the last decade, basic research in chemoreceptor genetics and neurobiology have revolutionized our understanding of individual differences in chemosensation. From an evolutionary perspective, chemosensory variations appear to have arisen in response to different living environments, generally in the avoidance of toxins and to better detect vital food sources. Today, it is often assumed that these differences may drive variable food preferences and choices, with downstream effects on health and wellness. A growing body of evidence indicates chemosensory variation is far more complex than previously believed. However, just because a genetic polymorphism results in altered receptor function in cultured cells or even behavioral phenotypes in the laboratory, this variation may not be sufficient to influence food choice in free living humans. Still, there is ample evidence to indicate allelic variation in TAS2R38 predicts variation in bitterness of synthetic pharmaceuticals (e.g., propylthiouracil) and natural plant compounds (e.g., goitrin), and this variation associates with differential intake of alcohol and vegetables. Further, this is only one of 25 unique bitter taste genes ( TAS2Rs ) in humans, and emerging evidence suggests other TAS2Rs may also contain polymorphisms that a functional with respect to ingestive behavior. For example, TAS2R16 polymorphisms are linked to the bitterness of naturally occurring plant compounds and alcoholic beverage intake, a TAS2R19 polymorphism predicts differences in quinine bitterness and grapefruit bitterness and liking, and TAS2R31 polymorphisms associate with differential bitterness of plant compounds like aristolochic acid and the sulfonyl amide sweeteners saccharin and acesulfame-K. More critically with respect to food choices, these polymorphisms may vary independently from each other within and across individuals, meaning a monolithic one-size-fits-all approach to bitterness needs to be abandoned. Nor are genetic

  13. MSTN gene polymorphism in livestock animals

    Directory of Open Access Journals (Sweden)

    Monika Stefaniuk

    2014-05-01

    Full Text Available Myostatin, also known as GDF8 (growth differentiation factor 8, belongs to one of the biggest groups of proteins, called transforming growth factors (TGF-β. The protein regulates embryonic development and maintains homeostasis of full-grown individuals. When the process of maturation is over, GDF8 becomes a negative regulator of skeletal muscle growth.The physiological role of myostatin is to prevent overgrowth of muscle tissue in various stages of organism development. It also inhibits the regeneration of skeletal muscles by weakening activation and proliferation of satellite cells and the migration of macrophages and myoblasts to the site of injury. Several mutations within the sequence of MSTN have been described; they may affect the activity of the protein in the tissues, and hence the level of the functional characteristics of the animals, which determine the value of breeding animals. Understanding the impact of individual mutations in the gene encoding the protein is particularly important in relation to production traits of livestock.

  14. Cytokine Gene Polymorphisms in Egyptian Cases with Brain Tumors

    International Nuclear Information System (INIS)

    Badr El-Din, N.K.; Abdel-Hady, E.K.; Salem, F.K.; Settin, A.; ALI, N.

    2009-01-01

    Background: Cytokines are proposed to play important roles in brain tumor biology as well as neuro degeneration or impaired neuronal function. Objectives: This work aimed to check the association of polymorphisms of cytokine genes in Egyptian cases with brain tumors. Methods: This work included 45 cases affected by brain tumors diagnosed as 24 benign and 21 malignant. Their median age was 45 years, and they were 20 males and 25 females. These cases were taken randomly from the Neurosurgery Department of Mansoura University Hospital, Egypt. Case genotypes were compared to 98 healthy unrelated controls from the same locality. DNA was amplified using PCR utilizing sequence specific primers (SSP) for detection of polymorphisms related to TNF-a-308 (G/A), IL-10-1082 (G/A), IL-6-174 (G/C) and IL-1Ra (VNTR) genes. Results: Cases affected with benign brain tumors showed a significant higher frequency of IL-10-1082 A/A [odds ratio (OR=8.0), p<0.001] and IL-6-174 C/C (OR=6.3, p=0.002) homozygous genotypes as compared to controls. Malignant cases, on the other hand, showed significantly higher frequency of IL-6-174 C/C (OR =4.8, p=0.002) homozygous genotype and TNF-a-308 A/A (OR=4.9, p<0.001) homozygous genotype when compared to controls. In the meantime, all cases showed no significant difference regarding the distribution of IL-1Ra VNTR genotype polymorphism compared to controls. Conclusions: Cytokine gene polymorphisms showed a pattern of association with brain tumors which may have potential impact on family counseling and disease management.

  15. Polymorphism in ABC transporter genes of Dirofilaria immitis.

    Science.gov (United States)

    Mani, Thangadurai; Bourguinat, Catherine; Prichard, Roger K

    2017-08-01

    Dirofilaria immitis, a filarial nematode, causes dirofilariasis in dogs, cats and occasionally in humans. Prevention of the disease has been mainly by monthly use of the macrocyclic lactone (ML) endectocides during the mosquito transmission season. Recently, ML resistance has been confirmed in D. immitis and therefore, there is a need to find new classes of anthelmintics. One of the mechanisms associated with ML resistance in nematodes has been the possible role of ATP binding cassette (ABC) transporters in reducing drug concentrations at receptor sites. ABC transporters, mainly from sub-families B, C and G, may contribute to multidrug resistance (MDR) by active efflux of drugs out of the cell. Gene products of ABC transporters may thus serve as the targets for agents that may modulate susceptibility to drugs, by inhibiting drug transport. ABC transporters are believed to be involved in a variety of physiological functions critical to the parasite, such as sterol transport, and therefore may also serve as the target for drugs that can act as anthelmintics on their own. Knowledge of polymorphism in these ABC transporter genes in nematode parasites could provide useful information for the process of drug design. We have identified 15 ABC transporter genes from sub-families A, B, C and G, in D. immitis, by comparative genomic approaches and analyzed them for polymorphism. Whole genome sequencing data from four ML susceptible (SUS) and four loss of efficacy (LOE) pooled populations were used for single nucleotide polymorphism (SNP) genotyping. Out of 231 SNPs identified in those 15 ABC transporter genes, 89 and 75 of them were specific to the SUS or LOE populations, respectively. A few of the SNPs identified may affect gene expression, protein function, substrate specificity or resistance development and may be useful for transporter inhibitor/anthelmintic drug design, or in order to anticipate resistance development. Copyright © 2017 The Authors. Published by

  16. Quick guide to polyketide synthase and nonribosomal synthetase genes in Fusarium

    DEFF Research Database (Denmark)

    Hansen, Jørgen T.; Sørensen, Jens L.; Giese, Henriette

    2012-01-01

    for future polyketide synthases (PKSs) and nonribosomal peptides synthetases (NRPSs) nomenclature assignment and classification. Sequence similarities of the adenylation and ketosynthase domain sequences were used to group the identified NRPS and PKS genes. We present the current state of knowledge of PKS......Fusarium species produce a plethora of bioactive polyketides and nonribosomal peptides that give rise to health problems in animals and may have drug development potential. Using the genome sequences for Fusarium graminearum, F. oxysporum, F. solani and F. verticillioides we developed a framework...

  17. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  18. Characterization of Squalene synthase gene from Chlorophytum borivilianum (Sant. and Fernand.).

    Science.gov (United States)

    Kalra, Shikha; Kumar, Sunil; Lakhanpal, Neha; Kaur, Jagdeep; Singh, Kashmir

    2013-07-01

    Saponins are important group of secondary metabolites known for their pharmacological properties. Chlorophytum borivilianum contains high amount of saponins and is thus, recognized as an important medicinal plant with aphrodisiac properties. Though the plant is well known for its pharmaceutical properties, there is meager information available about the genes and enzymes responsible for biosynthesis of saponins from this plant. Squalene synthase (SqS) is the key enzyme of saponin biosynthesis pathway and here, we report cloning and characterization of SqS gene from C. borivilianum. A full-length CbSqS cDNA consisting of 1,760 bp was cloned which contained an open reading frame (ORF) of 1,233 bp, encoding a protein of 411 amino acids. Analysis of deduced amino acid sequence of CbSqS predicted the presence of conserved isoprenoid family domain and catalytic sites. Phylogenetic analysis revealed that CbSqS is closer to Glycine max and monocotyledonous plants. 3D structure prediction using various programs showed CbSqS structure to be similar to SqS from other species. C-terminus truncated recombinant squalene synthase (TruncCbSqS) was expressed in E. coli M15 cells with optimum expression induced with 1 mM IPTG at 37 °C. The gene expression level was analyzed through semi-quantitative RT-PCR and was found to be higher in leaves as compared to the roots.

  19. Genome and transcriptome-wide analyses of cellulose synthase gene superfamily in soybean.

    Science.gov (United States)

    Nawaz, Muhammad Amjad; Rehman, Hafiz Mamoon; Baloch, Faheem Shehzad; Ijaz, Babar; Ali, Muhammad Amjad; Khan, Iqrar Ahmad; Lee, Jeong Dong; Chung, Gyuhwa; Yang, Seung Hwan

    2017-08-01

    The plant cellulose synthase gene superfamily belongs to the category of type-2 glycosyltransferases, and is involved in cellulose and hemicellulose biosynthesis. These enzymes are vital for maintaining cell-wall structural integrity throughout plant life. Here, we identified 78 putative cellulose synthases (CS) in the soybean genome. Phylogenetic analysis against 40 reference Arabidopsis CS genes clustered soybean CSs into seven major groups (CESA, CSL A, B, C, D, E and G), located on 19 chromosomes (except chromosome 18). Soybean CS expansion occurred in 66 duplication events. Additionally, we identified 95 simple sequence repeat makers related to 44 CSs. We next performed digital expression analysis using publically available datasets to understand potential CS functions in soybean. We found that CSs were highly expressed during soybean seed development, a pattern confirmed with an Affymatrix soybean IVT array and validated with RNA-seq profiles. Within CS groups, CESAs had higher relative expression than CSLs. Soybean CS models were designed based on maximum average RPKM values. Gene co-expression networks were developed to explore which CSs could work together in soybean. Finally, RT-PCR analysis confirmed the expression of 15 selected CSs during all four seed developmental stages. Copyright © 2017 Elsevier GmbH. All rights reserved.

  20. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    Science.gov (United States)

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed actinomycetes to produce bioactive molecules.

  1. Atlantic cod (Gadus morhua hemoglobin genes: multiplicity and polymorphism

    Directory of Open Access Journals (Sweden)

    Gamperl A Kurt

    2009-09-01

    Full Text Available Abstract Background Hemoglobin (Hb polymorphism, assessed by protein gel electrophoresis, has been used almost exclusively to characterize the genetic structure of Atlantic cod (Gadus morhua populations and to establish correlations with phenotypic traits such as Hb oxygen binding capacity, temperature tolerance and growth characteristics. The genetic system used to explain the results of gel electrophoresis entails the presence of one polymorphic locus with two major alleles (HbI-1; HbI-2. However, vertebrates have more than one gene encoding Hbs and recent studies have reported that more than one Hb gene is present in Atlantic cod. These observations prompted us to re-evaluate the number of Hb genes expressed in Atlantic cod, and to perform an in depth search for polymorphisms that might produce relevant phenotypes for breeding programs. Results Analysis of Expressed Sequence Tags (ESTs led to the identification of nine distinct Hb transcripts; four corresponding to the α Hb gene family and five to the β Hb gene family. To gain insights about the Hb genes encoding these transcripts, genomic sequence data was generated from heterozygous (HbI-1/2 parents and fifteen progeny; five of each HbI type, i.e., HbI-1/1, HbI-1/2 and HbI-2/2. β Hb genes displayed more polymorphism than α Hb genes. Two major allele types (β1A and β1B that differ by two linked non-synonymous substitutions (Met55Val and Lys62Ala were found in the β1 Hb gene, and the distribution of these β1A and β1B alleles among individuals was congruent with that of the HbI-1 and HbI-2 alleles determined by protein gel electrophoresis. RT-PCR and Q-PCR analysis of the nine Hb genes indicates that all genes are expressed in adult fish, but their level of expression varies greatly; higher expression of almost all Hb genes was found in individuals displaying the HbI-2/2 electrophoretic type. Conclusion This study indicates that more Hb genes are present and expressed in adult

  2. Transcriptional modulation of squalene synthase genes in barley treated with PGPR

    Science.gov (United States)

    Yousaf, Anam; Qadir, Abdul; Anjum, Tehmina; Ahmad, Aqeel

    2015-01-01

    Phytosterol contents and food quality of plant produce is directly associated with transcription of gene squalene synthase (SS). In current study, barley plants were treated with different rhizobacterial strains under semi controlled (27 ± 3°C) greenhouse conditions in order to modulate expression of SS gene. Plant samples were analyzed through semi-quantitative PCR to evaluate effect of rhizobacterial application on transcriptional status of SS. Results revealed that among four SS genes (i.e., SSA, SS1, SS2, and SS3), the most expressive gene was SSA; while, SS2 was screened out as the second best induced gene due to Acetobacter aceti. The most efficient bacterial strain which recorded maximum gene expression was A. aceti AC8. Moreover, AC7 was reported as the least efficient bacterial species for inducing SS gene expression. AC8 enhanced the share of SSA and SS2 up to 43 and 31%, respectively. The study also described ribosomal sequence of the most efficient bacterial strain AC8, which was used to determine its phylogenetic relationships with other microbial strains. The study would be helpful to improve quality of plant produce by modulating transcription of SS genes. PMID:26388880

  3. Functional Analysis of the Brassica napus L. Phytoene Synthase (PSY) Gene Family

    Science.gov (United States)

    López-Emparán, Ada; Quezada-Martinez, Daniela; Zúñiga-Bustos, Matías; Cifuentes, Víctor; Iñiguez-Luy, Federico; Federico, María Laura

    2014-01-01

    Phytoene synthase (PSY) has been shown to catalyze the first committed and rate-limiting step of carotenogenesis in several crop species, including Brassica napus L. Due to its pivotal role, PSY has been a prime target for breeding and metabolic engineering the carotenoid content of seeds, tubers, fruits and flowers. In Arabidopsis thaliana, PSY is encoded by a single copy gene but small PSY gene families have been described in monocot and dicotyledonous species. We have recently shown that PSY genes have been retained in a triplicated state in the A- and C-Brassica genomes, with each paralogue mapping to syntenic locations in each of the three “Arabidopsis-like” subgenomes. Most importantly, we have shown that in B. napus all six members are expressed, exhibiting overlapping redundancy and signs of subfunctionalization among photosynthetic and non photosynthetic tissues. The question of whether this large PSY family actually encodes six functional enzymes remained to be answered. Therefore, the objectives of this study were to: (i) isolate, characterize and compare the complete protein coding sequences (CDS) of the six B. napus PSY genes; (ii) model their predicted tridimensional enzyme structures; (iii) test their phytoene synthase activity in a heterologous complementation system and (iv) evaluate their individual expression patterns during seed development. This study further confirmed that the six B. napus PSY genes encode proteins with high sequence identity, which have evolved under functional constraint. Structural modeling demonstrated that they share similar tridimensional protein structures with a putative PSY active site. Significantly, all six B. napus PSY enzymes were found to be functional. Taking into account the specific patterns of expression exhibited by these PSY genes during seed development and recent knowledge of PSY suborganellar localization, the selection of transgene candidates for metabolic engineering the carotenoid content of

  4. Gene polymorphisms and sport attitude in Italian athletes.

    Science.gov (United States)

    Sessa, Francesco; Chetta, Massimiliano; Petito, Annamaria; Franzetti, Mauro; Bafunno, Valeria; Pisanelli, Daniela; Sarno, Michelina; Iuso, Salvatore; Margaglione, Maurizio

    2011-04-01

    The aim of this study was to evaluate whether the distribution of polymorphisms in the ACE, ACTN3, NOS3, UCP2, and UCP3 genes, which has been reported to be correlated with different physiological parameters, played a role in sport performance. We focused on a cohort of 82 Italian athletes: first of all, athletes were divided according to type of sport: team (n=72) versus individual (n=10), and subsequently, according to the performance, into "power" sports (n=29; sprinters, short distance swimmers, and volleyball players) and "intermittent" sports (n=53; football, basketball, and hockey players). All the populations studied were in Hardy-Weinberg equilibrium for the following polymorphisms: ACE (I/D), ACTN3 (R577X), NOS3 (-786 T/C), UCP2 (A55V), and UCP3 (-55 C/T). We observed that the frequency of NOS3-786 T and UCP2 C alleles was higher among power athletes compared with controls (p=0.011 and p=0.012, respectively); these alleles were also overrepresented in individual athletes (p=0.02 and p=0.045, respectively), although a small sample was analyzed. The frequency of NOS3 298G allele was higher among power athletes compared with controls (p=0.015); these data remained suggestive after correction for multiple testing. We found a suggestive association between NOS3 (-786 T/C; G298A) and UCP2 (A55V) polymorphisms and power athletes, whereas no significant correlation was found with UCP3 (-55C/T), ACE (I/D), and ACTN3 (R577X) polymorphisms, in contrast to previous studies. Analysis of multiple performance-associated genetic polymorphisms needs further examination to explain the relationship between genetic background and potential success in sport performance.

  5. Polymorphisms in the leptin gene promoter in Brazilian beef herds.

    Science.gov (United States)

    Guimarães, R C; Azevedo, J S N; Corrêa, S C; Campelo, J E G; Barbosa, E M; Gonçalves, E C; Silva Filho, E

    2016-12-02

    Brazil is the world's largest producer of beef cattle; however, the quality of its herds needs to be improved. The use of molecular markers as auxiliary tools in selecting animals for reproduction with high pattern for beef production would significantly improve the quality of the final beef product in Brazil. The leptin gene has been demonstrated to be an excellent candidate gene for bovine breeding. The objective of this study was to sequence and compare the leptin gene promoter of Brazil's important cattle breeds in order to identify polymorphisms in it. Blood samples of the Nellore, Guzerat, Tabapuã, and Senepol breeds were collected for genomic DNA extraction. The genomic DNA was used as a template for polymerase chain reaction (PCR) to amplify a 1575-bp fragment, which in turn was sequenced, aligned, and compared between animals of different breeds. Twenty-three single nucleotide polymorphic sites, including transitions and transversions, were detected at positions -1457, -1452, -1446, -1397, -1392, -1361, -1238, -963,-901, -578, -516, -483, -478, -470, -432, -430, -292, -282, -272, -211, -202, -170, and -147. Additionally, two insertion sites at positions -680 and -416 and two deletion sites at positions -1255 and -1059 were detected. As the promoter region of the leptin gene has been demonstrated to vary among breeds, these variations must be tested for their use as potential molecular markers for artificial selection of animals for enhanced beef production in different systems of bovine production in Brazil.

  6. Glutathione S-transferase gene polymorphisms in presbycusis.

    Science.gov (United States)

    Ateş, Nurcan Aras; Unal, Murat; Tamer, Lülüfer; Derici, Ebru; Karakaş, Sevim; Ercan, Bahadir; Pata, Yavuz Selim; Akbaş, Yücel; Vayisoğlu, Yusuf; Camdeviren, Handan

    2005-05-01

    Glutathione and glutathione-related antioxidant enzymes are involved in the metabolism and detoxification of cytotoxic and carcinogenic compounds as well as reactive oxygen species. Reactive oxygen species generation occurs in prolonged relative hypoperfusion conditions such as in aging. The etiology of presbycusis is much less certain; however, a complex genetic cause is most likely. The effect of aging shows a wide interindividual range; we aimed to investigate whether profiles of (glutathione S-transferase (GST) M1, T1 and P1 genotypes may be associated with the risk of age-related hearing loss. We examined 68 adults with presbycusis and 69 healthy controls. DNA was extracted from whole blood, and the GSTM1, GSTT1 and GSTP1 polymorphisms were determined using a real-time polymerase chain reaction and fluorescence resonance energy transfer with a Light-Cycler Instrument. Associations between specific genotypes and the development of presbycusis were examined by use of logistic regression analyses to calculate odds ratios and 95% confidence intervals. Gene polymorphisms at GSTM1, GSTT1, and GSTP1 in subjects with presbycusis were not significantly different than in the controls (p > 0.05). Also, the combinations of different GSTM1, GSTT1, and GSTP1 genotypes were not an increased risk of presbycusis (p > 0.05). We could not demonstrate any significant association between the GSTM1, GSTT1, and GSTP1 polymorphism and age-related hearing loss in this population. This may be because of our sample size, and further studies need to investigate the exact role of GST gene polymorphisms in the etiopathogenesis of the presbycusis.

  7. Rhesus macaque IFITM3 gene polymorphisms and SIV infection.

    Directory of Open Access Journals (Sweden)

    Michael Winkler

    Full Text Available Interferon-induced transmembrane proteins (IFITMs have been recognized as important antiviral effectors of the innate immune system, both in cell culture and in infected humans. In particular, polymorphisms of the human IFITM3 gene have been shown to affect disease severity and progression in influenza A virus (FLUAV and human immunodeficiency virus (HIV infection, respectively. Rhesus macaques (Macaca mulatta are commonly used to model human infections and the experimental inoculation of these animals with simian immunodeficiency virus (SIV is one of the best models for HIV/AIDS in humans. However, information on the role of IFITM3 in SIV infection of rhesus macaques is currently lacking. We show that rhesus macaque (rh IFITM3 inhibits SIV and FLUAV entry in cell culture, although with moderately reduced efficiency as compared to its human counterpart. We further report the identification of 16 polymorphisms in the rhIFITM3 gene, three of which were exonic and synonymous while the remainder was located in non-coding regions. Employing previously characterized samples from two cohorts of SIV-infected rhesus macaques, we investigated the relationship between these rhIFITM3 polymorphisms and both AIDS-free survival time and virus load. In cohort 1, several intronic polymorphisms were significantly associated with virus load or survival. However, an association with both parameters was not observed and significance was lost in most cases when animals were stratified for the presence of MHC allele Mamu-A1*001. Moreover, no significant genotype-phenotype associations were detected in cohort 2. These results suggest that, although IFITM3 can inhibit SIV infection in cell culture, genetic variation in rhIFITM3 might have only a minor impact on the course of SIV infection in experimentally infected animals.

  8. Polymorphisms in MTHFR, MS and CBS Genes and Homocysteine Levels in a Pakistani Population

    Science.gov (United States)

    Yakub, Mohsin; Moti, Naushad; Parveen, Siddiqa; Chaudhry, Bushra; Azam, Iqbal; Iqbal, Mohammad Perwaiz

    2012-01-01

    Background Hyperhomocysteinemia (>15 µmol/L) is highly prevalent in South Asian populations including Pakistan. In order to investigate the genetic determinants of this condition, we studied 6 polymorphisms in genes of 3 enzymes - methylenetetrahydrofolate reductase (MTHFR; C677T; A1298C), methionine synthase (MS; A2756G), cystathionine-β-synthase (CBS; T833C/844ins68, G919A) involved in homocysteine metabolism and investigated their interactions with nutritional and environmental factors in a Pakistani population. Methodology/Principal Findings In a cross-sectional survey, 872 healthy adults (355 males and 517 females; age 18–60 years) were recruited from a low-income urban population in Karachi. Fasting venous blood was obtained and assessed for plasma/serum homocysteine; folate, vitamin B12, pyridoxal phosphate and blood lead. DNA was isolated and genotyping was performed by PCR-RFLP (restriction-fragment-length- polymorphism) based assays. The average changes in homocysteine levels for MTHFR 677CT and TT genotypes were positive [β(SE β), 2.01(0.63) and 16.19(1.8) µmol/L, respectively]. Contrary to MTHFR C677T polymorphism, the average changes in plasma homocysteine levels for MS 2756AG and GG variants were negative [β(SE β), −0.56(0.58) and −0.83(0.99) µmol/L, respectively]. The average change occurring for CBS 844ins68 heterozygous genotype (ancestral/insertion) was −1.88(0.81) µmol/L. The combined effect of MTHFR C677T, MS A2756G and CBS 844ins68 genotypes for plasma homocysteine levels was additive (p value MTHFR 677TT genotype was 10-fold compared to MTHFR 677CC genotype [OR (95%CI); 10.17(3.6–28.67)]. Protective effect towards hyperhomocysteinemia was observed with heterozygous (ancestral/insertion) genotype of CBS 844ins68 compared to homozygous ancestral type [OR (95% CI); 0.58 (0.34–0.99)]. Individuals with MTHFR 677CT or TT genotypes were at a greater risk of hyperhomocysteinemia in folate and vitamin B12 deficiencies and high

  9. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.

    2007-01-29

    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  10. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Science.gov (United States)

    Wang, Guoliang; Zhao, Ge; Feng, Yanbin; Xuan, Jinsong; Sun, Jianwei; Guo, Baotai; Jiang, Guoyong; Weng, Manli; Yao, Jianting; Wang, Bin; Duan, Delin; Liu, Tao

    2010-01-01

    The full-length cDNA sequence (3219 base pairs) of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS) was isolated by RACE-PCR and deposited in GenBank (NCBI) with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5), whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB). Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI). All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94%) and in amino acid composition (>96%). Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes. PMID:20714424

  11. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  12. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  13. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  14. Association of oxidative stress gene polymorphisms with presbycusis.

    Science.gov (United States)

    Manche, Santoshi Kumari; Jangala, Madhavi; Putta, Padmavathi; Koralla, Raja Meganadh; Akka, Jyothy

    2016-11-30

    Presbycusis is characterised by etiopathological changes in the cochlea of the inner ear due to genetic and environmental factors and has a serious impact on quality of life. The present study was aimed to evaluate the role of oxidant stress gene polymorphisms in the development of presbycusis. 220 subjects with confirmed presbycusis from ENT specialists of MAA ENT hospital, Hyderabad, India from 2012 to 2014 were considered for the study. 270 age and sex matched controls were included in the study. Analysis of gene polymorphisms of SNPs cytochrome P450 1A1 (CYP1A1) 3801 T>C, 2455 A>G and 2453 A>C; glutathione S transferase (GST) T1 and M1; N-acetyl transferase (NAT2) 282 C>T and 857 G>A; uncoupled proteins (UCP1) (-3826) A>G and (UCP2) (866)G>A was carried out. Variations in the allelic and genotypic frequencies obtained were computed and analysed using appropriate statistical methods. The results of the study indicated that CYP1A1 gene polymorphism at 2453 C>A (adjusted OR: 1.59, 95% CI: 1.01-2.87) and 2455 A>G (adjusted OR: 1.87, 95% CI: 1.07-3.37), double null genotype of GSTM1 and GSTT1 (adjusted OR: 8.88, 95% CI: 4.10-19.19), NAT2 gene at C282T (adjusted OR: 1.77, 95% CI: 1.02-3.11) and G590 A (adjusted OR: 1.83, 95% CI 1.20-3.63) and UCP2 (-866) G>A (adjusted OR: 12.39; 95% CI: 6.51-23.56) showed increased risk for presbycusis while CYP1A1 at 3801 T>C and UCP1 (-3286) A>G exhibited no association. The haplotype combinations of T-G-A of CYP1A1 at 3801, 2455 and 2453 positions as well as T-A of NAT2*6 at 282 and 590 positions were found to contribute significant risk for the onset of presbycusis. Gene polymorphisms of CYP1A1 (A2455G, C2453A), NAT2*6 (C282T, G590 A), GST T1/M1 (double null genotype) and UCP2 (G-866 A) were found to contribute significant risk to presbycusis. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. (E)-β-farnesene synthase genes affect aphid (Myzus persicae) infestation in tobacco (Nicotiana tabacum).

    Science.gov (United States)

    Yu, Xiudao; Jones, Huw D; Ma, Youzhi; Wang, Genping; Xu, Zhaoshi; Zhang, Baoming; Zhang, Yongjun; Ren, Guangwei; Pickett, John A; Xia, Lanqin

    2012-03-01

    Aphids are major agricultural pests which cause significant yield losses of the crop plants each year. (E)-β-farnesene (EβF) is the alarm pheromone involved in the chemical communication between aphids and particularly in the avoidance of predation. In the present study, two EβF synthase genes were isolated from sweet wormwood and designated as AaβFS1 and AaβFS2, respectively. Overexpression of AaβFS1 or AaβFS2 in tobacco plants resulted in the emission of EβF ranging from 1.55 to 4.65 ng/day/g fresh tissues. Tritrophic interactions involving the peach aphids (Myzus persicae), predatory lacewings (Chrysopa septempunctata) demonstrated that the transgenic tobacco expressing AaβFS1 and AaβFS2 could repel peach aphids, but not as strongly as expected. However, AaβFS1 and AaβFS2 lines exhibited strong and statistically significant attraction to lacewings. Further experiments combining aphids and lacewing larvae in an octagon arrangement showed transgenic tobacco plants could repel aphids and attract lacewing larvae, thus minimizing aphid infestation. Therefore, we demonstrated a potentially valuable strategy of using EβF synthase genes from sweet wormwood for aphid control in tobacco or other economic important crops in an environmentally benign way.

  16. Polymorphisms in the prion protein gene and in the doppel gene increase susceptibility for Creutzfeldt-Jakob disease

    NARCIS (Netherlands)

    E.A. Croes (Esther); B.Z. Alizadeh (Behrooz); A.M. Bertoli Avella (Aida); T.A.M. Rademaker (Tessa); J. Vergeer-Drop (Jeannette); B. Dermaut (Bart); J.J. Houwing-Duistermaat (Jeanine); D.P.W.M. Wientjens (Dorothee); A. Hofman (Albert); C. van Broeckhoven (Christine); C.M. van Duijn (Cornelia)

    2004-01-01

    textabstractThe prion protein gene (PRNP) plays a central role in the origin of Creutzfeldt-Jakob disease (CJD), but there is growing interest in other polymorphisms that may be involved in CJD. Polymorphisms upstream of PRNP that may modulate the prion protein production as well as polymorphisms in

  17. TNFα gene polymorphisms in the pathogenesis of acne vulgaris.

    Science.gov (United States)

    Szabó, Kornélia; Tax, Gábor; Teodorescu-Brinzeu, Dragos; Koreck, Andrea; Kemény, Lajos

    2011-01-01

    Inflammation plays an important role in acne pathogenesis, and pro-inflammatory cytokines are key factors in these events. Tumor necrosis factor alpha (TNFα) is a central molecule coded by a gene that shows high level of genetic polymorphisms especially in its promoter region. Single nucleotide polymorphisms (SNPs) of the TNFα gene have been shown to be associated with an increased risk to develop chronic inflammatory diseases. In order to find out if known TNFα regulatory SNPs (-1031T>C, -857C>T, -863C>A, -308G>A, -238G>A) have a role in the development of the inflammatory reactions in acne vulgaris, we analyzed our genomic collection in a retrospective case-control study using the PCR-RFLP method, and we compared the resulting genotype and allele frequencies. There were no significant differences in the observed genotype or allele frequencies between the control and acne group in case of the -1031, -863, -238 SNPs; however, the TNFα -857 minor T allele was found to act as a protective factor in our study population in acne, and a higher occurrence of the minor -308 A allele in female acne patients was also noted. Genetic variants of the TNFα gene may affect the risk of acne vulgaris. Our results can help to elucidate the molecular events leading to acne development.

  18. Induction of Malate Synthase Gene Expression in Senescent and Detached Organs of Cucumber.

    Science.gov (United States)

    Graham, IA; Leaver, CJ; Smith, SM

    1992-01-01

    Expression of the malate synthase (MS) gene is activated in cotyledons of cucumber seedlings during postgerminative growth and then repressed as the cotyledons become photosynthetic. MS gene expression is subsequently reactivated in the cotyledons as they senesce a few weeks later. In situ hybridization revealed that MS RNA is distributed throughout the organ during postgerminative growth and senescence, showing that the same cells express the gene at different stages of development. MS RNA also appears in senescing leaves and petals of cucumber plants. In addition, we found that MS RNA appears in mature expanded leaves and roots when they are removed from the plant and incubated in darkness for several days, thus providing a potential experimental system for the manipulation of MS gene expression. Leaves from transgenic Nicotiana plumbaginifolia containing the cucumber MS promoter fused to the [beta]-glucuronidase (GUS) reporter gene accumulated GUS activity when detached, demonstrating an activation of transcription from the MS promoter following leaf excision. These results are discussed in terms of the metabolic regulation of MS gene expression. PMID:12297649

  19. JP-3 gene polymorphism in a healthy population of Serbia and ...

    Indian Academy of Sciences (India)

    Unknown

    Expansions of CTG repeats in JP-3 gene are associated with a phenotype similar to Huntington disease. These expan- sions are the cause of Huntington disease like-2 (HDL-2) phenotype. CTG repeats in JP-3 gene are polymorphic in healthy population. Analyses of CTG repeat polymorphism of JP-3 gene in various ...

  20. Association study between methylenetetrahydrofolate reductase gene polymorphisms and Graves' disease.

    Science.gov (United States)

    Mao, Renfang; Fan, Yihui; Zuo, Lulu; Geng, Dongfeng; Meng, Fantao; Zhu, Jing; Li, Qiang; Qiao, Hong; Jin, Yan; Bai, Jing; Fu, Songbin

    2010-10-01

    5,10-Methylenetetrahydrofolate reductase (MTHFR) catalyzes the metabolism of folate and nucleotides, which are essential for DNA synthesis and methylation. It is highly polymorphic, and its variant genotypes result in lower enzymatic activity and higher plasma homocysteine. Previous studies have provided evidence that a high prevalence of MTHFR gene polymorphisms is frequently detected in patients with autoimmune disease, suggesting a novel genetic association with autoimmune disorders. However, the genetic association between MTHFR and Graves' disease (GD), one of the most common autoimmune diseases, has not been studied. Here, we designed a clinic-based case-control study including 199 GD cases and 235 healthy controls to examine the associations between three common MTHFR polymorphisms (i.e., C677T, A1298C, and G1793A) and GD. Surprisingly, logistic regression analysis shows MTHFR 677CT + TT genotypes are associated with an approximately 42% reduction in the risk of GD in women (adjusted OR = 0.58, 95% CI = 0.3-0.9), compared to the CC genotype, indicating a significant protective effect of 677CT + TT genotypes. Our result provides epidemiological evidence that MTHFR mutation (C677T) protects women from GD. The protective effect, possibly obtained by influencing DNA methylation, should be confirmed in a large number of cohorts. Copyright © 2010 John Wiley & Sons, Ltd.

  1. [Progesterone receptor gene polymorphism and recurrent spontaneous abortion].

    Science.gov (United States)

    Traina, Evelyn; Daher, Silvia; Franchim, Camila Sommerauer; Fuziy, Juliana Aoki; Moron, Antônio Fernandes; Banzato, Priscilla Chamelete Andrade; Mattar, Rosiane

    2010-05-01

    To assess a possible association between polymorphism of the progesterone receptor gene (PROGINS) and recurrent spontaneous abortion (RSA). In this case-control study, 85 women with at least three previous spontaneous abortions without an identifiable cause (RSA Group) and 157 women with at least two previous term pregnancies without pathologies and no previous miscarriage (Control Group) were selected. An amount of 10 mL of peripheral blood was collected by venipuncture and genomic DNA was extracted by the DTAB/CTAB method, followed by the polymerase chain reaction (PCR) under specific conditions for this polymorphism and by amplification by 2% agarose gel electrophoresis. The bands were visualized with an ultraviolet light transilluminator and the gels were photographed. Differences in the PROGINS genotype and allele frequencies between groups were analyzed by the χ² test, with the level of significance set at p<0.05. The Odds Ratio (OR) was also used, with 95% confidence intervals 95%CI. PROGINS genotypic frequencies were 72.3% T1T1 and 27.7% T1T2 for the RSA group and 76.4% T1T1, 22.3% T1T2 and 1.3% T2T2 for the control group. There were no differences between groups when the genotype and allele frequencies were analyzed: respectively p=0.48 (OR: 0.8) and p=0.65 (OR: 0.9). Our results suggest that PROGINS polymorphism is not associated with RSA.

  2. Reactivation of methionine synthase from Thermotoga maritima (TM0268) requires the downstream gene product TM0269.

    Science.gov (United States)

    Huang, Sha; Romanchuk, Gail; Pattridge, Katherine; Lesley, Scott A; Wilson, Ian A; Matthews, Rowena G; Ludwig, Martha

    2007-08-01

    The crystal structure of the Thermotoga maritima gene product TM0269, determined as part of genome-wide structural coverage of T. maritima by the Joint Center for Structural Genomics, revealed structural homology with the fourth module of the cobalamin-dependent methionine synthase (MetH) from Escherichia coli, despite the lack of significant sequence homology. The gene specifying TM0269 lies in close proximity to another gene, TM0268, which shows sequence homology with the first three modules of E. coli MetH. The fourth module of E. coli MetH is required for reductive remethylation of the cob(II)alamin form of the cofactor and binds the methyl donor for this reactivation, S-adenosylmethionine (AdoMet). Measurements of the rates of methionine formation in the presence and absence of TM0269 and AdoMet demonstrate that both TM0269 and AdoMet are required for reactivation of the inactive cob(II)alamin form of TM0268. These activity measurements confirm the structure-based assignment of the function of the TM0269 gene product. In the presence of TM0269, AdoMet, and reductants, the measured activity of T. maritima MetH is maximal near 80 degrees C, where the specific activity of the purified protein is approximately 15% of that of E. coli methionine synthase (MetH) at 37 degrees C. Comparisons of the structures and sequences of TM0269 and the reactivation domain of E. coli MetH suggest that AdoMet may be bound somewhat differently by the homologous proteins. However, the conformation of a hairpin that is critical for cobalamin binding in E. coli MetH, which constitutes an essential structural element, is retained in the T. maritima reactivation protein despite striking divergence of the sequences.

  3. Functional Characterization of Nine Norway Spruce TPS Genes and Evolution of Gymnosperm Terpene Synthases of the TPS-d Subfamily1[w

    Science.gov (United States)

    Martin, Diane M.; Fäldt, Jenny; Bohlmann, Jörg

    2004-01-01

    Constitutive and induced terpenoids are important defense compounds for many plants against potential herbivores and pathogens. In Norway spruce (Picea abies L. Karst), treatment with methyl jasmonate induces complex chemical and biochemical terpenoid defense responses associated with traumatic resin duct development in stems and volatile terpenoid emissions in needles. The cloning of (+)-3-carene synthase was the first step in characterizing this system at the molecular genetic level. Here we report the isolation and functional characterization of nine additional terpene synthase (TPS) cDNAs from Norway spruce. These cDNAs encode four monoterpene synthases, myrcene synthase, (−)-limonene synthase, (−)-α/β-pinene synthase, and (−)-linalool synthase; three sesquiterpene synthases, longifolene synthase, E,E-α-farnesene synthase, and E-α-bisabolene synthase; and two diterpene synthases, isopimara-7,15-diene synthase and levopimaradiene/abietadiene synthase, each with a unique product profile. To our knowledge, genes encoding isopimara-7,15-diene synthase and longifolene synthase have not been previously described, and this linalool synthase is the first described from a gymnosperm. These functionally diverse TPS account for much of the structural diversity of constitutive and methyl jasmonate-induced terpenoids in foliage, xylem, bark, and volatile emissions from needles of Norway spruce. Phylogenetic analyses based on the inclusion of these TPS into the TPS-d subfamily revealed that functional specialization of conifer TPS occurred before speciation of Pinaceae. Furthermore, based on TPS enclaves created by distinct branching patterns, the TPS-d subfamily is divided into three groups according to sequence similarities and functional assessment. Similarities of TPS evolution in angiosperms and modeling of TPS protein structures are discussed. PMID:15310829

  4. T cell cytokine gene polymorphisms in canine diabetes mellitus.

    Science.gov (United States)

    Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R

    2009-03-15

    Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.

  5. Analyses of the sucrose synthase gene family in cotton: structure, phylogeny and expression patterns

    Directory of Open Access Journals (Sweden)

    Chen Aiqun

    2012-06-01

    Full Text Available Abstract Background In plants, sucrose synthase (Sus is widely considered as a key enzyme involved in sucrose metabolism. Several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, while limited information of Sus genes is available to date for cotton. Results Here, we report the molecular cloning, structural organization, phylogenetic evolution and expression profiles of seven Sus genes (GaSus1 to 7 identified from diploid fiber cotton (Gossypium arboreum. Comparisons between cDNA and genomic sequences revealed that the cotton GaSus genes were interrupted by multiple introns. Comparative screening of introns in homologous genes demonstrated that the number and position of Sus introns are highly conserved among Sus genes in cotton and other more distantly related plant species. Phylogenetic analysis showed that GaSus1, GaSus2, GaSus3, GaSus4 and GaSus5 could be clustered together into a dicot Sus group, while GaSus6 and GaSus7 were separated evenly into other two groups, with members from both dicot and monocot species. Expression profiles analyses of the seven Sus genes indicated that except GaSus2, of which the transcripts was undetectable in all tissues examined, and GaSus7, which was only expressed in stem and petal, the other five paralogues were differentially expressed in a wide ranges of tissues, and showed development-dependent expression profiles in cotton fiber cells. Conclusions This is a comprehensive study of the Sus gene family in cotton plant. The results presented in this work provide new insights into the evolutionary conservation and sub-functional divergence of the cotton Sus gene family in response to cotton fiber growth and development.

  6. Structural and functional characterization of three polyketide synthase gene clusters in Bacillus amyloliquefaciens FZB 42.

    Science.gov (United States)

    Chen, Xiao-Hua; Vater, Joachim; Piel, Jörn; Franke, Peter; Scholz, Romy; Schneider, Kathrin; Koumoutsi, Alexandra; Hitzeroth, Gabriele; Grammel, Nicolas; Strittmatter, Axel W; Gottschalk, Gerhard; Süssmuth, Roderich D; Borriss, Rainer

    2006-06-01

    Although bacterial polyketides are of considerable biomedical interest, the molecular biology of polyketide biosynthesis in Bacillus spp., one of the richest bacterial sources of bioactive natural products, remains largely unexplored. Here we assign for the first time complete polyketide synthase (PKS) gene clusters to Bacillus antibiotics. Three giant modular PKS systems of the trans-acyltransferase type were identified in Bacillus amyloliquefaciens FZB 42. One of them, pks1, is an ortholog of the pksX operon with a previously unknown function in the sequenced model strain Bacillus subtilis 168, while the pks2 and pks3 clusters are novel gene clusters. Cassette mutagenesis combined with advanced mass spectrometric techniques such as matrix-assisted laser desorption ionization-time of flight mass spectrometry and liquid chromatography-electrospray ionization mass spectrometry revealed that the pks1 (bae) and pks3 (dif) gene clusters encode the biosynthesis of the polyene antibiotics bacillaene and difficidin or oxydifficidin, respectively. In addition, B. subtilis OKB105 (pheA sfp(0)), a transformant of the B. subtilis 168 derivative JH642, was shown to produce bacillaene, demonstrating that the pksX gene cluster directs the synthesis of that polyketide. The GenBank accession numbers for gene clusters pks1(bae), pks2, and pks3(dif) are AJ 634060.2, AJ 6340601.2, and AJ 6340602.2, respectively.

  7. Positive selection and functional divergence of farnesyl pyrophosphate synthase genes in plants.

    Science.gov (United States)

    Qian, Jieying; Liu, Yong; Chao, Naixia; Ma, Chengtong; Chen, Qicong; Sun, Jian; Wu, Yaosheng

    2017-02-04

    Farnesyl pyrophosphate synthase (FPS) belongs to the short-chain prenyltransferase family, and it performs a conserved and essential role in the terpenoid biosynthesis pathway. However, its classification, evolutionary history, and the forces driving the evolution of FPS genes in plants remain poorly understood. Phylogeny and positive selection analysis was used to identify the evolutionary forces that led to the functional divergence of FPS in plants, and recombinant detection was undertaken using the Genetic Algorithm for Recombination Detection (GARD) method. The dataset included 68 FPS variation pattern sequences (2 gymnosperms, 10 monocotyledons, 54 dicotyledons, and 2 outgroups). This study revealed that the FPS gene was under positive selection in plants. No recombinant within the FPS gene was found. Therefore, it was inferred that the positive selection of FPS had not been influenced by a recombinant episode. The positively selected sites were mainly located in the catalytic center and functional areas, which indicated that the 98S and 234D were important positively selected sites for plant FPS in the terpenoid biosynthesis pathway. They were located in the FPS conserved domain of the catalytic site. We inferred that the diversification of FPS genes was associated with functional divergence and could be driven by positive selection. It was clear that protein sequence evolution via positive selection was able to drive adaptive diversification in plant FPS proteins. This study provides information on the classification and positive selection of plant FPS genes, and the results could be useful for further research on the regulation of triterpenoid biosynthesis.

  8. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  9. The human VH3b gene subfamily is highly polymorphic

    Energy Technology Data Exchange (ETDEWEB)

    Adderson, E.E.; Carroll, W.L. (Univ. of Utah, Salt Lake City, UT (United States)); Azmi, F.H.; Wilson, P.M.; Shackelford, P.G. (Washington Univ., St. Louis, MO (United States))

    1993-07-15

    The authors have previously shown that human antibody (Ab) directed against the capsular polysaccharide of the important bacterial pathogen, Haemophilus influenzae type b (Hib) is encoded by a small group of VH3 gene family members. The majority of anti-Hib PS Ab use members of the smaller VH3b subfamily. To examine directly the available human VH3 repertoire, they have used PCR to amplify and clone candidate germ-line VH3b H chain V region genes from two unrelated subjects from whom anti-Hib polysaccharide mAb had been previously obtained. A single functional VH3b germ-line gene was obtained from one subject. This gene is identical throughout the coding region to the previously identified gene 9.1. Twelve distinct VH3b germ-line sequences, 87.6-99.8% homologous to one another, were obtained from the second subject. One of these genes, LSG1.1, is also identical to the 9.1 germ-line gene, and a second, LSG6.1 is identical to a previously reported cDNA, M85. These germ-line VH3b genes are 82.7-94.1% homologous to rearranged anti-Hib PS VH3b segments obtained from these subjects. These findings further demonstrate that considerable polymorphism of VH segments exists in the human population. Despite the presence of very highly homologous VH elements in the germ line, particular genes are highly conserved within the outbred human population. 52 refs., 4 figs.

  10. Bovine gene polymorphisms related to fat deposition and meat tenderness

    Directory of Open Access Journals (Sweden)

    Marina R.S. Fortes

    2009-01-01

    Full Text Available Leptin, thyroglobulin and diacylglycerol O-acyltransferase play important roles in fat metabolism. Fat deposition has an influence on meat quality and consumers' choice. The aim of this study was to determine allele and genotype frequencies of polymorphisms of the bovine genes, which encode leptin (LEP, thyroglobulin (TG and diacylglycerol O-acyltransferase (DGAT1. A further objective was to establish the effects of these polymorphisms on meat characteristics. We genotyped 147 animals belonging to the Nelore (Bos indicus, Canchim (5/8 Bos taurus + 3/8 Bos indicus, Rubia Gallega X Nelore (1/2 Bos taurus + 1/2 Bos indicus, Brangus Three-way cross (9/16 Bos taurus + 7/16 Bos indicus and Braunvieh Three-way cross (3/4 Bos taurus + 1/4 Bos indicus breeds. Backfat thickness, total lipids, marbling score, ribeye area and shear force were fitted, using the General Linear Model (GLM procedure of the SAS software. The least square means of genotypes and genetic groups were compared using Tukey's test. Allele frequencies vary among the genetic groups, depending on Bos indicus versus Bos taurus influence. The LEP polymorphism segregates in pure Bos indicus Nelore animals, which is a new finding. The T allele of TG is fixed in Nelore, and DGAT1 segregates in all groups, but the frequency of allele A is lower in Nelore animals. The results showed no association between the genotypes and traits studied, but a genetic group effect on these traits was found. So, the genetic background remains relevant for fat deposition and meat tenderness, but the gene markers developed for Bos taurus may be insufficient for Bos indicus.

  11. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

    Science.gov (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2017-02-01

    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  13. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene.

    Science.gov (United States)

    Pereira, Luiz Miguel; Baroni, Luciana; Yatsuda, Ana Patrícia

    2014-03-01

    Neospora caninum is an Apicomplexa parasite related to abortion and losses of fertility in cattle. The amenability of Toxoplasma gondii and Plasmodium to genetic manipulation offers several tools to determine the invasion and replication processes, which support posterior strategies related to the combat of these diseases. For Plasmodium the use of pyrimethamine as an auxiliary drug on malaria treatment has been affected by the rise of resistant strains and the analyses on Dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene indicated several point mutations. In this work we developed a method for stable insertion of genes based on resistance to pyrimethamine. For that, the coding sequence of NcDHFR-TS (Dihydrofolate reductase-thymidylate synthase) was point mutated in two amino acids, generating DHFRM2M3. The DHFRM2M3 flanked by the promoter and 3'UTR of Ncdhfr-ts (Ncdhfr-DHFRM2M3) conferred resistance to pyrimethamine after transfection. For illustration of stability and expression, the cassette Ncdhfr-DHFRM2M3 was ligated to the reporter gene Lac-Z (β-galactosidase enzyme) controlled by the N. caninum tubulin promoter and was transfected and selected in N. caninum. The cassette was integrated into the genome and the selected tachyzoites expressed Lac-Z, allowing the detection of tachyzoites by the CPRG reaction and X-gal precipitation. The obtainment of transgenic N. caninum resistant to pyrimethamine confirms the effects on DHFR-TS among the Apicomplexa members and will support future approaches on pholate inhibitors for N. caninum prophylaxis. The construction of stable tachyzoites based on vectors with N. caninum promoters initiates the molecular manipulation of this parasite independently of T. gondii. Copyright © 2014. Published by Elsevier Inc.

  14. The role of ERBB2 gene polymorphisms in leprosy susceptibility

    Directory of Open Access Journals (Sweden)

    Jamile Leão Rêgo

    2015-03-01

    Full Text Available Mycobacterium leprae infects skin and peripheral nerves causing deformities and disability. The M. leprae bacterium binds to ErbB2 on the Schwann cell surface causing demyelination and favoring spread of the bacilli and causing nerve injury. Polymorphisms at the ERBB2 gene were previously investigated as genetic risk factors for leprosy in two Brazilian populations but with inconsistent results. Herein we extend the analysis of ERBB2 variants to a third geographically distinct population in Brazil. Our results show that there is no association between the genotyped SNPs and the disease (p > 0.05 in this population. A gene set or pathway analysis under the genomic region of ERBB2 will be necessary to clarify its regulation under M. leprae stimulus.

  15. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  16. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Phosphodiesterase 4D gene polymorphisms in sudden sensorineural hearing loss.

    Science.gov (United States)

    Chien, Chen-Yu; Tai, Shu-Yu; Wang, Ling-Feng; Hsi, Edward; Chang, Ning-Chia; Wang, Hsun-Mo; Wu, Ming-Tsang; Ho, Kuen-Yao

    2016-09-01

    The phosphodiesterase 4D (PDE4D) gene has been reported as a risk gene for ischemic stroke. The vascular factors are between the hypothesized etiologies of sudden sensorineural hearing loss (SSNHL), and this genetic effect might be attributed for its role in SSNHL. We hypothesized that genetic variants of the PDE4D gene are associated with susceptibility to SSNHL. We conducted a case-control study with 362 SSNHL cases and 209 controls. Three single nucleotide polymorphisms (SNPs) were selected. The genotypes were determined using TaqMan technology. Hardy-Weinberg equilibrium (HWE) was tested for each SNP, and genetic effects were evaluated according to three inheritance modes. We carried out sex-specific analysis to analyze the overall data. All three SNPs were in HWE. When subjects were stratified by sex, the genetic effect was only evident in females but not in males. The TT genotype of rs702553 exhibited an adjusted odds ratio (OR) of 3.83 (95 % confidence interval = 1.46-11.18) (p = 0.006) in female SSNHL. The TT genotype of SNP rs702553 was associated with female SSNHL under the recessive model (p = 0.004, OR 3.70). In multivariate logistic regression analysis, TT genotype of rs702553 was significantly associated with female SSNHL (p = 0.0043, OR 3.70). These results suggest that PDE4D gene polymorphisms influence the susceptibility for the development of SSNHL in the southern Taiwanese female population.

  18. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  19. Enhanced thermotolerance for ethanol fermentation of Saccharomyces cerevisiae strain by overexpression of the gene coding for trehalose-6-phosphate synthase.

    Science.gov (United States)

    An, Ming-Zhe; Tang, Yue-Qin; Mitsumasu, Kanako; Liu, Ze-Shen; Shigeru, Morimura; Kenji, Kida

    2011-07-01

    The effect of overexpression of the trehalose-6-phosphate (T6P) synthase gene (TPS1) on ethanol fermentation of Saccharomyces cerevisiae has been studied at 30 and 38°C. The activity of T6P synthase and the accumulation of trehalose during ethanol fermentation were significantly improved by overexpression of TPS1, and especially at 38°C. Ethanol produced by transformants with and without TPS1 gene overexpression at 38°C was approx. 60 and 37 g/l, respectively. The fermentation efficiency of transformants with TPS1 gene overexpression at 38°C was similar to that at 30°C. The critical growth temperature was increased from 36 to 42°C by TPS1 gene overexpression. These results indicated that overexpression of the TPS1 gene had a beneficial effect on the fermentation capacity of the title yeast strain at high temperatures.

  20. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming

    2009-06-01

    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  1. N-acetyltransferase 2 gene polymorphism and presbycusis.

    Science.gov (United States)

    Unal, Murat; Tamer, Lülüfer; Doğruer, Zeynep Nil; Yildirim, Hatice; Vayisoğlu, Yusuf; Camdeviren, Handan

    2005-12-01

    The enzyme of N-acetyltransferase (NAT) is involved in the metabolism and detoxification of cytotoxic and carcinogenic compounds as well as reactive oxygen species (ROS). The excessive amount of ROS generation occurs in the ageing inner ear. The exact etiopathogenesis of presbycusis is not known, but it is generally accepted that it is the result of series of insults, such as physiologic age-related degeneration, noise exposure, medical disorders and their treatment, as well as hereditary susceptibility. The effect of aging shows a wide interindividual range; we aimed to investigate whether profiles of NAT2 genotypes may be associated with the risk of presbycusis. Hospital-based, case-control study. We examined 68 adults with presbycusis and 98 healthy controls. DNA was extracted from whole blood, and the polymorphisms of NAT2*5A, NAT2*6A, NAT2*7A/B, and NAT2*14A were determined using a real-time polymerase chain reaction and fluorescence resonance energy transfer with a Light-Cycler Instrument. Associations between specific genotypes and the development of presbycusis were examined by use of logistic regression analyses to calculate odds ratios and 95% confidence intervals. Gene polymorphisms at NAT2*5A, NAT2*7A/B, and NAT2*14A in subjects with presbycusis were not significantly different from in the controls (P > .05). However, in NAT2*6A, the risk of presbycusis was 15.2-fold more in individuals with mutant allele than subjects with wild genotype (P = .013). Individuals with NAT2*6A heterozygote allele had a 0.34-fold less risk in the development of presbycusis than subjects with mutant allele (P = .032) We demonstrated a significant association between the NAT2*6A polymorphism and age-related hearing loss in this population. However, the sample size was relatively small, and further studies need to investigate the exact role of NAT2 gene polymorphism in the etiopathogenesis of the presbycusis.

  2. Phylogenetic diversification of glycogen synthase kinase 3/SHAGGY-like kinase genes in plants

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2006-02-01

    Full Text Available Abstract Background The glycogen synthase kinase 3 (GSK3/SHAGGY-like kinases (GSKs are non-receptor serine/threonine protein kinases that are involved in a variety of biological processes. In contrast to the two members of the GSK3 family in mammals, plants appear to have a much larger set of divergent GSK genes. Plant GSKs are encoded by a multigene family; analysis of the Arabidopsis genome revealed the existence of 10 GSK genes that fall into four major groups. Here we characterized the structure of Arabidopsis and rice GSK genes and conducted the first broad phylogenetic analysis of the plant GSK gene family, covering a taxonomically diverse array of algal and land plant sequences. Results We found that the structure of GSK genes is generally conserved in Arabidopsis and rice, although we documented examples of exon expansion and intron loss. Our phylogenetic analyses of 139 sequences revealed four major clades of GSK genes that correspond to the four subgroups initially recognized in Arabidopsis. ESTs from basal angiosperms were represented in all four major clades; GSK homologs from the basal angiosperm Persea americana (avocado appeared in all four clades. Gymnosperm sequences occurred in clades I, III, and IV, and a sequence of the red alga Porphyra was sister to all green plant sequences. Conclusion Our results indicate that (1 the plant-specific GSK gene lineage was established early in the history of green plants, (2 plant GSKs began to diversify prior to the origin of extant seed plants, (3 three of the four major clades of GSKs present in Arabidopsis and rice were established early in the evolutionary history of extant seed plants, and (4 diversification into four major clades (as initially reported in Arabidopsis occurred either just prior to the origin of the angiosperms or very early in angiosperm history.

  3. Human platelet/erythroleukemia cell prostaglandin G/H synthase: cDNA cloning, expression, and gene chromosomal assignment

    Energy Technology Data Exchange (ETDEWEB)

    Funk, C.D.; Funk, L.B.; Kennedy, M.E.; Pong, A.S.; Fitzgerald, G.A. (Vanderbilt Univ., Nashville, TN (United States))

    1991-06-01

    Platelets metabolize arachidonic acid to thromboxane A{sub 2}, a potent platelet aggregator and vasoconstrictor compound. The first step of this transformation is catalyzed by prostaglandin (PG) G/H synthase, a target site for nonsteroidal antiinflammatory drugs. We have isolated the cDNA for both human platelet and human erythroleukemia cell PGG/H synthase using the polymerase chain reaction and conventional screening procedures. The cDNA encoding the full-length protein was expressed in COS-M6 cells. Microsomal fractions from transfected cells produced prostaglandin endoperoxide derived products which were inhibited by indomethacin and aspirin. Mutagenesis of the serine residue at position 529, the putative aspirin acetylation site, to an asparagine reduced cyclooxygenase activity to barely detectable levels, an effect observed previously with the expressed sheep vesicular gland enzyme. Platelet-derived growth factor and phorbol ester differentially regulated the expression of PGG/H synthase mRNA levels in the megakaryocytic/platelet-like HEL cell line. The PGG/H synthase gene was assigned to chromosome 9 by analysis of a human-hamster somatic hybrid DNA panel. The availability of platelet PGG/H synthase cDNA should enhance our understanding of the important structure/function domains of this protein and it gene regulation.

  4. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  5. Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality

    Directory of Open Access Journals (Sweden)

    Anastasia K Armeni

    2017-02-01

    Full Text Available Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA gene polymorphism (rs2234693-PvuII (T→C substitution and oxytocin receptor gene polymorphism (rs53576 (G→A substitution with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20–25 years of age, sexually active, with normal menstrual cycles (28–35 days, were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs, polycystic ovary syndrome (PCOS, thyroid diseases as well as drugs that are implicated in hypothalamus–pituitary–gonadal axis. T allele (wildtype of rs2234693 (PvuII polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic of rs53576 (OXTR polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII and A allele of rs53576 (OXTR polymorphisms (T + A group was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences.

  6. Effects of point mutations in Plasmodium falciparum dihydrofolate reductase and dihydropterate synthase genes on clinical outcomes and in vitro susceptibility to sulfadoxine and pyrimethamine.

    Directory of Open Access Journals (Sweden)

    David J Bacon

    2009-08-01

    Full Text Available Sulfadoxine-pyrimethamine was a common first line drug therapy to treat uncomplicated falciparum malaria, but increasing therapeutic failures associated with the development of significant levels of resistance worldwide has prompted change to alternative treatment regimes in many national malaria control programs. METHODOLOGY AND FINDING: We conducted an in vivo therapeutic efficacy trial of sulfadoxine-pyrimethamine at two locations in the Peruvian Amazon enrolling 99 patients of which, 86 patients completed the protocol specified 28 day follow up. Our objective was to correlate the presence of polymorphisms in P. falciparum dihydrofolate reductase and dihydropteroate synthase to in vitro parasite susceptibility to sulfadoxine and pyrimethamine and to in vivo treatment outcomes. Inhibitory concentration 50 values of isolates increased with numbers of mutations (single [108N], sextuplet [BR/51I/108N/164L and 437G/581G] and septuplet (BR/51I/108N/164L and 437G/540E/581G with geometric means of 76 nM (35-166 nM, 582 nM (49-6890- nM and 4909 (3575-6741 nM nM for sulfadoxine and 33 nM (22-51 nM, 81 nM (19-345 nM, and 215 nM (176-262 nM for pyrimethamine. A single mutation present in the isolate obtained at the time of enrollment from either dihydrofolate reductase (164L or dihydropteroate synthase (540E predicted treatment failure as well as any other single gene alone or in combination. Patients with the dihydrofolate reductase 164L mutation were 3.6 times as likely to be treatment failures [failures 85.4% (164L vs 23.7% (I164; relative risk = 3.61; 95% CI: 2.14 - 6.64] while patients with the dihydropteroate synthase 540E were 2.6 times as likely to fail treatment (96.7% (540E vs 37.5% (K540; relative risk = 2.58; 95% CI: 1.88 - 3.73. Patients with both dihydrofolate reductase 164L and dihydropteroate synthase 540E mutations were 4.1 times as likely to be treatment failures [96.7% vs 23.7%; RR = 4.08; 95% CI: 2.45 - 7.46] compared to patients

  7. Identification of a novel hedycaryol synthase gene isolated from Camellia brevistyla flowers and floral scent of Camellia cultivars.

    Science.gov (United States)

    Hattan, Jun-ichiro; Shindo, Kazutoshi; Ito, Tomoko; Shibuya, Yurica; Watanabe, Arisa; Tagaki, Chie; Ohno, Fumina; Sasaki, Tetsuya; Ishii, Jun; Kondo, Akihiko; Misawa, Norihiko

    2016-04-01

    A novel terpene synthase (Tps) gene isolated from Camellia brevistyla was identified as hedycaryol synthase, which was shown to be expressed specifically in flowers. Camellia plants are very popular because they bloom in winter when other plants seldom flower. Many ornamental cultivars of Camellia have been bred mainly in Japan, although the fragrance of their flowers has not been studied extensively. We analyzed floral scents of several Camellia cultivars by gas chromatography-mass spectrometry (GC-MS) and found that Camellia brevistyla produced various sesquiterpenes in addition to monoterpenes, whereas Camellia japonica and its cross-lines produced only monoterpenes, including linalool as the main product. From a flower of C. brevistyla, we isolated one cDNA encoding a terpene synthase (TPS) comprised of 554 amino acids, which was phylogenetically positioned to a sole gene clade. The cDNA, designated CbTps1, was expressed in mevalonate-pathway-engineered Escherichia coli, which carried the Streptomyces mevalonate-pathway gene cluster in addition to the acetoacetate-CoA ligase gene. A terpene product was purified from recombinant E. coli cultured with lithium acetoacetate, and analyzed by (1)H-nulcear magnetic resonance spectroscopy ((1)H-NMR) and GC-MS. It was shown that a sesquiterpene hedycaryol was produced, because (1)H-NMR signals of the purified product were very broad, and elemol, a thermal rearrangement product from hedycaryol, was identified by GC-MS analysis. Spectroscopic data of elemol were also determined. These results indicated that the CbTps1 gene encodes hedycaryol synthase. Expression analysis of CbTps1 showed that it was expressed specifically in flowers, and hedycaryol is likely to be one of the terpenes that attract insects for pollination of C. brevistyla. A linalool synthase gene, which was isolated from a flower of Camellia saluenensis, is also described.

  8. Differential expression of cellulose synthase (CesA) gene transcripts in potato as revealed by QRT-PCR

    NARCIS (Netherlands)

    Olawole, O.; Jacobsen, E.; Vincken, J.P.; Visser, R.G.F.

    2009-01-01

    Two transgenic potato lines, csr2–1 and csr4–8 that contained two different antisense cellulose synthase (CesA) genes, csr2 and csr4, respectively were crossed. The aim, amongst others, was to investigate the possibility of generating double transformants to validate a hypothetical presence of the

  9. Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    2014-12-26

    Dec 26, 2014 ... RESEARCH ARTICLE. Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. MANISHA PATNAIK1,5, PALLABI PATI1, SURENDRA N. SWAIN2, MANOJ K.

  10. Association of Rho-kinase Gene Polymorphisms with Respiratory Distress Syndrome in Preterm Neonates

    Directory of Open Access Journals (Sweden)

    Gül Kaya

    2017-02-01

    Conclusion: This is the first study to examine the involvement of ROCK gene variation in the risk of incident RDS. The results strongly suggest that ROCK gene polymorphisms may modify individual susceptibility to RDS in the Turkish population.

  11. A novel polymorphism of resistin gene and its association with meat ...

    African Journals Online (AJOL)

    Jane

    2011-09-28

    Sep 28, 2011 ... Searching for candidate gene polymorphisms and their relationship with meat quality traits is an important issue for Bos taurus industry. In this study, we evaluated polymorphism of resistin (RETN) gene involved in energy metabolism. Using the polymerase chain reaction-single strand conformation.

  12. Association between A59V polymorphism in exon 3 of leptin gene ...

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... We used the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique to screen for DNA polymorphisms of the leptin gene in 255 cows of Iranian Holstein. Amplified region is located in exon 3 of leptin gene. The genomic bovine leptin sequences, which consist of three ...

  13. Linkage and association studies of IL1B and IL1RN gene polymorphisms in preeclampsia

    NARCIS (Netherlands)

    Lachmeijer, AMA; Nosti-Escanilla, MP; Bastiaans, EB; Pals, G; Sankuijl, LA; Kostense, PJ; Aarnoudse, JG; Crusius, JBA; Pena, AS; Dekker, GA; Arngrimsson, R; ten Kate, LP

    2002-01-01

    Objective: To determine whether preeclampsia is either associated with or linked to two polymorphisms in the IL1B gene (IL1B-TaqI and IL1B-511) and one polymorphism in the IL1RN gene (IL1RN-IVS2). Methods: Genotyping was performed in 150 affected sib-pair families and 104 healthy Dutch blood donors.

  14. Interleukin 10 gene promoter polymorphism and risk of diffuse large B cell lymphoma (DLBCL

    Directory of Open Access Journals (Sweden)

    Roba M. Talaat

    2014-01-01

    Conclusions: Taken together, our findings demonstrated that IL-10 promoter gene polymorphism (−1082 and −819 may not have an influence on the clinical outcome of DLBCL, especially in terms of overall secretion level. Further investigations of other cytokine gene polymorphisms will lead to a better understanding of the disease’s biological background.

  15. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Directory of Open Access Journals (Sweden)

    Bin Tang

    2018-01-01

    Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

  16. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Science.gov (United States)

    Tang, Bin; Wang, Su; Wang, Shi-Gui; Wang, Hui-Juan; Zhang, Jia-Yong; Cui, Shuai-Ying

    2018-01-01

    The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS) and trehalose-6-phosphate phosphatase (TPP) pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects. PMID:29445344

  17. Gene therapy of transplant arteriopathy by liposome-mediated transfection of endothelial nitric oxide synthase.

    Science.gov (United States)

    Iwata, A; Sai, S; Moore, M; Nyhuis, J; de Fries-Hallstrand, R; Quetingco, G C; Allen, M D

    2000-11-01

    Transplant arteriopathy is the major factor limiting long-term survival after cardiac transplantation. We have previously demonstrated that liposome-mediated gene delivery of endothelial nitric oxide synthase (eNOS) to donor hearts reduces ischemia-reperfusion injury by blocking NFkappaB activation, adhesion molecule expression, and leukocyte infiltration. In this study, we used gene transfer of eNOS in a rabbit carotid transplant model to see whether these same effects would similarly ameliorate transplant arteriopathy. Liposomes complexed to the gene encoding eNOS were injected into donor carotid arterial segments that were transplanted orthotopically into recipient carotid arteries (n = 10). Controls included transplanted carotids transfected with liposomes complexed to empty plasmids (no functional gene) (n = 4) and transplanted carotids treated with saline (n = 6). Transplanted arteries were harvested for processing at 21 days. Intima/media (I/M) area ratios were calculated by computerized image analysis. Infiltrating T-lymphocytes and macrophages, and expression of VCAM-1 and ICAM-1 were quantified on immunocytochemistry. The I/M ratio was significantly reduced in eNOS-transfected arteries compared with arteries transfected with empty plasmids and saline-treated controls. Compared to transplanted control arteries, eNOS-transfected arteries demonstrated significantly reduced T-cell infiltration into the intima and significantly reduced macrophage infiltration into the media. Cell surface expression of VCAM-1 and ICAM-1 were both reduced in eNOS-transfected arteries. ENOS gene delivery can suppress neointimal lesion formation and T-lymphocyte and macrophage infiltration in transplanted arteries, associated with a reduction in relevant adhesion molecule expression. Thus, gene therapy with eNOS may not only reduce ischemia-reperfusion injury but may also ameliorate transplant arteriopathy in transplanted hearts.

  18. Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes

    Directory of Open Access Journals (Sweden)

    van Oost Bernard A

    2007-10-01

    Full Text Available Abstract Background Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. Results We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. α-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan δ, titin cap, α-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. Conclusion The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.

  19. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang

    2014-12-01

    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  20. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

    2017-01-01

    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  1. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  2. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  3. The polyketide synthase gene pks4 of Trichoderma reesei provides pigmentation and stress resistance.

    Science.gov (United States)

    Atanasova, Lea; Knox, Benjamin P; Kubicek, Christian P; Druzhinina, Irina S; Baker, Scott E

    2013-11-01

    Species of the fungal genus Trichoderma (Hypocreales, Ascomycota) are well-known for their production of various secondary metabolites. Nonribosomal peptides and polyketides represent a major portion of these products. In a recent phylogenomic investigation of Trichoderma polyketide synthase (PKS)-encoding genes, the pks4 from T. reesei was shown to be an orthologue of pigment-forming PKSs involved in synthesis of aurofusarin and bikaverin in Fusarium spp. In this study, we show that deletion of this gene in T. reesei results in loss of green conidial pigmentation and in pigmentation alteration of teleomorph structures. It also has an impact on conidial cell wall stability and the antagonistic abilities of T. reesei against other fungi, including formation of inhibitory metabolites. In addition, deletion of pks4 significantly influences the expression of other PKS-encoding genes of T. reesei. To our knowledge, this is the first indication that a low-molecular-weight pigment-forming PKS is involved in defense, mechanical stability, and stress resistance in fungi.

  4. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    Science.gov (United States)

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  5. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  6. Nonsense Mutation Inside Anthocyanidin Synthase Gene Controls Pigmentation in Yellow Raspberry (Rubus idaeus L.).

    Science.gov (United States)

    Rafique, Muhammad Z; Carvalho, Elisabete; Stracke, Ralf; Palmieri, Luisa; Herrera, Lorena; Feller, Antje; Malnoy, Mickael; Martens, Stefan

    2016-01-01

    Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase ( Ans ) catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry ("Anne"). A 5 bp insertion in the coding region was identified and designated as ans +5 . The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild-type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect, i.e., nonsense-mediated mRNA decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans / ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans +5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  7. Nonsense mutation inside anthocyanidin synthase gene controls pigmentation in yellow raspberry (Rubus idaeus L..

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Rafique

    2016-12-01

    Full Text Available Yellow raspberry fruits have reduced anthocyanin contents and offer unique possibility to study the genetics of pigment biosynthesis in this important soft fruit. Anthocyanidin synthase catalyzes the conversion of leucoanthocyanidin to anthocyanidin, a key committed step in biosynthesis of anthocyanins. Molecular analysis of the Ans gene enabled to identify an inactive ans allele in a yellow fruit raspberry (Anne. A 5-bp insertion in the coding region was identified and designated as ans+5. The insertion creates a premature stop codon resulting in a truncated protein of 264 amino acids, compared to 414 amino acids wild type ANS protein. This mutation leads to loss of function of the encoded protein that might also result in transcriptional downregulation of Ans gene as a secondary effect i.e. nonsense-mRNA mediated decay. Further, this mutation results in loss of visible and detectable anthocyanin pigments. Functional characterization of raspberry Ans/ans alleles via complementation experiments in the Arabidopsis thaliana ldox mutant supports the inactivity of encoded protein through ans+5 and explains the proposed block in the anthocyanin biosynthetic pathway in raspberry. Taken together, our data shows that the mutation inside Ans gene in raspberry is responsible for yellow fruit phenotypes.

  8. Preconception Screening for Gene Polymorphisms Associated with Thrombophilia and Hyperhomocysteinemia Risk in Healthy Young Women

    Directory of Open Access Journals (Sweden)

    Elena Yu. Glotova

    2013-09-01

    Full Text Available The frequency characteristics of the gene polymorphisms (FVL G1691A, FII G20210A, MTHFR C677T, MTHFR A1298C, MTRR A66G associated with thrombophilia, hyperhomocysteinemia risk and different perinatal or pregnancy complications were studied. This examination was conducted among 130 planned-pregnancy healthy young women aged between 19 and 29 years. A gene mutation analysis was performed using a real-time polymerase chain reaction (real-time PCR. Factor V Leiden (FVL G1691A and prothrombin gene (FII G20210A mutations were not identified in the women surveyed. The frequency of the occurrence of the heterozygous FVL 1691G/A genotype associated with the risk of thrombosis during pregnancy was very low in these women (0.8%. The frequency of the MTHFR (methylenetetrahydrofolate reductase 1298C/С mutant genotype was 11.5%, MTHFR 677T/Т – 5.4%, and MTRR (methionine synthase reductase 66G/G – 31.5%. A combination of the MTHFR 677TT/1298CC and MTHFR 677TТ/MTRR 66GG mutant genotypes, which significantly increased the risk of pregnancy loss and neural tube defects, were found to occur in 0.8% of the cases.We concluded that selective thrombophilia screening (FVL G1691A and FII G20210A based on prior personal and/or family history of venous thromboembolism was more cost-effective than a universal preconception screening in all planning pregnancy women. However, in order to decrease the risk of congenital anomalies and pregnancy complications associated with folate dependent homocysteine metabolism, preconception care should include folate supplementation

  9. Regulation of acetate metabolism in Corynebacterium glutamicum: transcriptional control of the isocitrate lyase and malate synthase genes.

    Science.gov (United States)

    Wendisch, V F; Spies, M; Reinscheid, D J; Schnicke, S; Sahm, H; Eikmanns, B J

    1997-10-01

    In the amino-acid-producing microorganism Corynebacterium glutamicum, the specific activities of the acetate-activating enzymes acetate kinase and phosphotransacetylase and those of the glyoxylate cycle enzymes isocitrate lyase and malate synthase were found to be high when the cells were grown on acetate (0.8, 2.9, 2.1, and 1.8 U/mg protein, respectively). When the cells were grown on glucose or on other carbon sources such as lactate, succinate, or glutamate, the specific activities were two- to fourfold (acetate kinase and phosphotransacetylase) and 45- to 100-fold (isocitrate lyase and malate synthase) lower, indicating that the synthesis of the four enzymes is regulated by acetate in the growth medium. A comparative Northern (RNA) analysis of the C. glutamicum isocitrate lyase and malate synthase genes (aceA and aceB) and transcriptional cat fusion experiments revealed that aceA and aceB are transcribed as 1.6- and 2.7-kb monocistronic messages, respectively, and that the regulation of isocitrate lyase and malate synthase synthesis is exerted at the level of transcription from the respective promoters. Surprisingly, C. glutamicum mutants defective in either acetate kinase or phosphotransacetylase showed low specific activities of the other three enzymes (phosphotransacetylase, isocitrate lyase, and malate synthase or acetate kinase, isocitrate lyase, and malate synthase, respectively) irrespective of the presence or absence of acetate in the medium. This result and a correlation of a high intracellular acetyl coenzyme A concentration with high specific activities of isocitrate lyase, malate synthase, acetate kinase, and phosphotransacetylase suggest that acetyl coenzyme A or a derivative thereof may be a physiological trigger for the genetic regulation of enzymes involved in acetate metabolism of C. glutamicum.

  10. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren

    2006-01-01

    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  11. Single-nucleotide polymorphisms in the promoter region of the PARKIN gene and Parkinson's disease.

    Science.gov (United States)

    Mata, Ignacio F; Alvarez, Victoria; García-Moreira, Vanessa; Guisasola, Luis M; Ribacoba, René; Salvador, Carlos; Blázquez, Marta; Sarmiento, Rogelio González; Lahoz, Carlos H; Menes, Bernardino B; García, Eliecer Coto

    2002-08-30

    Mutations in the PARKIN gene have been identified in families with recessively inherited Parkinson disease (PD). Common DNA-polymorphisms at the PARKIN gene could contribute to the risk for PD in the general population. Here we searched for DNA-polymorphisms in the PARKIN promoter. We found two single nucleotide polymorphisms (-324 A/G and -797 A/G). In order to analyse the association of PD with these and two previously described polymorphisms (1281 G/A, Asp394Asn, and 601 G/A, Ser167Asn) we genotyped 105 patients and 150 healthy controls. Allele and genotype frequencies for the four polymorphisms did not differ between patients and controls, or between patients with an early-onset (40 years; n = 85). According to our data, the genetic variation at the PARKIN gene (including promoter polymorphisms) did not contribute to the risk of developing PD in the general population. Copyright 2002 Elsevier Science Ireland Ltd.

  12. Germacrene A synthase in yarrow (Achillea millefolium) is an enzyme with mixed substrate specificity: gene cloning, functional characterization and expression analysis

    OpenAIRE

    Pazouki, Leila; Memari, Hamid R.; Kännaste, Astrid; Bichele, Rudolf; Niinemets, Ülo

    2015-01-01

    Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5) residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focuse...

  13. Methylenetetrahy-drofolate Reductase Gene Polymorphism in Patients Receiving Hemodialysis

    Directory of Open Access Journals (Sweden)

    Ermina Kiseljaković

    2010-04-01

    Full Text Available Methylenetetrahydrofolate Reductase (MTHFR is key enzyme in metabolism of homocysteine. Homozygotes for mutation (TT genotype have hyperhomocysteinemia, risk factor for atherosclerosis development. The aim of the study was to find out distribution of genotype frequencies of C677T MTHFR among patients on maintenance hemodialysis. Possible association of alleles and genotypes of C677T polymorphism of the MTHFR gene with age of onset, duration of dialysis and cause of kidney failure was studied also. Cross-sectional study includes 80 patients from Clinic of Hemodialysis KUCS in Sarajevo. In order to perform genotyping, isolated DNA was analyzed by RFLP-PCR and gel-electrophoresis. From total of 80 patients, 42.5% (n=24 were female, 57.5% (n=46 were male, mean age 54.59±1.78 years and duration of dialysis 79.92±6.32 months. Genotype distribution was: CC 51.2% (n=41, CT 37.5% (n=30 and TT 11.2% (n=9. Patients with wild-type genotype have longer duration of dialysis in month (87.1 ± 63.93 comparing to TT genotype patients (67.06 ± 39.3, with no statistical significance. T allele frequency was significantly higher in group of vascular and congenital cause of kidney failure (Pearson X2 =6.049, P<0.05 comparing to inflammation etiology group. Genotype distribution results are within the results other studies in Europe. Obtained results indicate that C677T polymorphism is not associated with onset, duration and cause of kidney failure in our hemodialysis population. There is an association of T allele of the MTHFR gene and vascular and congenital cause kidney failure.

  14. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... treatment. Ten obese patients with NIDDM were studied before and after 8 weeks of treatment with a weight-maintaining diet in combination with the sulphonylurea gliclazide. Gliclazide treatment was associated with significant reductions in HbA1C (p=0.001) and fasting plasma glucose (p=0.005) as well...... metabolism (p=0.02) was demonstrated in teh gliclazide-treated patients when compared to pre-treatment values. In biopsies obtained from vastus lateralis muscle during insulin infusion, the half-maximal activation of glycogen synthase was achieved at a significantly lower concentration of the allosteric...

  15. POLYMORPHISMS OF GROWTH HORMONE GENE IN HARINGHATA BLACK CHICKEN

    Directory of Open Access Journals (Sweden)

    R. Saikhom

    2017-06-01

    Full Text Available The present study was carried out with an aim to investigate the genetic variability of growth hormone gene in Haringhata Black chicken. Blood samples were collected from 82 experimental birds and genomic DNA was extracted using the modified high salt method. Amplification of specific DNA fragment of intron 4 of growth hormone gene yielded a product size of 713 bp and was analyzed for polymorphism using PCR-SSCP technique. The banding pattern of present investigation revealed two SSCP variants AA and BB genotype in all experimental birds. In the analysed flock of Haringhata Black Chicken, the genotype frequencies were found to be 0.915 for AA and 0.085 for BB genotype. The frequencies of A and B alleles were 0.915 and 0.085 respectively which indicated A allele was predominant in the studied Haringhata Black Chicken population of the farm. The Chi Square Test revealed that studied population was not in accordance with Hardy Weinberg equilibrium with respect to intron 4 of Growth hormone gene.

  16. Cloning and Polymorphisms of Yak Lactate Dehydrogenase b Gene

    Directory of Open Access Journals (Sweden)

    Yaou Xu

    2013-06-01

    Full Text Available The main objective of this work was to study the unique polymorphisms of the lactate dehydrogenase-1 (LDH1 gene in yak (Bos grunniens. Native polyacrylamide gel electrophoresis revealed three phenotypes of LDH1 (a tetramer of H subunit in yak heart and longissimus muscle extracts. The corresponding gene, ldhb, encoding H subunits of three LDH1 phenotypes was obtained by RT-PCR. A total of six nucleotide differences were detected in yak ldhb compared with that of cattle, of which five mutations cause amino acid substitutions. Sequence analysis shows that the G896A and C689A, mutations of ldhb gene, result in alterations of differently charged amino acids, and create the three phenotypes (F, M, and S of yak LDH1. Molecular modeling of the H subunit of LDH indicates that the substituted amino acids are not located within NAD+ or substrate binding sites. PCR-RFLP examination of G896A mutation demonstrated that most LDH1-F samples are actually heterozygote at this site. These results help to elucidate the molecular basis and genetic characteristic of the three unique LDH1 phenotypes in yak.

  17. High Polyhydroxybutyrate Production in Pseudomonas extremaustralis Is Associated with Differential Expression of Horizontally Acquired and Core Genome Polyhydroxyalkanoate Synthase Genes

    Science.gov (United States)

    Catone, Mariela V.; Ruiz, Jimena A.; Castellanos, Mildred; Segura, Daniel; Espin, Guadalupe; López, Nancy I.

    2014-01-01

    Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB), a short chain length polyhydroxyalkanoate (sclPHA) infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA). All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI) associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC) in comparison with the mclPHA core genome genes (phaC1 and phaC2) indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases. PMID:24887088

  18. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  19. Glutathione S-transferase P1 gene polymorphisms and susceptibility ...

    Indian Academy of Sciences (India)

    matched and ethnicity-matched healthy controls (n = 200) were genotyped for polymorphisms in GSTP1 using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Genotype distribution of g.313A>G and ...

  20. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  1. RETRACTED: Association of the angiotensinogen M235T gene polymorphism with risk of diabetes mellitus developing into diabetic nephropathy.

    Science.gov (United States)

    Tang, Wenzhuang; Zhou, Tian-Biao; Jiang, Zongpei

    2015-12-01

    .1177/1470320314566019 Tian-Biao Zhou, Xue-Feng Guo, Zongpei Jiang, and Hong-Yan Li Relationship between the ACE I/D gene polymorphism and T1DN susceptibility/risk of T1DM developing into T1DN in the Caucasian population Journal of Renin-Angiotensin-Aldosterone System 1470320314563425, first published on February 1, 2015 doi: 10.1177/1470320314563425 Chun-Hua Yang and Tian-Biao Zhou Relationship between the angiotensinogen A1166C gene polymorphism and the risk of diabetes mellitus developing into diabetic nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314566221, first published on February 1, 2015 doi: 10.1177/1470320314566221 Chun-Hua Yang and Tian-Biao Zhou Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression Journal of Renin-Angiotensin-Aldosterone System 1470320314568521, first published on February 3, 2015 doi: 10.1177/1470320314568521 Articles published in an issue Guohui Liu, Tian-Biao Zhou, Zongpei Jiang, and Dongwen Zheng Association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in a Caucasian population Journal of Renin-Angiotensin-Aldosterone System March 2015 16: 165-171, first published on November 14, 2014 doi: 10.1177/1470320314557849 Weiqiang Zhong, Zhongliang Huang, Yong Wu, Zongpei Jiang, and Tian-Biao Zhou Association of aldosterone synthase (CYP11B2) gene polymorphism with IgA nephropathy risk and progression of IgA nephropathy Journal of Renin-Angiotensin-Aldosterone System September 2015 16: 660-665, first published on August 20, 2014 doi: 10.1177/1470320314524011.

  2. RETRACTED: Relationship between the angiotensinogen A1166C gene polymorphism and the risk of diabetes mellitus developing into diabetic nephropathy.

    Science.gov (United States)

    Yang, Chun-Hua; Zhou, Tian-Biao

    2015-12-01

    .1177/1470320314566019 Tian-Biao Zhou, Xue-Feng Guo, Zongpei Jiang, and Hong-Yan Li Relationship between the ACE I/D gene polymorphism and T1DN susceptibility/risk of T1DM developing into T1DN in the Caucasian population Journal of Renin-Angiotensin-Aldosterone System 1470320314563425, first published on February 1, 2015 doi: 10.1177/1470320314563425 Chun-Hua Yang and Tian-Biao Zhou Relationship between the angiotensinogen A1166C gene polymorphism and the risk of diabetes mellitus developing into diabetic nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314566221, first published on February 1, 2015 doi: 10.1177/1470320314566221 Chun-Hua Yang and Tian-Biao Zhou Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression Journal of Renin-Angiotensin-Aldosterone System 1470320314568521, first published on February 3, 2015 doi: 10.1177/1470320314568521 Articles published in an issue Guohui Liu, Tian-Biao Zhou, Zongpei Jiang, and Dongwen Zheng Association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in a Caucasian population Journal of Renin-Angiotensin-Aldosterone System March 2015 16: 165-171, first published on November 14, 2014 doi: 10.1177/1470320314557849 Weiqiang Zhong, Zhongliang Huang, Yong Wu, Zongpei Jiang, and Tian-Biao Zhou Association of aldosterone synthase (CYP11B2) gene polymorphism with IgA nephropathy risk and progression of IgA nephropathy Journal of Renin-Angiotensin-Aldosterone System Septembr 2015 16: 660-665, first published on August 20, 2014 doi: 10.1177/1470320314524011.

  3. [Antibacterial activity of Porphyra spp. epiphytic bacteria and polyketide synthase I gene screening].

    Science.gov (United States)

    Fang, Wenya; Yang, Rui; Zhu, Peng; Shan, Yuanyuan; Yan, Xiaojun

    2009-02-01

    Based on the antibacterial analysis, we screened Polyketide synthase (PKS I) gene from the epiphytic bacteria of Porphyra spp., in order to obtain the PKS I positive strains and detect the potential connection between the PKS pathway and the antibacterial mechanisms. A total of 31 bacteria with broad-spectrum antibacterial activity were screened by agar-screening methods. The 16S rDNA and the Ketosynthase gene were amplified from the genome DNA of these bacteria, which were cloned into pMD19-T vector for sequencing analysis. Porphyra spp. epiphytic bacteria showed broad-spectrum antibacterial activity. Three PKS I positive epiphytic bacteria were obtained from Wenzhou rotten Porphyra spp. samples which had high antibacterial activity. The BLAST results indicated that the Ketosynthase fragments of PKS I from the strains of WPhG3, WPySwl and WPySw2 shared highest similarity (98%, 99%, 98%) to the strains of Bacillus subtilis subsp. Subtilis str. 168 (NP_389602), Bacillus subtilis (ABR19776) and Aspergillus carbonarius (AAZ99721), respectively. Furthermore, the phylogenetic analysis based on 16S rDNA sequences indicated that they belonged to the genus of Bacillus. The flora of Porphyra spp. epiphytic bacteria was complex, which regulated the phycosphere in many ways. The PKS I pathway might be a performance of antibacterial function of Bacillus from Wenzhou rotten samples.

  4. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  5. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González

    2015-08-01

    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  6. Polymorphism of fat metabolism genes as candidate markers for meat quality and production traits in heavy pigs.

    Science.gov (United States)

    Renaville, B; Bacciu, N; Lanzoni, M; Corazzin, M; Piasentier, E

    2015-12-01

    High meat quality is required for dry-cured ham production, which quality depends on meat fat quantity and composition. The aim was to study the polymorphisms of six genes involved in fat metabolism, namely, Stearoyl-CoA desaturase (SCD), Diacylglycerol acyltransferase 1 and 2 (DGAT1 &DGAT2), Microsomal triglyceride transfer protein (MTTP), Fatty acid synthase (FASN) and Heart fatty acid binding protein (H-FABP) in two traditional (Large White or Duroc × (Landrace × Large White)) and two industrial hybrids (Goland and Danbred), which are used for dry-cured ham production. Significant associations of SCD and MTTP were found with carcass weight. DGAT2 was associated with back fat thickness and L* fat colour (objective white colour score). Several genes (DGAT2, MTTP &FASN) were associated with weight loss during salting, first step in dry-cured ham production, affecting final yield. Finally, MTTP was associated with shear force. Our findings suggest that the SCD, DGAT2, MTTP and FASN polymorphisms are associated with quality of heavy pig meat products. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Frequent epigenetic silencing of the folate-metabolising gene cystathionine-beta-synthase in gastrointestinal cancer.

    Directory of Open Access Journals (Sweden)

    Hong Zhao

    Full Text Available Both gastric and colorectal cancers (CRC are the most frequently occurring malignancies worldwide with the overall survival of these patients remains unsatisfied. Identification of tumor suppressor genes (TSG silenced by promoter CpG methylation uncovers mechanisms of tumorigenesis and identifies new epigenetic biomarkers for early cancer detection and prognosis assessment. Cystathionine-beta-synthase (CBS functions in the folate metabolism pathway, which is intricately linked to methylation of genomic DNA. Dysregulation of DNA methylation contributes substantially to cancer development.To identify potential TSGs silenced by aberrant promoter methylation in CRC, we analyzed tumor and adjacent tissues from CRC cases using the Illumina Human Methylation45 BeadChip. We identified hypermethylation of the CBS gene in CRC samples, compared to adjacent tissues. Methylation and decreased mRNA expression of CBS were detected in most CRC cell lines by methylation-specific PCR and semiquantitative RT-PCR, as well as in gastric cancer. Treatment with 5-aza-2'-deoxycytidine and/or trichostatin A reversed methylation and restored CBS mRNA expression indicating a direct effect. Aberrant methylation was further detected in 31% of primary CRCs (29 of 96 and 55% of gastric tumors (11 of 20. In contrast, methylation was seldom found in normal tissues adjacent to the tumor. CBS methylation was associated with KRAS mutations in primary CRCs (P = 0.04, by χ(2-test. However, no association was found between CBS methylation or KRAS mutations with cancer relapse/metastasis in Stage II CRC patients.A novel finding from this study is that the folate metabolism enzyme CBS mRNA levels are frequently downregulated through CpG methylation of the CBS gene in gastric cancer and CRC, suggesting that CBS functions as a tumor suppressor gene. These findings warrant further study of CBS as an epigenetic biomarker for molecular diagnosis of gastrointestinal cancers.

  8. [Cloning and prokaryotic expression of Rhodoblastus acidophilus 5-aminolevlinate synthase gene].

    Science.gov (United States)

    Zhang, De-yong; Cheng, Fei-xue; Cheng, Ju-e; Zhang, Zhan-hong; Liu, Yong

    2007-08-01

    5-aminolevulinic acid (ALA) is formed by the enzyme ALA synthase (ALAS). However, the fidelity of ALAS gene among species is low. The ALAS gene of photosynthetic bacteria Rhodoblastus acidophilus was cloned from its genomic DNA by conventional PCR and Veterette PCR and further sequenced. The identity of ALAS gene among photosynthetic bacteria species is from 64.0% to 95.1% according to phylogenic analysis. Furthermore, the ALAS gene was subcloned into an expression vector pQE30. For the overproduction of ALA, the recombinant ALAS was overexpressed in Escherichia coli strains JM109, M15 and BL21 (DE3), respectively. The expected 44kD protein was detected by SDS-PAGE in three E. coli strains after IPTG induction and further purified by affinity purification on Ni-NTA. The conditions including strain, medium, substrate of ALA synthesize (glycine and succinic acid), and ALA dehydratase inhibitor (levulinic acid) were optimized for attainning the maximum yield of ALA in E. coli. The ALA production was established on E. coli M15, medium 1 supplied with 100mmol/L glycine and 50mmol/L succinic acid, and 40mmol/L levulinic acid. The activity of ALAS was up to 333U/min x mg of protein. Meanwhile, the output of ALA was reached to 5.379g/L, which is the highest yield of ALA up to date by biofermentation. ALA has a variety of agricultural applications not only as an herbicide, insecticide, and growth promoting factor, but also based on its ability to confer salt and cold temperature tolerance in plants. Our recombinant bacteria are of great potential in the production of ALA. Our results offer an easy and simple ALA mass production method and may stimulate the application of ALA in agriculture.

  9. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

    2003-01-01

    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  10. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.

    Science.gov (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi

    2007-11-01

    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  11. Geographical and Ethnic Distributions of the MTHFR C677T, A1298C and MTRR A66G Gene Polymorphisms in Chinese Populations: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Xingmin Wang

    Full Text Available The geographical and ethnic distributions of the polymorphic methylenetetrahydrofolate reductase (MTHFR mutations (C677T and A1298C and methionine synthase reductase (MTRR mutation (A66G remain heterogeneous in China. The goal of this study was to estimate the pooled frequencies of the alleles and associated genotypes of these gene polymorphisms among healthy populations in Mainland China.We systematically reviewed published epidemiological studies on the distributions of 3 genetic variants in Chinese healthy populations living in Mainland China through a meta-analysis. The relevant electronic databases were searched. All of the raw data of the eligible citations were extracted. The frequency estimates were stratified by geography, ethnicity and sex.Sixty-six studies were identified with a total of 92277 study participants. The meta-analysis revealed that the frequencies of the MTHFR C677T, A1298C, and MTRR A66G gene polymorphisms varied significantly between different ethnic groups and along geographical gradients. The frequencies of the 677T allele and 677TT genotype increased along the southern-central-northern direction across Mainland China (all Pvalues≤0.001. The frequencies of the 1298C, 1298CC, 66G and 66GG genotypes decreased along the south-central-north direction across the country (all Pvalues≤0.001.Our meta-analysis strongly indicates significant geographical and ethnic variations in the frequencies of the C677T, A1298C, and A66G gene polymorphisms in the folate metabolism pathway among Chinese populations.

  12. Geographical and Ethnic Distributions of the MTHFR C677T, A1298C and MTRR A66G Gene Polymorphisms in Chinese Populations: A Meta-Analysis.

    Science.gov (United States)

    Wang, Xingmin; Fu, Jinjian; Li, Qianxi; Zeng, Dingyuan

    2016-01-01

    The geographical and ethnic distributions of the polymorphic methylenetetrahydrofolate reductase (MTHFR) mutations (C677T and A1298C) and methionine synthase reductase (MTRR) mutation (A66G) remain heterogeneous in China. The goal of this study was to estimate the pooled frequencies of the alleles and associated genotypes of these gene polymorphisms among healthy populations in Mainland China. We systematically reviewed published epidemiological studies on the distributions of 3 genetic variants in Chinese healthy populations living in Mainland China through a meta-analysis. The relevant electronic databases were searched. All of the raw data of the eligible citations were extracted. The frequency estimates were stratified by geography, ethnicity and sex. Sixty-six studies were identified with a total of 92277 study participants. The meta-analysis revealed that the frequencies of the MTHFR C677T, A1298C, and MTRR A66G gene polymorphisms varied significantly between different ethnic groups and along geographical gradients. The frequencies of the 677T allele and 677TT genotype increased along the southern-central-northern direction across Mainland China (all Pvalues≤0.001). The frequencies of the 1298C, 1298CC, 66G and 66GG genotypes decreased along the south-central-north direction across the country (all Pvalues≤0.001). Our meta-analysis strongly indicates significant geographical and ethnic variations in the frequencies of the C677T, A1298C, and A66G gene polymorphisms in the folate metabolism pathway among Chinese populations.

  13. [Association between HLA-DQA1 gene copy number polymorphisms and susceptibility to gastric cancer].

    Science.gov (United States)

    Huang, Li-ming; Cheng, Yan; Yu, Dian-ke; Zhai, Kan; Tan, Wen; Lin, Dong-xin

    2012-04-01

    To explore the association between HLA-DQA1 gene copy number polymorphisms and gastric cancer risk in Chinese population, and the interaction of those genes and environmental factors. The genotype of HLA-DQA1 gene copy number polymorphisms was determined in 343 patients with gastric cancer and 330 controls by quantitative polymerase chain reaction. Logistic regression model was used to evaluate the impact of this polymorphism on the risk of developing gastric cancer and the gene-environment interaction. Compared with 0 copy of HLA-DQA1 gene carriers, the 2 copies of HLA-DQA1 gene carriers had a significantly increased risk of gastric cancer (OR = 1.87, 95%CI = 1.15 - 3.06, P = 0.012). Gene-environment interaction of HLA-DQA1 gene copy number polymorphisms and Helicobacter pylori infection significantly increased the risk of gastric cancer in a multiplicative manner, with an OR of 3.89 (95%CI = 1.75 - 8.57, P = 0.001). HLA-DQA1 gene copy number polymorphism is associated with gastric cancer susceptibility, and there is a multiplicative gene-environment interaction between this polymorphism and Hp infection in the development of gastric cancer.

  14. Polymorphisms in methylenetetrahydrofolate reductase and cystathionine beta-synthase in oral cancer - a case-control study in southeastern Brazilians

    Directory of Open Access Journals (Sweden)

    Andressa Barbosa

    Full Text Available ABSTRACT INTRODUCTION: Oral squamous cell carcinoma (OSCC is a serious public health problem, due to its high mortality rate and worldwide rising incidence. OSCC susceptibility is mediated by interactions between genetic and environmental factors. Studies suggest that genetic variants encoding enzymes involved in folate metabolism may modulate OSCC risk by altering DNA synthesis/repair and methylation process. OBJECTIVE: The goals of this study were to evaluate the association of three genotypic polymorphism (MTHFR C677T, MTHFR A1298C and CBS 844ins68 and oral cancer risk in southeastern Brazilians and evaluate the interactions between polymorphisms and clinical histopathological parameters. METHODS: This case-control study included 101 cases and 102 controls in the state of Espírito Santo, Brazil. MTHFR genotyping was done by PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism and CBS genotyping by PCR (polymerase chain reaction analysis. RESULTS: MTHFR C677T polymorphism was associated with lymph node involvement. Genotype CT + TT acted as a protective factor. MTHFR A1298C AC + CC genotype was associated with tumor differentiation, and possibly with a better prognosis. In risk analysis, no correlation was observed between genotypes and OSCC. CONCLUSION: We concluded that MTHFR C677T, MTHFR A1298C and CBS 844ins68 polymorphisms were not associated with OSCC risk in southeastern Brazilians; however, we suggest a prognosis effect associated with MTHFR C677T and A1298C polymorphisms in OSCC.

  15. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  16. Polymorphism of three milk protein genes in Mexican Jersey cattle

    Directory of Open Access Journals (Sweden)

    José Luis Zepeda-Batista

    2015-01-01

    Full Text Available The objective was to estimate the allelic and genotypic frequencies, genetic diversity and polymorphic information content for the β-casein, κ-casein and β-lactoglobulin genes. Blood and frozen semen samples were collected from 453 Jersey individuals registered by the Mexican Jersey Cattle Association. Twenty eight breed specific SNP primers for whole genes were used. The B allele of κ-casein had higher frequency (0.69 than the A (0.26 and E (0.05. For β-lactoglobulin, the highest frequency was for B (0.72, followed by A and C alleles (0.26 and 0.02, respectively. The β-casein allele with the highest frequency was A2 (0.71, followed by A1 (0.19, A3 (0.05, B (0.04 and C (0.01. The average genetic diversity (He was 0.53. The average locus effective allele number was 1.79. These results indicate a high allelic diversity for κ-caseín, β-casein and β-lactoglobulin that could be included in breeding programs in the population studied, aimed to improve the milk quality traits of economic importance.

  17. 4G/5G variant of plasminogen activator inhibitor-1 gene and severe pregnancy-induced hypertension: subgroup analyses of variants of angiotensinogen and endothelial nitric oxide synthase.

    Science.gov (United States)

    Kobashi, Gen; Ohta, Kaori; Yamada, Hideto; Hata, Akira; Minakami, Hisanori; Sakuragi, Noriaki; Tamashiro, Hiko; Fujimoto, Seiichiro

    2009-01-01

    Pregnancy-induced hypertension (PIH) is a common cause of perinatal mortality. It is believed to result from the interaction of several factors, including those related to the blood coagulation system. We performed genotyping and subgroup analyses to determine if the 4G/5G genotypes of the plasminogen activator inhibitor-1 gene (PAI-1) play a role in the pathogenesis of PIH, and to evaluate possible interactions of the PAI-1 polymorphisms with those of the angiotensinogen gene (AGT) and the endothelial nitric oxide synthase gene (NOS3). An association study of PAI-1 polymorphism, and subgroup analyses of common variants of AGT and NOS3, among 128 patients with PIH and 376 healthy pregnant controls. No significant differences were found between the cases and controls in the frequencies of allele 4G or the 4G/4G genotype. In subgroup analyses, after adjustment for multiple comparison, a significant association with the AGT TT genotype was found among women with the PAI-1 4G/4G genotype, and an association with the NOS3 GA+AA genotype was found among women with the 5G/5G or 4G/5G genotypes. Our findings suggest that there are at least 2 pathways in the pathogenesis of severe PIH. However, with respect to early prediction and prevention of severe PIH, although the PAI-1 4G/4G genotype alone was not a risk factor for severe PIH, the fact that PAI-1 genotypes are associated with varying risks for severe PIH suggests that PAI-1 genotyping of pregnant women, in combination with other tests, may be useful in the development of individualized measures that may prevent severe PIH.

  18. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  19. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2015-01-01

    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  20. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  1. Correlation of Homocysteine Metabolic Enzymes Gene Polymorphism and Mild Cognitive Impairment in the Xinjiang Uygur Population

    OpenAIRE

    Luo, Mei; Ji, Huihui; Zhou, Xiaohui; Liang, Jie; Zou, Ting

    2015-01-01

    Background The aim of this study was to investigate the genetic polymorphisms in the homocysteine (HCY) metabolic enzymes in the Xinjiang Uygur population who have mild cognitive impairment (MCI). Material/Methods Based on the epidemiological investigation, 129 cases of diagnosed Uygur MCI patients and a matched control group with 131 cases were enrolled for analyzing the association between the polymorphisms in the HCY metabolism related genes (C677T, A1298C, and G1968A polymorphisms in MTHF...

  2. Multiple pigmentation gene polymorphisms account for a substantial proportion of risk of cutaneous malignant melanoma

    OpenAIRE

    Duffy, David L.; Zhao, Z. Z.; Sturm, Richard A.; Hayward, Nicholas K.; Martin, Nicholas G.; Montgomery, Grant W.

    2009-01-01

    We have previously described the role of red hair (Melanocortin 1 Receptor, MC1R) and blue eye (Oculocutaneous Albinism Type 2, OCA2) gene polymorphisms in modulating risk of cutaneous malignant melanoma (CMM) in a highly sun-exposed population of European descent. A number of recent studies, including genome-wide association studies (GWAS), have identified numerous polymorphisms controlling human hair, eye and skin colour. In this paper, we test a selected set of polymorphisms in pigmentatio...

  3. Interaction of MTHFR C677T and A1298C, and MTR A2756G gene polymorphisms in breast cancer risk in a population in Northeast Brazil.

    Science.gov (United States)

    de Cássia Carvalho Barbosa, Rita; da Costa, Débora Menezes; Cordeiro, Denise Ellen Francelino; Vieira, Ana Patricia Freitas; Rabenhorst, Silvia Helena Barem

    2012-11-01

    Polymorphisms in genes encoding enzymes of folate metabolism are a focus of breast cancer risk studies due of the role of these enzymes in DNA methylation, synthesis, and repair. MTHFR, encoding for 5,10-methylenetetrahydrofolate reductase, is one of the most studied genes in this regard, but findings are controversial, and the majority of studies have analyzed polymorphisms individually. In this case control study, we examined the combination of the polymorphisms MTHFR C677T and A1298C with MTR A2756G, where MTR, methionine synthase, is an important enzyme of the folate cycle in the methylation pathway. One hundred and forty-two patients with breast cancer and controls were included and the genotypes were determined using PCR-RFLP. In the population studied, individuals carrying the polymorphic allele in the heterozygous state for both enzymes, MTHFR C677T and MTR A2756G, had an increased risk [odds ratio, OR=2.77 (95% confidence interval, CI=1.19-6.52)] for disease, compared to those with the wild genotype. In addition, individuals carrying the MTR 2756 genotype AG had an increased risk when this was combined with the MTHFR 1298 genotype CC [OR=5.13 (95% CI=0.87-38.82)]. No significant results were found from the analyses associating the MTHFR C677T and A1298C genotypes. However, when stratifying the patients by age (50 years old as the cut-off), patients over 50 years old had greater risk, with the presence of both MTHFR polymorphisms in the heterozygous state [OR=5.33 (95% CI=1.42-21.03)]. This study points out the importance of the interactions between the MTHFR C677T, MTHFR A1298C and MTR A2756G polymorphisms, and also highlights the relevance of the MTR A2756G polymorphism and age in breast cancer risk.

  4. Gene polymorphisms as risk factors for predicting the cardiovascular manifestations in Marfan syndrome. Role of folic acid metabolism enzyme gene polymorphisms in Marfan syndrome.

    Science.gov (United States)

    Benke, Kálmán; Ágg, Bence; Mátyás, Gábor; Szokolai, Viola; Harsányi, Gergely; Szilveszter, Bálint; Odler, Balázs; Pólos, Miklós; Maurovich-Horvat, Pál; Radovits, Tamás; Merkely, Béla; Nagy, Zsolt B; Szabolcs, Zoltán

    2015-10-01

    Folic acid metabolism enzyme polymorphisms are believed to be responsible for the elevation of homocysteine (HCY) concentration in the blood plasma, correlating with the pathogenesis of aortic aneurysms and aortic dissection. We studied 71 Marfan patients divided into groups based on the severity of cardiovascular involvement: no intervention required (n=27, Group A); mild involvement requiring intervention (n=17, Group B); severe involvement (n=27, Group C) subdivided into aortic dilatation (n=14, Group C1) and aortic dissection (n=13, Group C2), as well as 117 control subjects. We evaluated HCY, folate, vitamin B12 and the polymorphisms of methylenetetrahydrofolate reductase (MTHFR;c.665C>T and c.1286A>C), methionine synthase (MTR;c.2756A>G) and methionine synthase reductase (MTRR;c.66A>G). Multiple comparisons showed significantly higher levels of HCY in Group C2 compared to Groups A, B, C1 and control group (pMarfan patients, and especially aortic dissection, is associated with higher HCY plasma levels and prevalence of homozygous genotypes of folic acid metabolism enzymes than mild or no cardiovascular involvement. These results suggest that impaired folic acid metabolism has an important role in the development and remodelling of the extracellular matrix of the aorta.

  5. [Polymorphism of vitamin D receptor gene Fok I in Mongolian population of China].

    Science.gov (United States)

    Xing, Shao-ji; Zhou, Li-she; Xu, Xiu-ju

    2006-04-01

    To investigate the polymorphism distribution of vitamin D receptor (VDR) gene Fok I in Mongolian population of China. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used to analyze three genotypes FF, Ff and ff in the start codon of VDR gene (Fok I) in unrelated normal healthy Mongolian individuals of China. In the population, we obtained the allelic frequencies of 57% and 43% for (F) and (f) allele and the percentage of genotypes FF, Ff and ff to be 31%, 52%, and 17% respectively. The polymorphism frequency and distribution of this VDR gene Fok I in Mongolian population of China exhibit its own characteristics.

  6. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  7. Cytokine Gene Polymorphisms across Tuberculosis Clinical Spectrum in Pakistani Patients

    Science.gov (United States)

    Ansari, Ambreen; Talat, Najeeha; Jamil, Bushra; Hasan, Zahra; Razzaki, Tashmeem; Dawood, Ghaffar; Hussain, Rabia

    2009-01-01

    Background Pakistan ranks 7th globally in terms of tuberculosis (TB) disease burden (incidence 181/100000 pop./yr; prevalence of 329/pop./yr). Reports from different populations show variable associations of TB susceptibility and severity with cytokine gene polymorphisms. Tuberculosis clinical severity is multi-factorial and cytokines play a pivotal role in the modulation of disease severity. We have recently reported that the ratio of two key cytokines (IFNγ and IL10) show significant correlation with the severity spectrum of tuberculosis. The objective of the current study was to analyze the frequency of cytokine gene polymorphisms linked to high and low responder phenotypes (IFNγ +874 T hi→A lo and IL10 −1082 G lo→A hi) in tuberculosis patients. Methods and Findings Study groups were stratified according to disease site as well as disease severity: Pulmonary N = 111 (Minimal, PMN = 19; Moderate, PMD = 63; Advance, PAD = 29); Extra-pulmonary N = 67 (Disseminated DTB = 20, Localized LTB = 47) and compared with healthy controls (TBNA = 188). Genotype analyses were carried out using amplification refractory mutation system-PCR (ARMS-PCR) and stimulated whole blood (WB) culture assay was used for assessing cytokine profiles. Our results suggest that the IFNγ +874 TT genotype and T allele was overrepresented in PMN (p = 0.01) and PMD (p = 0.02). IFNγ +874 TT in combination with IL10 GG lo genotypes showed the highest association (χ2 = 6.66, OR = 6.06, 95% CI = 1.31–28.07, p = 0.01). IFNγ AA lo on the other hand in combination with IL10 GG lo increased the risk of PAD (OR = 5.26; p = 0.005) and DTB (OR = 3.59; p = 0.045). Conclusion These findings are consistent with the role of IL10 in reducing collateral tissue damage and the protective role of IFNγ in limiting disease in the lung. PMID:19274101

  8. Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis.

    Science.gov (United States)

    Yigit, Serbulent; Inanir, Ahmet; Tekcan, Akın; Tural, Ercan; Ozturk, Gokhan Tuna; Kismali, Gorkem; Karakus, Nevin

    2014-03-01

    Interleukin-4 (IL-4) is a strong chondroprotective cytokine and polymorphisms within this gene may be a risk factor for osteoarthritis (OA). We aimed to investigate genotype and allele frequencies of IL-4 gene intron 3 variable number of tandem repeats (VNTR) polymorphism in patients with knee OA in a Turkish population. The study included 202 patients with knee OA and 180 healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers followed by restriction fragment length polymorphism (RFLP) analysis. Our result show that there was statistically significant difference between knee OA patients and control group with respect to IL-4 genotype distribution and allele frequencies (p=0.000, OR: 0.20, 95% CI: 0.10-0.41, OR: 0.22, 95% CI: 0.12-0.42, respectively). Our findings suggest that there is an association of IL-4 gene intron 3 VNTR polymorphism with susceptibility of a person for development of knee OA. As a result, IL-4 gene intron 3 VNTR polymorphism could be a genetic marker in OA in a Turkish study population. This is the first association study that evaluates the associations between IL-4 gene VNTR polymorphism and knee OA. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  9. The (CTGn polymorphism in the NOTCH4 gene is not associated with schizophrenia in Japanese individuals

    Directory of Open Access Journals (Sweden)

    Okubo Takehito

    2001-06-01

    Full Text Available Abstract Background The human NOTCH4 gene is a candidate gene for schizophrenia due to its chromosomal location and neurobiological roles. In a British linkage study, NOTCH4 gene polymorphisms were highly associated with schizophrenia. In a Japanese case-control association study, however, these polymorphisms did not show significant associations with schizophrenia. We conducted a case-control study with Japanese subjects to explore an association between the triplet repeat polymorphism in the NOTCH4 gene and schizophrenia, including subtypes of schizophrenia, longitudinal disease course characteristics, and a positive family history for psychoses. Methods We examined the (CTGn repeat polymorphism in the NOTCH4 gene among 100 healthy Japanese individuals and 102 patients with schizophrenia (22 paranoid, 38 disorganized, 29 residual, 64 episodic, 31 continuous, 42 with prominent negative symptoms, and 46 with positive family histories using a polymerase chain reaction-based, single-strand conformational polymorphism analysis. Results Five different alleles consisting of 6, 9, 10, 11, and 13 repeats of CTG (Leu in patients with schizophrenia, and 4 alleles consisting of 6, 9, 10, and 11 repeats in controls were found. No significant differences in genotype or allele frequencies of repeat numbers were found between controls and patients. In addition, there were no associations between the polymorphism and schizophrenia subtypes, longitudinal disease course characteristics, or positive family history of the patients. Conclusions Our data suggest a lack of association between the NOTCH4 gene triplet repeat polymorphism and schizophrenia in Japanese individuals.

  10. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  11. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Science.gov (United States)

    Mishra, Smrati; Bansal, Shilpi; Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S

    2016-01-01

    Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  12. A multilevel prediction of physiological response to challenge: Interactions among child maltreatment, neighborhood crime, endothelial nitric oxide synthase gene (eNOS), and GABA(A) receptor subunit alpha-6 gene (GABRA6).

    Science.gov (United States)

    Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante

    2015-11-01

    Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.

  13. Molecular characterization of a transient expression gene encoding for 1-aminocyclopropane-1-carboxylate synthase in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Wang, Xia; Zhang, Ying; Zhang, Jiedao; Cheng, Cheng; Guo, Xingqi

    2007-09-30

    Ethylene performs an important function in plant growth and development. 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), the key enzyme involved in ethylene biosynthesis, has been the focus of most ethylene studies. Here, a cotton ACS gene referred to as Gossypium hirsutum ACS1 (GhACS1), was isolated. The full-length cDNA of GhACS1 encodes for a 476-amino acid protein which harbors seven conserved regions, 11 invariant amino acid residues, and the PLP binding active site, all of which characterize ACC synthases. Alignment analysis showed that GhACS1 shared a high degree of identity with other known ACC synthases from different species. Two introns were detected in the genomic DNA sequence, and the results of Southern blot analysis suggested that there might be a multi-gene family encoding for ACC synthase in cotton. From the phylogenetic tree constructed with 24 different kinds of ACC synthases, we determined that GhACS1 falls into group II, and was closely associated with the wound-inducible ACS of citrus. The analysis of the 5' flanking region of GhACS1 revealed a group of putative cis-acting elements. The results of expression analysis showed that GhACS1 displayed its transient expression nature after wounding, abscisic acid (ABA), and CuCl(2) treatments. These results indicate that GhACS1, which was transiently expressed in response to certain stimuli, may be involved in the production of ethylene for the transmission of stress signals.

  14. Carotenoid content and expression of phytoene synthase and phytoene desaturase genes in bitter melon (Momordica charantia).

    Science.gov (United States)

    Tuan, Pham Anh; Kim, Jae Kwang; Park, Nam Il; Lee, Sook Young; Park, Sang Un

    2011-06-15

    Momordica charantia, a tropical plant, produces a fruit that has a β-carotene concentration five times higher than that of carrot. To elucidate the molecular basis of β-carotene accumulation in M. charantia, the gene expression levels of phytoene synthase (McPSY) and phytoene desaturase (McPDS) were determined. These levels were particularly high in the flowers of M. charantia. During fruit maturation, the expression levels of McPSY and McPDS decreased during the mid-stages but increased in the fully mature fruit. In addition, carotenoids accumulated as the peel changed from green to orange. Thus, McPSY and McPDS expression correlated with carotenoid accumulation during fruit maturation. Principal component analysis (PCA) also was used to evaluate the differences among the profiles of seven carotenoids identified in the fruit at several maturation stages. Riper fruits had higher carotenoid concentrations than less ripe fruits. Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  15. Metagenomic Survey of Potential Symbiotic Bacteria and Polyketide Synthase Genes in an Indonesian Marine Sponge

    Directory of Open Access Journals (Sweden)

    Nia M. Kurnia

    2017-01-01

    Full Text Available There has been emerging evidence that the bacteria associated with marine sponges are the key producers of many complex bioactive compounds. The as-yet uncultured candidate bacterial genus “Candidatus Entotheonella” of the marine sponge Theonella swinhoei from Japan have recently been recognized as the source of numerous pharmacologically relevant polyketides and modified peptides, as previously reported by the Piel group (Wilson et al. 2014. This work reported the presence of “Candidatus Entotheonella sp.” in the highly complex microbiome of an Indonesian marine sponge from Kapoposang Island, South Sulawesi. We further identified the Kapoposang sponge specimen used in this work as Rhabdastrella sp. based on the integrated morphological, histological, and cytochrome oxidase subunit I (COI gene analyses. To detect the polyketide biosynthetic machinery called type I polyketide synthase (PKS in this Indonesian Rhabdastrella sp., we amplified and cloned the ketosynthase-encoding DNA regions of approximately 700 bp from the uncultured sponge's microbiome. Further sequencing and analysis of several randomly chosen clones indicated that all of them are mostly likely involved in the biosynthesis of methyl-branched fatty acids. However, employing a PKS-targeting primer designed in this work led to the isolation of four positive clones. BlastX search and subsequent phylogenetic analysis showed that one of the positive clones, designed as RGK32, displayed high homology with ketosynthase domains of many type I PKS systems and may belong to the subclass cis-AT PKS group.

  16. Expression of monoamine transporters, nitric oxide synthase 3 and neurotrophin genes in antidepressant-stimulated astrocytes

    Directory of Open Access Journals (Sweden)

    Sarah eKittel-Schneider

    2012-04-01

    Full Text Available Background: There is increasing evidence that glial cells play a role in the pathomechanisms of mood disorders and the mode of action of antidepressant drugs. Methods: To examine whether there is a direct effect on the expression of different genes encoding proteins that have been implicated in the pathophysiology of affective disorders, primary astrocyte cell cultures from rats were treated with two different antidepressant drugs, imipramine and escitalopram, and the mRNA expression of brain derived neurotrophic factor (Bdnf, serotonin transporter (5Htt, dopamine transporter (Dat and endothelial nitric oxide synthase (Nos3 was examined. Results: Stimulation of astroglial cell culture with imipramine, a tricyclic antidepressant, lead to a significant increase of the Bdnf mRNA level whereas treatment with escitalopram did not. In contrast, 5Htt was not differentially expressed after antidepressant treatment. Finally, neither Dat nor Nos3 mRNA expression was detected in cultured astrocytes. Conclusions: These data provide further evidence for a role of astroglial cells in the molecular mechanisms of action of antidepressants.

  17. Identification and characterization of a novel trehalose synthase gene derived from saline-alkali soil metagenomes.

    Directory of Open Access Journals (Sweden)

    Ling Jiang

    Full Text Available A novel trehalose synthase (TreS gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn(2+ and Hg(2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficiency (Kcat/K m for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%, making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis.

  18. [Analyses of coding sequence point mutation and polymorphism of TGFBI gene in Chinese patients with keratoconus].

    Science.gov (United States)

    GUAN, Tao; MA, Zhang-wei; DING, Shi-ping

    2011-04-01

    To investigate the point mutations and polymorphisms of transforming growth factor beta-induced gene (TGFBI) in Chinese patients with keratoconus and discuss the relationship between the feature of gene mutations and single nucleotide polymorphisms of TGFBI gene and keratoconus. Polymerase chain reaction single strand conformation polymorphism and DNA direct sequencing were performed in 30 keratoconus cases and 30 healthy controls. All 17 exons of the TGFBI gene were analyzed for point mutations and single nucleotide polymorphisms. Totally two heterozygous nucleotide changes were identified in exon 12 of the TGFBI gene. The codon 535 is changed from GGA to TGA in 1 patient, leading to a substitution of glycine to a stop codon at the protein level (G535X). The codon 540 is changed from TTT to TTC in 2 patients and 1 control individual, resulting in a nonsense mutation (F54F), and is a single nucleotide polymorphism of the gene. Mutation and polymorphisms of the TGFBI gene were detected in Chinese patients with keratoconus in this study. The results suggest that TGFBI gene might play an important role in the pathogenesis of keratoconus.

  19. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

    Science.gov (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

    2016-02-01

    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  20. Polymorphisms in methylenetetrahydrofolate reductase and cystathionine beta-synthase in oral cancer - a case-control study in southeastern Brazilians.

    Science.gov (United States)

    Barbosa, Andressa; Dos Santos, Marcelo; de Podestá, José Roberto Vasconcelos; Gouvêa, Sônia Alves; Von Zeidler, Sandra Ventorin; Louro, Iúri Drumond; Cordeiro-Silva, Melissa de Freitas

    2016-01-01

    Oral squamous cell carcinoma (OSCC) is a serious public health problem, due to its high mortality rate and worldwide rising incidence. OSCC susceptibility is mediated by interactions between genetic and environmental factors. Studies suggest that genetic variants encoding enzymes involved in folate metabolism may modulate OSCC risk by altering DNA synthesis/repair and methylation process. The goals of this study were to evaluate the association of three genotypic polymorphism (MTHFR C677T, MTHFR A1298C and CBS 844ins68) and oral cancer risk in southeastern Brazilians and evaluate the interactions between polymorphisms and clinical histopathological parameters. This case-control study included 101 cases and 102 controls in the state of Espírito Santo, Brazil. MTHFR genotyping was done by PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism) and CBS genotyping by PCR (polymerase chain reaction) analysis. MTHFR C677T polymorphism was associated with lymph node involvement. Genotype CT+TT acted as a protective factor. MTHFR A1298C AC+CC genotype was associated with tumor differentiation, and possibly with a better prognosis. In risk analysis, no correlation was observed between genotypes and OSCC. We concluded that MTHFR C677T, MTHFR A1298C and CBS 844ins68 polymorphisms were not associated with OSCC risk in southeastern Brazilians; however, we suggest a prognosis effect associated with MTHFR C677T and A1298C polymorphisms in OSCC. Copyright © 2015 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  1. Association of polymorphisms in avian apoVLDL-II gene with body ...

    African Journals Online (AJOL)

    Association of polymorphisms in avian apoVLDL-II gene with body weight and abdominal fat weight. HH Musa, GH Chen ... Blood samples from the respective populations were taken for DNA extraction, and then slaughter for fat determination. Polymorphism was detected by PCR-RFLP and PCR-SSCP techniques.

  2. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC...

  3. Effect of CYP2C9 *3 gene polymorphism on lipid-lowering efficacy of ...

    African Journals Online (AJOL)

    Effect of CYP2C9 *3 gene polymorphism on lipid-lowering efficacy of fluvastatin in a Chinese hyperlipidemic population. ... Tropical Journal of Pharmaceutical Research ... and to analyze the impact of CYP2C9*3 genetic polymorphism on the cholesterol-lowering effect of fluvastatin in a Chinese hyperlipidemic population.

  4. Relationship between IL-10 gene -819C/T polymorphism and the ...

    African Journals Online (AJOL)

    Background: The -819C/T polymorphism in interleukin 10 (IL-10) gene has been reported to be associated with inflammatory bowel disease (IBD) ,but the previous results are conflicting. Materials and methods: The present study aimed at investigating the association between this polymorphism and risk of IBD using a ...

  5. Angiotensin-converting enzyme gene I/D polymorphism and renal disease

    NARCIS (Netherlands)

    Navis, G; van der Kleij, FGH; de Zeeuw, D; de Jong, PE

    1999-01-01

    In recent years a vast amount of data has been published on the association between the insertion/deletion (VD) polymorphism of the gene coding for angiotensin-converting enzyme and renal disease. It has be come clear that the polymorphism does not affect the prevalence of renal disease. However,

  6. Polymorphisms in Dopamine System Genes Are Associated with Individual Differences in Attention in Infancy

    Science.gov (United States)

    Holmboe, Karla; Nemoda, Zsofia; Fearon, R. M. Pasco; Csibra, Gergely; Sasvari-Szekely, Maria; Johnson, Mark H.

    2010-01-01

    Knowledge about the functional status of the frontal cortex in infancy is limited. This study investigated the effects of polymorphisms in four dopamine system genes on performance in a task developed to assess such functioning, the Freeze-Frame task, at 9 months of age. Polymorphisms in the catechol-O-methyltransferase ("COMT") and the…

  7. Polymorphism of glucagon-like peptide-1 receptor gene (rs1042044 ...

    African Journals Online (AJOL)

    patience

    2015-02-16

    Feb 16, 2015 ... turnover via GLP-1 receptors (GLP1Rs) in postmenopausal state. Furthermore, polymorphisms in. GLP1R gene were suggested to affect the function of GLP1Rs and be associated with many diseases. However, the relationships between GLP1R polymorphisms and osteoporosis susceptibility and bone.

  8. Polymorphisms of the prion protein gene Arabi sheep breed in Iran ...

    African Journals Online (AJOL)

    Ovine scrapie is a neurodegenerative disease caused by polymorphisms of the prion protein gene (Prnp); especially the amino acid residue alterations at codons 136, 154, and 174, in sheep have been found to be associated with susceptibility to scrapie disease. We studied Prnp polymorphisms in local sheep of ...

  9. Mitochondrial ATP synthase deficiency due to a mutation in the ATP5E gene for the F1 e subunit

    Czech Academy of Sciences Publication Activity Database

    Mayr, J. A.; Havlíčková, Vendula; Zimmermann, F.; Magler, I.; Kaplanová, Vilma; Ješina, Pavel; Pecinová, Alena; Nůsková, Hana; Koch, J.; Sperl, W.; Houštěk, Josef

    2010-01-01

    Roč. 19, č. 17 (2010), s. 3430-3439 ISSN 0964-6906 R&D Projects: GA MZd(CZ) NS9759; GA MŠk(CZ) 1M0520 Grant - others:Univerzita Karlova(CZ) 97807 Institutional research plan: CEZ:AV0Z50110509 Keywords : ATP-synthase * ATP5E * disease Subject RIV: EB - Gene tics ; Molecular Biology Impact factor: 8.058, year: 2010

  10. Multifactor dimensionality reduction analysis of MTHFR, PAI-1, ACE, PON1, and eNOS gene polymorphisms in patients with early onset coronary artery disease.

    Science.gov (United States)

    Agirbasli, M; Guney, A I; Ozturhan, H S; Agirbasli, D; Ulucan, K; Sevinc, D; Kirac, D; Ryckman, K K; Williams, S M

    2011-12-01

    Association studies in the Turkish population have investigated the single locus effects of different gene polymorphisms on coronary artery disease (CAD). CAD is a complex polygenic disease that involves complex interactions among multiple genetic and environmental conditions. We evaluated associations of five candidate genetic polymorphisms (methylene tetrahydrofolate reductase C677T, plasminogen activator inhibitor 4G/5G, endothelial nitric oxide synthase (eNOS) 3-27 base pair repeat, insertion, or deletion of a 287 bp Alu repeat sequence polymorhism of angiotensin I converting enzyme, and paraoxonase Gln192Arg PON1 polymorphisms) with the presence and extent of early onset CAD. DNA was isolated and amplified from 90 consecutive patients with angiographically proven early onset CAD (ages 41 ± 5 for men, 49 ± 7 for women) and also from 90 control subjects with no significant coronary obstruction angiographically (ages 42 ± 5 for men, 48 ± 6 for women). Multifactor dimensionality reduction (MDR) analysis was performed to identify a model of CAD based on both genetic and conventional risk factors. MDR analysis detected a significant model with four genes (prediction success ∼ 61%, p = 0.03). When the total number of the conventional risk factors is analysed with the candidate polymorphisms, a different model is identified that includes three of the four genes from the above model and achieves a similar prediction of CAD as the gene only model. These data indicate that gene-gene and gene-environmental risk interactions form significant models in predicting early onset CAD.

  11. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  12. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  13. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  14. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

    2001-01-01

    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  15. Influence of FCGRT gene polymorphisms on pharmacokinetics of therapeutic antibodies.

    Science.gov (United States)

    Passot, Christophe; Azzopardi, Nicolas; Renault, Sylvaine; Baroukh, Nadine; Arnoult, Christophe; Ohresser, Marc; Boisdron-Celle, Michèle; Gamelin, Erick; Watier, Hervé; Paintaud, Gilles; Gouilleux-Gruart, Valérie

    2013-01-01

    The neonatal Fc receptor (FcRn) encoded by FCGRT is known to be involved in the pharmacokinetics (PK) of therapeutic monoclonal antibodies (mAbs). Variability in the expression of FCGRT gene and consequently in the FcRn protein level could explain differences in PK observed between patients treated with mAbs. We studied whether the previously described variable number tandem repeat (VNTR) or copy number variation (CNV) of FCGRT are associated with individual variations of PK parameters of cetuximab. VNTR and CNV were assessed on genomic DNA of 198 healthy individuals and of 94 patients treated with the therapeutic mAb. VNTR and CNV were analyzed by allele-specific PCR and duplex real-time PCR with Taqman (®) technology, respectively. The relationship between FCGRT polymorphisms (VNTR and CNV) and PK parameters of patients treated with cetuximab was studied. VNTR3 homozygote patients had a lower cetuximab distribution clearance than VNTR2/VNTR3 and VNTR3/VNTR4 patients (p = 0.021). We observed no affects of VNTR genotype on elimination clearance. One healthy person (0.5%) and 1 patient (1.1%) had 3 copies of FCGRT. The PK parameters of this patient did not differ from those of patients with 2 copies. The FCGRT promoter VNTR may influence mAbs' distribution in the body. CNV of FCGRT cannot be used as a relevant pharmacogenetic marker because of its low frequency.

  16. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  17. Association of ACE Gene I/D polymorphism with migraine in Kashmiri population

    Directory of Open Access Journals (Sweden)

    Irfan Yousuf Wani

    2016-01-01

    Full Text Available Introduction: Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. Materials and Methods: The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP. Results: Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. Conclusion: We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.

  18. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

    Science.gov (United States)

    Oberding, Lisa K; Gieg, Lisa M

    2018-01-01

    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  19. Gene Polymorphisms and Chemotherapy in Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Kayo OSAWA

    2009-08-01

    Full Text Available The phamacogenetics is being used to predict whether the selected chemotherapy will be really effective and tolerable to the patient. Irinotecan, oxidized by CYP3A4 to produce inactive compounds, is used for treatment of various cancers including advanced non small cell lung cancer (NSCLC patients. CYP3A4*16B polymorphism was associated with decreased metabolism of irrinotecan. Irinotecan is also metabolized by carboxylesterase to its principal active metabolite, SN-38, which is subsequently glucuronidated by UGT1As to form the inactive compound SN-38G. UGT1A1*28 and UGT1A1*6 polymorphisms were useful for predicting severe toxicity with NSCLC patients treated with irinotecan-based chemotherapy. Platinum-based compounds (cisplatin, carboplatin are being used in combination with new cytotoxic drugs such as gemcitabine, paclitaxel, docetaxel, or vinorelbine in the treatment of advanced NSCLC. Cisplatin activity is mediated through the formation of cisplatin-DNA adducts. Gene polymorphisms of DNA repair factors are therefore obvious candidates for determinants of repair capacity and chemotherapy efficacy. ERCC1, XRCC1 and XRCC3 gene polymorphisms were a useful marker for predicting better survival in advanced NSCLC patients treated with platinum-based chemotherapy. XPA and XPD polymorphisms significantly increased response to platinum-based chemotherapy. These DNA repair gene polymorphisms were useful as a predictor of clinical outcome to the platinum-based chemotherapy. EGFR kinase inhibitors induce dramatic clinical responses in NSCLC patients with advanced disease. EGFR gene polymorphism in intron 1 contains a polymorphic single sequence dinucleotide repeat (CA-SSR showed a statistically significant correlation with the gefitinib response and was appeared to be a useful predictive marker of the development of clinical outcome containing skin rashes with gefitinib treatment. The other polymorphisms of EGFR were also associated with increased EGFR

  20. Association of Interleukin 27 gene polymorphism and risk of Hepatitis B viral infection in Egyptian population

    Directory of Open Access Journals (Sweden)

    Yasser B.M. Ali

    2014-01-01

    Conclusion: Our data suggested that polymorphisms in the IL-27 gene may not contribute to HBV susceptibility. Further studies with large sample size should be conducted to validate these results in Egyptian population.

  1. Relationship of PON1 192 and 55 gene polymorphisms to calcific valvular aortic stenosis

    DEFF Research Database (Denmark)

    Moura, Luis M; Faria, Susana; Brito, Miguel

    2012-01-01

    Paraoxonases may exert anti-atherogenic action by reducing lipid peroxidation. Previous studies examined associations between polymorphisms in the paraoxonase 1 (PON1) gene and development of coronary artery disease (CAD), with inconsistent results. Given the similarities in clinical...

  2. Androgen Receptor Gene Polymorphism, Aggression, and Reproduction in Tanzanian Foragers and Pastoralists

    Science.gov (United States)

    Butovskaya, Marina L.; Lazebny, Oleg E.; Vasilyev, Vasiliy A.; Dronova, Daria A.; Karelin, Dmitri V.; Mabulla, Audax Z. P.; Shibalev, Dmitri V.; Shackelford, Todd K.; Fink, Bernhard; Ryskov, Alexey P.

    2015-01-01

    The androgen receptor (AR) gene polymorphism in humans is linked to aggression and may also be linked to reproduction. Here we report associations between AR gene polymorphism and aggression and reproduction in two small-scale societies in northern Tanzania (Africa)—the Hadza (monogamous foragers) and the Datoga (polygynous pastoralists). We secured self-reports of aggression and assessed genetic polymorphism of the number of CAG repeats for the AR gene for 210 Hadza men and 229 Datoga men (aged 17–70 years). We conducted structural equation modeling to identify links between AR gene polymorphism, aggression, and number of children born, and included age and ethnicity as covariates. Fewer AR CAG repeats predicted greater aggression, and Datoga men reported more aggression than did Hadza men. In addition, aggression mediated the identified negative relationship between CAG repeats and number of children born. PMID:26291982

  3. RAPTOR gene polymorphism is independently correlated with urothelial cancer susceptibility compared with environmental toxin exposure

    Directory of Open Access Journals (Sweden)

    Hao Lun Luo

    2017-12-01

    Conclusion: RAPTOR gene polymorphisms are important SNPs with significantly association with the risk of urothelial cancer in Taiwan. Further researches about raptor-mTOR complex interfering malignant transformation of urothelium is worthy of further investigation.

  4. Role of TLR4 gene polymorphisms in the colorectal cancer risk ...

    African Journals Online (AJOL)

    Role of TLR4 gene polymorphisms in the colorectal cancer risk modulation in ethnic Kashmiri population – A case–control study. Saniya Nissar, Aga Syed Sameer, Roohi Rasool, Qurteeba Qadri, Nissar A. Chowdri, Fouzia Rashid ...

  5. DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...

    African Journals Online (AJOL)

    We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...

  6. Contrasting genetic influence of PON 1 coding gene polymorphisms ...

    African Journals Online (AJOL)

    Background: Paraoxonase (PON1) is an A-esterase capable of hydrolyzing the active metabolites (oxons) of many organophosphorus (OP) insecticides. Human PON1 displays two polymorphisms in the coding region (Q192R and L55M) and several polymorphisms in the promoter and the 30-UTR regions. Animal studies ...

  7. Impact of genetic polymorphisms of four cytokine genes on treatment ...

    African Journals Online (AJOL)

    Background: Many factors contribute for viral clearance and response to antiviral therapy. Genetic polymorphisms of cytokines, chemokines, and their receptors can alter the immune response against Hepatitis C virus (HCV). Aim of the study: The aim of the current study is to assess single nucleotide polymorphism (SNP) in ...

  8. Do prion protein gene polymorphisms induce apoptosis in non

    Indian Academy of Sciences (India)

    To elucidate the relationship between the SNPs and apoptosis, TUNEL assays and active caspase-3 immunodetection techniques in brain sections of the polymorphic samples were performed. The results revealed that TUNEL-positive cells and active caspase-3-positive cells in the turtles with four polymorphisms were ...

  9. Association of MTHFR gene polymorphisms with breast cancer survival

    Directory of Open Access Journals (Sweden)

    Mechanic Leah E

    2006-10-01

    Full Text Available Abstract Background Two functional single nucleotide polymorphisms (SNPs in the 5,10-methylenetetrahydrofolate reductase (MTHFR gene, C677T and A1298C, lead to decreased enzyme activity and affect chemosensitivity of tumor cells. We investigated whether these MTHFR SNPs were associated with breast cancer survival in African-American and Caucasian women. Methods African-American (n = 143 and Caucasian (n = 105 women, who had incident breast cancer with surgery, were recruited between 1993 and 2003 from the greater Baltimore area, Maryland, USA. Kaplan-Meier survival and multivariate Cox proportional hazards regression analyses were used to examine the relationship between MTHFR SNPs and disease-specific survival. Results We observed opposite effects of the MTHFR polymorphisms A1298C and C677T on breast cancer survival. Carriers of the variant allele at codon 1298 (A/C or C/C had reduced survival when compared to homozygous carriers of the common A allele [Hazard ratio (HR = 2.05; 95% confidence interval (CI, 1.05–4.00]. In contrast, breast cancer patients with the variant allele at codon 677 (C/T or T/T had improved survival, albeit not statistically significant, when compared to individuals with the common C/C genotype (HR = 0.65; 95% CI, 0.31–1.35. The effects were stronger in patients with estrogen receptor-negative tumors (HR = 2.70; 95% CI, 1.17–6.23 for A/C or C/C versus A/A at codon 1298; HR = 0.36; 95% CI, 0.12–1.04 for C/T or T/T versus C/C at codon 677. Interactions between the two MTHFR genotypes and race/ethnicity on breast cancer survival were also observed (A1298C, pinteraction = 0.088; C677T, pinteraction = 0.026. Conclusion We found that the MTHFR SNPs, C677T and A1298C, were associated with breast cancer survival. The variant alleles had opposite effects on disease outcome in the study population. Race/ethnicity modified the association between the two SNPs and breast cancer survival.

  10. Antioxidant-related gene polymorphisms associated with the cardio-ankle vascular index in young Russians.

    Science.gov (United States)

    Sorokin, Alexander V; Kotani, Kazuhiko; Bushueva, Olga Y; Polonikov, Alexey V

    2016-04-01

    The cardio-ankle vascular index is a measure of arterial stiffness, whereas oxidative stress underlies arterial pathology. This study aimed to investigate the association between the cardio-ankle vascular index and antioxidant-related gene polymorphisms in young Russians. A total of 89 patients (mean age, 21.6 years) were examined by the cardio-ankle vascular index and for 15 gene polymorphisms related to antioxidant enzymes including FMO3 (flavin-containing monooxygenase 3), GPX1 (glutathione peroxidase 1), and GPX4 (glutathione peroxidase 4). A higher cardio-ankle vascular index level was detected in carriers with the KK-genotype of FMO3 polymorphism rs2266782 than in those without (mean levels: 6.2 versus 5.6, respectively, pcardio-ankle vascular index level was seen in carriers with the CC-genotype of GPX4 polymorphism rs713041 than in those without (6.0 versus 5.5, respectively, pcardio-ankle vascular index levels and the other gene polymorphisms. Although carriers with the LL-genotype of GPX1 polymorphism rs1050450 showed a higher diastolic blood pressure level than those without, the polymorphism did not affect the cardio-ankle vascular index level. This study showed a significant association between rs2266782 and rs713041 polymorphisms and arterial stiffness, as measured by the cardio-ankle vascular index, in young Russians. The pathways utilised by antioxidant enzymes may be responsible for early arterial stiffening in the Russian population.

  11. CYTOKINE GENE POLYMORPHISMS AS PREDICTORS OF CHRONIC PAIN SYNDROME IN ONCOLOGY

    Directory of Open Access Journals (Sweden)

    O. P. Bobrova

    2017-01-01

    Full Text Available The literature review on the role of cytokine gene polymorphisms in the development of chronic pain in cancer patients was presented using MedLine, PubMed, NEB elibrary.ru, WileyOnlineLibrary, WebofScience, OxfordUniversityPress and SAGEPremier databases for years 1995 to 2016. The role of inter-individual differences based on cytokine gene polymorphisms and their receptors for personalized anesthetic and accompanying treatment in oncology was shown.

  12. Effects of bovine prolactin gene polymorphism within exon 4 on milk ...

    African Journals Online (AJOL)

    In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for variation and genetic trends in milk yield and composition traits. Genomic DNAs were extracted from 268 semen samples belonged to Iranian Holstein bulls. Genotyping for the prolactin gene using PCRRFLP technique and RsaI ...

  13. Angiotensin II type 1 receptor (A1166C) gene polymorphism in ...

    African Journals Online (AJOL)

    Abstract. Background: Genetic variability in the genes of different components of renin-angiotensin system (RAS) is likely to contribute for its heterogenous association in renal diseased patients. Among the candidate genes of RAS, angiotensin II type 1 receptor gene polymorphism (AT1R A1166C) seems to be particularly ...

  14. Novel SNPs polymorphism of bovine CACNA2D1 gene and their ...

    African Journals Online (AJOL)

    user

    2011-03-07

    Mar 7, 2011 ... Mastitis is a major cause of economic loss in dairy cattle. In this study, the bovine CACNA2D1 gene was taken as a candidate gene for mastitis resistance. The objective of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine CACNA2D1 gene and evaluate the association of these.

  15. Angiotensin II type 1 receptor (A1166C) gene polymorphism in ...

    African Journals Online (AJOL)

    H. El-banawy

    2015-01-05

    Jan 5, 2015 ... Abstract Background: Genetic variability in the genes of different components of renin-angioten- sin system (RAS) is likely to contribute for its heterogenous association in renal diseased patients. Among the candidate genes of RAS, angiotensin II type 1 receptor gene polymorphism (AT1R. A1166C) seems ...

  16. Novel SNPs polymorphism of bovine CACNA2D1 gene and their ...

    African Journals Online (AJOL)

    In this study, the bovine CACNA2D1 gene was taken as a candidate gene for mastitis resistance. The objective of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine CACNA2D1 gene and evaluate the association of these SNPs with mastitis in cattle. Through DNA sequencing and PCR-RFLP ...

  17. Gene polymorphisms of TNF-α and IL-10 related to rheumatic heart ...

    African Journals Online (AJOL)

    Background: Rheumatic fever (RF) is inherited as a single recessive gene. Several genes are Likely to predispose an individual to develop rheumatic fever and rheumatic heart disease (RHD). Polymorphisms of TNF-α gene were associated with susceptibility to develop RF.T cells from all rheumatic fever patients produce ...

  18. Gene polymorphisms of TNF-α and IL-10 related to rheumatic heart ...

    African Journals Online (AJOL)

    Objectives: To test the relation of RHD and gene polymorphisms of pro- inflammatory cytokines TNF-α gene at position -308 and anti–inflammatory. IL-10 gene at position -1082. Subjects and Methods: This study included 20 children with chronic rheumatic heart disease (group A) and 10 healthy children as a control group.

  19. Gene polymorphism of aldosterone synthetase (CYP11B2 variants and main cardiovascular risk factors

    Directory of Open Access Journals (Sweden)

    L. Ye. Lobach

    2016-12-01

    Full Text Available Background. Purpose of the work – to investigate the possible relationship of the cardiovascular risk main factors with certain polymorphism of aldosterone synthase gene (CYP11B2. Materials and methods. Аt the Cardiology Department of PL Shupyk NMAPE general clinical examination of 378 patients was held. Patients were divided into four groups: 100 patients with postinfarction cardiosclerosis, 78 patients with CAD without myocardial infarction in history, 100 high cardiovascular risk patients (with diabetes, hypertension or dyslipidemia and 100 healthy patients (absence of cardiovascular disease was confirmed by medical history, ECG, blood pressure measurement and stress-ECG. Genetic testing was performed by polymerase chain reaction in real time at the Institute of Physiology named after O. O. Bogomolets. Exclusion criteria were hemodynamically significant valvular heart disease, chronic obstructive pulmonary disease, permanent or temporary heart pacing, acute heart failure and implanted cardioverter-defibrillator, permanent form of atrial fibrillation. Statistical analysis of the results was performed using Microsoft Excel, the statistical program SPSS (version 13US. Results. When analyzing the average levels of low density lipoprotein (LDL cholesterol statistically significant difference between the group of patients with postinfarction cardiosclerosis and the group of high-risk patients (2.93±1.2 mmol/L vs 3.4±1.2 mmol/L, p=0.0075 was demonstrated, indicating a better cholesterol control in the group of patients with postinfarction cardiosclerosis, despite the fact that the average cholesterol level did not reach the target. The highest average levels of triglycerides (TG were observed in patients with postinfarction cardiosclerosis – 1.56±0.725 mmol/L, intermediate – in patients with stable coronary artery disease – 1.39±0.795 mmol/L, and the lowest – in high cardiovascular risk patients – 1.04±0.565 mmol/L, with

  20. Linalool and linalool nerolidol synthases in roses, several genes for little scent.

    Science.gov (United States)

    Magnard, Jean-Louis; Bony, Aurélie Rius; Bettini, Fabienne; Campanaro, Ausilia; Blerot, Bernard; Baudino, Sylvie; Jullien, Frédéric

    2018-03-11

    Roses are widely appreciated for the appearance of their flowers and for their fragrance. This latter character results from the combination of different odorant molecules among which monoterpenes are often prevalent constituents. In this study, we report the cloning and characterization of three rose monoterpene synthases. In vitro functional characterization of these enzymes showed that one is a (-)-(3R)-linalool synthase whereas the others have a dual (+)-(3S)-linalool nerolidol synthase activity. However, given that the characterized rose cultivars were only able to produce the (-)-(3R)-linalool stereoisomer, the linalool nerolidol synthases are probably not active in planta. Furthermore, these three enzymes were also characterized by a weak expression level as assessed by RT-qPCR and by the low abundance of the corresponding sequences in an EST library. This characteristic is likely to explain why linalool is generally a minor constituent in rose flowers' scents. On this basis, we propose that in roses the monoterpene biosynthesis effort is focused on the production of acyclic monoterpenes derived from geraniol through the recently characterized Nudix biosynthesis pathway, at the expense of conventional monoterpene biosynthesis via terpene synthases such as linalool or linalool nerolidol synthases. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  1. Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

    Directory of Open Access Journals (Sweden)

    Duygu Gezen Ak

    2005-01-01

    Full Text Available Vitamin D receptor (VDR gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08. Also no association between biochemical data and VDR gene polymorphisms was observed.

  2. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz

    2016-03-01

    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  3. Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Dangler, C. A.; Sordillo, L. M.

    1995-01-01

    This study was conducted to investigate polymorphism of the coagulase gene of Staphylococcus aureus causing bovine mastitis. One hundred eighty-seven strains of S. aureus were isolated from bovine mastitic milk samples obtained from 187 different Danish dairy farms. The isolates were characterised......% of the isolates. The ease of analysing coagulase gene polymorphisms among a large number of strains, and the multiple distinct polymorphic patterns generated, supports the use of this technique in epidemiological investigations of bovine mastitis. The predominating variants may have predelection for causing...

  4. Allelic polymorphisms in the transcriptional regulatory region of apolipoprotein E gene.

    Science.gov (United States)

    Artiga, M J; Bullido, M J; Sastre, I; Recuero, M; García, M A; Aldudo, J; Vázquez, J; Valdivieso, F

    1998-01-09

    In this work, we explored the existence of genetic variants within the apolipoprotein E gene transcriptional regulatory region, using a denaturing gradient gel electrophoresis screening of a region comprising nucleotides -1017 to +406. Upon a population study, three new polymorphic sites (-491, -427 and -219) and two mutations were found. Functional effects of the polymorphisms, assayed by transient transfection and electrophoretic mobility shift assays in a human hepatoma cell line, showed that polymorphisms at sites -491 and -219 of the APOE promoter produce variations in the transcriptional activity of the gene, most probably through differential binding of nuclear proteins.

  5. Application of an optimized electroporation procedure for replacement of the polyhydroxyalkanoate synthase I gene in Nocardia corallina.

    Science.gov (United States)

    Valentin, H E; Dennis, D

    1996-07-01

    To develop a system for gene replacement in Nocardia corallina, a protocol for electroporation was optimized by systematic alterations of growth conditions, field strength, time constant and the electroporation buffer. Transformation efficiencies of 0.5 x 10(6) - 3 x 10(6) transformants/microgram plasmid DNA were obtained routinely. The gene encoding the polyhydroxyalkanoate (PHA) synthase I of N. corallina was cloned and interrupted by insertion of a kanamycin-resistance gene. The resulting plasmid was introduced into N. corallina by electroporation to inactivate the wild-type gene by homologous recombination. Kanamycin-resistant clones were screened by Southern hybridization for the absence of the wild-type gene and analyzed for PHA accumulation.

  6. Isolation of the GFA1 gene encoding glucosamine-6-phosphate synthase of Sporothrix schenckii and its expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Sánchez-López, Juan Francisco; González-Ibarra, Joaquín; Álvarez-Vargas, Aurelio; Milewski, Slawomir; Villagómez-Castro, Julio César; Cano-Canchola, Carmen; López-Romero, Everardo

    2015-06-01

    Glucosamine-6-phosphate synthase (GlcN-6-P synthase) is an essential enzyme involved in cell wall biogenesis that has been proposed as a strategic target for antifungal chemotherapy. Here we describe the cloning and functional characterization of Sporothrix schenckii GFA1 gene which was isolated from a genomic library of the fungus. The gene encodes a predicted protein of 708 amino acids that is homologous to GlcN-6-P synthases from other sources. The recombinant enzyme restored glucosamine prototrophy of the Saccharomyces cerevisiae gfa1 null mutant. Purification and biochemical analysis of the recombinant enzyme revealed some differences from the wild type enzyme, such as improved stability and less sensitivity to UDP-GlcNAc. The sensitivity of the recombinant enzyme to the selective inhibitor FMDP [N(3)-(4-methoxyfumaroyl)-l-2,3-diaminopropanoic acid] and other properties were similar to those previously reported for the wild type enzyme. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Interleukin-6 and tumor necrosis factor-alpha gene polymorphisms in chronic idiopathic urticaria.

    Science.gov (United States)

    Tavakol, M; Amirzargar, A A; Movahedi, M; Aryan, Z; Bidoki, A Z; Gharagozlou, M; Aghamohammadi, A; Nabavi, M; Ahmadvand, A; Behniafard, N; Heidari, K; Soltani, S; Rezaei, N

    2014-01-01

    This study was performed to evaluate association of gene polymorphisms among proinflammatory cytokines and susceptibility to chronic idiopathic urticaria (CIU). Ninety patients with prolonged urticaria more than 6 weeks were included as case group. Single nucleotide polymorphisms (SNPs) of IL-6 (G/C -174, G/A nt565) and TNF-α (G/A -308, G/A -238) were evaluated, using polymerase chain reaction (PCR); and the results were compared to the control group. G allele was significantly higher in the patients at locus of -238 of promoter of TNF-α gene (p<0.001). Frequency of following genotypes were significantly lower in patients with CIU, compared to controls: AG at -308 and GA at -238 of TNF-α gene (p<0.05 and p<0.001, respectively), CG at -174 and GG at +565 of IL-6 gene (p<0.05). Additionally, following genotypes were more common among patients with CIU: GG at -308 and -238 of TNF-α gene (p<0.05 and p<0.001, respectively), GG at -174 and GA at +565 of IL-6 gene (p<0.05). Pro-inflammatory cytokine gene polymorphisms can affect susceptibility to CIU. TNF-α promoter polymorphisms as well as IL-6 gene polymorphisms are associated with CIU. Copyright © 2013 SEICAP. Published by Elsevier Espana. All rights reserved.

  8. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: nishizaw@sk.ritsumei.ac.jp [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)

    2013-09-13

    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  9. Osteoporosis and polymorphisms of osteoprotegerin gene in postmenopausal women – a pilot study

    Directory of Open Access Journals (Sweden)

    Selma Cvijetic

    2016-03-01

    Full Text Available Objectives: Osteoprotegerin (OPG has an important role in bone remodeling, and it has been proposed that the OPG gene might be a candidate gene for osteoporosis predisposition. Several studies have already assessed the connection between OPG gene polymorphism and bone mineral density (BMD. In this study we wanted to analyze the association of two polymorphisms in the OPG gene with BMD and bone turnover markers in women with and without osteoporosis. Material and methods: In 22 postmenopausal women with osteoporosis (aged 65.6 ±12.6 and 59 women without osteoporosis (aged 60.8 ±8.7 we analyzed the association of two polymorphisms in the OPG gene with BMD, measured by dual energy absorptiometry and with bone turnover markers (crosslaps and osteoprotegerin. A163G, G209A, T245G and G1181C polymorphisms were determined. Results: No significant differences in age, anthropometry, number of fractures, osteocalcin and cross-laps were found between women with and without osteoporosis. Women with osteoporosis were significantly longer in postmenopause. Significantly more women with osteoporosis had AG polymorphism (p = 0.038 compared to women without osteoporosis, while no significant difference was found in prevalence of TT and GG polymorphism between patients with and without osteoporosis. No relationship was found between investigated polymorphism and bone turnover markers. A significant negative correlation between total hip BMD and crosslaps (p = 0.046 as well as between total hip T score and crosslaps (p = 0.044 was found in women without osteoporosis Conclusions : Postmenopausal women with osteoporosis had AG polymorphism more frequently than women without osteoporosis. Our results indicate that A163G polymorphism could have an impact on higher bone loss in postmenopausal women.

  10. Correlation of homocysteine metabolic enzymes gene polymorphism and mild cognitive impairment in the Xinjiang Uygur population.

    Science.gov (United States)

    Luo, Mei; Ji, Huihui; Zhou, Xiaohui; Liang, Jie; Zou, Ting

    2015-01-27

    The aim of this study was to investigate the genetic polymorphisms in the homocysteine (HCY) metabolic enzymes in the Xinjiang Uygur population who have mild cognitive impairment (MCI). Based on the epidemiological investigation, 129 cases of diagnosed Uygur MCI patients and a matched control group with 131 cases were enrolled for analyzing the association between the polymorphisms in the HCY metabolism related genes (C677T, A1298C, and G1968A polymorphisms in MTHFR, as well as the A2756G polymorphism in MS) and MCI by using the SNaPshot method. We then determined the homocysteine level in patients. In Xinjiang Uygur subjects, the A1298C polymorphisms in MTHFR and the A2756G polymorphisms in the MS gene in the MCI group were different from those in the control group. However, the C677T and G1968A polymorphisms in the MTHFR gene in MCI patients were not different from those in the control group. Multivariate logistic regression showed that, in addition to the well-known risk factors, such as low education level, high cholesterol level, high level of low-density lipoprotein, and high homocysteine levels, the A>G mutation in the MS gene at the rs1805087 locus was another independent risk factor for MCI in the Uyghur MCI population. The risk of MCI in G allele carriers was 2.265 times higher than that in matched control individuals (95% CI: 1.205~4.256, P<0.05). The genetic polymorphism of HCY metabolizing enzymes is correlated to the occurrence of MCI in the Xinjiang Uygur population. The A2756G polymorphism in the MS gene could be an independent risk factor for MCI in the Xinjiang Uygur population.

  11. How complex an intron may be? The example of the first intron of the CTP synthase gene of Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Roberto Piergentili

    2013-02-01

    Full Text Available In eukaryotes, maturation of primary transcripts into mature messenger RNAs involves the elimination of parts of the gene called ‘introns’. The biological significance of introns is not yet completely understood. It has been demonstrated that introns may contain other genes, or regulatory sequences that may be involved in transcriptional control, or also being involved in alternative splicing mechanisms. However, these functions explain the role of only a small number of them, and it is very difficult to formulate any generalization. The CTP synthase gene of Drosophila melanogaster is characterized by the presence of a long first intron (approximately 7.2 kilobases whose role is currently unknown. In the present report we analyzed in silico the content of this intron, and found that it contains at least three interesting sub-sequences. Two of them are homologous to the CTP synthase itself and to a putative nucleotide pyrophosphatase, respectively. The third is a short stretch of DNA able to fold into a thermodynamically stable hairpin and showing homology with other 19 sequences from 21 genes inside the D. melanogaster genome. These findings suggest a complex yet very accurate way of controlling gene expression inside the fruit fly.

  12. Genetic polymorphism of the OPG gene associated with breast cancer

    International Nuclear Information System (INIS)

    Ney, Jasmin Teresa; Juhasz-Boess, Ingolf; Gruenhage, Frank; Graeber, Stefan; Bohle, Rainer Maria; Pfreundschuh, Michael; Solomayer, Erich Franz; Assmann, Gunter

    2013-01-01

    The receptor activator of NF-κB (RANK), its ligand (RANKL) and osteoprotegerin (OPG) have been reported to play a role in the pathophysiological bone turnover and in the pathogenesis of breast cancer. Based on this we investigated the role of single nucleotide polymorphisms (SNPs) within RANK, RANKL and OPG and their possible association to breast cancer risk. Genomic DNA was obtained from Caucasian participants consisting of 307 female breast cancer patients and 396 gender-matched healthy controls. We studied seven SNPs in the genes of OPG (rs3102735, rs2073618), RANK (rs1805034, rs35211496) and RANKL (rs9533156, rs2277438, rs1054016) using TaqMan genotyping assays. Statistical analyses were performed using the χ 2 -tests for 2 x 2 and 2 x 3 tables. The allelic frequencies (OR: 1.508 CI: 1.127-2.018, p=0.006) and the genotype distribution (p=0.019) of the OPG SNP rs3102735 differed significantly between breast cancer patients and healthy controls. The minor allele C and the corresponding homo- and heterozygous genotypes are more common in breast cancer patients (minor allele C: 18.4% vs. 13.0%; genotype CC: 3.3% vs. 1.3%; genotype CT: 30.3% vs. 23.5%). No significantly changed risk was detected in the other investigated SNPs. Additional analysis showed significant differences when comparing patients with invasive vs. non-invasive tumors (OPG rs2073618) as well as in terms of tumor localization (RANK rs35211496) and body mass index (RANKL rs9533156 and rs1054016). This is the first study reporting a significant association of the SNP rs3102735 (OPG) with the susceptibility to develop breast cancer in the Caucasian population

  13. Blood lead levels, iron metabolism gene polymorphisms and homocysteine: a gene-environment interaction study.

    Science.gov (United States)

    Kim, Kyoung-Nam; Lee, Mee-Ri; Lim, Youn-Hee; Hong, Yun-Chul

    2017-12-01

    Homocysteine has been causally associated with various adverse health outcomes. Evidence supporting the relationship between lead and homocysteine levels has been accumulating, but most prior studies have not focused on the interaction with genetic polymorphisms. From a community-based prospective cohort, we analysed 386 participants (aged 41-71 years) with information regarding blood lead and plasma homocysteine levels. Blood lead levels were measured between 2001 and 2003, and plasma homocysteine levels were measured in 2007. Interactions of lead levels with 42 genotyped single-nucleotide polymorphisms (SNPs) in five genes ( TF , HFE , CBS , BHMT and MTR ) were assessed via a 2-degree of freedom (df) joint test and a 1-df interaction test. In secondary analyses using imputation, we further assessed 58 imputed SNPs in the TF and MTHFR genes. Blood lead concentrations were positively associated with plasma homocysteine levels (p=0.0276). Six SNPs in the TF and MTR genes were screened using the 2-df joint test, and among them, three SNPs in the TF gene showed interactions with lead with respect to homocysteine levels through the 1-df interaction test (phomocysteine levels at an α-level of 0.05, but the associations did not persist after Bonferroni correction. These SNPs did not show interactions with lead levels. Blood lead levels were positively associated with plasma homocysteine levels measured 4-6 years later, and three SNPs in the TF gene modified the association. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  14. Exhaled nitric oxide and inducible nitric oxide synthase gene polymorphism in Japanese asthmatics

    Directory of Open Access Journals (Sweden)

    Suguru Sato

    2016-07-01

    Conclusions: The number of CCTTT repeats in the iNOS promoter region was associated with FeNO levels in asthmatics before treatment, suggesting the importance of iNOS genotype in the clinical application of FeNO for asthmatics.

  15. ASSOCIATIONS BETWEEN POLYMORPHISMS WITHIN THE THYMIDYLATE SYNTHASE GENE AND SPINA BIFIDA. (R828292)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  16. Association of Rho-kinase Gene Polymorphisms with Respiratory Distress Syndrome in Preterm Neonates.

    Science.gov (United States)

    Kaya, Gül; Sivasli, Ercan; Oztuzcu, Serdar; Melekoglu, Nuriye A; Ozkara, Esma; Sarikabadayi, Unal; Demiryürek, Abdullah T

    2017-02-01

    Respiratory distress syndrome (RDS) of the newborn is one of the most common causes of morbidity and mortality in preterm infants. Our objective was to determine the association between Rho-kinase (ROCK1 and ROCK2) gene polymorphisms and RDS in preterm neonates. A total of 193 preterm infants with RDS and 186 preterm infants without respiratory problems were included in this study. Polymorphisms were analyzed in genomic DNA using a BioMark 96.96 dynamic array system. We observed that ROCK1 gene rs2271255 (Lys222Glu) and rs35996865 polymorphisms, and ROCK2 gene rs726843, rs2290156, rs10178332, and rs35768389 (Asp601Val) polymorphisms were associated with RDS. However, no associations were found with rs73963110, rs1515219, rs965665, rs2230774 (Thr431Asn), rs6755196, and rs10929732 polymorphisms. Additionally, 12 haplotypes (6 in ROCK1 and 6 in ROCK2) were found to be markedly associated with RDS. This is the first study to examine the involvement of ROCK gene variation in the risk of incident RDS. The results strongly suggest that ROCK gene polymorphisms may modify individual susceptibility to RDS in the Turkish population. Copyright © 2016. Published by Elsevier B.V.

  17. CD36 gene polymorphism is associated with Alzheimer's disease

    Czech Academy of Sciences Publication Activity Database

    Šerý, Omar; Janoutová, J.; Ewerlingová, Laura; Hálová, Alice; Lochman, J.; Janout, V.; Khan, N. A.; Balcar, Vladimír Josef

    2017-01-01

    Roč. 135, č. 1 (2017), s. 46-53 ISSN 0300-9084 Institutional support: RVO:67985904 Keywords : polymorphism * association * CD36 Subject RIV: FH - Neurology OBOR OECD: Neurosciences (including psychophysiology Impact factor: 3.112, year: 2016

  18. Analysis of polymorphisms and selective pressures on ama1 gene ...

    Indian Academy of Sciences (India)

    Chuen Yang Chua

    2017-09-05

    . Analysis of DNA sequence revealed that most of the nucleotide polymorphisms were synonymous and concentrated in domain I of PkAMA-1. Forteen haplotypes were identified based on amino acid variations and haplotype ...

  19. Prolactin receptor gene polymorphism and the risk of recurrent pregnancy loss: a case-control study.

    Science.gov (United States)

    Kim, Jin Ju; Choi, Young Min; Lee, Sung Ki; Yang, Kwang Moon; Paik, Eun Chan; Jeong, Hyeon Jeong; Jun, Jong Kwan; Han, Ae Ra; Hwang, Kyu Ri; Hong, Min A

    2018-02-01

    Since the first study was published reporting the candidate association between the prolactin receptor gene intron C/T polymorphism (rs37389) and recurrent miscarriage, no replication study has been performed. In this study, we investigated the role of the prolactin receptor gene C/T polymorphism in 311 Korean women with recurrent pregnancy loss and 314 controls. Genotyping for prolactin receptor gene intron C/T polymorphism was performed using a TaqMan assay. The significance of difference in the genotype distribution was assessed using a chi-square test, and continuous variables were compared using a Student's t-test. The genotype distribution of the prolactin receptor gene C/T polymorphism in the recurrent pregnancy loss group did not differ from that in the control group (CC/CT/TT rates were 49.8%/41.5%/8.7% and 52.5%/37.6%/9.9% for the recurrent pregnancy loss patient and control groups, respectively, p = .587). When the analysis was restricted to patients with three or more consecutive spontaneous miscarriages or patients without prior live birth, there were also no differences in the genotype distribution between these subgroups and controls. In conclusion, the findings of the current study suggest that the prolactin receptor gene intron C/T polymorphism is not a major determinant of the development of recurrent pregnancy loss. Impact statement What is already known: Many studies have investigated whether there is a genetic component for the risk of recurrent pregnancy loss. Recently, one study investigated whether genetic polymorphisms involved in the regulation of the hypothalamic-pituitary-ovarian axis would be associated with recurrent miscarriage. Among 35 polymorphisms in 20 candidate genes, genotype distribution with regard to the prolactin receptor gene intron C/T polymorphism (rs37389) differed between the recurrent miscarriage and the control groups. Since this study reporting the candidate association between the prolactin receptor gene and

  20. Conservation and divergence of Starch Synthase III genes of monocots and dicots.

    Directory of Open Access Journals (Sweden)

    Bhavya Priyadarshini Mishra

    Full Text Available Starch Synthase (SS plays an important role in extending the α-1,4 glucan chains during starch biosynthesis by catalyzing the transfer of the glucosyl moiety from ADP-glucose to the non-reducing end of a pre-existing glucan chain. SS has five distinct isoforms of which SSIII is involved in the formation of longer glucan chain length. Here we report identification and detailed characterization of 'true' orthologs of the well-characterized maize SSIII (ZmSSIII, among six monocots and two dicot species. ZmSSIII orthologs have nucleotide sequence similarity ranging from 56-81%. Variation in gene size among various orthologs ranged from 5.49 kb in Arabidopsis to 11.62 kb in Brachypodium and the variation was mainly due to intron size and indels present in the exons 1 and 3. Number of exons and introns were highly conserved among all orthologs however. While the intron number was conserved, intron phase showed variation at group, genera and species level except for intron 1 and 5. Several species, genera, and class specific cis-acting regulatory elements were identified in the promoter region. The predicted protein size of the SSIII orthologs ranged from 1094 amino acid (aa in Arabidopsis to 1688 aa in Brachypodium with sequence identity ranging from 60%-89%. The N-terminal region of the protein was highly variable whereas the C-terminal region containing the Glycosyltransferase domain was conserved with >80% sequence similarity among the orthologs. In addition to confirming the known motifs, eleven novel motifs possibly providing species, genera and group specific functions, were identified in the three carbohydrate binding domains. Despite of significant sequence variation among orthologs, most of the motifs and their relative distances are highly conserved among the orthologs. The 3-D structure of catalytic region of SSIII orthologs superimposed with higher confidence confirming the presence of similar binding sites with five unidentified

  1. Association of gender, ABCA1 gene polymorphisms and lipid profile in Greek young nurses.

    Science.gov (United States)

    Kolovou, Vana; Marvaki, Apostolia; Karakosta, Agathi; Vasilopoulos, Georgios; Kalogiani, Antonia; Mavrogeni, Sophie; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa

    2012-07-09

    One of the important proteins involved in lipid metabolism is the ATP-binding cassette transporter A1 (ABCA1) encoding by ABCA1 gene. In this study we evaluated the single nucleotide polymorphisms (SNPs) of ABCA1 gene. We analyzed SNPs in chromosome 9 such as rs2230806 (R219K) in the position 107620867, rs2230808 (R1587K) in the position 106602625 and rs4149313 (I883M) in the position 106626574 according to gender and lipid profile of Greek nurses. The study population consisted of 447 (87 men) unrelated nurses who were genotyped for ABCA1 gene polymorphisms. Additionally, lipid profile [total cholesterol, triglycerides, high density lipoprotein cholesterol, low density lipoprotein cholesterol (LDL-C) and apolipoprotein A1] was evaluated. The distribution of all three studied ABCA1 gene polymorphisms did not differ according to gender. However, only R219K genotype distribution bared borderline statistical significance (p = 0.08) between the two studied groups. Moreover, allele frequencies of R219K, R1587K and I88M polymorphisms did not differ according to gender. In general, blood lipid levels did not seem to vary according to ABCA1 gene polymorphisms, when testing all subjects or when testing only men or only women. However, a significant difference of LDL-C distribution was detected in all subjects according to R1587K genotype, indicating lower LDL-C levels with KK polymorphism (p = 0.0025). The above difference was solely detected on female population (p = 0.0053). The ABCA1 gene polymorphisms frequency, distribution and lipid profile did not differ according to gender. However, in the female population the KK genotype of R1587K gene indicated lower LDL-C levels. Further studies, involving a higher number of individuals, are required to clarify genes and gender contribution.

  2. Association of gender, ABCA1 gene polymorphisms and lipid profile in Greek young nurses

    Directory of Open Access Journals (Sweden)

    Kolovou Vana

    2012-07-01

    Full Text Available Abstract Objective One of the important proteins involved in lipid metabolism is the ATP-binding cassette transporter A1 (ABCA1 encoding by ABCA1 gene. In this study we evaluated the single nucleotide polymorphisms (SNPs of ABCA1 gene. We analyzed SNPs in chromosome 9 such as rs2230806 (R219K in the position 107620867, rs2230808 (R1587K in the position 106602625 and rs4149313 (I883M in the position 106626574 according to gender and lipid profile of Greek nurses. Methods The study population consisted of 447 (87 men unrelated nurses who were genotyped for ABCA1 gene polymorphisms. Additionally, lipid profile [total cholesterol, triglycerides, high density lipoprotein cholesterol, low density lipoprotein cholesterol (LDL-C and apolipoprotein A1] was evaluated. Results The distribution of all three studied ABCA1 gene polymorphisms did not differ according to gender. However, only R219K genotype distribution bared borderline statistical significance (p = 0.08 between the two studied groups. Moreover, allele frequencies of R219K, R1587K and I88M polymorphisms did not differ according to gender. In general, blood lipid levels did not seem to vary according to ABCA1 gene polymorphisms, when testing all subjects or when testing only men or only women. However, a significant difference of LDL-C distribution was detected in all subjects according to R1587K genotype, indicating lower LDL-C levels with KK polymorphism (p = 0.0025. The above difference was solely detected on female population (p = 0.0053. Conclusions The ABCA1 gene polymorphisms frequency, distribution and lipid profile did not differ according to gender. However, in the female population the KK genotype of R1587K gene indicated lower LDL-C levels. Further studies, involving a higher number of individuals, are required to clarify genes and gender contribution.

  3. XRCC1 gene polymorphisms and risk of ameloblastoma.

    Science.gov (United States)

    Yanatatsaneejit, Pattamawadee; Boonsuwan, Titiporn; Mutirangura, Apiwat; Kitkumthorn, Nakarin

    2013-06-01

    Ameloblastoma is a common benign odontogenic tumour with inherently aggressive behaviour. Genetic susceptibility of single nucleotide polymorphism (SNP) can likely predict ameloblastoma at risk patients but this data remains limited. Here, we studied XRCC1 polymorphism as a risk factor for ameloblastoma. Eighty-two ameloblastoma samples and blood from 140 healthy controls were used to perform polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for XRCC1 at codons 194, 280 and 399, and confirmed by sequence analysis. Compare to healthy control, a significant increase was noted in the occurrence of polymorphism at codon 194 and 399 in ameloblastoma patients. At codon 194, tryptophan encoded by T, was the susceptibility allele showed an ODD ratio of (95% CI)=1.62 (1.05-2.48), p=0.027. At codon 399, glycine encoded by A was the susceptibility allele showing ODD ratio of (95% CI)=1.83 (1.19-2.84), p=0.005. Moreover at codon 399, we found AG as the susceptibility genotype (2.06 (1.14-3.72), p=0.015). However, we did not find any significant increase in polymorphic occurrence in ameloblastoma patients at codon 280. For haplotype analysis of 3 codons, we found GGC as protective haplotype, and AGT as the risk haplotype. Our data suggest that polymorphism at codons 194 and 399, likely contributes to the risk of developing ameloblastoma. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Polymorphisms and haplotypes in methylenetetrahydrofolate reductase gene and head and neck squamous cell carcinoma risk.

    Science.gov (United States)

    Galbiatti, Ana Lívia Silva; Ruiz, Mariangela Torreglosa; Rodrigues, Juliana Olsen; Raposo, Luiz Sérgio; Maníglia, José Victor; Pavarino, Érika Cristina; Goloni-Bertollo, Eny Maria

    2012-01-01

    Functional polymorphisms in genes encoding enzymes involved in folate metabolism might modulate head and neck carcinoma risk because folate participates in DNA methylation and synthesis. We therefore conducted a case-control study of 853 individuals (322 head and neck cancer cases and 531 non-cancer controls) to investigate associations among MTHFR C677T and MTHFR A1298C polymorphisms and head and neck squamous cell carcinoma risk. Interactions between these two polymorphisms and risk factors and clinical histopathological parameters were also evaluated. The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique was used to genotype the polymorphisms and Chi-square test and multiple logistic regression were used for statistical analyses. The variables age≥49 years, male gender, tobacco habits and alcohol consumption, MTHFR 1298 AC or CC genotypes, combined genotypes with two or more polymorphic alleles and 677T and 1298C polymorphic alleles were associated with increased risk for this disease (PA1298C polymorphism was more frequent in patients with oral cavity as primary site (PA1298C polymorphism has higher risk for this disease.

  5. GGC and StuI polymorphism on the androgen receptor gene in endometrial cancer patients

    International Nuclear Information System (INIS)

    Sasaki, Masahiro; Karube, Akihiro; Karube, Yuko; Watari, Michiko; Sakuragi, Noriaki; Fujimoto, Seiichiro; Dahiya, Rajvir

    2005-01-01

    Androgens have an anti-proliferative effect on endometrial cells. Human androgen receptor (AR) gene contains two polymorphic short tandem repeats of GGC and CAG, and a single-nucleotide polymorphism on exon 1 that is recognized by the restriction enzyme, StuI. Prior studies have shown that the lengths of the CAG repeat are inversely and linearly related to AR activity and associated with endometrial cancer. However, little is known about the GGC repeat and the StuI polymorphism of the AR gene. Thus, we investigated whether these AR polymorphisms are risk factors for endometrial cancer. To test this hypothesis, the genetic distributions of these polymorphisms were investigated in blood samples from endometrial cancer patients and healthy controls. The allelic and genotyping profiles were analyzed by polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and direct DNA sequencing, and analyzed statistically. The GGC repeat was significantly longer in endometrial cancer patients as compared to normal healthy controls. In general, an increased risk of endometrial cancer was found with increasing GGC repeat. The relative risk for the 17 GGC repeat was greater than 4, as compared to controls. However, the StuI polymorphism was not significantly different between patients and controls. The findings suggest that increased numbers of GGC repeat on the AR gene may be a risk factor for endometrial cancer

  6. Association of Gene Polymorphisms in Interleukin 6 in Infantile Bronchial Asthma.

    Science.gov (United States)

    Babusikova, Eva; Jurecekova, Jana; Jesenak, Milos; Evinova, Andrea

    2017-07-01

    The genetic background of bronchial asthma is complex, and it is likely that multiple genes contribute to its development both directly and through gene-gene interactions. Cytokines contribute to different aspects of asthma, as they determine the type, severity and outcomes of asthma pathogenesis. Allergic asthmatics undergoing an asthmatic attack exhibit significantly higher levels of pro-inflammatory cytokines, such as interleukins and chemokines. In recent years, cytokines and their receptors have been shown to be highly polymorphic, and this prompted us to investigate interleukin 6 promoter polymorphisms at position -174G/C (rs1800795) and at -572G/C (rs1800796) in relation to asthma in children. Interleukin 6 promoter polymorphisms were analyzed in bronchial asthma patients and healthy children using polymerase chain reaction-restriction fragment length polymorphism analysis. We observed a significant association between polymorphism at -174G/C and bronchial asthma (OR=3.4, 95% CI: 2.045-5.638, P10 -7 ). Interleukin 6 polymorphism is associated with bronchial asthma, particularly its atopic phenotype. Expression and secretion of interleukins in asthmatic patients may be affected by genetic polymorphisms, and could have a disease-modifying effect in the asthmatic airway and modify the therapeutic response. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  7. Association of TAP gene polymorphisms and risk of cervical intraepithelial neoplasia.

    Science.gov (United States)

    Natter, Camilla; Polterauer, Stephan; Rahhal-Schupp, Jasmin; Cacsire Castillo-Tong, Dan; Pils, Sophie; Speiser, Paul; Zeillinger, Robert; Heinze, Georg; Grimm, Christoph

    2013-01-01

    Transporter associated with antigen processing (TAP) is responsible for peptide loading onto class I major histocompatibility complex (MHC-I) molecules. TAP seems to facilitate the detection of HPV by MHC-I molecules and contributes to successful eradication of HPV. TAP polymorphisms could have an important impact on the course of HPV infection. The aim of this study is to evaluate the association between five TAP gene polymorphisms and the risk of CIN. Methods. This case-control study investigated five common TAP polymorphisms in TAP1 (1341 and 2254) and TAP2 (1135, 1693, and 1993) in 616 women with CIN and 206 controls. Associations between gene polymorphisms and risk of CIN were analysed by univariate and multivariable models. The combined effect of the five TAP gene polymorphisms on the risk for CIN was investigated by haplotype analysis. No significant difference in genotype distribution of the five TAP polymorphisms was observed in women with CIN and controls. Haplotype analysis revealed that women with haplotype mut-wt-wt-wt-wt (TAP polymorphisms t1135-t1341-t1693-t1993-t2254) had a significantly lower risk for CIN, compared to women with the haplotype wt-wt-wt-wt-wt (P = 0.006; OR 0.5 [0.35-0.84]). Identification of this haplotype combination could be used to identify women, less susceptible for development of CIN following HPV infection.

  8. Association of TAP Gene Polymorphisms and Risk of Cervical Intraepithelial Neoplasia

    Directory of Open Access Journals (Sweden)

    Camilla Natter

    2013-01-01

    Full Text Available Background. Transporter associated with antigen processing (TAP is responsible for peptide loading onto class I major histocompatibility complex (MHC-I molecules. TAP seems to facilitate the detection of HPV by MHC-I molecules and contributes to successful eradication of HPV. TAP polymorphisms could have an important impact on the course of HPV infection. Objective. The aim of this study is to evaluate the association between five TAP gene polymorphisms and the risk of CIN. Methods. This case-control study investigated five common TAP polymorphisms in TAP1 (1341 and 2254 and TAP2 (1135, 1693, and 1993 in 616 women with CIN and 206 controls. Associations between gene polymorphisms and risk of CIN were analysed by univariate and multivariable models. The combined effect of the five TAP gene polymorphisms on the risk for CIN was investigated by haplotype analysis. Results. No significant difference in genotype distribution of the five TAP polymorphisms was observed in women with CIN and controls. Haplotype analysis revealed that women with haplotype mut-wt-wt-wt-wt (TAP polymorphisms t1135-t1341-t1693-t1993-t2254 had a significantly lower risk for CIN, compared to women with the haplotype wt-wt-wt-wt-wt (; OR 0.5 []. Conclusion. Identification of this haplotype combination could be used to identify women, less susceptible for development of CIN following HPV infection.

  9. Promoter methylation and gene polymorphism are two independent events in regulation of GSTP1 gene expression.

    Science.gov (United States)

    Bhat, Aaliya; Masood, A; Wani, K A; Bhat, Younus Ahmad; Nissar, Bushra; Khan, Nuzhat Shaheen; Ganai, B A

    2017-04-01

    Breast carcinogenesis is a multistep process, involving both genetic and epigenetic modification process of genes, involved in diverse pathways ranging from DNA repair to metabolic processes. This study was undertaken to assess the role of promoter methylation of GSTP1 gene, a member of glutathione-S-transferase family of enzymes, in relation to its expression, polymorphism, and clinicopathological parameters. Tissue samples were taken from breast cancer patients and paired with their normal adjacent tissues. A total of 51 subjects were studied, in which the frequency of promoter methylation in cancerous tissue was 37.25% as against 11% in the normal tissues ( p ≤ 0.001). The hypermethylated status of the gene was significantly associated with the loss of the protein expression ( r = -0.449, p = 0.001, odds ratio = 7.42, 95% confidence interval = 2.05-26.92). Furthermore, when compared with the clinical parameters, the significant association was found between the promoter hypermethylation and lymph node metastasis ( p ≤ 0.001), tumor stage ( p = 0.039), tumor grade ( p = 0.028), estrogen receptor status ( p = 0.018), and progesterone receptor status ( p = 0.046). Our study is the first of its kind in Kashmiri population, which indicates that GSTP1 shows aberrant methylation pattern in the breast cancer with the consequent loss in the protein expression. Furthermore, it also shows that the gene polymorphism (Ile105Val) at codon 105 is not related to the promoter methylation and two are the independent events in breast cancer development.

  10. [Distinctive Features of the Microbial Diversity and the Polyketide Synthase GenesSpectrum in the Community of the Endemic Baikal Sponge Swartschewskia papyracea].

    Science.gov (United States)

    Kaluzhnaya, O V; Itskovich, V B

    2016-01-01

    The diversity of the symbiotic community of the endemic Baikal sponge Swartschewskia papyracea was studied, and an analysis of the polyketide synthases genes spectrum in sponge-associated microorganisms was carried out. Six bacterial phyla were detected in the S. papyracea microbiome, namely, Verrucomicrobia, Cyanobacteria, Actinobacteria, Bacteroidetes, Proteobacteria, and Planctomycetes. Unlike the microbial associations of other freshwater sponges, the community under study was dominated by the Verrucomicrobia (42.1%) and Cyanobacteria (17.5%) phyla, while the proportion of the Proteobacteria was unusually low (9.7%). In the S. papyracea community metagenome, there were identified 18 polyketide synthases genes fragments, the closest homologs of which included the polyketide synthases of the microorganisms belonging to the bacterial phyla Cyanobacteria, Proteobacteria (Betaproteobacteria, Deltaproteobacteria, and Gammaproteobacteria classes), and Acidobacteria and to the eukaryotic algae of the Heterokonta phylum (Eustigmatophyceae class). Polyketide synthase sequences from S. papyracea formed three groups on the phylogenetic tree: a group of hybrid NRPS/PKS complexes, a group of cyanobacterial polyketide synthases, and a group of homologs of the eukaryotic alga Nannochloropsis galiana. Notably, the identified polyketide synthase genes fragments showed only a 57-88% similarity to the sequences in the databases, which implies the presence of genes controlling the synthesis of the novel, still unstudied, polyketide compounds in the S. papyracea community. It was proposed that the habitation conditions of S. papyracea affect the taxonomic composition of the microorganisms associated with the sponge, including the diversity of the producers of secondary metabolites.

  11. Risk conferred by FokI polymorphism of vitamin D receptor (VDR) gene for essential hypertension.

    Science.gov (United States)

    Swapna, N; Vamsi, U Mohana; Usha, G; Padma, T

    2011-09-01

    The vitamin D receptor (VDR) gene serves as a good candidate gene for susceptibility to several diseases. The gene has a critical role in regulating the renin-angiotensin system (RAS) influencing the regulation of blood pressure. Hence determining the association of VDR polymorphisms with essential hypertension is expected to help in the evaluation of risk for the condition. The aim of this study was to evaluate association between VDRFok I polymorphism and genetic susceptibility to essential hypertension. Two hundred and eighty clinically diagnosed hypertensive patients and 200 normotensive healthy controls were analyzed for Fok I (T/C) [rs2228570] polymorphism by polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) analysis. Genotype distribution and allele frequencies in patients and controls, and odds ratios (ORs) were calculated to predict the risk for developing hypertension by the individuals of different genotypes. The genotype distribution and allele frequencies of Fok I (T/C) [rs2228570] VDR polymorphism differed significantly between patients and controls (χ(2) of 18.0; 2 degrees of freedom; P = 0.000). FF genotype and allele F were at significantly greater risk for developing hypertension and the risk was elevated for both the sexes, cases with positive family history and habit of smoking. Our data suggest that VDR gene Fok I polymorphism is associated with the risk of developing essential hypertension.

  12. Associations Between TNFAIP3 Gene Polymorphisms and Rheumatoid Arthritis Risk: A Meta-analysis.

    Science.gov (United States)

    Zhang, Liang; Yuan, Xier; Zhou, Qiang; Shi, Jiujun; Song, Zhoufeng; Quan, Renfu; Zhang, Dawei

    2017-05-01

    A host of studies investigated the associations between tumor necrosis factor alpha inducible protein 3 (TNFAIP3) gene rs2230926 and rs5029937 polymorphisms and rheumatoid arthritis (RA) susceptibility, but with conflicting findings. Therefore, we explored whether TNFAIP3 gene rs2230926 and rs5029937 polymorphisms are associated with RA by meta-analysis. We performed out a comprehensive literature search of PubMed, Elsevier, Embase, and CNKI databases to identify relevant studies. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were used to assess the strength of the associations. Literature search identified 10 case-control studies involving 18,014 cases and 20,112 controls in this meta-analysis. Our data supported an association between TNFAIP3 gene rs2230926 and rs5029937 polymorphisms and RA risk. Stratification analysis of ethnicity indicated that rs5029937 polymorphism increased the risk of RA among Caucasians, while rs2230926 polymorphism increased the risk of RA among Asians and Caucasians. In conclusion, this meta-analysis demonstrates that TNFAIP3 gene polymorphisms (rs2230926 and rs5029937) are associated with the increased risk of RA. Copyright © 2017 IMSS. Published by Elsevier Inc. All rights reserved.

  13. Polymorphisms in candidate genes and their association with carcass traits and meat quality in Nellore cattle

    Directory of Open Access Journals (Sweden)

    Bárbara Oliveira Borges

    2014-05-01

    Full Text Available The objective of this work was to estimate the allele polymorphism frequencies of genes in Nellore cattle and associate them with meat quality and carcass traits. Six hundred males were genotyped for the following polymorphisms: DGAT1 (VNTR with 18 nucleotides at the promoter region; ANK1, a new polymorphism, identified and mapped here at the gene regulatory region NW_001494427.3; TCAP (AY428575.1:g.346G>A; and MYOG (NW_001501985:g.511G>C. In the association study, phenotype data of hot carcass weight, ribeye area, backfat thickness, percentage of intramuscular fat, shear force, myofibrillar fragmentation index, meat color (L*, a*, b*, and cooking losses were used. Allele B from the ANK1 gene was associated with greater redness (a*. Alleles 5R, 6R, and 7R from the DGAT1 VNTR gene were associated with increased intramuscular fat, reduced cooking losses and increased ribeye area, respectively. The single nucleotide polymorphism (SNP of the TCAP gene was not polymorphic, and MYOG alleles were not associated with any of the evaluated characteristics. These results indicate that ANK1 and DGAT1 genes can be used in the selection of Nellore cattle for carcass and meat quality.

  14. Association of growth hormone (GH gene polymorphism with growth and carcass in Sumba Ongole (SO cattle

    Directory of Open Access Journals (Sweden)

    P. P. Agung

    2017-08-01

    Full Text Available A study was conducted to identify the polymorphism in the intron 3 of the Growth Hormone (GH gene and also to evaluate the association of the GH gene polymorphism with growth parameters and dressing percentage in the Sumba Ongole (SO cattle. A total of 267 individual DNA samples were used in the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP analysis. The SO cattle growth parameters data (n=44 including birth weight (BW, weaning weight at 205 days of age (WW205, yearling weight at 365 days of age (YW365 and also dressing percentage (DP (n=122 were investigated in this study. There were three genotypes (AA, AB, and BB of the GH gene based on the PCR-RFLP analysis with allele frequency was 0.87 and 0.13 for A allele and B allele respectively. The highest genotype frequency in the SO cattle is AA (0.76 and the lowest is BB (0.02. The Heterozygosity Observed (Ho value in the SO cattle population is 0.23 and Polymorphism Information Content (PIC value is 0.20. Therefore, the genetic diversity in the SO cattle based on the GH gene polymorphism is quite low. There is no association (P>0.05 in BW, WW205, YW365, and DP with genotypes of the GH gene. As the result, the GH gene in this study cannot be used as a genetic marker in the SO cattle breeding program.

  15. Homocysteine Metabolism Gene Polymorphisms (MTHFR C677T, MTHFR A1298C, MTR A2756G and MTRR A66G Jointly Elevate the Risk of Folate Deficiency

    Directory of Open Access Journals (Sweden)

    Wen-Xing Li

    2015-08-01

    Full Text Available Folate deficiency is strongly associated with cardiovascular disease. We aimed to explore the joint effect of the methylenetetrahydrofolate reductase (MTHFR C677T and A1298C, methionine synthase (MTR A2756G, and methionine synthase reductase (MTRR A66G polymorphisms on folate deficiency in a Chinese hypertensive population. A total of 480 subjects aged 28–75 were enrolled in this study from September 2005–December 2005 from six hospitals in different Chinese regions. Known genotypes were detected by PCR-RFLP methods and serum folate was measured by chemiluminescence immunoassay. Our results showed that MTHFR 677TT and MTR 2756AG + GG were independently associated with a higher risk of folate deficiency (TT vs. CC + CT, p < 0.001 and AG + GG vs. AA p = 0.030, respectively. However, the MTHFR A1298C mutation may confer protection by elevating the serum folate level (p = 0.025. Furthermore, patients carrying two or more risk genotypes showed higher odds of folate deficiency than null risk genotype carriers, especially those carrying four risk genotypes. These findings were verified by generalized multifactor dimensionality reduction (p = 0.0107 and a cumulative effects model (p = 0.001. The results of this study have shown that interactions among homocysteine metabolism gene polymorphisms lead to dramatic elevations in the folate deficiency risk.

  16. Homocysteine Metabolism Gene Polymorphisms (MTHFR C677T, MTHFR A1298C, MTR A2756G and MTRR A66G) Jointly Elevate the Risk of Folate Deficiency.

    Science.gov (United States)

    Li, Wen-Xing; Dai, Shao-Xing; Zheng, Jun-Juan; Liu, Jia-Qian; Huang, Jing-Fei

    2015-08-10

    Folate deficiency is strongly associated with cardiovascular disease. We aimed to explore the joint effect of the methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C, methionine synthase (MTR) A2756G, and methionine synthase reductase (MTRR) A66G polymorphisms on folate deficiency in a Chinese hypertensive population. A total of 480 subjects aged 28-75 were enrolled in this study from September 2005-December 2005 from six hospitals in different Chinese regions. Known genotypes were detected by PCR-RFLP methods and serum folate was measured by chemiluminescence immunoassay. Our results showed that MTHFR 677TT and MTR 2756AG + GG were independently associated with a higher risk of folate deficiency (TT vs. CC + CT, p MTHFR A1298C mutation may confer protection by elevating the serum folate level (p = 0.025). Furthermore, patients carrying two or more risk genotypes showed higher odds of folate deficiency than null risk genotype carriers, especially those carrying four risk genotypes. These findings were verified by generalized multifactor dimensionality reduction (p = 0.0107) and a cumulative effects model (p = 0.001). The results of this study have shown that interactions among homocysteine metabolism gene polymorphisms lead to dramatic elevations in the folate deficiency risk.

  17. Interleukin-17 Gene Polymorphisms Contribute to Cancer Risk

    Directory of Open Access Journals (Sweden)

    Yu-Ming Niu

    2014-01-01

    Full Text Available Epidemiological studies have suggested that interleukin-17 (IL-17 polymorphisms are associated with cancer risk. However, the results of these studies are inconsistent. Therefore, we performed a meta-analysis to obtain a precise conclusion. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the association of the IL-17A rs2275913G>A and IL-17F rs763780T>C polymorphisms with cancer risk. Publication bias and sensitivity analyses were performed to ensure the statistical power. Overall, 10 relevant case-control studies involving 4,516 cases and 5,645 controls were included. The pooled ORs with 95% CIs indicated that the IL-17A rs2275913G>A polymorphism was significantly associated with increased cancer risk (for A versus G: OR = 1.28, 95% CI: 1.16–1.41, PC polymorphism was also significantly associated with gastric cancer development. Overall, the present meta-analysis suggests that IL-17 polymorphisms increase the risk of developing cancer, particularly gastric cancer, in the Asian (and Chinese population.

  18. Polymorphisms of Selected DNA Repair Genes and Lung Cancer in Chromium Exposure.

    Science.gov (United States)

    Halasova, E; Matakova, T; Skerenova, M; Krutakova, M; Slovakova, P; Dzian, A; Javorkova, S; Pec, M; Kypusova, K; Hamzik, J

    2016-01-01

    Chromium is a well-known mutagen and carcinogen involved in lung cancer development. DNA repair genes play an important role in the elimination of genetic changes caused by chromium exposure. In the present study, we investigated the polymorphisms of the following DNA repair genes: XRCC3, participating in the homologous recombination repair, and hMLH1 and hMSH2, functioning in the mismatch repair. We focused on the risk the polymorphisms present in the development of lung cancer regarding the exposure to chromium. We analyzed 106 individuals; 45 patients exposed to chromium with diagnosed lung cancer and 61 healthy controls. Genotypes were determined by a PCR-RFLP method. We unravelled a potential for increased risk of lung cancer development in the hMLH1 (rs1800734) AA genotype in the recessive model. In conclusion, gene polymorphisms in the DNA repair genes underscores the risk of lung cancer development in chromium exposed individuals.

  19. Promoter polymorphism of transforming growth factor-beta1 gene and ulcerative colitis.

    Science.gov (United States)

    Tamizifar, B; Lankarani, K B; Naeimi, S; Rismankar Zadeh, M; Taghavi, A; Ghaderi, A

    2008-01-14

    To elucidate the possible difference in two promoter polymorphisms of the transforming growth factor-beta1 (TGF-beta1) gene (-800G > A, -509C > T) between ulcerative colitis (UC) patients and normal subjects. A total of 155 patients with established ulcerative colitis and 139 normal subjects were selected as controls. Two single nucleotide polymorphisms within the promoter region of TGF-beta1 gene (-509C > T and -800G > A) were genotyped using PCR-RFLP. There was a statistically significant difference in genotype and allele frequency distributions between UC patients and controls for the -800G > A polymorphism of the TGF-beta1 gene (P A of TGF-beta1 gene promoter between Iranian patients with UC and normal subjects.

  20. Research on the relativity between gene polymorphism and children cardiac insufficiency.

    Science.gov (United States)

    He, X-H; Li, C-L; Ling, N; Wang, Q-W; Wang, Z-Z; An, X-J

    2017-08-01

    We analyzed the relationship between Mink-S27 gene polymorphism and children with cardiac insufficiency. From April 2013 to April 2015, we enrolled 73 cases of children with cardiac insufficiency for this study, and all 73 were placed in the observation group. 76 normal cases were selected for the control group. Restriction fragment length polymorphism (RFLP) was used to make polymorphism analysis of the Mink-S27. Our results showed no significant differences in Mink-S27 genotype and allele distribution in both observation and control groups (p>0.05). In lesion samples collected from children with cardiac insufficiency, we detected significant difference in AA, CC genotype frequency and allele frequency between the observation group and the control group (prelatively high. GNAS2 gene polymorphism was associated with the prevalence of cardiac insufficiency in children. And also the patients' condition was correlated to the frequency of different genotypes and alleles.

  1. Relationship between estrogen receptor 1 gene polymorphisms and postmenopausal osteoporosis of the spine in Chinese women.

    Science.gov (United States)

    Shang, D P; Lian, H Y; Fu, D P; Wu, J; Hou, S S; Lu, J M

    2016-06-03

    The purpose of this study was to evaluate single nucleotide polymorphism (SNP) variants of the estrogen receptor 1 gene (ESR1) at rs2234693 and rs9340799, as well as to investigate the relationship between ESR gene polymorphisms and postmenopausal osteoporosis (OP) of the spine in Chinese women. We recruited 198 postmenopausal women with OP and 276 healthy women between May 2012 and September 2015 in Zhongshan Hospital. Dual energy x-ray absorptiometry was used to measure the bone mineral density (BMD) of the lumbar vertebrae in all subjects. In addition, PCR-restriction fragment length polymorphism based analysis was conducted to identify the genotypes of ESR1. The distribution of ESR1 in the osteoporosis group and the control group was determined; the relationship between ESR polymorphisms and BMD was analyzed. The distributions of BMD were: TT women.

  2. Prediction of Drug Therapy for Chronic Hepatitis C Depending on the IL28B Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Moroz L.V. Moroz L.V.

    2014-09-01

    Molecular and genetic analysis of IL28V (rs12979860 gene polymorphism, located at a distance of 3 thousand nucleotide pairs from IL28V gene, using the polymerase chain reaction allows to predict the success of combination antiviral therapy, and the presence of C/C genotype can be a predictor of sustained virological response in patients chronic hepatitis C.

  3. Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

    African Journals Online (AJOL)

    Dilay Ciglidag Dungul

    Alpha thalassemia is caused by mutations in the alpha chain of the hemoglobin molecule. ... According to Human Gene Mutation Database (HGMD) more than 48 different .... Electroferogram of the DNA sequence, showing a G to A polymorphism in the downstream untranslated region of the HBA2 gene. Table 3 The ...

  4. Analysis of DNA repair gene polymorphisms and survival in low-grade and anaplastic gliomas

    DEFF Research Database (Denmark)

    Berntsson, Shala Ghaderi; Wibom, Carl; Sjöström, Sara

    2011-01-01

    The purpose of this study was to explore the variation in DNA repair genes in adults with WHO grade II and III gliomas and their relationship to patient survival. We analysed a total of 1,458 tagging single-nucleotide polymorphisms (SNPs) that were selected to cover DNA repair genes, in 81 grade ...

  5. Role of MTHFR A1298C gene polymorphism in the etiology of ...

    African Journals Online (AJOL)

    Various studies have performed to evaluate the role of MTHFR A1298C gene polymorphism to the risk of prostate cancer and the results were inconclusive and inconsistent. A meta-analysis of published case-control studies, up to December 2014, was performed to investigate the association between MTHFR A1298C gene ...

  6. Hindiii and S447x polymorphisms of lipoprotein lipase gene and ...

    African Journals Online (AJOL)

    Coronary artery disease (CAD) is a leading cause of morbidity and mortality worldwide. Lipoprotein lipase is a key enzyme in lipoprotein metabolism and its gene is a major candidate gene for coronary heart disease. The aim of the present work was to study the association of HindIII and S447X polymorphisms in lipoprotein ...

  7. 839C/T polymorphism in the SLC6A3 gene promoter

    Indian Academy of Sciences (India)

    of the substantia nigra and ventral tegmental regions (Ban- non et al. 2001). In order to show the importance of the. SLC6A3 gene as a functional candidate gene, several asso- ciation studies were performed between SLC6A3 and devel- oping schizophrenia. In these studies, polymorphisms in the. *For correspondence.

  8. Association of HS6ST3 gene polymorphisms with obesity and ...

    Indian Academy of Sciences (India)

    The heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene is involved in heparan sulphate and heparin metabolism, and has been reported to be associated with diabetic retinopathy in type 2 diabetes. We hypothesized that HS6ST3 gene polymorphisms might play an important role in obesity and related phenotypes (such ...

  9. Association of 308G/A TNF-α gene polymorphism and spontaneous ...

    African Journals Online (AJOL)

    Background: Single nucleotide polymorphism (SNP) within tumor necrosis factor alpha (TNF-α) gene promoter (308G/A TNFA) is associated with higher gene expression. The role of this SNP as a risk factor for spontaneous preterm birth has been assessed in some regions and the findings were significantly different ...

  10. Association of HS6ST3 gene polymorphisms with obesity and ...

    Indian Academy of Sciences (India)

    Supplementary data: Association of HS6ST3 gene polymorphisms with obesity and triglycerides: gene × gender interaction. Ke-Sheng Wang, Liang Wang, Xuefeng Liu and Min Zeng. J. Genet. 92, 395–402. Table 1. Associations of 117 SNPs with obesity in the Health ABC and Marshfield samples. Minor. OR Health.

  11. Avian Clock gene polymorphism : evidence for a latitudinal cline in allele frequencies

    NARCIS (Netherlands)

    Johnsen, A.; Fidler, A. E.; Kuhn, S.; Carter, K. L.; Hoffmann, A.; Barr, I. R.; Biard, C.; Charmantier, A.; Eens, M.; Korsten, P.; Siitari, H.; Tomiuk, J.; Kempenaers, B.

    2007-01-01

    In comparison with most animal behaviours, circadian rhythms have a well-characterized molecular genetic basis. Detailed studies of circadian clock genes in 'model' organisms provide a foundation for interpreting the functional and evolutionary significance of polymorphic circadian clock genes found

  12. Prolactin-RsaI gene polymorphism in East Anatolian Red cattle in ...

    African Journals Online (AJOL)

    The aim of the study was to determine by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method the gene and genotype frequencies of PRL gene in native East Anatolian Red (EAR) cattle, which are raised as a genetic resource in Turkey. PCR-RFLP analysis involved the use of the ...

  13. Association of metabolic gene polymorphisms with tobacco consumption in healthy controls.

    NARCIS (Netherlands)

    Smits, K.M.; Benhamou, S.; Garte, S.; Weijenberg, M.P.; Alamanos, Y.; Ambrosone, C.; Autrup, H.; Autrup, J.L.; Baranova, H.; Bathum, L.; Boffetta, P.; Bouchardy, C.; Brockmoller, J.; Butkiewicz, D.; Cascorbi, I.; Clapper, M.L.; Coutelle, C.; Daly, A.; Muzi, G.; Dolzan, V.; Duzhak, T.G.; Farker, K.; Golka, K.; Haugen, A.; Hein, D.W.; Hildesheim, A.; Hirvonen, A.; Hsieh, L.L.; Ingelman-Sundberg, M.; Kalina, I.; Kang, D.; Katoh, T.; Kihara, M.; Ono-Kihara, M.; Kim, H.L.; Kiyohara, C.; Kremers, P.; Lazarus, P.; Marchand, L. le; Lechner, M.C.; London, S.; Manni, J.J.; Maugard, C.M.; Morgan, G.J.; Morita, S.; Nazar-Stewart, V.; Kristensen, V.N.; Oda, Y.; Parl, F.F.; Peters, W.H.M.; Rannug, A.; Rebbeck, T.; Pinto, L.F.; Risch, A.; Romkes, M.; Salagovic, J.; Schoket, B.; Seidegard, J.; Shields, P.G.; Sim, E.; Sinnett, D.; Strange, R.C.; Stucker, I.; Sugimura, H.; To-Figueras, J.; Vineis, P.; Yu, M.C.; Zheng, W.; Pedotti, P.; Taioli, E.

    2004-01-01

    Polymorphisms in genes that encode for metabolic enzymes have been associated with variations in enzyme activity between individuals. Such variations could be associated with differences in individual exposure to carcinogens that are metabolized by these genes. In this study, we examine the

  14. A polymorphism in the gene for microsomal epoxide hydrolase is associated with pre-eclampsia.

    NARCIS (Netherlands)

    Zusterzeel, P.L.M.; Peters, W.H.M.; Visser, W.A.; Hermsen, K.J.; Roelofs, H.M.J.; Steegers, E.A.P.

    2001-01-01

    OBJECTIVE: Microsomal epoxide hydrolase is an important enzyme involved in the metabolism of endogenous and exogenous toxicants. Polymorphic variants of the human epoxide hydrolase gene vary in enzyme activity. We determined whether genetic variability in the gene encoding for microsomal epoxide

  15. Association of serum fetuin-A and fetuin-A gene polymorphism in ...

    African Journals Online (AJOL)

    Dalia A. Maharem

    2013-09-12

    Sep 12, 2013 ... fetuin-A and its gene and VC and also with bone mineral density (BMD) in patients with CKD on conservative treatment, on .... Determination of routine bio- chemical parameters ... autoanalyzer [48]. Association of serum fetuin-A and fetuin-A gene polymorphism in relation to mineral and bone disorders. 339 ...

  16. Differential effect of beetroot bread on postprandial DBP according to Glu298Asp polymorphism in the eNOS gene: a pilot study.

    Science.gov (United States)

    Hobbs, D A; George, T W; Lovegrove, J A

    2014-12-01

    Our objective was to investigate whether the presence of Glu298Asp polymorphism in the endothelial NO synthase (eNOS) gene differentially affects the postprandial blood pressure response to dietary nitrate-rich beetroot bread. A randomised, single-blind, controlled, crossover acute pilot study was performed in 14 healthy men (mean age: 34±9 years) who were retrospectively genotyped for Glu298Asp polymorphism (7GG; T carriers 7). Volunteers were randomised to receive 200 g beetroot-enriched bread (1.1 mmol nitrate) or control bread (no beetroot; 0.01 mmol nitrate) on two separate occasions 10 days apart. Baseline and incremental area under the curve of blood pressure and NOx (nitrate/nitrite) were measured for a 6-h postprandial period. A treatment × genotype interaction was observed for diastolic blood pressure (Pconsumption of beetroot bread compared with control bread. No significant differences were observed in the GG group. The beneficial diastolic blood pressure reduction was observed only in the T carriers of the Glu298Asp polymorphism in the eNOS gene after consumption of nitrate-rich beetroot bread. These data require confirmation in a larger population group.

  17. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.

    2005-01-01

    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  18. of endothelial nitric oxide synthase gene and serum level of vascular ...

    African Journals Online (AJOL)

    uwerhiavwe

    Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

  19. A single arabidopsis gene encodes two differentially targeted geranylgeranyl diphosphate synthase isoforms

    NARCIS (Netherlands)

    Águila Ruiz-Sola, M.; Barja, M.V.; Manzano, David; Llorente, Briardo; Schipper, Bert; Beekwilder, Jules; Rodriguez-Concepcion, Manuel

    2016-01-01

    A wide diversity of isoprenoids is produced in different plant compartments. Most groups of isoprenoids synthesized in plastids, and some produced elsewhere in the plant cell derive from geranylgeranyl diphosphate (GGPP) synthesized by GGPP synthase (GGPPS) enzymes. In Arabidopsis (Arabidopsis

  20. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hansen, K.; Szabo, Peter

    2003-01-01

    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3....