WorldWideScience

Sample records for synthase gene polymorphisms

  1. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  2. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan

    2014-06-01

    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  3. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

    Science.gov (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

    2016-06-01

    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  4. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

    Science.gov (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

    2016-03-01

    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

    Science.gov (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M

    2014-12-01

    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  6. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-05-24

    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  7. Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

    Directory of Open Access Journals (Sweden)

    T. Angeline

    2011-01-01

    Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

  8. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

    Science.gov (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

    2017-02-01

    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  9. The joint effect of the endothelin receptor B gene (EDNRB polymorphism rs10507875 and nitric oxide synthase 3 gene (NOS3 polymorphism rs869109213 in Slovenian patients with type 2 diabetes mellitus and diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Dejan Bregar

    2018-02-01

    Full Text Available Increasing evidence suggests that endothelin and nitric oxide synthase genes and their products exert biological effects on the vasculature via the nitric oxide or endothelin pathway. The aim of the study was to evaluate the association of rs10507875 and rs869109213 (alone or in interaction with diabetic retinopathy (DR in subjects with type 2 diabetes mellitus (T2DM. We genotyped the single nucleotide polymorphism rs10507875 of the endothelin receptor B gene (EDNRB and variable number tandem repeats rs869109213 of the nitric oxide synthase 3 gene (NOS3 in 270 Slovenian patients with DR and T2DM and 256 controls with T2DM without clinical signs of DR. The genotyping was performed using either real-time polymerase chain reaction (PCR or standard PCR. We found a significant association between the genotypes of NOS3 rs869109213 polymorphism and the risk of DR in the co-dominant model (4a4b genotype; 1.99-fold increased risk [1.09-3.65]; 95% confidence interval [CI]; p = 0.02, co-dominant model (4a4a genotype; 4.16-fold increased risk [1.03-16.74]; 95% CI; p = 0.04, and dominant model (4a4a and 4a4b genotypes; 2.22-fold increased risk [1.26-3.92]; 95% CI; p = 0.01 compared to the 4b4b genotype. Moreover, the joint effect of the two polymorphisms on DR risk was greater than the individual effect of each polymorphism in the analyzed genetic models. Additionally, adjusted odds ratio showed an increased risk in dominant × dominant (4.15-fold [1.40-12.26]; 95% CI; p = 0.01 and recessive × dominant (2.24-fold [1.25-4.01]; 95% CI; p = 0.02 genotype combinations of the two polymorphisms. In conclusion, our results indicate that NOS3 rs869109213 polymorphism alone or in a combination with EDNRB rs10507875 polymorphism may be associated with DR in Slovenian patients with T2DM.

  10. Association of a neuronal nitric oxide synthase gene polymorphism with levodopa-induced dyskinesia in Parkinson's disease.

    Science.gov (United States)

    Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor

    2018-04-01

    Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Nitric oxide synthase gene G298 allele

    International Nuclear Information System (INIS)

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

    2004-01-01

    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  12. Association of endothelial nitric oxide synthase gene polymorphism with the risk of Henoch-Schönlein purpura/Henoch-Schönlein purpura nephritis.

    Science.gov (United States)

    Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei

    2015-04-01

    Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.

  13. THE POLYMORPHISM OF THE SUS4 SUCROSE SYNTHASE DOMAIN SEQUENCES IN RUSSIAN, BELORUSSIAN AND KAZAKH POTATO CULTIVARS

    Directory of Open Access Journals (Sweden)

    M. A. Slugina

    2016-01-01

    Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.

  14. Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...

    African Journals Online (AJOL)

    Administrator

    2011-09-12

    Sep 12, 2011 ... Figure 1. The Glu298Asp polymorphism of eNOS gene was shown by .... mechanisms by which eNOS Asp298 polymorphism ... Asp298 is exposed to selective proteolytic cleavage in ... grounds, inclusion and exclusion criteria for PE women ... attention to meta analysis study, it is more probable that.

  15. Association between Polymorphism of Endothelial Nitric Oxide Synthase Gene (Glu298Asp) and Chronic Heart Failure in Patients with Ischemic Heart Disease and Obesity

    OpenAIRE

    O.I. Kadykova; P.P. Kravchun

    2016-01-01

    The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...

  16. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated ... specific human leukocyte antigen alleles that seem to be ... prevents the contractions of the uterine myometrium directly or by an ... an anatomical factor, to avoid this possible bias all candidates.

  17. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

    Directory of Open Access Journals (Sweden)

    Linda Koshy

    2008-01-01

    Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

  18. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women.

    Science.gov (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J

    2005-09-01

    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  19. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan

    2017-01-01

    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  20. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat

    2011-01-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  1. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Energy Technology Data Exchange (ETDEWEB)

    Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)

    2011-12-01

    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  2. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.

    2004-01-01

    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  3. Association of Nitric Oxide Synthase2 gene polymorphisms with leprosy reactions in northern Indian population.

    Science.gov (United States)

    Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja

    2017-07-01

    The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular damage in hypertensive subjects: an Italian case-control study

    Directory of Open Access Journals (Sweden)

    Pizzo Federica

    2008-05-01

    Full Text Available Abstract Background Nitric oxide (NO synthesized by endothelial nitric oxide synthase (eNOS plays an important role in regulation of endothelial function and in the control of blood pressure. However, the results from some studies on the association between three clinically relevant eNOS gene polymorphisms (G894T, T786C and intron 4b/a and essential hypertension are unclear. We designed a case-control study to evaluate the influence of eNOS polymorphisms on target organ damage in 127 hypertensives and 67 normotensives. Clinical evaluation, biochemical parameters, Urinary Albumin Excretion (UAE and echocardiogram were performed to characterize target organ damage. eNOS polymorphism were recognized by PCR method. Results The distribution of eNOS genotypes was similar in hypertensives and normotensives but 4aa was present in the 2.5% of hypertensives and completely absent in normotensives. Subjects with 4bb, G894T, and T786C genotypes showed an increased prevalence of target organ damage. Moreover prevalence of G894T and introne 4 variants was significantly higher in hypertensives than in normotensives both with cardiovascular damage. Logistic regression analysis didn't show any association between eNOS polymorphisms, Body Mass Index (BMI, hypertension, gender and cardiovascular damage. Only the age (OR 1.11; IC 95% 1.06–1.18 was predictive of cardiovascular damage in our population. Conclusion Our results seem to indicate a lack of association with eNOS variants and cardiovascular damage onset.

  5. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review)

    OpenAIRE

    Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.

    2017-01-01

    Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...

  6. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

    Science.gov (United States)

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

    2013-09-06

    Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular

  7. Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility.

    Science.gov (United States)

    Eaton, Keith D; Romine, Perrin E; Goodman, Gary E; Thornquist, Mark D; Barnett, Matt J; Petersdorf, Effie W

    2018-05-01

    Chronic inflammation has been implicated in carcinogenesis, with increasing evidence of its role in lung cancer. We aimed to evaluate the role of genetic polymorphisms in inflammation-related genes in the risk for development of lung cancer. A nested case-control study design was used, and 625 cases and 625 well-matched controls were selected from participants in the β-Carotene and Retinol Efficacy Trial, which is a large, prospective lung cancer chemoprevention trial. The association between lung cancer incidence and survival and 23 polymorphisms descriptive of 11 inflammation-related genes (interferon gamma gene [IFNG], interleukin 10 gene [IL10], interleukin 1 alpha gene [IL1A], interleukin 1 beta gene [IL1B], interleukin 2 gene [IL2], interleukin 4 receptor gene [IL4R], interleukin 4 gene [IL4], interleukin 6 gene [IL6], prostaglandin-endoperoxide synthase 2 gene [PTGS2] (also known as COX2), transforming growth factor beta 1 gene [TGFB1], and tumor necrosis factor alpha gene [TNFA]) was evaluated. Of the 23 polymorphisms, two were associated with risk for lung cancer. Compared with individuals with the wild-type (CC) variant, individuals carrying the minor allele variants of the IL-1β-511C>T promoter polymorphism (rs16944) (CT and TT) had decreased odds of lung cancer (OR = 0.74, [95% confidence interval (CI): 0.58-0.94] and OR = 0.71 [95% CI: 0.50-1.01], respectively, p = 0.03). Similar results were observed for the IL-1β-1464 C>G promoter polymorphism (rs1143623), with presence of the minor variants CG and CC having decreased odds of lung cancer (OR = 0.75 [95% CI: 0.59-0.95] and OR = 0.69 [95% CI: 0.46-1.03], respectively, p = 0.03). Survival was not influenced by genotype. This study provides further evidence that IL1B promoter polymorphisms may modulate the risk for development of lung cancer. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  8. A66G and C524T polymorphisms of methionine synthase reductase gene are linked to the development of acyanotic congenital heart diseases in Egyptian children.

    Science.gov (United States)

    Hassan, Fahima M; Khattab, Ahmad A; Abo El Fotoh, Wafaa Moustafa M; Zidan, Reham S

    2017-09-20

    Methionine synthase reductase (MTRR) is one of the main regulatory enzymes in the homocysteine/folate pathway. Genes involved in this pathway may play an important role in the development of congenital heart diseases (CHDs). C524T and A66G polymorphisms of MTRR gene may play an imperative role in the development of acyanotic CHDs. This study carried out on 200 children equally divided into 2 groups: group I: 100 children with acyanotic CHDs; and group II: 100 healthy children served as controls. PCR-RFLP method carried out to amplify the A66G and C524T polymorphisms of MTRR gene digested with Xho1and NdeI enzymes. A significant difference(P=0.015) in genotype frequencies of C524T polymorphism between cases and controls, where CC, CT, and TT were 14.0%, 40.0% and 46.0% in patients compared to 38.0,36.0% and 26.0% in controls. Again, a significant difference (P=0.010) in genotype frequencies of A66G polymorphism between the two groups as AA, AG and GG were 26.0%, 32.0% and42.0% in patients compared to 48.0, 36.0% and 16.0% in controls. Also, MTRR A66G and C524T polymorphisms were associated with a higher CHD risk in the homozygote comparison of wild and mutant genotypes and also in heterozygote and mutant comparison. So A66G and C524T polymorphisms of MTRR gene are associated with increased risk of acyanotic CHDs. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak

    Directory of Open Access Journals (Sweden)

    Marić Slađana

    2005-01-01

    Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.

  10. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

    2008-01-01

    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

  11. The Role of ?786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome

    OpenAIRE

    Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard

    2011-01-01

    Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 su...

  12. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

    Science.gov (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

    2017-10-01

    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  13. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases.

    Science.gov (United States)

    Diler, S B; Öden, A

    2016-02-01

    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  14. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  15. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  16. POLYMORPHISMS OF ENDOTHELIAL NITRIC OXIDE SYNTHASE GENE AS PREDICTORS OF WOLFF-PARKINSON-WHITE SYNDROME

    Directory of Open Access Journals (Sweden)

    G. V. Matyushin

    2017-01-01

    Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups  and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group.  In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men,  this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.

  17. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  18. Endothelial nitric oxide synthase polymorphism G298T in ...

    Indian Academy of Sciences (India)

    Supplementary data: Endothelial nitric oxide synthase polymorphism G298T in association with oxidative DNA damage in coronary atherosclerosis. Rajesh G. Kumar, Mrudula K. Spurthi, Kishore G. Kumar, Sanjib K. Sahu and Surekha H. Rani. J. Genet. 91, 349–352. Table 1. The demographic and clinical data of the CHD ...

  19. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review

    Directory of Open Access Journals (Sweden)

    S.N. Koval

    2017-08-01

    Full Text Available Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL, enzyme aldosterone synthase (AS, which takes a direct part in the formation of this hormone, as well as gene polymorphisms of AS, which have not only molecular genetic, but also differential diagnostic and therapeutic significance for secondary forms of arterial hypertension, abdominal obesity (AO, metabolic syndrome (MS, adrenal pathology and other endocrine disorders. AL is a steroid (mineralocorticoid hormone of the adrenal cortex, which is synthesized from cholesterol (CH, mainly in the glomerular zone of the adrenal glands, is released under the action of angiotensin II (A II and potassium ions (K+. AL acti­vity is mediated through the corresponding mineralocorticoid receptors (MKR. The particular importance in AH and MS development belongs to AL activation and MKR density in adipocytes, this phenomenon is accompanied by increased expression of pro-inflammatory cytokines, leptin, an adipogenic effect, and the inhibition of MCR activity is accompanied by increased production of adiponectin, which is more pronounced in patients with AH. Aldosterone synthase, a mitochondrial human enzyme encoded by the CYP11B2 gene (cytochrome P450, family 11, subfamily B, polypeptide 2 is located on the 8th chromosome. AS belongs to the superfamily of cytochrome P450 and regulates the synthesis of AL hormone. The CYP11B2 gene encodes the key enzyme for the synthesis of AL 18-hydroxylase. In scientific papers, single nucleotide polymorphism (SNP of AS gene is often studied, such as 5312T, Intron 2, Lys-173/Arg; T-344C, 3097 C/A. 227 SNP of the AS gene were identified in different

  20. [Features of allele polymorphism of genes involved in homocysteine and folate metabolism in patients with atherosclerosis of the lower extremity arteries].

    Science.gov (United States)

    Klenkova, N A; Kapustin, S I; Saltykova, N B; Shmeleva, V M; Blinov, M N

    2009-01-01

    Under study were features of allele polymorphism of genes of methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MS A 2756G), methionine synthase reductase (MTRR A66G) and methylenetetrahydrofolate dehydrogenase (MTHFD G1958A) in patients with atherosclerosis of the lower extremity arteries (ALEA). Patients with hyperhomocysteinemia (HHcy) had statistically significant increase of allele MTHFR 677T and MTRR 66GG as compared both with the control group and with the group of patients without HHcy. It suggests that polymorphism of genes involved in homocystein and folate metabolism might affect the risk of HHcy in patients with ALEA.

  1. Role of Polymorphisms of Inducible Nitric Oxide Synthase and Endothelial Nitric Oxide Synthase in Idiopathic Environmental Intolerances

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2015-01-01

    Full Text Available Oxidative stress and inflammation play a pathogenetic role in idiopathic environmental intolerances (IEI, namely, multiple chemical sensitivity (MCS, fibromyalgia (FM, and chronic fatigue syndrome (CFS. Given the reported association of nitric oxide synthase (NOS gene polymorphisms with inflammatory disorders, we aimed to investigate the distribution of NOS2A −2.5 kb (CCTTTn as well as Ser608Leu and NOS3 −786T>C variants and their correlation with nitrite/nitrate levels, in a study cohort including 170 MCS, 108 suspected MCS (SMCS, 89 FM/CFS, and 196 healthy subjects. Patients and controls had similar distributions of NOS2A Ser608Leu and NOS3 −786T>C polymorphisms. Interestingly, the NOS3 −786TT genotype was associated with increased nitrite/nitrate levels only in IEI patients. We also found that the NOS2A −2.5 kb (CCTTT11 allele represents a genetic determinant for FM/CFS, and the (CCTTT16 allele discriminates MCS from SMCS patients. Instead, the (CCTTT8 allele reduces by three-, six-, and tenfold, respectively, the risk for MCS, SMCS, and FM/CFS. Moreover, a short number of (CCTTT repeats is associated with higher concentrations of nitrites/nitrates. Here, we first demonstrate that NOS3 −786T>C variant affects nitrite/nitrate levels in IEI patients and that screening for NOS2A −2.5 kb (CCTTTn polymorphism may be useful for differential diagnosis of various IEI.

  2. The Role of -786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome.

    Science.gov (United States)

    Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard

    2011-01-01

    Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of -786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT) and intima-media thickness of carotid arteries were significantly higher in -786CC homozygotes, in comparison with -786TC and -786TT patients. Regarding current smoking status, -786C allele was associated with higher CHOLT than -786T allele. Conclusion. Our study indicates the putative role of -786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking.

  3. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin.

    Science.gov (United States)

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova

    2008-05-01

    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  4. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  5. A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women.

    Science.gov (United States)

    Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K

    2011-10-01

    A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

  6. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  7. Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease.

    Science.gov (United States)

    Masud, Rizwan; Qureshi, Irfan Zia

    2011-09-01

    Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.

  8. [Prevalence of dyslipidemia in middle-aged adults with NOS3 gene polymorphism and low cardiorespiratory fitness].

    Science.gov (United States)

    Malagrino, Pamella A; Sponton, Carlos H G; Esposti, Rodrigo D; Franco-Penteado, Carla F; Fernandes, Romulo A; Bezerra, Marcos André C; Albuquerque, Dulcinéia M; Rodovalho, Cynara M; Bacci, Maurício; Zanesco, Angelina

    2013-02-01

    To evaluate the influence of the interaction between endothelial nitric oxide synthase gene (NOS3) polymorphisms at positions -786T>C, Glu298Asp and intron 4b/a, and cardiorespiratory fitness on plasma nitrite/nitrate levels, blood pressure, lipid profile, and prevalence of cardiometabolic disorders. Ninety-two volunteers were genotyped for NOS3 polymorphisms at positions (-786T>C and Glu298Asp) and (intron 4b/a) and divided according to the genotype: non-polymorphic (NP) and polymorphic (P). After that, they were subdivided according to the cardiorespiratory fitness associated with genotype: high (HNP and HP) and low (LNP and LP). The subjects with polymorphism for the interactions at positions Glu298Asp + intron 4b/a, and Glu298Asp+-786T>C showed the highest values in total cholesterol, as well as dyslipidemia. Our findings show that NOS3 gene polymorphisms at positions -786T>C, Glu298Asp, and intron 4b/a exert negative effects on the lipid profile compared with those who do not carry polymorphisms.

  9. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  10. Analysis of polymorphisms and haplotype structure of the human thymidylate synthase genetic region: a tool for pharmacogenetic studies.

    Directory of Open Access Journals (Sweden)

    Soma Ghosh

    Full Text Available 5-Fluorouracil (5FU, a widely used chemotherapeutic drug, inhibits the DNA replicative enzyme, thymidylate synthase (Tyms. Prior studies implicated a VNTR (variable numbers of tandem repeats polymorphism in the 5'-untranslated region (5'-UTR of the TYMS gene as a determinant of Tyms expression in tumors and normal tissues and proposed that these VNTR genotypes could help decide fluoropyrimidine dosing. Clinical associations between 5FU-related toxicity and the TYMS VNTR were reported, however, results were inconsistent, suggesting that additional genetic variation in the TYMS gene might influence Tyms expression. We thus conducted a detailed genetic analysis of this region, defining new polymorphisms in this gene including mononucleotide (poly A:T repeats and novel single nucleotide polymorphisms (SNPs flanking the VNTR in the TYMS genetic region. Our haplotype analysis of this region used data from both established and novel genetic variants and found nine SNP haplotypes accounting for more than 90% of the studied population. We observed non-exclusive relationships between the VNTR and adjacent SNP haplotypes, such that each type of VNTR commonly occurred on several haplotype backgrounds. Our results confirmed the expectation that the VNTR alleles exhibit homoplasy and lack the common ancestry required for a reliable marker of a linked adjacent locus that might govern toxicity. We propose that it may be necessary in a clinical trial to assay multiple types of genetic polymorphisms in the TYMS region to meaningfully model linkage of genetic markers to 5FU-related toxicity. The presence of multiple long (up to 26 nt, polymorphic monothymidine repeats in the promoter region of the sole human thymidylate synthetic enzyme is intriguing.

  11. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)

    SERVER

    2007-10-18

    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  12. Inducible nitric oxide synthase gene polymorphisms are associated with a risk of nephritis in Henoch-Schönlein purpura children.

    Science.gov (United States)

    Jiang, Jue; Duan, Wuqiong; Shang, Xu; Wang, Hua; Gao, Ya; Tian, Peijun; Zhou, Qi

    2017-08-01

    Henoch-Schönlein purpura (HSP) is the most common form of systemic small-vessel vasculitis in children, and HSP nephritis (HSPN) is a major complication of HSP and is the primary cause of morbidity and mortality. Previous studies have suggested that inducible nitric oxide synthase (iNOS) may play an important role in the pathogenesis of HSP. In this study, we performed a detailed analysis to investigate the potential association between iNOS polymorphisms and the risk of HSP and the tendency for children with HSP to develop HSPN in a Chinese Han population. A promoter pentanucleotide repeat (CCTTT)n and 10 functional single-nucleotide polymorphisms (SNPs) from 532 healthy controls and 513 children with HSP were genotyped using the MassARRAY system and GeneScan. The results suggested that the allelic and genotypic frequencies of the rs3729508 polymorphism were nominally associated with susceptibility to HSP. In addition, there was a significant difference in the allelic distribution of the (CCTTT)12 repeats and rs2297518 between the HSP children with and without nephritis; the HSP children with nephritis exhibited a significantly higher frequency of the (CCTTT)12 repeats and A allele of rs2297518 than the HSP children without nephritis (P FDR  = 0.033, OR = 1.624, 95% CI = 1.177-2.241 and P FDR  = 0.030, OR = 1.660, 95% CI = 1.187-2.321, respectively). Our results support that iNOS polymorphisms are associated with the risk of HSP and may strongly contribute to the genetic basis of individual differences in the progression to nephritis among children with HSP in the Chinese Han population. What is Known: • The etiology of HSP is unknown, but the genetic factors may play an important role in the pathogenesis of HSP. • iNOS could contribute to the development and clinical manifestations of HSP, and this has not been studied extensively so far. What is New: • Our results support that iNOS polymorphisms not only are associated with HSP risk but also

  13. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  14. Analysis of renin-angiotensin aldosterone system gene polymorphisms in malaysian essential hypertensive and type 2 diabetic subjects

    OpenAIRE

    Ramachandran, Vasudevan; Ismail, Patimah; Stanslas, Johnson; Shamsudin, Norashikin

    2009-01-01

    Abstract Background The renin-angiotensin aldosterone system (RAAS) plays an important role in regulating the blood pressure and the genetic polymorphisms of RAAS genes has been extensively studied in relation to the cardiovascular diseases in various populations with conflicting results. The aim of this study was to determine the association of five genetic polymorphisms (A6G and A20C of angiotensinogen (AGT), MboI of renin, Gly460Trp of aldosterone synthase and Lys173Arg of adducin) of RAAS...

  15. The Role of −786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    Blazej Misiak

    2011-01-01

    Full Text Available Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS. Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT and intima-media thickness of carotid arteries were significantly higher in −786CC homozygotes, in comparison with −786TC and −786TT patients. Regarding current smoking status, −786C allele was associated with higher CHOLT than −786T allele. Conclusion. Our study indicates the putative role of −786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking.

  16. The Role of −786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome

    Science.gov (United States)

    Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard

    2011-01-01

    Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT) and intima-media thickness of carotid arteries were significantly higher in −786CC homozygotes, in comparison with −786TC and −786TT patients. Regarding current smoking status, −786C allele was associated with higher CHOLT than −786T allele. Conclusion. Our study indicates the putative role of −786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking. PMID:22164159

  17. Influence of leukotriene gene polymorphisms on chronic rhinosinusitis

    Directory of Open Access Journals (Sweden)

    Duval Melanie

    2008-03-01

    Full Text Available Abstract Background Chronic rhinosinusitis (CRS is increasingly viewed as an inflammatory condition of the sinonasal mucosa interacting with bacteria and/or fungi. However, factors conferring susceptibility to disease remain unknown. Advances in genomics offer powerful tools to explore this disorder. The goal of this study was to evaluate the effect of single nucleotide polymorphisms (SNP on CRS in a panel of genes related to cysteinyl leukotriene metabolism. Methods Severe cases of CRS and postal code match controls were recruited prospectively. A total of 206 cases and 200 controls were available for the present study. Using a candidate gene approach, five genes related to cysteinyl leukotriene metabolism were assessed. For each gene, we selected the maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. These SNPs are in arachidonate 5-lipoxygenase (ALOX5, arachidonate 5-lipoxygenase-activating protein (ALOX5AP, leukotriene C4 synthase (LTC4S, cysteinyl leukotriene receptor 1 (CYSLTR1 and cysteinyl leukotriene receptor 2 (CYSLTR2 genes. Results A total of 59 SNPs were genotyped to capture the common genetic variations within these genes. Three SNPs located within the ALOX5, CYSLTR1 and ALOX5AP genes reached the nominal p-value threshold (p Conclusion While these initial results do not support that polymorphsims in genes assessed involved in the leukotriene pathways are contributing to the pathogenesis of CRS, this initial study was not powered to detect polymorphisms with relative risk of 2.0 or less, where we could expect many gene effects for complex diseases to occur. Thus, despite this lack of significant association noted in this study, we believe that validation with external populations and the use of better-powered studies in the future may allow more conclusive findings.

  18. [BIOINFORMATIC SEARCH AND PHYLOGENETIC ANALYSIS OF THE CELLULOSE SYNTHASE GENES OF FLAX (LINUM USITATISSIMUM)].

    Science.gov (United States)

    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B

    2015-01-01

    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  19. Cystathionine β-synthase T833C/844INS68 polymorphism: a family-based study on mentally retarded children

    Directory of Open Access Journals (Sweden)

    Mukhopadhyay Jotideb

    2005-12-01

    Full Text Available Abstract Background Cystathionine β-synthase (CBS mediates conversion of homocysteine to cystathionine and deficiency in enzyme activity may lead to hyperhomocysteinemia/homocystinuria, which are often associated with mental retardation (MR. A large number of polymorphisms have been reported in the CBS gene, some of which impair its activity and among these, a T833C polymorphism in cis with a 68 bp insertion at 844 in the exon 8 is found to be associated with mild hyperhomocysteinemia in different ethnic groups. Methods The present study is aimed at investigating the association between T833C/844ins68 polymorphism and MR. One hundred and ninety MR cases were recruited after psychometric evaluation. Hundred and thirty-eight control subjects, two hundred and sixty-seven parents of MR probands and thirty cardiovascular disorder (CVD patients were included for comparison. Peripheral blood was collected after obtaining informed written consent. The T833C/844ins68 polymorphism was investigated by PCR amplification of genomic DNA and restriction fragment length polymorphism analysis, followed by statistical analysis. Results The genotypic distribution of the polymorphism was within the Hardy-Weinberg equilibrium. A slightly increased genotypic frequency was observed in the Indian control population as compared to other Asian populations. Both haplotype-based haplotype relative risk analysis and transmission disequilibrium test reveled lack of association of the T833C/844ins68 polymorphism with MR; nevertheless, the relative risk calculated was higher (>1 and in a limited number of informative MR families, preferential transmission of the double mutant from heterozygous mothers to the MR probands was noticed (χ2 = 4.00, P Conclusion This is the first molecular genetic study of CBS gene dealing with T833C/844ins68 double mutation in MR subjects. Our preliminary data indicate lack of association between T833C/844ins68 polymorphism with MR. However

  20. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  1. Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion.

    Science.gov (United States)

    Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza

    2015-02-01

    To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

  2. Analysis of prostaglandin-endoperoxide synthase-2 gene polymorphisms and risk of cervical cancer in an East Indian population: A case–control study

    Directory of Open Access Journals (Sweden)

    Dipanshu Sur

    2017-01-01

    Conclusions: PTGS-2 genotype rs689466:—1195A/G gene polymorphism demonstrated strongly associated with cervical cancer disease. However, exon1-+837T > C polymorphism was not associated with cancer risk in East Indian women. Further studies evaluating the role of PTGS-2 gene polymorphisms in ethnically diverse populations and a larger cohort may help in understanding the etiopathogenesis of cervical cancer in women worldwide.

  3. Polymorphisms in folate metabolism genes are associated with susceptibility to presbycusis.

    Science.gov (United States)

    Manche, Santoshi Kumari; Jangala, Madhavi; Dudekula, Dinesh; Koralla, Meganadh; Akka, Jyothy

    2018-03-01

    Presbycusis or age related hearing loss is caused by several extrinsic and intrinsic factors that damage the auditory system. Gene polymorphisms in folate metabolism were found to play an important role in the etiology of presbycusis. The present study aimed to investigate the role of 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTR) and thymidylate synthase (TYMS) gene polymorphisms in the onset of presbycusis in a South Indian population. A total of 220 subjects confirmed with presbycusis along with 270 age and sex matched healthy controls visiting MAA ENT Hospitals, Hyderabad, India were enrolled for the study. Genotyping of MTHFR C677T (rs180133) and A1298C (rs1801131), MTR A2756G (rs1805087), TSER (rs1801136) and TS1494indel6 bp (rs16430) was carried out using PCR & PCR-RFLP methods. The 'TT' genotype of MTHFR C677T and '152 bp/152 bp' genotype of TS1494indel6 bp showed statistically significant risk for presbycusis while CC genotype of MTHFR A1298C, '2R/2R' genotype of TSER at 3'UTR and 6 bp ins/6 bp ins of TYMS at 5'UTR were found to be protective. The T-A-A haplotype combination of MTHFR C677T, MTHFR A1298C and MTR A2756G as well as 3R- 152 bp of TYMS at 5'UTR and 3'UTR were also found to contribute significant risk for the onset of presbycusis. Further, the combination of SNP loci TSER: TS1494indel6 bp exhibited moderate linkage in presbycusis. The present pilot study identified the significant association of gene variants of MTHFR and TYMS with presbycusis. These findings aid in early diagnosis of hearing loss in the elderly population. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    International Nuclear Information System (INIS)

    Soliman, S.E.T.; Zaater, M.K.

    2010-01-01

    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  5. Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

    Science.gov (United States)

    Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

    2015-03-31

    Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

  6. Analysis of renin-angiotensin aldosterone system gene polymorphisms in malaysian essential hypertensive and type 2 diabetic subjects

    Directory of Open Access Journals (Sweden)

    Stanslas Johnson

    2009-02-01

    Full Text Available Abstract Background The renin-angiotensin aldosterone system (RAAS plays an important role in regulating the blood pressure and the genetic polymorphisms of RAAS genes has been extensively studied in relation to the cardiovascular diseases in various populations with conflicting results. The aim of this study was to determine the association of five genetic polymorphisms (A6G and A20C of angiotensinogen (AGT, MboI of renin, Gly460Trp of aldosterone synthase and Lys173Arg of adducin of RAAS genes in Malaysian essential hypertensive and type 2 diabetic subjects. Methods RAAS gene polymorphisms were determined using mutagenically separated PCR and PCR-RFLP method in a total of 270 subjects consisting of 70 hypertensive subjects without type 2 diabetes mellitus (T2DM, 60 T2DM, 65 hypertensive subjects with T2DM and 75 control subjects. Results There was significant difference found in age, body mass index, systolic/diastolic blood pressure, fasting plasma glucose and high density lipoprotein cholesterol levels between the hypertensive subjects with or without T2DM and control subjects. No statistically significant differences between groups were found in the allele frequency and genotype distribution for A20C variant of AGT gene, MboI of renin, Gly460Trp of aldosterone and Lys173Arg of adducin (p > 0.05. However, the results for A6G of AGT gene revealed significant differences in allele and genotype frequencies in essential hypertension with or without T2DM (p Conclusion Among the five polymorphisms of RAAS genes only A6G variant of AGT gene was significantly associated in Malaysian essential hypertensive and type 2 diabetic subjects. Therefore, A6G polymorphism of the AGT gene could be a potential genetic marker for increased susceptibility to essential hypertension with or without T2DMin Malaysian subjects.

  7. X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

    International Nuclear Information System (INIS)

    Lamas, Maria J.; Duran, Goretti; Gomez, Antonio; Balboa, Emilia; Anido, Urbano; Bernardez, Beatriz; Rana-Diez, Pablo; Lopez, Rafael; Carracedo, Angel; Barros, Francisco

    2012-01-01

    Purpose: 5-Fluorouracil–based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m 2 /d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62–10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10–6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR C 677 and MTHFR A 1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

  8. X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Lamas, Maria J., E-mail: mlamasd@yahoo.es [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Duran, Goretti [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Gomez, Antonio [Department of Oncology Radiotherapy, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Balboa, Emilia [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Anido, Urbano [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Bernardez, Beatriz [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Rana-Diez, Pablo [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Lopez, Rafael [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Carracedo, Angel; Barros, Francisco [Fundacion Publica Galega de Medicina Xenomica and Genomic Medicine Group-CIBERER, University of Santiago de Compostela, Calle San Fransisco S/N, Santiago de Compostela (Spain)

    2012-01-01

    Purpose: 5-Fluorouracil-based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m{sup 2}/d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62-10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10-6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR{sub C}677 and MTHFR{sub A}1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

  9. Thymidylate synthase genetic polymorphism and plasma total homocysteine level in a group of Turkish patients with rheumatoid arthritis: relationship with disease activity and methotrexate toxicity.

    Science.gov (United States)

    Borman, Pınar; Taşbaş, Özgur; Karabulut, Halil; Tukun, Ajlan; Yorgancıoğlu, Rezan

    2015-01-01

    The polymorphism of thymidylate synthase (TS) gene and homocysteine are reported to have a relationship to methotrexate (MTX) metabolism, with conflicting results. The aim of this study was to determine homocysteine levels and the frequency of TS gene triple repeat (TS3R) and double repeat (TS2R) polymorphisms in a group of Turkish RA patients and evaluate its association with MTX toxicity and disease activity. Sixty-four patients with RA and 31 control subjects with a mean age of 48.7 ± 12.5 and 46.2 ± 13.4 years, were enrolled to the study. Demographic characteristics were obtained and number of patients with MTX-related adverse affects, were recorded in the patient group. The homocysteine levels and TS2R/TS3R polymorphisms of the TS gene were analyzed and the distribution of genotypes according to MTX toxicity and disease activity, were determined. The demographic properties were similar between the patient and control subjects. Folic acid supplementation with a mean dose of 5mg folic acid/week, was present in all patients. Thirty-six of the 64 patients showed adverse effects to MTX treatment. The frequency of TS2R and TS3R polymorphisms were found to be similar in the patient and control groups. TS2R and TS3R gene polymorphisms were found to be similar in patients with and without MTX-related adverse events. The mean homocysteine level was also similar in patients with and without TS gene polymorphism, but was found to be higher (12.45μmol/L vs 10.7μmol/L) in patients with MTX-related side effects than in patients without side effects. The mean level of homocysteine was correlated with levels of ESR in the patient group. In conclusion, homocysteine levels might effect the disease activity and toxicity of MTX but 2R and 3R polymorphisms in the TS gene, were not related with MTX-related toxicity in RA patients receiving folate supplementation. Further studies are needed to illuminate the polymorphisms in other enzymes that might be responsible from the MTX

  10. TS gene polymorphisms are not good markers of response to 5-FU therapy in stage III colon cancer patients.

    Science.gov (United States)

    Fariña-Sarasqueta, A; Gosens, M J E M; Moerland, E; van Lijnschoten, I; Lemmens, V E P P; Slooter, G D; Rutten, H J T; van den Brule, Adriaan J C

    2011-08-01

    Although the predictive and prognostic value of thymidylate synthase (TS) expression and gene polymorphism in colon cancer has been widely studied, the results are inconclusive probably because of methodological differences. With this study, we aimed to elucidate the role of TS gene polymorphisms genotyping in therapy response in stage III colon carcinoma patients treated with 5-FU adjuvant chemotherapy. 251 patients diagnosed with stage III colon carcinoma treated with surgery followed by 5-FU based adjuvant therapy were selected. The variable number of tandem repeats (VNTR) and the single nucleotide polymorphism (SNP) in the 5'untranslated region of the TS gene were genotyped. There was a positive association between tumor T stage and the VNTR genotypes (p = 0.05). In both univariate and multivariate survival analysis no effects of the studied polymorphisms on survival were found. However, there was an association between both polymorphisms and age. Among patients younger than 60 years, the patients homozygous for 2R seemed to have a better overall survival, whereas among the patients older than 67 this longer survival was seen by the carriers of other genotypes. We conclude that the TS VNTR and SNP do not predict response to 5-FU therapy in patients with stage III colon carcinoma. However, age appears to modify the effects of TS polymorphisms on survival.

  11. Association between FASN gene polymorphisms ultrasound carcass traits and intramuscular fat in Qinchuan cattle.

    Science.gov (United States)

    Raza, Sayed Haidar Abbas; Gui, Linsheng; Khan, Rajwali; Schreurs, Nicola M; Xiaoyu, Wang; Wu, Sen; Mei, Chugang; Wang, Li; Ma, Xueyao; Wei, Dawei; Guo, Hongfang; Zhang, Song; Wang, Xingping; Kaleri, Hubdar Ali; Zan, Linsen

    2018-03-01

    Fatty acid synthase (FASN) is an enzyme involved with fat deposition and fatty acid composition in cattle. This study was conducted to detect single nucleotide polymorphisms (SNPs) of the FASN gene and explore their relationships with ultrasound carcass traits in order to assess the potential use of the FASN gene for the breeding selection of Qinchuan cattle for desirable carcass traits. The frequencies of SNP g.12740C>T, g.13192T>C and g.13232C>T were identified in 525 individual Qinchuan cattle which were also assessed for backfat depth, eye muscle area and intramuscular fat by ultrasound. According to the PIC values, g.13192T>C possessed an intermediate polymorphism (0.25T, g.12740C>T possessed low polymorphism (PICC were in Hardy-Weinberg disequilibrium (c2C was associated with a greater eye muscle area and the TT genotype at g.13232C>T was associated with greater intramuscular fat. When these genotypes were combined there was no difference in eye muscle area and intramuscular fat between the diplotypes. The H 2 H 2 diplotype was associated with carcass traits that are likely to provide economic advantage in Qinchuan cattle. Variations in the FASN genes and their corresponding genotypes may be considered as molecular markers for economic traits in cattle breeding. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.

  13. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.

    2006-01-01

    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  14. A genetic polymorphism in the sex-linked ATP5A1 gene is associated with individual fitness in Ovenbirds (Seiurus aurocapilla)

    Science.gov (United States)

    Judith D. Toms; Lori S. Eggert; Wayne J. Arendt; John Faaborg

    2012-01-01

    While testing genetic sexing techniques in Ovenbirds (Seiurus aurocapilla),we found a genetic polymorphism in the ATP5A1 gene in 38% of individuals. The Z ' allele included changes in both intronic and exonic portions of the sequenced region, but there was no evidence that this changed the resulting ATP synthase product. Males that had one or more copies of...

  15. A novel haplotype of low-frequency variants in the aldosterone synthase gene among northern Han Chinese with essential hypertension.

    Science.gov (United States)

    Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun

    2017-09-01

    Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.

  16. Association of nNOS Gene Polymorphism with Ischemic Stroke in Han Chinese of North China

    Directory of Open Access Journals (Sweden)

    Yingjie Dai

    2013-01-01

    Full Text Available Nitric oxide (NO is an important messenger molecule and effector molecule. This study aimed to investigate the relation of neuronal nitric oxide synthase (nNOS gene polymorphism with ischemic stroke in Han Chinese of North China. This was a case-control study. A total of 413 patients with ischemic stroke were recruited from Han Chinese of North China. There were 201 males and 212 females. In addition, 477 healthy subjects served as controls including 224 males and 253 females. Multiplex SNaPshot was employed to detect nNOS gene polymorphism (rs2293050, rs2139733, rs7308402, and rs1483757. Results showed that the rs1483757, rs2139733, and rs2293050 genotypes and allele frequencies were comparable between patients and controls. However, ischemic stroke patients had significantly reduced AG genotype and A allele frequency when compared with controls (P=0.037, P=0.041. After adjusting confounding factors (gender, age, smoking, history of drinking, hypertension, and diabetes, AG genotype and A allele were still related to ischemic stroke (OR=0.572, 95% CI: 0.335–0.978, P=0.041; OR=0.611, 95% C: 0.378–0.985, and P=0.041 and both were found to be protective factors. Our results showed that rs7308402 gene polymorphism of nNOS is related to ischemic stroke in Han Chinese of North China.

  17. Lack of association between methionine synthase A2756G polymorphism and digestive system cancer risk: evidence from 3,9327 subjects.

    Directory of Open Access Journals (Sweden)

    Yuan Zhao

    Full Text Available BACKGROUND: Polymorphisms in genes involved in the metabolism of folate and methyl groups have been implicated with risk of digestive system cancer. Methionine synthase (MTR plays a central role in folate metabolism, thereby affecting DNA methylation. The association between A2756G polymorphism (rs1805087 in MTR and digestive system cancer susceptibility was inconsistent in previous studies. To investigate this inconsistency, we performed this meta-analysis. METHODS: Databases including Pubmed, EMBASE, ISI Web of Science and China National Knowledge Infrastructure (CNKI were searched to find relevant studies. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the strength of association. Potential sources of heterogeneity were also assessed by subgroup analysis and meta-regression. RESULTS: A total of 29 articles with 15,368 patients and 23,959 controls were included. We found no association between MTR A2756G polymorphism and digestive system cancer in overall population (G allele: OR = 1.03, 95% CI = 0.98-1.09, P = 0.25; dominant model: OR = 1.03, 95% CI = 0.97-1.10, P = 0.33; recessive model: OR = 1.02, 95% CI = 0.89-1.17, P = 0.79. In the stratified analyses according to cancer type, sample size and genotyping method, no evidence of any gene-disease association was obtained in almost all genetic models. However, marginal significant associations were found for East Asians and hospital-based studies. CONCLUSIONS: This meta-analysis suggests that there is no significant association between the MTR A2756G polymorphism and digestive system cancer risk.

  18. Prevalence of endothelial nitric oxide synthase (eNOS) gene exon 7 Glu298Asp variant in North Eastern India

    Science.gov (United States)

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish

    2011-01-01

    Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032

  19. [Homocysteine levels and polymorphisms of MTHFR and CBS genes in Colombian patients with superficial and deep venous thrombosis].

    Science.gov (United States)

    Ayala, Claudia; García, Reggie; Cruz, Edith; Prieto, Karol; Bermúdez, Marta

    2010-01-01

    Thrombosis develops when the hemostatic system is incorrectly activated due to the unbalance between procoagulant, anticoagulant and fibrinolytic mechanisms allowing the formation of a clot within a blood vessel. The risk factors of this pathology can be acquired or can be genetic. To analyze in a Colombian population with diagnosis of venous thrombosis, lipid profile, glucose and homocystein levels, to calculate the alleles and genotypic frequencies of polymorphisms c.699 C>T, c.1080 C>T, c.844ins68 of the cystathionine ß synthase and the c.677 C>T of the methylenetetrahydrofolate reductase (MTHFR) genes. Thirty three patients and their controls were studied. The biochemical test was carried out by colorimetric methods and immunoassay. In this survey we used the restriction fragments longitude polymorphism (RLFP) technique to identify the polymorphisms mentioned. The association study was performed through the chi square test. We confirmed that gene alterations increase risk for pathology; we found statistically significant differences in the group with hypercholesterolemia in presence of the polymorphism c.699 C>T in the CBS gene, showing a protective effect in the individuals carrying this genetic variation. Likewise, we found a statistical trend for an eventual protective effect of the CBS c.844ins68 polymorphism to venous thrombotic disease. There were not any statistically significant differences in homocystein levels between cases and controls; nevertheless, the variability in the plasma concentrations was greater in the group of cases.

  20. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf

    2009-01-01

    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  1. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara

    2004-01-01

    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  2. Methylenetetrahydrofolate reductase gene polymorphism in type 1 ...

    African Journals Online (AJOL)

    In patients with type-I diabetes mellitus folate deficiency is associated with endothelial dysfunction. So, polymorphism in genes involved in folate metabolism may have a role in vascular disease. This study was designed to evaluate the relationship between methylenetetrahydrofolate reductase (MTHFR) gene polymorphism ...

  3. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

    Science.gov (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

    2007-07-10

    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  4. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    African Journals Online (AJOL)

    Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...

  5. Endothelial nitric oxide synthase single nucleotide polymorphism and left ventricular function in early chronic kidney disease.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Chronic kidney disease (CKD is associated with accelerated cardiovascular disease and heart failure. Endothelial nitric oxide synthase (eNOS Glu298Asp single nucleotide polymorphism (SNP genotype has been associated with a worse phenotype amongst patients with established heart failure and in patients with progression of their renal disease. The association of a cardiac functional difference in non-dialysis CKD patients with no known previous heart failure, and eNOS gene variant is investigated.140 non-dialysis CKD patients, who had cardiac magnetic resonance (CMR imaging and tissue doppler echocardiography as part of two clinical trials, were genotyped for eNOS Glu298Asp SNP retrospectively.The median estimated glomerular filtration rate (eGFR was 50 mls/min and left ventricular ejection fraction (LVEF was 74% with no overt diastolic dysfunction in this cohort. There were significant differences in LVEF across eNOS genotypes with GG genotype being associated with a worse LVEF compared to other genotypes (LVEF: GG 71%, TG 76%, TT 73%, p = 0.006. After multivariate analysis, (adjusting for age, eGFR, baseline mean arterial pressure, contemporary CMR heart rate, total cholesterol, high sensitive C-reactive protein, body mass index and gender GG genotype was associated with a worse LVEF, and increased LV end-diastolic and systolic index (p = 0.004, 0.049 and 0.009 respectively.eNOS Glu298Asp rs1799983 polymorphism in CKD patients is associated with relevant sub-clinical cardiac remodelling as detected by CMR. This gene variant may therefore represent an important genetic biomarker, and possibly highlight pathways for intervention, in these patients who are at particular risk of worsening cardiac disease as their renal dysfunction progresses.

  6. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

    Science.gov (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

    2009-02-01

    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  7. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

    1994-01-01

    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  8. Relationship between endothelial nitric oxide synthase (eNOS) and natural history of intracranial aneurysms: meta-analysis.

    Science.gov (United States)

    Paschoal, Eric Homero Albuquerque; Yamaki, Vitor Nagai; Teixeira, Renan Kleber Costa; Paschoal Junior, Fernando Mendes; Jong-A-Liem, Glaucia Suzanna; Teixeira, Manoel Jacobsen; Yamada, Elizabeth Sumi; Ribeiro-Dos-Santos, Ândrea; Bor-Seng-Shu, Edson

    2018-01-01

    The aneurysmal subarachnoid hemorrhage is a major public health problem described as a sudden drastic event with no warning symptoms and high morbidity and mortality rates. The role of the endothelial isoform of nitric oxide synthase gene polymorphism in intracranial aneurysms (IAs) is still a matter of controversy with divergent findings among European, American, and Asian populations. Our study purposed to test the association between intracranial aneurysms formation and nitric oxide gene polymorphisms through a systematic review and meta-analysis. Systematic search on Medline, Lilacs, and EMBASE was performed. The primary search resulted in 139 papers, out of which 9 met our inclusion criteria after a full text analysis. The dominant T786C model found a significant association with IA (OR 1.22, 95 % CI 1.04-1.44, p = 0.01), so did studies of the recessive T786C model (OR 0.37, 95 % CI 0.30-0.45, p < 0.0001) but with opposite effect. Our findings support the presence of the T786C polymorphism as a predictor for the development of intracranial aneurysm in the cerebral vascular system. More studies are necessary in order to elucidate the pathways of the endothelial nitric oxide synthase (eNOS) in cerebrovascular diseases and in defining how different allelic combinations of the eNOS gene single-nucleotide polymorphism (SNP) could favor this pathological process.

  9. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.

    2003-01-01

    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  10. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

    Science.gov (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  11. Gene polymorphisms in chronic periodontitis

    NARCIS (Netherlands)

    Laine, M.L.; Loos, B.G.; Crielaard, W.

    2010-01-01

    We aimed to conduct a review of the literature for gene polymorphisms associated with chronic periodontitis (CP) susceptibility. A comprehensive search of the literature in English was performed using the keywords: periodontitis, periodontal disease, combined with the words genes, mutation, or

  12. gene polymorphism and its serum lev

    Indian Academy of Sciences (India)

    Navya

    polymorphisms and its serum level with the risk of MetS as well as their ... population for quantifying insulin resistance and β-cell function (Matthews et al. 1985). .... of IL-10 -819 C >T gene polymorphism (Co-dominant model) was significantly.

  13. Evaluation of inflammation-related genes polymorphisms in Mexican with Alzheimer’s disease: a pilot study

    Directory of Open Access Journals (Sweden)

    Danira eToral-Rios

    2015-05-01

    Full Text Available Amyloid peptide is able to promote the activation of microglia and astrocytes in Alzheimer’s disease (AD, and this stimulates the production of pro-inflammatory cytokines. Inflammation contributes to the process of neurodegeneration and therefore is a key factor in the development of AD. Some of the most important proteins involved in AD inflammation are: clusterin (CLU, complement receptor 1 (CR1, C reactive protein (CRP, tumor necrosis factor α (TNF- α, the interleukins 1α (IL - 1α, 6 (IL-6, 10 (IL-10 and cyclooxygenase 2 (COX-2. In particular, COX-2 is encoded by the prostaglandin-endoperoxide synthase 2 gene (PTGS2. Since variations in the genes that encode these proteins may modify gene expression or function, it is important to investigate whether these variations may change the developing AD. The aim of this study was to determine whether the presence of polymorphisms in the genes encoding the aforementioned proteins is associated Mexican patients with AD. Fourteen polymorphisms were genotyped in 96 subjects with AD and the differences in allele, genotype and haplotype frequencies were analyzed. Additionally, an ancestry analysis was conducted to exclude differences in genetic ancestry among groups as a confounding factor in the study. Significant differences in frequencies between AD and controls were found for the SNP rs20417 within the PTGS2 gene. Ancestry analysis revealed no significant differences in the ancestry of the compared groups, and the association was significant even after adjustment for ancestry and correction for multiple testing, which strengthens the validity of the results. We conclude that this polymorphism plays an important role in the development of the AD pathology and further studies are required, including their proteins.

  14. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

    Science.gov (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

    2017-01-01

    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  15. Analysis of T-786C and 4a/b endothelial nitric oxide synthase gene polymorphisms in retinopathy of prematurity

    Directory of Open Access Journals (Sweden)

    Pantelić Jelica R.

    2016-01-01

    Full Text Available Retinopathy of prematurity (ROP is a vascular proliferative disorder of retina, that causes visual impairment in premature children. Beside well known risk factors such as short gestational age, low birth weight and early oxygen exposure, genetic susceptibility is considered as a risk factor for development of the disease. The aim of our study was to explore the association of T-786C and 4a/b eNOS gene polymorphisms with the development of severe ROP. Study included 174 preterm infants, 84 with ROP and 90 as a control group. No differences have been observed in genotypes and alleles distributions of eNOS T-786C and eNOS 4a/b polymorphisms between two analyzed groups. There was significant difference in female infants by dominant model for 4a/b genotypes (4bb/4ba+4aa. Namely, female infants in ROP group were more frequently carriers of 4ba and 4aa genotypes than female infants in control group (p=0.037. Analysis of association between 4a/b eNOS polymorphism and ROP among preterm infants have not shown statistically significant association (p=0.288. Gestational age values by recessive model (4bb+4ba/4aa were significantly lower in infants with 4aa genotype (t=2.034 p=0.044. Almost all detected 4aa genotypes were present in the group of infants with gestational age under 30 weeks (p=0.032, but multivariate linear regression analysis does not show association of 4a/b genotypes with gestational age of premature infants. According to results of the present study T-786C and 4a/b polymorphisms of the eNOS gene may not be the risk factors for the manifestation of severe ROP in Serbian infants. [Projekat Ministarstva nauke Republike Srbije, br. 175091

  16. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang

    2017-04-01

    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  17. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    African Journals Online (AJOL)

    Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This study was conducted in the Medical Genetics Center, Ain-Shams University hospitals, on a total of 170 mothers of children, diagnosed with ...

  18. Genetic polymorphisms of the TYMS gene are not associated with congenital cardiac septal defects in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Jian-Yuan Zhao

    Full Text Available BACKGROUND: Clinical research indicates that periconceptional administration of folic acid can reduce the occurrence of congenital cardiac septal defects (CCSDs. The vital roles of folate exhibits in three ways: the unique methyl donor for DNA expression regulation, the de novo biosynthesis of purine and pyrimidine for DNA construction, and the serum homocysteine removal. Thymidylate synthase (TYMS is the solo catalysis enzyme for the de novo synthesis of dTMP, which is the essential precursor of DNA biosynthesis and repair process. To examine the role of TYMS in Congenital Cardiac Septal Defects (CCSDs risk, we investigated whether genetic polymorphisms in the TYMS gene associated with the CCSDs in a Han Chinese population. METHOD: Polymorphisms in the noncoding region of TYMS were identified via direct sequencing in 32 unrelated individuals composed of half CCSDs and half control subjects. Nine SNPs and two insertion/deletion polymorphisms were genotyped from two independent case-control studies involving a total of 529 CCSDs patients and 876 healthy control participants. The associations were examined by both single polymorphism and haplotype tests using logistic regression. RESULT: We found that TYMS polymorphisms were not related to the altered CCSDs risk, and even to the changed risk of VSDs subgroup, when tested in both studied groups separately or in combination. In the haplotype analysis, there were no haplotypes significantly associated with risks for CCSDs either. CONCLUSION: Our results show no association between common genetic polymorphisms of the regulatory region of the TYMS gene and CCSDs in the Han Chinese population.

  19. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  20. Polymorphism of the VEGF gene and its association with growth ...

    African Journals Online (AJOL)

    User

    Keywords: VEGF gene, caprine, single nucleotide polymorphism (SNP), genetic variation, PCR-SSCP ... This field is strongly focusing on gene loci and polymorphisms that have ..... Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining. Anal.

  1. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

    Science.gov (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

    2018-03-01

    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  2. Effects of MTHFR and MS gene polymorphisms on baseline blood pressure and Benazepril effectiveness in Chinese hypertensive patients.

    Science.gov (United States)

    Jiang, S; Yu, Y; Venners, S A; Zhang, Y; Xing, H; Wang, X; Xu, X

    2011-03-01

    The development of essential hypertension (EH) and inter-individual differences in response to antihypertensive treatment may partly result from genetic heterogeneity. In this study, we conducted an investigation of the combined effects of 5, 10-methylenetetrahydrofolate reductase (MTHFR) C677T and methionine synthase (MS) A2756G polymorphisms on baseline blood pressure (BP) and BP response to antihypertensive Benazepril treatment in 823 Chinese hypertensive patients with a fixed daily dosage of 10 mg for 15 consecutive days. When MTHFR C677T and MS A2756G polymorphisms were modelled together with adjustment for important covariates, only MTHFR C677T was associated with baseline systolic BP (SBP) (β (s.e.)=2.84 (1.10), P=0.0096) or baseline diastolic BP (DBP) (β (s.e.)=2.19 (0.65), P=0.0008). Modelled together with adjustment for important covariates, MTHFR C677T and MS A2756G polymorphisms were both independently associated with increased DBP response (baseline minus post-treatment) to Benazepril treatment (C677T: β (s.e.)=1.58 (0.76), P=0.038; A2756G: β (s.e.)=2.14 (0.89), P=0.016). Neither polymorphism was associated with SBP response to Benazepril treatment. There were no significant interactions or effect modification between MTHFR C677T and MS A2756G gene polymorphisms in models of baseline SBP, baseline DBP or DBP response to Benazepril treatment. Our results suggest that the effects of MTHFR C677T and MS A2756G gene polymorphisms may have pivotal roles in the aetiology of EH and BP response to Benazepril treatment.

  3. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf

    2000-10-11

    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  4. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  5. gene polymorphism and its serum lev

    Indian Academy of Sciences (India)

    Navya

    Association of Interleukin-10 (-1082 A>G, -819 C >T and -592 C >A) gene polymorphism and its ... Th2 induced component of anti-β cell immunity is mediated principally by IL-10 (Lee et al. ..... promoter polymorphisms influence the clinical outcome of diffuse large B-cell lymphoma. ... Bone Marrow Transplant 36, 1089-1095.

  6. Gene-gene interactions and gene polymorphisms of VEGFA and EG-VEGF gene systems in recurrent pregnancy loss.

    Science.gov (United States)

    Su, Mei-Tsz; Lin, Sheng-Hsiang; Chen, Yi-Chi; Kuo, Pao-Lin

    2014-06-01

    Both vascular endothelial growth factor A (VEGFA) and endocrine gland-derived vascular endothelial growth factor (EG-VEGF) systems play major roles in angiogenesis. A body of evidence suggests VEGFs regulate critical processes during pregnancy and have been associated with recurrent pregnancy loss (RPL). However, little information is available regarding the interaction of these two major major angiogenesis-related systems in early human pregnancy. This study was conducted to investigate the association of gene polymorphisms and gene-gene interaction among genes in VEGFA and EG-VEGF systems and idiopathic RPL. A total of 98 women with history of idiopathic RPL and 142 controls were included, and 5 functional SNPs selected from VEGFA, KDR, EG-VEGF (PROK1), PROKR1 and PROKR2 were genotyped. We used multifactor dimensionality reduction (MDR) analysis to choose a best model and evaluate gene-gene interactions. Ingenuity pathways analysis (IPA) was introduced to explore possible complex interactions. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL (P<0.01). The MDR test revealed that the KDR (Q472H) polymorphism was the best loci to be associated with RPL (P=0.02). IPA revealed EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3 signaling pathways. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL. EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3.

  7. Serotonin transporter (SERT gene polymorphism in Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Mahmut Özkaya

    2004-06-01

    Full Text Available Background: Parkinson disease (PD is the second most common neurodegenerative disorder with a prevalence of about 2% in persons older than 65 years of age. Neurodegenerative process in PD is not restricted to the dopaminergic neurons of the substantia nigra but also affects serotoninergic neurons. It has been shown that PD brains with Lewy bodies in the substantia nigra also had Lewy bodies in the raphe nuclei. The re-uptake of 5HT released into the synaptic cleft is mediated by the 5HT transporter (SERT. The SERT gene has been mapped to the chromosome of 17q11.1-q12 and has two main polymorphisms: intron two VNTR polymorphism and promoter region 44 bp insertion/deletion polymorphism. Objective: In this study we investigated whether two polymorphic regions in the serotonin transporter gene are associated with PD. Material and Method: After obtaining informed consent, blood samples were collected from 76 patients and 54 healthy volunteers. Genomic DNA was extracted from peripheral leucocytes using standard methods. The SERT gene genotypes were determined using polymerase chain reaction (PCR method. Results: Based on the intron 2 VNTR polymorphism of SERT gene, the distribution of 12/12, 12/10 and 10/10 genotypes were found as, 56.6 %, 35.5 %, 7.9 % in patients whereas this genotype distribution in control group was 40.7 %, 46.3 % and 13 %, respectively. According to 5-HTTLPR polymorphism, the distribution of L/L, L/S and S/S genotypes were found as 27.6 % 51.3 % and 21.1 % in patients whereas this genotype distribution in control group was 33.4 %, 50.0 % and 16.6 %, respectively. Despite the fact that the genotype distribution of SERT gene polymorphism in patients and control group seemed to be different from each other, this difference was not found to be statistically significant. Conclusion: This finding suggests that polymorphisms within the SERT gene do not play a major role in PD susceptibility in the Turkish population.

  8. Gene polymorphisms as risk factors for predicting the cardiovascular manifestations in Marfan syndrome. Role of folic acid metabolism enzyme gene polymorphisms in Marfan syndrome.

    Science.gov (United States)

    Benke, Kálmán; Ágg, Bence; Mátyás, Gábor; Szokolai, Viola; Harsányi, Gergely; Szilveszter, Bálint; Odler, Balázs; Pólos, Miklós; Maurovich-Horvat, Pál; Radovits, Tamás; Merkely, Béla; Nagy, Zsolt B; Szabolcs, Zoltán

    2015-10-01

    Folic acid metabolism enzyme polymorphisms are believed to be responsible for the elevation of homocysteine (HCY) concentration in the blood plasma, correlating with the pathogenesis of aortic aneurysms and aortic dissection. We studied 71 Marfan patients divided into groups based on the severity of cardiovascular involvement: no intervention required (n=27, Group A); mild involvement requiring intervention (n=17, Group B); severe involvement (n=27, Group C) subdivided into aortic dilatation (n=14, Group C1) and aortic dissection (n=13, Group C2), as well as 117 control subjects. We evaluated HCY, folate, vitamin B12 and the polymorphisms of methylenetetrahydrofolate reductase (MTHFR;c.665C>T and c.1286A>C), methionine synthase (MTR;c.2756A>G) and methionine synthase reductase (MTRR;c.66A>G). Multiple comparisons showed significantly higher levels of HCY in Group C2 compared to Groups A, B, C1 and control group (pMarfan patients, and especially aortic dissection, is associated with higher HCY plasma levels and prevalence of homozygous genotypes of folic acid metabolism enzymes than mild or no cardiovascular involvement. These results suggest that impaired folic acid metabolism has an important role in the development and remodelling of the extracellular matrix of the aorta.

  9. Association of -330 interleukin-2 gene polymorphism with oral cancer.

    Science.gov (United States)

    Singh, Prithvi Kumar; Kumar, Vijay; Ahmad, Mohammad Kaleem; Gupta, Rajni; Mahdi, Abbas Ali; Jain, Amita; Bogra, Jaishri; Chandra, Girish

    2017-12-01

    Cytokines play an important role in the development of cancer. Several single-nucleotide polymorphisms (SNPs) of cytokine genes have been reported to be associated with the development and severity of inflammatory diseases and cancer predisposition. This study was undertaken to evaluate a possible association of interleukin 2 (IL-2) (- 330A>C) gene polymorphisms with the susceptibility to oral cancer. The SNP in IL-2 (-330A>C) gene was genotyped in 300 oral cancer patients and in similar number of healthy volunteers by polymerase chain reaction (PCR)-restriction fragment length polymorphism and the association of the gene with the disease was evaluated. IL-2 (-330A>C) gene polymorphism was significantly associated with oral cancer whereas it was neither associated with clinicopathological status nor with cancer pain. The AC heterozygous genotype was significantly associated with oral cancer patients as compared to controls [odds ratio (OR): 3.0; confidence interval (CI): 2.14-4.20; Poral cancer (OR: 1.80; CI: 1.39-2.33; PC) gene polymorphism was also associated with oral cancer in tobacco smokers and chewers. Our results showed that oral cancer patients had significantly higher frequency of AA genotype but significantly lower frequency of AC genotype and C allele compared to controls. The IL-2 AC genotype and C allele of IL-2 (-330A>C) gene polymorphisms could be potential protective factors and might reduce the risk of oral cancer in Indian population.

  10. RETRACTED: Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression.

    Science.gov (United States)

    Yang, Chun-Hua; Zhou, Tian-Biao

    2015-12-01

    Jiang, and Hong-Yan Li Relationship between the ACE I/D gene polymorphism and T1DN susceptibility/risk of T1DM developing into T1DN in the Caucasian population Journal of Renin-Angiotensin-Aldosterone System 1470320314563425, first published on February 1, 2015 doi: 10.1177/1470320314563425 Chun-Hua Yang and Tian-Biao Zhou Relationship between the angiotensinogen A1166C gene polymorphism and the risk of diabetes mellitus developing into diabetic nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314566221, first published on February 1, 2015 doi: 10.1177/1470320314566221 Chun-Hua Yang and Tian-Biao Zhou Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression Journal of Renin-Angiotensin-Aldosterone System 1470320314568521, first published on February 3, 2015 doi: 10.1177/1470320314568521 Articles published in an issue Guohui Liu, Tian-Biao Zhou, Zongpei Jiang, and Dongwen Zheng Association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in a Caucasian population Journal of Renin-Angiotensin-Aldosterone System March 2015 16: 165-171, first published on November 14, 2014 doi: 10.1177/1470320314557849 Weiqiang Zhong, Zhongliang Huang, Yong Wu, Zongpei Jiang, and Tian-Biao Zhou Association of aldosterone synthase (CYP11B2) gene polymorphism with IgA nephropathy risk and progression of IgA nephropathy Journal of Renin-Angiotensin-Aldosterone System September 2015 16: 660-665, first published on August 20, 2014 doi: 10.1177/1470320314524011.

  11. STAT4 gene polymorphism in patients after renal allograft transplantation.

    Science.gov (United States)

    Dąbrowska-Żamojcin, Ewa; Dziedziejko, Violetta; Safranow, Krzysztof; Domański, Leszek; Słuczanowska-Głabowska, Sylwia; Pawlik, Andrzej

    2016-01-01

    STAT4 (signal transducer and activator of transcription 4) is involved in the regulation of innate and adaptive immune responses. Some studies have suggested that STAT4 may be involved in the immune response after graft transplantation. Several polymorphisms in the STAT4 gene have been identified. The most commonly studied polymorphism in the STAT4 gene is rs7574865. In our study, we examined whether this polymorphism is associated with the early and late functions of renal allografts. A total of 270 recipients of first renal transplants were included in the study. Single nucleotide polymorphisms (SNPs) within the STAT4 gene were genotyped using TaqMan genotyping assays. There were no statistically significant associations between the STAT4 gene rs7574865 polymorphism and delayed graft function, acute rejection, chronic allograft dysfunction, post-transplant diabetes mellitus, or creatinine serum concentrations after transplantation. Our results suggest a lack of association between the STAT4 rs7574865 SNP and kidney allograft function in the Polish population.

  12. NOS3 Polymorphisms and Chronic Kidney Disease

    Directory of Open Access Journals (Sweden)

    Alejandro Marín Medina

    2018-05-01

    Full Text Available ABSTRACT Chronic kidney disease (CKD is a multifactorial pathophysiologic irreversible process that often leads to a terminal state in which the patient requires renal replacement therapy. Most cases of CKD are due to chronic-degenerative diseases and endothelial dysfunction is one of the factors that contribute to its pathophysiology. One of the most important mechanisms for proper functioning of the endothelium is the regulation of the synthesis of nitric oxide. This compound is synthesized by the enzyme nitric oxide synthase, which has 3 isoforms. Polymorphisms in the NOS3 gene have been implicated as factors that alter the homeostasis of this mechanism. The Glu298Asp polymorphisms 4 b/a and -786T>C of the NOS3 gene have been associated with a more rapid deterioration of kidney function in patients with CKD. These polymorphisms have been evaluated in patients with CKD of determined and undetermined etiology and related to a more rapid deterioration of kidney function.

  13. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  14. A novel polymorphism of resistin gene and its association with meat ...

    African Journals Online (AJOL)

    Searching for candidate gene polymorphisms and their relationship with meat quality traits is an important issue for Bos taurus industry. In this study, we evaluated polymorphism of resistin (RETN) gene involved in energy metabolism. Using the polymerase chain reaction-single strand conformation polymorphism ...

  15. Differential effect of beetroot bread on postprandial DBP according to Glu298Asp polymorphism in the eNOS gene: a pilot study.

    Science.gov (United States)

    Hobbs, D A; George, T W; Lovegrove, J A

    2014-12-01

    Our objective was to investigate whether the presence of Glu298Asp polymorphism in the endothelial NO synthase (eNOS) gene differentially affects the postprandial blood pressure response to dietary nitrate-rich beetroot bread. A randomised, single-blind, controlled, crossover acute pilot study was performed in 14 healthy men (mean age: 34±9 years) who were retrospectively genotyped for Glu298Asp polymorphism (7GG; T carriers 7). Volunteers were randomised to receive 200 g beetroot-enriched bread (1.1 mmol nitrate) or control bread (no beetroot; 0.01 mmol nitrate) on two separate occasions 10 days apart. Baseline and incremental area under the curve of blood pressure and NOx (nitrate/nitrite) were measured for a 6-h postprandial period. A treatment × genotype interaction was observed for diastolic blood pressure (Pconsumption of beetroot bread compared with control bread. No significant differences were observed in the GG group. The beneficial diastolic blood pressure reduction was observed only in the T carriers of the Glu298Asp polymorphism in the eNOS gene after consumption of nitrate-rich beetroot bread. These data require confirmation in a larger population group.

  16. The Serotonin Transporter Gene Polymorphisms and Risk of Ischemic Stroke

    DEFF Research Database (Denmark)

    Mortensen, Janne Kærgård; Kraglund, Kristian Lundsgaard; Johnsen, Søren Paaske

    2018-01-01

    may influence platelet activity, as they result in different levels of transporters and thereby different levels of serotonin in platelets. SERT gene polymorphisms have thus been associated with the risk of myocardial infarction. A similar association may exist between SERT gene polymorphisms...... and stroke. However, to our knowledge, this potential association has not previously been studied. We therefore aimed to investigate the association between polymorphisms in the SERT gene and the risk of ischemic stroke/transitory ischemic attack (TIA). MATERIALS AND METHODS: We conducted a case...

  17. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  18. Association of transforming growth factor-ß3 gene polymorphism ...

    African Journals Online (AJOL)

    Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

  19. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

    Science.gov (United States)

    von Wettstein-Knowles, Penny

    2017-07-10

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  20. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B

    1989-01-01

    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  1. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

    Science.gov (United States)

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

    2015-05-15

    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  2. A multilevel prediction of physiological response to challenge: Interactions among child maltreatment, neighborhood crime, endothelial nitric oxide synthase gene (eNOS), and GABA(A) receptor subunit alpha-6 gene (GABRA6).

    Science.gov (United States)

    Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante

    2015-11-01

    Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.

  3. Prevalence of MTHFR C677T and MS A2756G polymorphisms in major depressive disorder, and their impact on response to fluoxetine treatment

    Science.gov (United States)

    To examine the prevalence of the C677T polymorphism of the methylene tetrahydrofolate reductase (MTHFR) gene and the A2756G polymorphism of methionine synthase (MS), and their impact on antidepressant response. We screened 224 subjects (52% female, mean age 39 +/- 11 years) with SCID-diagnosed major...

  4. Do prion protein gene polymorphisms induce apoptosis in non ...

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... Genetic variations such as single nucleotide polymorphisms (SNPs) in prion protein coding gene, Prnp, greatly affect susceptibility to prion diseases in mammals. Here, the coding region of Prnp was screened for polymorphisms in redeared turtle, Trachemys scripta. Four polymorphisms, L203V, N205I, ...

  5. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  6. Polymorphism of the prolactin gene and its association with egg ...

    African Journals Online (AJOL)

    p2492989

    In this study, polymorphism of the prolactin gene was screened in six Chinese native ... Prolactin (PRL) is a single-chain polypeptide hormone that belongs to the growth hormone gene ..... Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining.

  7. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

    2014-03-07

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  8. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

    2014-01-01

    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  9. Polymorphism at codon 36 of the p53 gene.

    Science.gov (United States)

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A

    1994-01-01

    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  10. Tumor Necrosis Factor (TNF -308G>A, Nitric Oxide Synthase 3 (NOS3 +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Conflicting data have been reported on the association between tumor necrosis factor (TNF -308G>A and nitric oxide synthase 3 (NOS3 +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF -308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine.We performed an updated meta-analysis for TNF -308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR and 95% confidence intervals (95% CI assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates.Eleven studies in 6682 migraineurs and 22591 controls for TNF -308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the "A" allele of the TNF -308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 - 2.87. The risk of migraine with aura (MA was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the "T" allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 - 3.88.Our findings appear to support the hypothesis that the TNF -308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians.

  11. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA) Genes in Flax (Linum usitatissimum L.).

    Science.gov (United States)

    Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V

    2017-01-01

    Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  12. STAT4 gene polymorphism in patients after renal allograft transplantation

    OpenAIRE

    D?browska-?amojcin, Ewa; Dziedziejko, Violetta; Safranow, Krzysztof; Doma?ski, Leszek; S?uczanowska-G?abowska, Sylwia; Pawlik, Andrzej

    2016-01-01

    Introduction STAT4 (signal transducer and activator of transcription 4) is involved in the regulation of innate and adaptive immune responses. Some studies have suggested that STAT4 may be involved in the immune response after graft transplantation. Several polymorphisms in the STAT4 gene have been identified. The most commonly studied polymorphism in the STAT4 gene is rs7574865. In our study, we examined whether this polymorphism is associated with the early and late functions of renal allog...

  13. Depressive symptoms in schizophrenia and dopamine and serotonin gene polymorphisms.

    Science.gov (United States)

    Peitl, Vjekoslav; Štefanović, Mario; Karlović, Dalibor

    2017-07-03

    Although depressive symptoms seem to be frequent in schizophrenia they have received significantly less attention than other symptom domains. As impaired serotonergic and dopaminergic neurotransmission is implicated in the pathogenesis of depression and schizophrenia this study sought to investigate the putative association between several functional gene polymorphisms (SERT 5-HTTLPR, MAO-A VNTR, COMT Val158Met and DAT VNTR) and schizophrenia. Other objectives of this study were to closely examine schizophrenia symptom domains by performing factor analysis of the two most used instruments in this setting (Positive and negative syndrome scale - PANSS and Calgary depression rating scale - CDSS) and to examine the influence of investigated gene polymorphisms on the schizophrenia symptom domains, focusing on depressive scores. A total of 591 participants were included in the study (300 schizophrenic patients and 291 healthy volunteers). 192 (64%) of schizophrenic patients had significant depressive symptoms. Genotype distribution revealed no significant differences regarding all investigated polymorphisms except the separate gender analysis for MAO-A gene polymorphism which revealed significantly more allele 3 carriers in schizophrenic males. Factor analysis of the PANSS scale revealed the existence of five separate factors (symptom domains), while the CDSS scale revealed two distinct factors. Several investigated gene polymorphisms (mostly SERT and MAO-A, but also COMT) significantly influenced two factors from the PANSS (aggressive/impulsive and negative symptoms) and one from the CDSS scale (suicidality), respectively. Depressive symptoms in schizophrenic patients may be influenced by functional gene polymorphisms, especially those implicated in serotonergic neurotransmission. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Association of ACE Gene I/D polymorphism with migraine in Kashmiri population.

    Science.gov (United States)

    Wani, Irfan Yousuf; Sheikh, Saleem; Shah, Zafar Amin; Pandith, Arshid A; Wani, Mushtaq; Asimi, Ravouf; Wani, Maqbool; Sheikh, Shahnawaz; Mehraj, Iqra

    2016-01-01

    Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP). Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.

  15. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

    Science.gov (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

    2016-12-01

    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  16. The Evaluation of IL6 and ESR1 Gene Polymorphisms in Primary Dysmenorrhea.

    Science.gov (United States)

    Ozsoy, Asker Zeki; Karakus, Nevin; Yigit, Serbulent; Cakmak, Bulent; Nacar, Mehmet Can; Yılmaz Dogru, Hatice

    2016-01-01

    Primary dysmenorrhea is the most common gynecological complaint with painful menstrual cramps in pelvis without any pathology. It affects about half of menstruating women, and it causes significant disruption in quality of life. We investigated the association between IL6 gene promoter and ESR1 gene XbaI and PvuII polymorphisms and primary dysmenorrhea. In this case-control study, 152 unrelated young women with primary dysmenorrhea and 150 unrelated healthy age-matched controls participated. Genomic DNA was isolated and IL6 and ESR1 gene polymorphisms were genotyped using PCR-based RFLP assay. The distribution of genotype and allele frequencies of IL6 gene promoter and ESR1 gene XbaI polymorphisms were not statistically different between patients and controls (p > 0.05). However, the genotype and allele frequencies of ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls (p = 0.009 and p = 0.021, respectively). Statistically significant associations were also observed between age and married status of primary dysmenorrhea patients and ESR1 gene PvuII polymorphism (p = 0.044 and p = 0.023, respectively). In combined genotype analyses, AG at ESR1 XbaI and TC at ESR1 PvuII loci encoded a p-value of 0.027. Thus, individuals who are heterozygote at both loci have a lower risk of developing primary dysmenorrhea. Our study suggests no strong association between IL6 gene promoter and ESR1 gene XbaI polymorphisms and primary dysmenorrhea in Turkish women. However, ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls. The potential association between ESR1 gene PvuII polymorphism and age and married status of dysmenorrhea patients deserves further consideration.

  17. Glucocorticoid receptor gene polymorphism and juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Scheplyagina Larisa A

    2011-01-01

    Full Text Available Abstract Background The glucocorticoid receptor gene (NR3C1 has been suggested as a candidate gene affecting juvenile idiopathic arthritis (JIA course and prognosis. The purpose of this study is to investigate the glucocorticoid receptor gene BclI polymorphism (rs41423247 in JIA patients, the gene's role in susceptibility to juvenile idiopathic arthritis, and its associations with JIA activity, course and bone mineralization. Methods One hundred twenty-two Caucasian children with JIA and 143 healthy ethnically matched controls were studied. We checked markers of clinical and laboratory activity: morning stiffness, Ritchie Articular Index (RAI, swollen joint count (SJC, tender joint count (TJC, physician's visual analog scale (VAS, hemoglobin level (Hb, leukocyte count (L, platelet count (Pl, Westergren erythrocyte sedimentation rate (ESR, C-reactive protein (CRP, albumin, DAS and DAS28. Bone mineralization was measured by dual-energy X-ray absorptiometry (DXA of lumbar spine L1-L4. Assessments of bone metabolism included osteocalcin, C-terminal telopeptide (CTT, parathyroid hormone (PTH, total and ionized calcium, inorganic phosphate and total alkaline phosphatase (TAP. BclI polymorphism was genotyped by polymerase chain reaction restriction fragment length polymorphism. Results No association was observed between glucocorticoid receptor gene polymorphism and the presence or absence of JIA. In girls with JIA, the presence of the G allele was associated with an unfavorable arthritis course, a younger age of onset of arthritis (p = 0.0017, and higher inflammatory activity. The higher inflammatory activity was demonstrated by the following: increased time of morning stiffness (p = 0.02, VAS (p = 0.014, RAI (p = 0.048, DAS (p = 0.035, DAS28 (p = 0.05, Pl (p = 0.003, L (p = 0.046, CRP (p = 0.01. In addition, these patients had bone metabolism disturbances as follows: decreased BA (p = 0.0001, BMC (p = 0.00007, BMD (0.005 and Z score (p = 0.002; and

  18. DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...

    African Journals Online (AJOL)

    The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...

  19. Inflammatory bowel disease: the role of inflammatory cytokine gene polymorphisms

    Directory of Open Access Journals (Sweden)

    Joanna Balding

    2004-01-01

    Full Text Available THE mechanisms responsible for development of inflammatory bowel disease (IBD have not been fully elucidated, although the main cause of disease pathology is attributed to up-regulated inflammatory processes. The aim of this study was to investigate frequencies of polymorphisms in genes encoding pro-inflammatory and anti-inflammatory markers in IBD patients and controls. We determined genotypes of patients with IBD (n=172 and healthy controls (n=389 for polymorphisms in genes encoding various cytokines (interleukin (IL-1β, IL-6, tumour necrosis factor (TNF, IL-10, IL-1 receptor antagonist. Association of these genotypes to disease incidence and pathophysiology was investigated. No strong association was found with occurrence of IBD. Variation was observed between the ulcerative colitis study group and the control population for the TNF-α-308 polymorphism (p=0.0135. There was also variation in the frequency of IL-6-174 and TNF-α-308 genotypes in the ulcerative colitis group compared with the Crohn's disease group (p=0.01. We concluded that polymorphisms in inflammatory genes are associated with variations in IBD phenotype and disease susceptibility. Whether the polymorphisms are directly involved in regulating cytokine production, and consequently pathophysiology of IBD, or serve merely as markers in linkage disequilibrium with susceptibility genes remains unclear.

  20. EVALUATION OF CYTOKINE GENE POLYMORPHISM IN B CELL LYMPHOID MALIGNANCIES

    Directory of Open Access Journals (Sweden)

    E. L. Nazarova

    2014-01-01

    Full Text Available Previous studies with some solid tumors has shown that polymorphisms of certain cytokine genes may be used as predictors of clinical outcome in the patients. It seemed important to evaluate potential correlations between production of certain pro- and anti-inflammatory cytokines and co-receptor molecules, and promoter polymorphism of the cytokine genes involved into regulation of cell proliferation, differentiation, apoptosis, lipid metabolism and blood clotting in the patients with hematological malignancies. The article contains our results concerning associations between of IL-1β, -2, -4, -10, -17, TNFα, and allelic polymorphisms of their genes in 62 patients with B cell lymphoid malignancies in an ethnically homogenous group (self-identified as Russians. We have shown that the GА and AA genotypes of the G-308A polymorphism in TNFα gene are significantly associated with increased production of this cytokine, being more common in aggressive non-Hodgkin lymphomas, more rare in multiple myeloma and in indolent non-Hodgkin lymphomas.

  1. Effects of Growth Hormone Gene Polymorphism on Lipogenic Gene Expression Levels in Diaphragm Tissues of Japanese Black Heifers

    Directory of Open Access Journals (Sweden)

    Astrid Ardiyanti

    2012-08-01

    Full Text Available Two SNPs, i.e. L127V and T172M, of bovine growth hormone (GH causing the presence of GH gene haplotypes A, B, and C was previously shown to alter intramuscular fatty acid (FA composition in Japanese Black (JB heifers. To determine the SNP effect on somatotropic hormone concentration and lipogenesis, we measured plasma GH, insulin, and insulin-like growth factor-1 (IGF-1 concentrations. We also measured mRNA levels of fatty acid synthase (FASN, stearoyl-coA desaturase (SCD, and sterol regulatory element binding proteins-1 (SREBP-1 and FA composition in diaphragm tissues. Heifers with genotype CC had the lowest plasma insulin concentration and FASN and SCD mRNA levels among genotypes. FASN mRNA levels in haplotype A tended to positively correlate with saturated FA (SFA content and negatively correlated with C18:2 and unsaturated FA (USFA contents. SCD mRNA levels in haplotype A positively correlated with monounsaturated FA (MUFA contents and negatively correlated with C18:0 content. They also tended to positively correlate with C16:1, C18:1, and USFA contents and USFA/SFA ratio and negatively correlate with SFA content. Taken together, GH gene polymorphism affects the lipogenic genes expression levels and their relationships with fatty acid compositions in diaphragm tissues of JB heifers at 31 months of age.

  2. Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes.

    Science.gov (United States)

    Wiersma, Anje C; Leegwater, Peter Aj; van Oost, Bernard A; Ollier, William E; Dukes-McEwan, Joanna

    2007-10-19

    Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. alpha-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan delta, titin cap, alpha-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.

  3. Tumor Necrosis Factor (TNF) –308G>A, Nitric Oxide Synthase 3 (NOS3) +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis

    Science.gov (United States)

    Chen, Min; Tang, Wenjing; Hou, Lei; Liu, Ruozhuo; Dong, Zhao; Han, Xun; Zhang, Xiaofei; Wan, Dongjun; Yu, Shengyuan

    2015-01-01

    Background and Objective Conflicting data have been reported on the association between tumor necrosis factor (TNF) –308G>A and nitric oxide synthase 3 (NOS3) +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF –308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine. Method We performed an updated meta-analysis for TNF –308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR) and 95% confidence intervals (95% CI) assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates. Results Eleven studies in 6682 migraineurs and 22591 controls for TNF –308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the “A” allele of the TNF –308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 – 2.87). The risk of migraine with aura (MA) was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the “T” allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 – 3.88). Conclusions Our findings appear to support the hypothesis that the TNF –308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians. PMID:26098763

  4. New polymorphisms of Xeroderma Pigmentosum DNA repair genes in myelodysplastic syndrome.

    Science.gov (United States)

    Santiago, Sabrina Pinheiro; Junior, Howard Lopes Ribeiro; de Sousa, Juliana Cordeiro; de Paula Borges, Daniela; de Oliveira, Roberta Taiane Germano; Farias, Izabelle Rocha; Costa, Marília Braga; Maia, Allan Rodrigo Soares; da Nóbrega Ito, Mayumi; Magalhães, Silvia Maria Meira; Pinheiro, Ronald Feitosa

    2017-07-01

    The association between Xeroderma Pigmentosum DNA repair genes (XPA rs1800975, XPC rs2228000, XPD rs1799793 and XPF rs1800067) polymorphisms and myelodysplastic syndrome (MDS) have not been reported. To assess the functional role between these polymorphisms and MDS, we evaluated 189 samples stratified in two groups: 95 bone marrow samples from MDS patients and 94 from healthy elderly volunteers used as controls. Genotypes for all polymorphisms were identified in DNA samples in an allelic discrimination experiment by real-time polymerase chain reaction (qPCR). We also studied the mRNA expression of XPA and XPC genes to evaluate if its polymorphisms were functional in 53 RNAm MDS patients by qPCR methodologies. To the rs2228000 polymorphism, the CT and TT polymorphic genotype were associated with increased odds ratio (OR) of more profound cytopenia (hemoglobin and neutrophils count). To the rs1799793 polymorphism, we found that the GG homozygous wild-type genotype was associated with a decreased chance of developing MDS. We observed low expression of XPA in younger patients, in hypoplastic MDS and patients with abnormal karyotype when presented AG or AA polymorphic genotypes. We also found that there was a statistically significant interaction between the presence of micromegakaryocyte on down regulation of XPC regarding the CT heterozygous genotype of the rs1800975 polymorphism. Our results suggest that new functional polymorphisms of Xeroderma Pigmentosum DNA repair genes in MDS are related to its pathogenesis and prognosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

    Science.gov (United States)

    Ak, Duygu Gezen; Kahraman, Hakkí; Dursun, Erdinç; Duman, Belgin Süsleyici; Erensoy, Nevin; Alagöl, Faruk; Tanakol, Refik; Yılmazer, Selma

    2005-01-01

    Vitamin D receptor (VDR) gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD) and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08). Also no association between biochemical data and VDR gene polymorphisms was observed. PMID:16403954

  6. Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

    Directory of Open Access Journals (Sweden)

    Duygu Gezen Ak

    2005-01-01

    Full Text Available Vitamin D receptor (VDR gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08. Also no association between biochemical data and VDR gene polymorphisms was observed.

  7. Promotor polymorphisms in leukotriene C4 synthase and risk of ischemic cerebrovascular disease

    DEFF Research Database (Denmark)

    Freiberg, J.J.; Tybjaerg-Hansen, A.; Sillesen, H.

    2008-01-01

    OBJECTIVE: Cysteinyl leukotrienes are involved in inflammation and possibly in early carotid atherosclerosis. We tested the hypothesis that the -444 A/C and -1072 G/A polymorphisms of the leukotriene C(4) synthase associate with risk of ischemic cerebrovascular disease. METHODS AND RESULTS: We...... genotyped 10 592 individuals from the Danish general population, the Copenhagen City Heart Study. During 24 years of follow-up, 557 individuals developed ischemic cerebrovascular disease. The allele frequency was 0.07 for -1072 A and 0.29 for -444 C. Cumulative incidence for ischemic cerebrovascular disease...... was higher for -1072 AA versus GG genotype (log-rank: P=0.002), and lower for -444 CC versus AA genotype (log-rank: P=0.008). Combined genotypes showed corresponding cumulative incidence differences (log-rank: P=0.003). Multifactorially adjusted hazard ratios for ischemic cerebrovascular disease were 2...

  8. Geographical and Ethnic Distributions of the MTHFR C677T, A1298C and MTRR A66G Gene Polymorphisms in Chinese Populations: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Xingmin Wang

    Full Text Available The geographical and ethnic distributions of the polymorphic methylenetetrahydrofolate reductase (MTHFR mutations (C677T and A1298C and methionine synthase reductase (MTRR mutation (A66G remain heterogeneous in China. The goal of this study was to estimate the pooled frequencies of the alleles and associated genotypes of these gene polymorphisms among healthy populations in Mainland China.We systematically reviewed published epidemiological studies on the distributions of 3 genetic variants in Chinese healthy populations living in Mainland China through a meta-analysis. The relevant electronic databases were searched. All of the raw data of the eligible citations were extracted. The frequency estimates were stratified by geography, ethnicity and sex.Sixty-six studies were identified with a total of 92277 study participants. The meta-analysis revealed that the frequencies of the MTHFR C677T, A1298C, and MTRR A66G gene polymorphisms varied significantly between different ethnic groups and along geographical gradients. The frequencies of the 677T allele and 677TT genotype increased along the southern-central-northern direction across Mainland China (all Pvalues≤0.001. The frequencies of the 1298C, 1298CC, 66G and 66GG genotypes decreased along the south-central-north direction across the country (all Pvalues≤0.001.Our meta-analysis strongly indicates significant geographical and ethnic variations in the frequencies of the C677T, A1298C, and A66G gene polymorphisms in the folate metabolism pathway among Chinese populations.

  9. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  10. Are Toll-like receptor gene polymorphisms associated with prostate cancer?

    International Nuclear Information System (INIS)

    Kutikhin, Anton G; Yuzhalin, Arseniy E

    2012-01-01

    The suggestion that there is a connection between chronic intraprostatic inflammation and prostate cancer was declared some years ago. As Toll-like receptors (TLRs) are the key players in the processes of chronic intraprostatic inflammation, there is a hypothesis that TLR gene polymorphisms may be associated with prostate cancer risk. Although a number of comprehensive studies have been conducted on large samples in various countries, reliable connections between these single nucleotide polymorphisms and prostate cancer risk, stage, grade, aggressiveness, ability to metastasize, and mortality have not been detected. Results have also varied slightly in different populations. The data obtained regarding the absence of connection between the polymorphisms of the genes encoding interleukin-1 receptor-associated kinases (IRAK1 and IRAK4) and prostate cancer risk might indicate a lack of association between inherited variation in the TLR signaling pathway and prostate cancer risk. It is possible to consider that polymorphisms of genes encoding TLRs and proteins of the TLR pathway also do not play a major role in the etiology and pathogenesis of prostate cancer. Feasibly, it would be better to focus research on associations between TLR single nucleotide polymorphisms and cancer risk in other infection-related cancer types

  11. Cytokine gene polymorphisms and their association with cervical ...

    African Journals Online (AJOL)

    Materials and methods: The present study was undertaken to evaluate association of cytokine gene polymorphisms with cervical cancer in a north Indian population. Genotyping of single nucleotide polymorphisms (SNPs) viz. IL 6-597G/A (rs1800797), IL-1b-511C/T (rs16944) and TNF-a-308G/A (rs1800629) was carried out ...

  12. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Olga Y. Yurkevich

    2017-08-01

    Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  13. Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

    Energy Technology Data Exchange (ETDEWEB)

    Nicholas C Carpita

    2009-04-20

    Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

  14. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

    Science.gov (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

    2015-12-01

    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  15. MTHFR Gene C677T Polymorphism in Autism Spectrum Disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Sener

    2014-01-01

    Full Text Available Aim. Autism is a subgroup of autism spectrum disorders, classified as a heterogeneous neurodevelopmental disorder and symptoms occur in the first three years of life. The etiology of autism is largely unknown, but it has been accepted that genetic and environmental factors may both be responsible for the disease. Recent studies have revealed that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. In particular, C677T polymorphism in the MTHFR gene as a possible risk factor for autism is still controversial. We aimed to investigate the possible effect of C677T polymorphism in a Turkish cohort. Methods. Autism patients were diagnosed by child psychiatrists according to DSM-IV and DSM-V criteria. A total of 98 children diagnosed as autistic and 70 age and sex-matched children who are nonautistic were tested for C677T polymorphism. This polymorphism was studied by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP methods. Results. MTHFR 677T-allele frequency was found to be higher in autistic children compared with nonautistic children (29% versus 24%, but it was not found statistically significant. Conclusions. We conclude that other MTHFR polymorphisms such as A1298C or other folate/homocysteine pathway genes may be studied to show their possible role in autism.

  16. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  17. Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes

    Directory of Open Access Journals (Sweden)

    van Oost Bernard A

    2007-10-01

    Full Text Available Abstract Background Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. Results We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. α-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan δ, titin cap, α-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. Conclusion The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.

  18. Androgen Receptor Gene Polymorphism, Aggression, and Reproduction in Tanzanian Foragers and Pastoralists

    Science.gov (United States)

    Butovskaya, Marina L.; Lazebny, Oleg E.; Vasilyev, Vasiliy A.; Dronova, Daria A.; Karelin, Dmitri V.; Mabulla, Audax Z. P.; Shibalev, Dmitri V.; Shackelford, Todd K.; Fink, Bernhard; Ryskov, Alexey P.

    2015-01-01

    The androgen receptor (AR) gene polymorphism in humans is linked to aggression and may also be linked to reproduction. Here we report associations between AR gene polymorphism and aggression and reproduction in two small-scale societies in northern Tanzania (Africa)—the Hadza (monogamous foragers) and the Datoga (polygynous pastoralists). We secured self-reports of aggression and assessed genetic polymorphism of the number of CAG repeats for the AR gene for 210 Hadza men and 229 Datoga men (aged 17–70 years). We conducted structural equation modeling to identify links between AR gene polymorphism, aggression, and number of children born, and included age and ethnicity as covariates. Fewer AR CAG repeats predicted greater aggression, and Datoga men reported more aggression than did Hadza men. In addition, aggression mediated the identified negative relationship between CAG repeats and number of children born. PMID:26291982

  19. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria

    2008-01-01

    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences....... The present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  20. IDENTIFICATION OF GH|ALUI AND GHR|ALUI GENES POLYMORPHISMS IN INDONESIAN BUFFALO

    Directory of Open Access Journals (Sweden)

    E. Andreas

    2014-10-01

    Full Text Available Growth hormone (GH is an anabolic hormone which sintesized and secreted by somatrotop cell inpituitary anterior lobe. GH exert its effect on growth and metabolism by interacting with a specificreceptor on the surface of the target cells. Growth hormone receptor (GHR has been suggested ascandidate gene for traits related to meat production in Bovidae. The objectives of this study were toidentify polymorphism of GH and GHR genes in buffalo. The 452 DNA samples buffalo were collectedfrom five populations in Indonesia (Siborong-Borong-Medan (65, Lebak-Banten (29, Pandeglang-Banten (180, Semarang-Central Java, and Mataram-West Nusa Tenggara (103. A gene fragment of theGH|AluI gene at 432 bp located on exon 3 and GHR|AluI gene at 298 bp on exon 10 were successfullyamplified by using the techniques of a PCR (polymerase chain reaction and genotyped by PCR-RFLP(restriction fragment length polymorphism then -SSCP (single strand conformation polymorphism. Theresults showed no polymorphisms were detected in these genes. All buffaloes tested had LL genotype forlocus GH|AluI and AA genotype for locus GHR|AluI.

  1. Association of genetic polymorphism in GH gene with milk ...

    Indian Academy of Sciences (India)

    Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various ...

  2. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  3. Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality

    Directory of Open Access Journals (Sweden)

    Anastasia K Armeni

    2017-02-01

    Full Text Available Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA gene polymorphism (rs2234693-PvuII (T→C substitution and oxytocin receptor gene polymorphism (rs53576 (G→A substitution with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20–25 years of age, sexually active, with normal menstrual cycles (28–35 days, were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs, polycystic ovary syndrome (PCOS, thyroid diseases as well as drugs that are implicated in hypothalamus–pituitary–gonadal axis. T allele (wildtype of rs2234693 (PvuII polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic of rs53576 (OXTR polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII and A allele of rs53576 (OXTR polymorphisms (T + A group was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences.

  4. Genetic Polymorphisms in Cytokine Genes in Colombian Patients with Ocular Toxoplasmosis.

    Science.gov (United States)

    Naranjo-Galvis, C A; de-la-Torre, A; Mantilla-Muriel, L E; Beltrán-Angarita, L; Elcoroaristizabal-Martín, X; McLeod, R; Alliey-Rodriguez, N; Begeman, I J; López de Mesa, C; Gómez-Marín, J E; Sepúlveda-Arias, J C

    2018-04-01

    Toxoplasmosis is caused by infection with the protozoan parasite Toxoplasma gondii , which has the capacity to infect all warm-blooded animals worldwide. Toxoplasmosis is a major cause of visual defects in the Colombian population; however, the association between genetic polymorphisms in cytokine genes and susceptibility to ocular toxoplasmosis has not been studied in this population. This work evaluates the associations between polymorphisms in genes coding for the cytokines tumor necrosis factor alpha (TNF-α) (rs1799964, rs1800629, rs1799724, rs1800630, and rs361525), interleukin 1β (IL-1β) (rs16944, rs1143634, and rs1143627), IL-1α (rs1800587), gamma interferon (IFN-γ) (rs2430561), and IL-10 (rs1800896 and rs1800871) and the presence of ocular toxoplasmosis (OT) in a sample of a Colombian population (61 patients with OT and 116 healthy controls). Genotyping was performed with the "dideoxynucleotide (ddNTP) primer extension" technique. Functional-effect predictions of single nucleotide polymorphisms (SNPs) were done by using FuncPred. A polymorphism in the IL-10 gene promoter (-1082G/A) was significantly more prevalent in OT patients than in controls ( P = 1.93e-08; odds ratio [OR] = 5.27e+03; 95% confidence interval [CI] = 3.18 to 8.739; Bonferroni correction [BONF] = 3.48e-07). In contrast, haplotype "AG" of the IL-10 gene promoter polymorphisms (rs1800896 and rs1800871) was present at a lower frequency in OT patients ( P = 7e-04; OR = 0.10; 95% CI = 0.03 to 0.35). The +874A/T polymorphism of IFN-γ was associated with OT ( P = 3.37e-05; OR = 4.2; 95% CI = 2.478 to 7.12; BONF = 6.07e-04). Haplotype "GAG" of the IL-1β gene promoter polymorphisms (rs1143634, rs1143627, and rs16944) appeared to be significantly associated with OT ( P = 0.0494). The IL-10, IFN-γ, and IL-1β polymorphisms influence the development of OT in the Colombian population. Copyright © 2018 American Society for Microbiology.

  5. Association between Single Nucleotide Polymorphisms in Vitamin D Receptor Gene Polymorphisms and Permanent Tooth Caries Susceptibility to Permanent Tooth Caries in Chinese Adolescent

    Directory of Open Access Journals (Sweden)

    Miao Yu

    2017-01-01

    Full Text Available Purpose. Dental caries is a multifactorial infectious disease. In this study, we investigated whether single nucleotide polymorphisms (SNPs in vitamin D receptor (VDR gene were associated with susceptibility to permanent tooth caries in Chinese adolescents. Method. A total of 200 dental caries patients and 200 healthy controls aged 12 years were genotyped for VDR gene polymorphisms using the PCR-restriction fragment length polymorphism (PCR-RFLP assay. All of them were examined for their oral and dental status with the WHO criteria, and clinical information such as the Decayed Missing Filled Teeth Index (DMFT was evaluated. Genomic DNA was extracted from the buccal epithelial cells. The four polymorphic SNPs (Bsm I, Taq I, Apa I, and Fok I in VDR were assessed for both genotypic and phenotypic susceptibilities. Results. Among the four examined VDR gene polymorphisms, the increased frequency of the CT and CC genotype of the Fok I VDR gene polymorphism was associated with dental caries in 12-year-old adolescent, compared with the controls (X2 = 17.813, p≤0.001. Moreover, Fok I polymorphic allele C frequency was significantly increased in the dental caries cases, compared to the controls (X2 = 14.144, p≤0.001, OR = 1.730, 95% CI = 1.299–2.303. However, the other three VDR gene polymorphisms (Bsm I, Taq I, and Apa I showed no statistically significant differences in the caries groups compared with the controls. Conclusion. VDR-Fok I gene polymorphisms may be associated with susceptibility to permanent tooth caries in Chinese adolescent.

  6. Polymorphism of growth hormone gene and its association with ...

    African Journals Online (AJOL)

    sunny t

    2016-04-06

    Apr 6, 2016 ... recorded to be more frequent (83.3, 92.86 and 90%) than pattern II (16.7, 7.14 and 10%) in Barki,. Rahmani ... Key words: Sheep, wool, growth hormone (GH) gene, polymorphism, single strand conformation polymorphism. (SSCP). ... electrophoresis and chemical and ribonuclease cleavage,. SSCP has ...

  7. Association of Gene Polymorphisms in Interleukin 6 in Infantile Bronchial Asthma.

    Science.gov (United States)

    Babusikova, Eva; Jurecekova, Jana; Jesenak, Milos; Evinova, Andrea

    2017-07-01

    The genetic background of bronchial asthma is complex, and it is likely that multiple genes contribute to its development both directly and through gene-gene interactions. Cytokines contribute to different aspects of asthma, as they determine the type, severity and outcomes of asthma pathogenesis. Allergic asthmatics undergoing an asthmatic attack exhibit significantly higher levels of pro-inflammatory cytokines, such as interleukins and chemokines. In recent years, cytokines and their receptors have been shown to be highly polymorphic, and this prompted us to investigate interleukin 6 promoter polymorphisms at position -174G/C (rs1800795) and at -572G/C (rs1800796) in relation to asthma in children. Interleukin 6 promoter polymorphisms were analyzed in bronchial asthma patients and healthy children using polymerase chain reaction-restriction fragment length polymorphism analysis. We observed a significant association between polymorphism at -174G/C and bronchial asthma (OR=3.4, 95% CI: 2.045-5.638, P<.001). Higher associations between polymorphism at IL-6 -174G/C and bronchial asthma were observed in atopic patients (OR=4.1, 95% CI: 2.308-7.280, P<8.10 -7 ). Interleukin 6 polymorphism is associated with bronchial asthma, particularly its atopic phenotype. Expression and secretion of interleukins in asthmatic patients may be affected by genetic polymorphisms, and could have a disease-modifying effect in the asthmatic airway and modify the therapeutic response. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  8. Analysis of Vitamin D Receptor (VDR Gene Polymorphisms in Alopecia Areata

    Directory of Open Access Journals (Sweden)

    Omer Ates

    2016-09-01

    Full Text Available Aim: Alopecia areata (AA is a disease characterized with hair loss on the hair skin any region of the body. This disease affects approximately 1%u20132% of the general population. The etiopathogenesis of this disease is unclear but infections, genetic, psychological and autoimmune factors is known play to role. Vitamin D is thought to be a regulator of the immune system and the action of it is dependent on the vitamin D receptor (VDR. Given the autoimmune component shared by this autoimmune diseases. In this study investigated the role of VDR gene polymorphisms in the development of AA. Material and Method: The study group included 198 patients with AA and 167 control. Genomic DNA was extracted from blood samples using DNA isolation kit. The frequency of VDR gene polymorphisms genotypes and allelic variants were analyzed by using Polymerase Chain Reaction (PCR and Restriction Fragment Length Polymorphisms (RFLP method. Results: Statistical evaluation of data results showed a not significant association for genotypic frequency distribution between the VDR gene BsmI (rs1544410 and ApaI (rs7975232, TaqI (rs731236 polymorphisms and AA (p=0.8891, 0.7309, 0.6761, respectively. Discussion: Our study reflects that VDR gene polymorphisms could not play a role in determining genetic susceptibility to AA.

  9. The evaluation of angiotensin-converting enzyme (ACE) gene I/D and IL-4 gene intron 3 VNTR polymorphisms in coronary artery disease.

    Science.gov (United States)

    Basol, Nursah; Celik, Atac; Karakus, Nevin; Ozturk, Sibel Demir; Ozsoy, Sibel Demir; Yigit, Serbulent

    2014-01-01

    Genetic polymorphism is a strong risk factor for coronary artery disease (CAD). In the present study, our aim was to evaluate angiotensin-converting enzyme (ACE) gene I/D polymorphism and interleukin-4 (IL-4) gene Intron 3 variable number of tandem repeat (VNTR) polymorphism in CAD. One hundred and twenty-four CAD patients and one hundred and twenty-three controls were enrolled. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses. The risk associated with inheriting the combined genotypes for the two polymorphisms were evaluated and it was found that the individuals who were P2P2-homozygous at IL-4 gene intron 3 VNTR and DD-homozygous at ACE gene I/D have a higher risk of developing CAD. Although, there is no correlation between IL4 VNTR polymorphism and ACE gene polymorphism and CAD, there is a strong association between CAD and co-existence of IL-4 VNTR and ACE gene polymorphisms in the Turkish population. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  10. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    OpenAIRE

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

    2003-01-01

    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  11. Association of TAP Gene Polymorphisms and Risk of Cervical Intraepithelial Neoplasia

    Directory of Open Access Journals (Sweden)

    Camilla Natter

    2013-01-01

    Full Text Available Background. Transporter associated with antigen processing (TAP is responsible for peptide loading onto class I major histocompatibility complex (MHC-I molecules. TAP seems to facilitate the detection of HPV by MHC-I molecules and contributes to successful eradication of HPV. TAP polymorphisms could have an important impact on the course of HPV infection. Objective. The aim of this study is to evaluate the association between five TAP gene polymorphisms and the risk of CIN. Methods. This case-control study investigated five common TAP polymorphisms in TAP1 (1341 and 2254 and TAP2 (1135, 1693, and 1993 in 616 women with CIN and 206 controls. Associations between gene polymorphisms and risk of CIN were analysed by univariate and multivariable models. The combined effect of the five TAP gene polymorphisms on the risk for CIN was investigated by haplotype analysis. Results. No significant difference in genotype distribution of the five TAP polymorphisms was observed in women with CIN and controls. Haplotype analysis revealed that women with haplotype mut-wt-wt-wt-wt (TAP polymorphisms t1135-t1341-t1693-t1993-t2254 had a significantly lower risk for CIN, compared to women with the haplotype wt-wt-wt-wt-wt (; OR 0.5 []. Conclusion. Identification of this haplotype combination could be used to identify women, less susceptible for development of CIN following HPV infection.

  12. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon.

    Science.gov (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong

    2016-09-01

    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  13. Association of ghrelin receptor gene polymorphism with bulimia nervosa in a Japanese population.

    Science.gov (United States)

    Miyasaka, K; Hosoya, H; Sekime, A; Ohta, M; Amono, H; Matsushita, S; Suzuki, K; Higuchi, S; Funakoshi, A

    2006-09-01

    Eating disorders (EDs) have a highly heterogeneous etiology and multiple genetic factors might contribute to their pathogenesis. Ghrelin, a novel growth hormone-releasing peptide, enhances appetite and increases food intake, and human ghrelin plasma levels are inversely correlated with body mass index. In the present study, we examined the 171T/C polymorphism of the ghrelin receptor (growth hormone secretagogue receptor, GHSR) gene in patients diagnosed with EDs, because the subjects having ghrelin gene polymorphism (Leu72Met) was not detected in a Japanese population, previously. In addition, beta3 adrenergic receptor gene polymorphism (Try64Arg) and cholecystokinin (CCK)-A receptor (R) gene polymorphism (-81A/G, -128G/T), which are both associated with obesity, were investigated. The subjects consisted of 228 Japanese patients with EDs [96 anorexia nervosa (AN), 116 bulimia nervosa (BN) and 16 not otherwise specified (NOS)]. The age- and gender-matched control group consisted of 284 unrelated Japanese subjects. The frequency of the CC type of the GHSR gene was significantly higher in BN subjects than in control subjects (chi(2) = 4.47, p = 0.035, odds ratio = 2.05, Bonferroni correction: p = 0.070), while the frequency in AN subjects was not different from that in controls. The distribution of neither beta3 adrenergic receptor gene nor CCK-AR polymorphism differed between EDs and control subjects. Therefore, the CC type of GHSR gene polymorphism (171T/C) is a risk factor for BN, but not for AN.

  14. Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

    International Nuclear Information System (INIS)

    Rothenberg, M.; Hanson, M.R.

    1988-01-01

    A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

  15. High polymorphism in Est-SSR loci for cellulose synthase and β-amylase of sugarcane varieties (Saccharum spp.) used by the industrial sector for ethanol production.

    Science.gov (United States)

    Augusto, Raphael; Maranho, Rone Charles; Mangolin, Claudete Aparecida; Pires da Silva Machado, Maria de Fátima

    2015-01-01

    High and low polymorphisms in simple sequence repeats of expressed sequence tag (EST-SSR) for specific proteins and enzymes, such as β-amylase, cellulose synthase, xyloglucan endotransglucosylase, fructose 1,6-bisphosphate aldolase, and fructose 1,6-bisphosphatase, were used to illustrate the genetic divergence within and between varieties of sugarcane (Saccharum spp.) and to guide the technological paths to optimize ethanol production from lignocellulose biomass. The varieties RB72454, RB867515, RB92579, and SP813250 on the second stage of cutting, all grown in the state of Paraná (PR), and the varieties RB92579 and SP813250 cultured in the PR state and in Northeastern Brazil, state of Pernambuco (PE), were analyzed using five EST-SSR primers for EstC66, EstC67, EstC68, EstC69, and EstC91 loci. Genetic divergence was evident in the EstC67 and EstC69 loci for β-amylase and cellulose synthase, respectively, among the four sugarcane varieties. An extremely high level of genetic differentiation was also detected in the EstC67 locus from the RB82579 and SP813250 varieties cultured in the PR and PE states. High polymorphism in SSR of the cellulose synthase locus may explain the high variability of substrates used in pretreatment and enzymatic hydrolysis processes, which has been an obstacle to effective industrial adaptations.

  16. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  17. Interleukin-6 and tumor necrosis factor-alpha gene polymorphisms in chronic idiopathic urticaria.

    Science.gov (United States)

    Tavakol, M; Amirzargar, A A; Movahedi, M; Aryan, Z; Bidoki, A Z; Gharagozlou, M; Aghamohammadi, A; Nabavi, M; Ahmadvand, A; Behniafard, N; Heidari, K; Soltani, S; Rezaei, N

    2014-01-01

    This study was performed to evaluate association of gene polymorphisms among proinflammatory cytokines and susceptibility to chronic idiopathic urticaria (CIU). Ninety patients with prolonged urticaria more than 6 weeks were included as case group. Single nucleotide polymorphisms (SNPs) of IL-6 (G/C -174, G/A nt565) and TNF-α (G/A -308, G/A -238) were evaluated, using polymerase chain reaction (PCR); and the results were compared to the control group. G allele was significantly higher in the patients at locus of -238 of promoter of TNF-α gene (p<0.001). Frequency of following genotypes were significantly lower in patients with CIU, compared to controls: AG at -308 and GA at -238 of TNF-α gene (p<0.05 and p<0.001, respectively), CG at -174 and GG at +565 of IL-6 gene (p<0.05). Additionally, following genotypes were more common among patients with CIU: GG at -308 and -238 of TNF-α gene (p<0.05 and p<0.001, respectively), GG at -174 and GA at +565 of IL-6 gene (p<0.05). Pro-inflammatory cytokine gene polymorphisms can affect susceptibility to CIU. TNF-α promoter polymorphisms as well as IL-6 gene polymorphisms are associated with CIU. Copyright © 2013 SEICAP. Published by Elsevier Espana. All rights reserved.

  18. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su

    2012-06-01

    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  19. General and Specific Genetic Polymorphism of Cytokines-Related Gene in AITD

    Directory of Open Access Journals (Sweden)

    Chen Xiaoheng

    2017-01-01

    Full Text Available Autoimmune thyroid disease (AITD shows the highest incidence among organ-specific autoimmune diseases and is the most common thyroid disease in humans, including Graves’ disease (GD and Hashimoto’s thyroiditis (HT. The susceptibility to autoimmune diseases is affected by increased autoantibody levels, susceptibility gene polymorphisms, environmental factors, and psychological factors, but the pathogenesis remains unclear. Various cytokines and related genes encoding them play important roles in the development and progression of AITD. CD152, an expression product of the CTLA-4 gene, downregulates T cell activation. The A/A genotype polymorphism in the CT60 locus may reduce the production of thyroid autoantibodies. The C1858T polymorphism of the PTNP22 gene reduces the expression of its encoded LYP, which increases the risk of GD and HT. GD is an organ-specific autoimmune disease involving increased secretion of thyroid hormone, whereas HT may be associated with the destruction of thyroid gland tissue and hypothyroidism. These two diseases exhibit similar pathogenesis but opposite trends in the clinical manifestations. In this review, we focus on the structure and function of these cytokines and related genes in AITD, as well as the association of polymorphisms with susceptibility to GD and HT, and attempt to describe their differences in pathogenesis and clinical manifestations.

  20. PTH Gene Polymorphism and Breast Cancer Risk in Kazakhstan

    Directory of Open Access Journals (Sweden)

    Nurgul Sikhayeva

    2014-12-01

    Full Text Available Introduction. Breast cancer is the most common type of cancer among women. In Kazakhstan, breast cancer holds first place among causes of women death caused by cancer in the 45-55 year age group . Many studies have shown that the risk of acquiring breast cancer may be related to the level of calcium in the blood serum. One of the important regulators of calcium metabolism in the body is the parathyroid hormone. Single nucleotide polymorphisms in the gene encoding the parathyroid hormone (PTH are associated with breast cancer development risk, and may modify the associative interaction between the levels of calcium intake and breast cancer. Experimental studies have shown that PTH gene has a carcinogenic effect. At least three studies showed a weak positive correlation between the risk of acquiring breast cancer and primary hyperparathyroidism, a state with high levels of PTH and often high levels of calcium. The aim of this investigation was to evaluate potential association between PTH gene polymorphism and breast cancer risk among Kazakhstani women.Methods. Female breast cancer patients (n = 429 and matched control women (n = 373 were recruited into a case – control study,. Genomic DNA was extracted from peripheral venous blood of study participants using Wizard® Genomic DNA Purification Kit (Promega, USA. Detection of PTH gene polymorphism (rs1459015 was done by means of the TaqMan® SNP Genotyping Assay of real-time PCR. Statistical analysis was conducted using SPSS 19.0.Results. PTH gene alleles were in Hardy–Weinberg equilibrium (p > 0.05. Distribution was 59% CC, 35% CT, 6% TT in the group with breast cancer and 50% CC, 43% CT, 6% TT in the control group. Total difference (between the group with breast cancer and the control group in allele frequencies for PTH polymorphism was not significant (p > 0.05. No association was found between rs1459015 TT and breast cancer risk (OR = 1.039; 95%, CI 0.740 - 1.297; p = 0.893.Conclusion. We

  1. Malassezia Yeast and Cytokine Gene Polymorphism in Atopic Dermatitis.

    Science.gov (United States)

    Jain, Charu; Das, Shukla; Ramachandran, V G; Saha, Rumpa; Bhattacharya, S N; Dar, Sajad

    2017-03-01

    Atopic Dermatitis (AD) is a recurrent chronic condition associated with microorganism and their interaction with the susceptible host. Malassezia yeast is a known commensal which is thought to provoke the recurrent episodes of symptoms in atopic dermatitis patients. Malassezia immunomodulatory properties along with defective skin barrier in such host, results in disease manifestation. Here, we studied Single Nucleotide Polymorphism (SNP) in IL10 and IFN γ genes of the host and its relation with susceptibility to Malassezia infection. To isolate Malassezia yeast from AD patients and compare the genetic susceptibility of the host by correlating the cytokine gene polymorphism with the control subjects. Study was conducted from January 2012 to January 2013. It was a prospective observational study done in Department of Microbiology and Department of Dermatology and Venereology in University College of Medical Sciences and GTB Hospital, Delhi. Sample size comprised of 38 cases each of AD. Skin scrapings were used for fungal culture on Sabouraud Dextrose Agar (SDA) and Modified Dixon Agar (MDA) and isolated were identified as per conventional phenotypic methods. Genomic DNA was extracted from blood samples collected from all study subjects. Cytokine genotyping was carried out by Amplification Refractory Mutations System- Polymerase Chain Reaction (ARMS-PCR) with sequence specific primers. Three SNPs (IL10-1082A/G; IL10-819/592C/T; IFN-γ+874A/T) in two cytokine genes were assessed in all the patients and healthy controls. Chi-Square Test or Fisher's-Exact Test and Bonferroni's correction. In AD group, Malassezia yeasts were cultured in 24 out of 38 samples and thus the identification rate was 63.1 percent as compared to healthy group, 52.6 percent (20/38). Significant difference in allele, or genotype distribution were observed in IL10-819/592C/T and IFN-γ+874A/T gene polymorphism in AD group. Higher isolation rate in cases as compared to control group highlights the

  2. Polymorphism in ABC transporter genes of Dirofilaria immitis

    Directory of Open Access Journals (Sweden)

    Thangadurai Mani

    2017-08-01

    Full Text Available Dirofilaria immitis, a filarial nematode, causes dirofilariasis in dogs, cats and occasionally in humans. Prevention of the disease has been mainly by monthly use of the macrocyclic lactone (ML endectocides during the mosquito transmission season. Recently, ML resistance has been confirmed in D. immitis and therefore, there is a need to find new classes of anthelmintics. One of the mechanisms associated with ML resistance in nematodes has been the possible role of ATP binding cassette (ABC transporters in reducing drug concentrations at receptor sites. ABC transporters, mainly from sub-families B, C and G, may contribute to multidrug resistance (MDR by active efflux of drugs out of the cell. Gene products of ABC transporters may thus serve as the targets for agents that may modulate susceptibility to drugs, by inhibiting drug transport. ABC transporters are believed to be involved in a variety of physiological functions critical to the parasite, such as sterol transport, and therefore may also serve as the target for drugs that can act as anthelmintics on their own. Knowledge of polymorphism in these ABC transporter genes in nematode parasites could provide useful information for the process of drug design. We have identified 15 ABC transporter genes from sub-families A, B, C and G, in D. immitis, by comparative genomic approaches and analyzed them for polymorphism. Whole genome sequencing data from four ML susceptible (SUS and four loss of efficacy (LOE pooled populations were used for single nucleotide polymorphism (SNP genotyping. Out of 231 SNPs identified in those 15 ABC transporter genes, 89 and 75 of them were specific to the SUS or LOE populations, respectively. A few of the SNPs identified may affect gene expression, protein function, substrate specificity or resistance development and may be useful for transporter inhibitor/anthelmintic drug design, or in order to anticipate resistance development. Keywords: Dirofilaria immitis

  3. Association of angiotensin receptor 2 gene polymorphisms with pregnancy induced hypertension risk.

    Science.gov (United States)

    Li, Chenyang; Peng, Weijun; Zhang, Heng; Yan, Weirong

    2018-05-01

    To investigate the association of polymorphisms and haplotypes of angiotensin receptor 2 (AT2R) gene with pregnancy induced hypertension (PIH) in Chinese Han women. A case-control study was designed with 446 cases (gestational hypertension, GH: 124; pre-eclampsia, PE + eclampsia, E: 322) and 650 controls. rs5193, rs1403543 and rs12710567 of AT2R gene were genotyped. A logistic regression approach was applied to estimate the relationship between the polymorphisms and haplotypes of AT2Rgene with PIH risk. No relationship between AT2R gene polymorphisms and PIH was detected. The haplotype analysis also showed a negative result. rs5193, rs1403543 and rs12710567 of AT2R gene might have no effect on PIH risk among Chinese Han women.

  4. Angiotensinogen gene polymorphisms in IDDM patients with diabetic nephropathy

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P

    1996-01-01

    Genotypic abnormalities of the renin-ANG system have been suggested as a risk factor for the development of diabetic nephropathy. Cleavage of angiotensinogen is the rate-limiting step in the activation of the renin-ANG system. The TT genotype of a polymorphism encoding threonine instead of methio......Genotypic abnormalities of the renin-ANG system have been suggested as a risk factor for the development of diabetic nephropathy. Cleavage of angiotensinogen is the rate-limiting step in the activation of the renin-ANG system. The TT genotype of a polymorphism encoding threonine instead...... of methionine (M235T) has been associated not only with increased plasma angiotensinogen concentration but also with essential hypertension. In addition, a polymorphism in the angiotensinogen gene substituting methionine for threonine (T174M) has been associated with hypertension in nondiabetic populations. We...... studied the relationship between these polymorphisms in the angiotensinogen gene in IDDM patients with diabetic nephropathy (121 men, 74 women, age 40.9 +/- 10 years, diabetes duration 27 +/- 8 years). There was no difference in M235T genotype distribution between IDDM patients with diabetic nephropathy...

  5. Genetic polymorphism in three glutathione s-transferase genes and breast cancer risk

    Energy Technology Data Exchange (ETDEWEB)

    Woldegiorgis, S.; Ahmed, R.C.; Zhen, Y.; Erdmann, C.A.; Russell, M.L.; Goth-Goldstein, R.

    2002-04-01

    The role of the glutathione S-transferase (GST) enzyme family is to detoxify environmental toxins and carcinogens and to protect organisms from their adverse effects, including cancer. The genes GSTM1, GSTP1, and GSTT1 code for three GSTs involved in the detoxification of carcinogens, such as polycyclic aromatic hydrocarbons (PAHs) and benzene. In humans, GSTM1 is deleted in about 50% of the population, GSTT1 is absent in about 20%, whereas the GSTP1 gene has a single base polymorphism resulting in an enzyme with reduced activity. Epidemiological studies indicate that GST polymorphisms increase the level of carcinogen-induced DNA damage and several studies have found a correlation of polymorphisms in one of the GST genes and an increased risk for certain cancers. We examined the role of polymorphisms in genes coding for these three GST enzymes in breast cancer. A breast tissue collection consisting of specimens of breast cancer patients and non-cancer controls was analyzed by polymerase chain reaction (PCR) for the presence or absence of the GSTM1 and GSTT1 genes and for GSTP1 single base polymorphism by PCR/RFLP. We found that GSTM1 and GSTT1 deletions occurred more frequently in cases than in controls, and GSTP1 polymorphism was more frequent in controls. The effective detoxifier (putative low-risk) genotype (defined as presence of both GSTM1 and GSTT1 genes and GSTP1 wild type) was less frequent in cases than controls (16% vs. 23%, respectively). The poor detoxifier (putative high-risk) genotype was more frequent in cases than controls. However, the sample size of this study was too small to provide conclusive results.

  6. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  7. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Polymorphisms in the prion protein gene and in the doppel gene increase susceptibility for Creutzfeldt-Jakob disease

    NARCIS (Netherlands)

    E.A. Croes (Esther); B.Z. Alizadeh (Behrooz); A.M. Bertoli Avella (Aida); T.A.M. Rademaker (Tessa); J. Vergeer-Drop (Jeannette); B. Dermaut (Bart); J.J. Houwing-Duistermaat (Jeanine); D.P.W.M. Wientjens (Dorothee); A. Hofman (Albert); C. van Broeckhoven (Christine); C.M. van Duijn (Cornelia)

    2004-01-01

    textabstractThe prion protein gene (PRNP) plays a central role in the origin of Creutzfeldt-Jakob disease (CJD), but there is growing interest in other polymorphisms that may be involved in CJD. Polymorphisms upstream of PRNP that may modulate the prion protein production as well as polymorphisms in

  9. Association of −330 interleukin-2 gene polymorphism with oral cancer

    Directory of Open Access Journals (Sweden)

    Prithvi Kumar Singh

    2017-01-01

    >Results: IL-2 (−330A>C gene polymorphism was significantly associated with oral cancer whereas it was neither associated with clinicopathological status nor with cancer pain. The AC heterozygous genotype was significantly associated with oral cancer patients as compared to controls [odds ratio (OR: 3.0; confidence interval (CI: 2.14-4.20; PC gene polymorphism was also associated with oral cancer in tobacco smokers and chewers. >Interpretation & conclusions: Our results showed that oral cancer patients had significantly higher frequency of AA genotype but significantly lower frequency of AC genotype and C allele compared to controls. The IL-2 AC genotype and C allele of IL-2 (−330A>C gene polymorphisms could be potential protective factors and might reduce the risk of oral cancer in Indian population.

  10. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

    OpenAIRE

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

    2012-01-01

    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  11. Polymorphisms in human DNA repair genes and head and neck ...

    Indian Academy of Sciences (India)

    Abstract. Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and ... Such studies may benefit from analysis of multiple genes or polymorphisms and from the ... low survival and high morbidity when diagnosed in advanced ...... racial and/or ethnic cohort.

  12. Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Dangler, C. A.; Sordillo, L. M.

    1995-01-01

    This study was conducted to investigate polymorphism of the coagulase gene of Staphylococcus aureus causing bovine mastitis. One hundred eighty-seven strains of S. aureus were isolated from bovine mastitic milk samples obtained from 187 different Danish dairy farms. The isolates were characterised......% of the isolates. The ease of analysing coagulase gene polymorphisms among a large number of strains, and the multiple distinct polymorphic patterns generated, supports the use of this technique in epidemiological investigations of bovine mastitis. The predominating variants may have predelection for causing...

  13. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  14. Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

    Science.gov (United States)

    Flynn, Christopher M; Schmidt-Dannert, Claudia

    2018-06-01

    The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

  15. The first report of prion-related protein gene (PRNT) polymorphisms in goat.

    Science.gov (United States)

    Kim, Yong-Chan; Jeong, Byung-Hoon

    2017-06-01

    Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

  16. Polymorphism of the ACE gene and the risk of obstructive sleep apnoea.

    Science.gov (United States)

    Chmielewska, Izabela; Mlak, Radosław; Krawczyk, Paweł; Czukiewska, Ewa; Milanowski, Janusz

    2013-01-01

    Obstructive sleep apnoea/hypopnea syndrome (OSA) is characterized by obstruction of the upper airway during sleep, resulting in repetitive breathing pauses accompanied by oxygen desaturation and arousal from sleep. Among the candidate genes affecting the risk of OSA, genes whose polymorphisms influence the development of diseases with similar pathogenesis such as OSA could be listed: APOE, genes for leptin and leptin receptor, TNFA1, ADRB2 and ACE (gene for angiotensin-converting enzyme). Until now there has been a confirmed relationship between ACE gene polymorphism and cardiovascular diseases, but its effect on the incidence of OSA is debatable. The aim of this study was to investigate the effect of ACE gene insertion/deletion (I/D) polymorphism on the risk of OSA. Fifty-five patients with confirmed diagnose of OSA and qualified to CPAP therapy entered the study. The control group included 50 subjects who did not complain of any sleep related symptoms. Diagnose of OSA was set on the basis of full overnight polysomnography together with Epworth Sleepiness Scale according to American Academy of Sleep Medicine guidelines. DNA was isolated from peripheral blood leukocytes with Qiagen DNA mini Kit. ACE gene polymorphism was determined in genomic DNA using allele specific polymerase chain reaction. Different sizes of PCR products were observed on agarose gel electrophoresis. There were non-significant differences in the frequency of ACE genotypes. However, allele D had significantly lower prevalence in the study group than in the control group. (χ(2) = 4.25 p = 0.04). Moreover, I allele carriers had a threefold greater risk of developing OSA (HR = 2.748, 95% CI = 1.029-7.340, p gene polymorphism might be useful to determine the risk of developing OSA in clinically predisposed patients.

  17. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C

    1995-01-01

    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

  18. Glutathione S-transferase gene polymorphisms in presbycusis.

    Science.gov (United States)

    Ateş, Nurcan Aras; Unal, Murat; Tamer, Lülüfer; Derici, Ebru; Karakaş, Sevim; Ercan, Bahadir; Pata, Yavuz Selim; Akbaş, Yücel; Vayisoğlu, Yusuf; Camdeviren, Handan

    2005-05-01

    Glutathione and glutathione-related antioxidant enzymes are involved in the metabolism and detoxification of cytotoxic and carcinogenic compounds as well as reactive oxygen species. Reactive oxygen species generation occurs in prolonged relative hypoperfusion conditions such as in aging. The etiology of presbycusis is much less certain; however, a complex genetic cause is most likely. The effect of aging shows a wide interindividual range; we aimed to investigate whether profiles of (glutathione S-transferase (GST) M1, T1 and P1 genotypes may be associated with the risk of age-related hearing loss. We examined 68 adults with presbycusis and 69 healthy controls. DNA was extracted from whole blood, and the GSTM1, GSTT1 and GSTP1 polymorphisms were determined using a real-time polymerase chain reaction and fluorescence resonance energy transfer with a Light-Cycler Instrument. Associations between specific genotypes and the development of presbycusis were examined by use of logistic regression analyses to calculate odds ratios and 95% confidence intervals. Gene polymorphisms at GSTM1, GSTT1, and GSTP1 in subjects with presbycusis were not significantly different than in the controls (p > 0.05). Also, the combinations of different GSTM1, GSTT1, and GSTP1 genotypes were not an increased risk of presbycusis (p > 0.05). We could not demonstrate any significant association between the GSTM1, GSTT1, and GSTP1 polymorphism and age-related hearing loss in this population. This may be because of our sample size, and further studies need to investigate the exact role of GST gene polymorphisms in the etiopathogenesis of the presbycusis.

  19. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

    Science.gov (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

    2001-09-01

    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  20. Gene Polymorphism and Left Ventricular Geometry and Function in Hypertensive Subjects

    Directory of Open Access Journals (Sweden)

    Rosario Scaglione

    2010-01-01

    Full Text Available The distribution of the T29C TGFβ1 gene polymorphism was analyzed in 198 hypertensives with left ventricular hypertrophy (LVH and in 235 hypertensives without LVH. Circulating TGFβ1 levels, procollagen type III levels, microalbuminuria, and left ventricular geometry and function were evaluated in all the hypertensives with LVH subgrouped according to T29C TGFβ1 gene polymorphism. Circulating TGFβ1 was evaluated by ELISA technique, procollagen type III by a specific radioimmunoassay, microalbuminuria by radioimmunoassay, and left ventricular geometry and function by echocardiography. All groups were comparable for gender, age, and sex. Regarding T29C TGFβ1 gene polymorphism, prevalence of TC or CC genotypes was significantly (P<.05 higher in hypertensives with LVH than hypertensives without LVH TC and CC LVH hypertensives were characterized by a higher prevalence of subjects with microalbuminuria (P<.05 TC and CC versus TT, by increased levels of TGFβ1, procollagen type III, urinary albumin excretion, LVM, LVM/h2.7, and lower values of left ventricular ejection fraction (P<.05 TC and CC versus TT. Our data suggest that T29C TGFβ1 gene polymorphism was associated with clinical characteristics adequate to recognize a subset of LVH hypertensives with a higher severity of hypertension.

  1. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  2. Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis.

    Science.gov (United States)

    Yigit, Serbulent; Inanir, Ahmet; Tekcan, Akın; Tural, Ercan; Ozturk, Gokhan Tuna; Kismali, Gorkem; Karakus, Nevin

    2014-03-01

    Interleukin-4 (IL-4) is a strong chondroprotective cytokine and polymorphisms within this gene may be a risk factor for osteoarthritis (OA). We aimed to investigate genotype and allele frequencies of IL-4 gene intron 3 variable number of tandem repeats (VNTR) polymorphism in patients with knee OA in a Turkish population. The study included 202 patients with knee OA and 180 healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers followed by restriction fragment length polymorphism (RFLP) analysis. Our result show that there was statistically significant difference between knee OA patients and control group with respect to IL-4 genotype distribution and allele frequencies (p=0.000, OR: 0.20, 95% CI: 0.10-0.41, OR: 0.22, 95% CI: 0.12-0.42, respectively). Our findings suggest that there is an association of IL-4 gene intron 3 VNTR polymorphism with susceptibility of a person for development of knee OA. As a result, IL-4 gene intron 3 VNTR polymorphism could be a genetic marker in OA in a Turkish study population. This is the first association study that evaluates the associations between IL-4 gene VNTR polymorphism and knee OA. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  3. Polymorphism of glucagon-like peptide-1 receptor gene (rs1042044 ...

    African Journals Online (AJOL)

    patience

    2015-02-16

    Feb 16, 2015 ... turnover via GLP-1 receptors (GLP1Rs) in postmenopausal state. Furthermore, polymorphisms in. GLP1R gene were suggested to affect the function of GLP1Rs and be associated with many diseases. However, the relationships between GLP1R polymorphisms and osteoporosis susceptibility and bone.

  4. CYTOKINE GENE POLYMORPHISMS AS PREDICTORS OF CHRONIC PAIN SYNDROME IN ONCOLOGY

    Directory of Open Access Journals (Sweden)

    O. P. Bobrova

    2017-01-01

    Full Text Available The literature review on the role of cytokine gene polymorphisms in the development of chronic pain in cancer patients was presented using MedLine, PubMed, NEB elibrary.ru, WileyOnlineLibrary, WebofScience, OxfordUniversityPress and SAGEPremier databases for years 1995 to 2016. The role of inter-individual differences based on cytokine gene polymorphisms and their receptors for personalized anesthetic and accompanying treatment in oncology was shown.

  5. Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene

    Energy Technology Data Exchange (ETDEWEB)

    Polymeropoulos, M H; Xiao, Hong; Rath, D S; Merril, C R [National Inst. of Mental Health Neuroscience Center, Washington, DC (United States)

    1991-09-11

    The polymorphic (AAAT){sub n} repeat begins at base pair 2342 of the human prostatic acid phosphatase gene on chromosome 3q21-qter. The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously. The predicted length of the amplified sequence was 275 bp. Co-dominant segregation was observed in two informative families. The human prostatic acid phosphatase gene has been assigned to chromosome 3q21-qter.

  6. Effects of aerobic exercise on the blood pressure, oxidative stress and eNOS gene polymorphism in pre-hypertensive older people.

    Science.gov (United States)

    Zago, Anderson Saranz; Park, Joon-Young; Fenty-Stewart, Nicola; Silveira, Leonardo Reis; Kokubun, Eduardo; Brown, Michael D

    2010-11-01

    The polymorphisms of endothelial nitric oxide synthase (eNOS) are associated with reduced eNOS activity. Aerobic exercise training (AEX) may influence resting nitric oxide (NO) production, oxidative stress and blood pressure. The purpose of this study was to investigate the effect of AEX on the relationship among blood pressure, eNOS gene polymorphism and oxidative stress in pre-hypertensive older people. 118 pre-hypertensive subjects (59 ± 6 years) had blood samples collected after a 12 h overnight fast for assessing plasma NO metabolites (NOx) assays, thiobarbituric acid reactive substances (T-BARS) and superoxide dismutase activity (ecSOD). eNOS polymorphism (T-786C and G-894T) was done by standard PCR methods. All people were divided according to the genotype results (G1: TT/GG, G2: TT/GT + TT, G3: TC + CC/GG, G4: TC + CC/GT + TT). All parameters were measured before and after 6 months of AEX (70% of VO(2 max)). At baseline, no difference was found in systolic and diastolic blood pressure, ecSOD and T-BARS activity. Plasma NOx levels were significantly different between G1 (19 ± 1 μM) and G4 (14.2 ± 0.6 μM) and between G2 (20.1 ± 1.7 μM) and G4 (14.2 ± 0.6 μM). Therefore, reduced NOx concentration in G4 group occurred only when the polymorphisms were associated, suggesting that these results are more related to genetic factors than NO-scavenging effect. After AEX, the G4 increased NOx values (17.2 ± 1.2 μM) and decreased blood pressure. G1, G3 and G4 decreased T-BARS levels. These results suggest the AEX can modulate the NOx concentration, eNOS activity and the relationship among eNOS gene polymorphism, oxidative stress and blood pressure especially in C (T-786C) and T (G-894T) allele carriers.

  7. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  8. Cytokine gene polymorphisms and their association with cervical ...

    African Journals Online (AJOL)

    Maneesh Kumar Gupta

    2015-11-17

    Nov 17, 2015 ... gene polymorphisms with cervical cancer in a north Indian population. Genotyping of ... diseases like coronary heart disease, breast cancer, cervical cancer etc ...... Environmental risk factors for prevention and molecular inter-.

  9. Polymorphisms of genes involved in polycyclic aromatic hydrocarbons’ biotransformation and atherosclerosis

    Science.gov (United States)

    Marinković, Natalija; Pašalić, Daria; Potočki, Slavica

    2013-01-01

    Polycyclic aromatic hydrocarbons (PAHs) are among the most prevalent environmental pollutants and result from the incomplete combustion of hydrocarbons (coal and gasoline, fossil fuel combustion, byproducts of industrial processing, natural emission, cigarette smoking, etc.). The first phase of xenobiotic biotransformation in the PAH metabolism includes activities of cytochrome P450 from the CYP1 family and microsomal epoxide hydrolase. The products of this biotransformation are reactive oxygen species that are transformed in the second phase through the formation of conjugates with glutathione, glucuronate or sulphates. PAH exposure may lead to PAH-DNA adduct formation or induce an inflammatory atherosclerotic plaque phenotype. Several genetic polymorphisms of genes encoded for enzymes involved in PAH biotransformation have been proven to lead to the development of diseases. Enzyme CYP P450 1A1, which is encoded by the CYP1A1 gene, is vital in the monooxygenation of lipofilic substrates, while GSTM1 and GSTT1 are the most abundant isophorms that conjugate and neutralize oxygen products. Some single nucleotide polymorphisms of the CYP1A1 gene as well as the deletion polymorphisms of GSTT1 and GSTM1 may alter the final specific cellular inflammatory respond. Occupational exposure or conditions from the living environment can contribute to the production of PAH metabolites with adverse effects on human health. The aim of this study was to obtain data on biotransformation and atherosclerosis, as well as data on the gene polymorphisms involved in biotransformation, in order to better study gene expression and further elucidate the interaction between genes and the environment. PMID:24266295

  10. [Prevalence of gene polymorphisms associated with immune-dependent diseases in the populations of North Eurasia].

    Science.gov (United States)

    Cherednichenko, A A; Trifonova, E A; Vagaitseva, K V; Bocharova, A V; Varzari, A M; Radzhabov, M O; Stepanov, V A

    2015-01-01

    The data on distribution of genetic diversity in gene polymorphisms associated with autoimmune and allergic diseases and with regulation of immunoglobulin E and cytokines levels in 26 populations of the Northern Eurasia is presented. Substantial correlation between the values of average expected heterozygosity by 44 gene polymorphisms with climatic and geographical factors has not been revealed. Clustering of population groups in correspondence with their geographic locations is observed. The degree of gene differentiation among populations and the selective neutrality of gene polymorphisms have been assessed. The results of our work evidence the substantial genetic diversity and differentiation of human populations by studied genes.

  11. [Polymorphism of vitamin D receptor gene Fok I in Mongolian population of China].

    Science.gov (United States)

    Xing, Shao-ji; Zhou, Li-she; Xu, Xiu-ju

    2006-04-01

    To investigate the polymorphism distribution of vitamin D receptor (VDR) gene Fok I in Mongolian population of China. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used to analyze three genotypes FF, Ff and ff in the start codon of VDR gene (Fok I) in unrelated normal healthy Mongolian individuals of China. In the population, we obtained the allelic frequencies of 57% and 43% for (F) and (f) allele and the percentage of genotypes FF, Ff and ff to be 31%, 52%, and 17% respectively. The polymorphism frequency and distribution of this VDR gene Fok I in Mongolian population of China exhibit its own characteristics.

  12. Genetic Analysis of the Atrial Natriuretic Peptide Gene Polymorphisms among Essential Hypertensive Patients in Malaysia

    Directory of Open Access Journals (Sweden)

    Nooshin Ghodsian

    2016-01-01

    Full Text Available Background. Atrial natriuretic peptide (ANP considerably influences blood pressure regulation through water and sodium homoeostasis. Several of the studies have utilized anonymous genetic polymorphic markers and made inconsequent claims about the ANP relevant disorders. Thus, we screened Insertion/Deletion (ID and G191A polymorphisms of ANP to discover sequence variations with potential functional significance and to specify the linkage disequilibrium pattern between polymorphisms. The relationships of detected polymorphisms with EH with or without Type 2 Diabetes Mellitus (T2DM status were tested subsequently. Method. ANP gene polymorphisms (I/D and A191G were specified utilizing mutagenically separated Polymerase Chain Reaction (PCR in 320 subjects including 163 EH case subjects and 157 controls. Result. This case-control study discovered a significant association between I/D polymorphisms of ANP gene in EH patient without T2DM. However, the study determined no association between G191A polymorphisms of ANP in EH with or without T2DM. In addition, sociodemographic factors in the case and healthy subjects exhibited strong differences (P<0.05. Conclusion. As a risk factor, ANP gene polymorphisms may affect hypertension. Despite the small sample size in this study, it is the first research assessing the ANP gene polymorphisms in both EH and T2DM patients among Malaysian population.

  13. Association of Interleukin-10 gene promoter polymorphisms with obstructive sleep apnea.

    Science.gov (United States)

    Özdaş, Sibel; Özdaş, Talih; Acar, Mustafa; Erbek, Selim S; Köseoğlu, Sabri; Göktürk, Gökhan; Izbirak, Afife

    2016-05-01

    Interleukin-10 (IL) is an anti-inflammatory cytokine that regulates normal sleep patterns, and recent studies have reported that it is a potential useful biomarker to identify presence and severity of sleep apnea syndrome (OSAS). Promoter polymorphisms of IL-10 gene have been associated with altered expression levels, which contributes to OSAS. The aim of this study was to determine the prevalence of -1082 G/A, -819 C/T, and -592 C/A promoter polymorphisms of IL-10 gene in individuals with OSAS and controls. An open-label study was performed in the Otorhinolaryngology and Sleep Disorders Outpatient Clinics. One hundred four cases with OSAS were included as the study group, and 78 individuals without OSAS were included as the controls. DNAs were extracted from peripheral blood leukocytes, and the sites that encompassed those polymorphisms were identified by DNA sequencing analyses. Data were analyzed with SNPStats and multifactor dimensionality reduction (MDR) software. The prevalence of OSAS was higher in males in the study group when compared to controls (P = 0.0003). The IL-10-1082 G/A, -819 C/T, and -592 C/A SNPs, and their minor alleles were associated with a significantly increased risk for OSAS compared to the controls (P ˂ 0.05 for all). Furthermore, ATA haplotype frequency was significantly higher in the study group compared to the control group, but the GCC haplotype frequency was lower (P = 0.0001 and P = 0.0001). As indicated in MDR analysis, combinations of IL-10 gene were associated with OSAS in single-, double-, and triple-locus analyses. The prevalences of the IL-10 gene promoter polymorphisms were different in OSAS patients and the controls in Turkish population. IL-10 gene polymorphisms may lead to altered inflammatory cascade, which might contribute to OSAS. Further studies on larger cohorts are needed to validate our findings.

  14. AT1 Receptor Gene Polymorphisms in relation to Postprandial Lipemia

    Directory of Open Access Journals (Sweden)

    B. Klop

    2012-01-01

    Full Text Available Background. Recent data suggest that the renin-angiotensin system may be involved in triglyceride (TG metabolism. We explored the effect of the common A1166C and C573T polymorphisms of the angiotensin II type 1 receptor (AT1R gene on postprandial lipemia. Methods. Eighty-two subjects measured daytime capillary TG, and postprandial lipemia was estimated as incremental area under the TG curve. The C573T and A1166C polymorphisms of the AT1R gene were determined. Results. Postprandial lipemia was significantly higher in homozygous carriers of the 1166-C allele (9.39±8.36 mM*h/L compared to homozygous carriers of the 1166-A allele (2.02±6.20 mM*h/L (P<0.05. Postprandial lipemia was similar for the different C573T polymorphisms. Conclusion. The 1166-C allele of the AT1R gene seems to be associated with increased postprandial lipemia. These data confirm the earlier described relationships between the renin-angiotensin axis and triglyceride metabolism.

  15. A PCR marker linked to a THCA synthase polymorphism is a reliable tool to discriminate potentially THC-rich plants of Cannabis sativa L.

    Science.gov (United States)

    Staginnus, Christina; Zörntlein, Siegfried; de Meijer, Etienne

    2014-07-01

    Neither absolute THC content nor morphology allows the unequivocal discrimination of fiber cultivars and drug strains of Cannabis sativa L. unequivocally. However, the CBD/THC ratio remains constant throughout the plant's life cycle, is independent of environmental factors, and considered to be controlled by a single locus (B) with two codominant alleles (B(T) and B(D)). The homozygous B(T)/B(T) genotype underlies the THC-predominant phenotype, B(D)/B(D) is CBD predominant, and an intermediate phenotype is induced by the heterozygous state (B(T)/B(D)). Using PCR-based markers in two segregating populations, we proved that the THCA synthase gene represents the postulated B locus and that specific sequence polymorphisms are absolutely linked either to the THC-predominant or the THC-intermediate chemotype. The absolute linkage provides an excellent reliability of the marker signal in forensic casework. For validation, the species-specific marker system was applied to a large number of casework samples and fiber hemp cultivars. © 2014 American Academy of Forensic Sciences.

  16. Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Em Sutrisna

    2015-06-01

    Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

  17. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu

    2013-10-01

    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  18. Research on the relativity between gene polymorphism and children cardiac insufficiency.

    Science.gov (United States)

    He, X-H; Li, C-L; Ling, N; Wang, Q-W; Wang, Z-Z; An, X-J

    2017-08-01

    We analyzed the relationship between Mink-S27 gene polymorphism and children with cardiac insufficiency. From April 2013 to April 2015, we enrolled 73 cases of children with cardiac insufficiency for this study, and all 73 were placed in the observation group. 76 normal cases were selected for the control group. Restriction fragment length polymorphism (RFLP) was used to make polymorphism analysis of the Mink-S27. Our results showed no significant differences in Mink-S27 genotype and allele distribution in both observation and control groups (p>0.05). In lesion samples collected from children with cardiac insufficiency, we detected significant difference in AA, CC genotype frequency and allele frequency between the observation group and the control group (prelatively high. GNAS2 gene polymorphism was associated with the prevalence of cardiac insufficiency in children. And also the patients' condition was correlated to the frequency of different genotypes and alleles.

  19. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    African Journals Online (AJOL)

    Calpastatin has been known as candidate gene in muscle growth efficiency and meat quality. This gene has been located to chromosome 5 of sheep. In order to evaluate the calpastatin gene polymorphism, random blood sample were collected from 111 Arabic ram sheep from different regions. The DNA extraction was ...

  20. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

    Science.gov (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

    2013-03-01

    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Correlation between endometriosis combined with infertility and STAT3 gene polymorphisms

    Directory of Open Access Journals (Sweden)

    Juan Hu

    2016-05-01

    Full Text Available Objective: To investigate the correlation between STAT3 gene polymorphisms and endometriosis complicated with infertility. Methods: A total of 35 patients with endometriosis complicated with infertility and 35 cases of healthy volunteer from October 2014 to October 2015 in our hospital were selected as research objects. STAT3 gene polymorphisms of all objects were detected by PCR-RFLP method. Results: Polymorphic sites of STAT3 gene rs2293152 were expressed as three genotypes, namely, CC, GC, and GG. There were 18 cases, 10 cases and 7 cases of type CC, GC and GG in the observation group, accounted for 51.43%, 28.57% and 20.00%, respectively. There were 29 cases, 3 cases and 3 cases of type CC, GC and GG in the control group, accounted for 82.86%, 8.57% and 8.57%. There was a statistically difference` between the two groups. The frequency of C and G allele in the observation group and the control group were 65.71%, 34.29% and 87.14%, 12.86%, respectively. There were statistically significant differences between two groups. In addition, compared with the CC genotype, genotype G might increase the risk of the disease. Conclusions: The susceptibility of endometriosis complicated with infertility may be associated with STAT3 gene polymorphism and women who carried the G allele may have an increased the risk of the disease.

  2. Interleukin 17 receptor gene polymorphism in periimplantitis and chronic periodontitis.

    Directory of Open Access Journals (Sweden)

    Mahdi Kadkhodazadeh

    2013-06-01

    Full Text Available Gene polymorphism of cytokines influencing their function has been known as a contributing factor in the pathogenesis of inflammatory diseases of the tooth and implant supporting tissues. The aim of this study was to investigate the association of IL-17R gene polymorphism (rs879576 with chronic periodontitis and periimplantitis in an Iranian population. 73 patients with chronic periodontitis, 37 patients with periimplantitis and 83 periodontally healthy patients were enrolled in this study. 5cc blood was obtained from each subject's arm vein and transferred to tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP technique. Chi-square and Kruskal Wallis tests were used to analyze differences in the expression of genotypes and frequency of alleles in disease and control groups (P-Value less than 0.05 was considered statistically significant. There were no significant differences between periodontitis, periimplantitis with AA, GG, GA genotype of IL-17R gene (P=0.8239. Also comparison of frequency of alleles in SNP rs879576 of IL-17R gene between the chronic periodontitis group and periimplantitis group did not revealed statistically significant differences (P=0.8239. The enigma of IL-17 and its polymorphism-role in periodontitis and periimplantitis is yet to be investigated more carefully throughout further research but this article demonstrates that polymorphism of IL-17R plays no significant role in incidence of chronic periodontitis and Periimplantitis.

  3. Interleukin 17 Receptor Gene Polymorphism in Periimplantitis and Chronic Periodontitis

    Directory of Open Access Journals (Sweden)

    Mahdi Kadkhodazadeh

    2013-05-01

    Full Text Available Gene polymorphism of cytokines influencing their function has been known as a contributing factor in the pathogenesis of inflammatory diseases of the tooth and implant supporting tissues. The aim of this study was to investigate the association of IL-17R gene polymorphism (rs879576 with chronic periodontitis and periimplantitis in an Iranian population. 73 patients with chronic periodontitis, 37 patients with periimplantitis and 83 periodontally healthy patients were enrolled in this study. 5cc blood was obtained from each subject’s arm vein and transferred to tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP technique. Chi-square and Kruskal Wallis tests were used to analyze differences in the expression of genotypes and frequency of alleles in disease and control groups (P-Value less than 0.05 was considered statistically significant. There were no significant differences between periodontitis, periimplantitis with AA, GG, GA genotype of IL-17R gene (P=0.8239. Also comparison of frequency of alleles in SNP rs879576 of IL-17R gene between the chronic periodontitis group and periimplantitis group did not revealed statistically significant differences (P=0.8239. The enigma of IL-17 and its polymorphism-role in periodontitis and periimplantitis is yet to be investigated more carefully throughout further research but this article demonstrates that polymorphism of IL-17R plays no significant role in incidence of chronic periodontitis and Periimplantitis.

  4. Association between polymorphism at 3 ׳UTR of urokinase gene and risk of calcium

    Directory of Open Access Journals (Sweden)

    S. Morovvati

    2016-06-01

    Full Text Available Background: Kidney stone is a common multifactorial disease in Iran. Environmental and genetic factors including single nucleotide polymorphism (SNP affect the incidence of kidney stones. Objective: The aim of this study was to determine the association of +4065 T/C polymorphism at 3′untranslated region (3'UTR of urokinase gene and calcium kidney stones. Methods: This case-control study was conducted on 70 patients with history of calcium kidney stones as case group and 70 healthy subjects as control group in the Baqiyatallah hospital in 2013. The polymorphism was assessed using the Allele Specific PCR (AS-PCR method. Allele and genotype frequencies of the two groups were compared using 2x2 contingency tables. Hardy-Weinberg equilibrium was compared between the two groups using Chi-square test. Findings: Of 70 cases, 10 (15% were heterozygous and 24 (34% were homozygous for the polymorphism. Of 70 controls, 25 (35% were heterozygous for the polymorphism. The frequency of mutant T allele was 41% in the case group and 18% in the control group. The frequency of mutant C allele was 59% in the case group and 82% in the control group. The risk of calcium kidney stones in carriers of the mutant allele was 1.7 times higher than non-carriers (OR: 1.7. Conclusion: With regards to the results, it seems that there is a significant association between the polymorphism at 3 ׳UTR of urokinase gene and formation of calcium kidney stones. Urokinase gene polymorphism may be introduced as a candidate gene involved in calcium stone formation.

  5. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  6. Gene Expression and Polymorphism of Myostatin Gene and its Association with Growth Traits in Chicken.

    Science.gov (United States)

    Dushyanth, K; Bhattacharya, T K; Shukla, R; Chatterjee, R N; Sitaramamma, T; Paswan, C; Guru Vishnu, P

    2016-10-01

    Myostatin is a member of TGF-β super family and is directly involved in regulation of body growth through limiting muscular growth. A study was carried out in three chicken lines to identify the polymorphism in the coding region of the myostatin gene through SSCP and DNA sequencing. A total of 12 haplotypes were observed in myostatin coding region of chicken. Significant associations between haplogroups with body weight at day 1, 14, 28, and 42 days, and carcass traits at 42 days were observed across the lines. It is concluded that the coding region of myostatin gene was polymorphic, with varied levels of expression among lines and had significant effects on growth traits. The expression of MSTN gene varied during embryonic and post hatch development stage.

  7. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

    Science.gov (United States)

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

    2014-01-01

    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  8. Vitamin D Receptor Gene Polymorphisms Associated with Childhood Autism.

    Science.gov (United States)

    Cieślińska, Anna; Kostyra, Elżbieta; Chwała, Barbara; Moszyńska-Dumara, Małgorzata; Fiedorowicz, Ewa; Teodorowicz, Małgorzata; Savelkoul, Huub F J

    2017-09-09

    Autism spectrum disorder (ASD) is a group of heterogeneous, behaviorally defined disorders whereby currently no biological markers are common to all affected individuals. A deregulated immune response may be contributing to the etiology of ASD. The active metabolite of vitamin D₃ has an immunoregulatory role mediated by binding to the vitamin D receptor (VDR) in monocyte, macrophages, and lymphocytes. The effects of vitamin D and interaction with the VDR may be influenced by polymorphism in the VDR gene. Genetic association of four different VDR polymorphisms (Apa-I, Bsm-I, Taq-I, Fok-I) associated with susceptibility to the development of autism in children was investigated. We uniquely found an association between the presence of the T allele at position Taq-I and presence of the a allele at position Apa-I of the VDR gene with decreased ASD incidence. There was also an association between female gender and the presence of the T allele. We found no statistical significant correlation between VDR single nucleotide polymorphisms (SNPs) and vitamin D₃ concentration in serum of ASD children. Genetic polymorphism in two SNP in VDR may be correlated with development of ASD symptoms by influencing functionality of vitamin D₃ metabolism, while vitamin D₃ levels were not significantly different between ASD and non-ASD children.

  9. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  10. Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne

    2004-01-01

    The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

  11. Association of inflammatory gene polymorphisms with ischemic stroke in a Chinese Han population

    OpenAIRE

    Zhao, Nan; Liu, Xin; Wang, Yongqin; Liu, Xiaoqiu; Li, Jiana; Yu, Litian; Ma, Liyuan; Wang, Shuyu; Zhang, Hongye; Liu, Lisheng; Zhao, Jingbo; Wang, Xingyu

    2012-01-01

    Abstract Background Inflammatory mechanisms are important in stroke risk, and genetic variations in components of the inflammatory response have been implicated as risk factors for stroke. We tested the inflammatory gene polymorphisms and their association with ischemic stroke in a Chinese Han population. Methods A total of 1,124 ischemic stroke cases and 1,163 controls were genotyped with inflammatory panel strips containing 51 selected inflammatory gene polymorphisms from 35 candidate genes...

  12. No Association between Personality and Candidate Gene Polymorphisms in a Wild Bird Population.

    Directory of Open Access Journals (Sweden)

    Hannah A Edwards

    Full Text Available Consistency of between-individual differences in behaviour or personality is a phenomenon in populations that can have ecological consequences and evolutionary potential. One way that behaviour can evolve is to have a genetic basis. Identifying the molecular genetic basis of personality could therefore provide insight into how and why such variation is maintained, particularly in natural populations. Previously identified candidate genes for personality in birds include the dopamine receptor D4 (DRD4, and serotonin transporter (SERT. Studies of wild bird populations have shown that exploratory and bold behaviours are associated with polymorphisms in both DRD4 and SERT. Here we tested for polymorphisms in DRD4 and SERT in the Seychelles warbler (Acrocephalus sechellensis population on Cousin Island, Seychelles, and then investigated correlations between personality and polymorphisms in these genes. We found no genetic variation in DRD4, but identified four polymorphisms in SERT that clustered into five haplotypes. There was no correlation between bold or exploratory behaviours and SERT polymorphisms/haplotypes. The null result was not due to lack of power, and indicates that there was no association between these behaviours and variation in the candidate genes tested in this population. These null findings provide important data to facilitate representative future meta-analyses on candidate personality genes.

  13. Evaluation of ACE gene I/D polymorphism in Iranian elite athletes.

    Science.gov (United States)

    Shahmoradi, Somayeh; Ahmadalipour, Ali; Salehi, Mansoor

    2014-01-01

    Angiotensin converting enzyme (ACE) is an important gene, which is associated with the successful physical activity. The ACE gene has a major polymorphism (I/D) in intron 16 that determines its plasma and tissue levels. In this study, we aimed to determine whether there is an association between this polymorphism and sports performance in our studied population including elite athletes of different sports disciplines. We investigated allele frequency and genotype distribution of the ACE gene in 156 Iranian elite athletes compared to 163 healthy individuals. We also investigated this allele frequency between elite athletes in three functional groups of endurance, power, and mixed sports performances. DNA was extracted from peripheral blood, and polymerase chain reaction (PCR) method was performed on intron 16 of the ACE gene. The ACE genotype was determined for each subject. Statistical analysis was performed by SPSS 15, and results were analyzed by Chi-Square test. There was a significant difference in genotype distribution and allele frequency of the ACE gene in athletes and control group (P = 0.05, P = 0.03, respectively). There was also a significant difference in allele frequency of the ACE gene in 3 groups of athletes with different sports disciplines (P = 0.045). Proportion of the ACE gene D allele was greater in elite endurance athletes (37 high-distance cyclists) than two other groups. Findings of the present study demonstrated that there is an association between the ACE gene I/D polymorphism and sports performance in Iranian elite athletes.

  14. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

    Science.gov (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

    2012-06-01

    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  15. Polymorphisms of Selected DNA Repair Genes and Lung Cancer in Chromium Exposure.

    Science.gov (United States)

    Halasova, E; Matakova, T; Skerenova, M; Krutakova, M; Slovakova, P; Dzian, A; Javorkova, S; Pec, M; Kypusova, K; Hamzik, J

    2016-01-01

    Chromium is a well-known mutagen and carcinogen involved in lung cancer development. DNA repair genes play an important role in the elimination of genetic changes caused by chromium exposure. In the present study, we investigated the polymorphisms of the following DNA repair genes: XRCC3, participating in the homologous recombination repair, and hMLH1 and hMSH2, functioning in the mismatch repair. We focused on the risk the polymorphisms present in the development of lung cancer regarding the exposure to chromium. We analyzed 106 individuals; 45 patients exposed to chromium with diagnosed lung cancer and 61 healthy controls. Genotypes were determined by a PCR-RFLP method. We unravelled a potential for increased risk of lung cancer development in the hMLH1 (rs1800734) AA genotype in the recessive model. In conclusion, gene polymorphisms in the DNA repair genes underscores the risk of lung cancer development in chromium exposed individuals.

  16. Polymorphisms in miRNA genes and their involvement in autoimmune diseases susceptibility.

    Science.gov (United States)

    Latini, Andrea; Ciccacci, Cinzia; Novelli, Giuseppe; Borgiani, Paola

    2017-08-01

    MicroRNAs (miRNAs) are small non-coding RNA molecules that negatively regulate the expression of multiple protein-encoding genes at the post-transcriptional level. MicroRNAs are involved in different pathways, such as cellular proliferation and differentiation, signal transduction and inflammation, and play crucial roles in the development of several diseases, such as cancer, diabetes, and cardiovascular diseases. They have recently been recognized to play a role also in the pathogenesis of autoimmune diseases. Although the majority of studies are focused on miRNA expression profiles investigation, a growing number of studies have been investigating the role of polymorphisms in miRNA genes in the autoimmune diseases development. Indeed, polymorphisms affecting the miRNA genes can modify the set of targets they regulate or the maturation efficiency. This review is aimed to give an overview about the available studies that have investigated the association of miRNA gene polymorphisms with the susceptibility to various autoimmune diseases and to their clinical phenotypes.

  17. Polymorphisms in inflammation pathway genes and endometrial cancer risk

    Science.gov (United States)

    Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou

    2013-01-01

    Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (PAsian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

  18. DNA Repair Gene Polymorphism and the Risk of Mitral Chordae Tendineae Rupture

    Directory of Open Access Journals (Sweden)

    Aysel Kalayci Yigin

    2015-01-01

    Full Text Available Polymorphisms in Lys939Gln XPC gene may diminish DNA repair capacity, eventually increasing the risk of carcinogenesis. The aim of the present study was to evaluate the significance of polymorphism Lys939Gln in XPC gene in patients with mitral chordae tendinea rupture (MCTR. Twenty-one patients with MCTR and thirty-seven age and sex matched controls were enrolled in the study. Genotyping of XPC gene Lys939Gln polymorphism was carried out using polymerase chain reaction- (PCR- restriction fragment length polymorphism (RFLP. The frequencies of the heterozygote genotype (Lys/Gln-AC and homozygote genotype (Gln/Gln-CC were significantly different in MCTR as compared to control group, respectively (52.4% versus 43.2%, p=0.049; 38.15% versus 16.2%, p=0.018. Homozygote variant (Gln/Gln genotype was significantly associated with increased risk of MCTR (OR = 2.059; 95% CI: 1.097–3.863; p=0.018. Heterozygote variant (Lys/Gln genotype was also highly significantly associated with increased risk of MCTR (OR = 1.489; 95% CI: 1.041–2.129; p=0.049. The variant allele C was found to be significantly associated with MCTR (OR = 1.481; 95% CI: 1.101–1.992; p=0.011. This study has demonstrated the association of XPC gene Lys939Gln polymorphism with MCTR, which is significantly associated with increased risk of MCTR.

  19. Angiotensinogen and ACE gene polymorphisms and risk of atrial fibrillation in the general population

    DEFF Research Database (Denmark)

    Ravn, Lasse Steen; Benn, Marianne; Nordestgaard, Børge

    2008-01-01

    Objectives The renin-angiotensin system may play a role in the pathogenesis of atrial fibrillation, and renin-angiotensin system blockers reduce the risk of atrial fibrillation. We hypothesized that polymorphisms in the angiotensinogen and angiotensin-converting enzyme (ACE) genes encoding proteins...... in this system predict risk of atrial fibrillation. Methods and results We genotyped 9235 individuals from the Danish general population, The Copenhagen City Heart Study, for the a-20c, g-6a, T174M, and M235T polymorphisms in the angiotensinogen gene and the insertion/deletion (I/D) polymorphism in the ACE gene...

  20. Association of porcine UCP3 gene polymorphisms with fatness traits ...

    African Journals Online (AJOL)

    Administrator

    2011-04-25

    Apr 25, 2011 ... ... for fatness traits in pig. Polymorphism in UCP3 gene may change the function ... NM_214049) and human UCP3 gene DNA sequence (GenBank accession No. NC_000011). ..... Sleep, 29: 645-649. Zhao J, Li H, Kong X, ...

  1. HAS-1 genetic polymorphism in sporadic abdominal aortic aneurysm

    Directory of Open Access Journals (Sweden)

    Alberto Balbarini

    2009-04-01

    Full Text Available The hyaluronan synthase 1 (HAS-1 gene encodes a plasma membrane protein that synthesizes hyaluronan (HA, an extracellular matrix molecule. Accumulating evidence emphasizes the relevance of HA metabolism in an increasing number of processes of clinical interest, including abdominal aortic aneurysm (AAA. The existence of aberrant splicing variants of the HAS-1 gene could partly explain the altered extracellular matrix architecture and influence various biological functions, resulting in progressive arterial wall failure in the development of AAA. In the present study, we assessed the hypothesis that HAS-1 genetic 833A/G polymorphism could be associated with the risk of AAA by performing a case-control association study, involving AAA patients and healthy matched donors.

  2. ALK7 Gene Polymorphism is Associated with Metabolic Syndrome Risk and Cardiovascular Remodeling

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wenchao; Wang, Hui; Zhang, Wei [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Lv, Ruijuan [Department of Emergency, Qilu Hospital of Shandong University, Jinan (China); Wang, Zhihao [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Department of Geriatrics, Qilu Hospital of Shandong University, Jinan (China); Shang, Yuanyuan; Zhang, Yun; Zhong, Ming [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Chen, Yuguo; Tang, Mengxiong, E-mail: tangmengxiongsdu8@163.com [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Department of Emergency, Qilu Hospital of Shandong University, Jinan (China)

    2013-08-15

    Activin receptor-like kinase 7 (ALK7) is a type I receptor for the TGF-β superfamily and has recently been demonstrated to play an important role in the maintenance of metabolic homeostasis. To investigate the association of the ALK7 gene polymorphism with metabolic syndrome (MetS) and cardiovascular remodeling in MetS patients. The single nucleotide polymorphism rs13010956 in the ALK7 gene was genotyped in 351 Chinese subjects undergoing carotid and cardiac ultrasonography. The associations of the ALK7 gene polymorphism with the MetS phenotype, MetS parameters, and cardiovascular ultrasonic features were analyzed. The rs13010956 polymorphism in the ALK7 gene was found to be significantly associated with the MetS phenotype in females (p < 0.05) and was also significantly associated with blood pressure in the total (p < 0.05) and female populations (p < 0.01). Further analysis revealed that rs13010956 was associated with mean intima-media thickness of the carotid arteries in females (p < 0.05). After control for body mass index, blood pressure, fasting blood glucose, and triglycerides, rs13010956 was also found to be significantly associated with left ventricular mass index in the total (p < 0.05) and female populations (p < 0.05). Our findings suggested that the ALK7 gene polymorphism rs13010956 was significantly associated with MetS risk in females and may be involved in cardiovascular remodeling in MetS patients.

  3. ALK7 Gene Polymorphism is Associated with Metabolic Syndrome Risk and Cardiovascular Remodeling

    International Nuclear Information System (INIS)

    Zhang, Wenchao; Wang, Hui; Zhang, Wei; Lv, Ruijuan; Wang, Zhihao; Shang, Yuanyuan; Zhang, Yun; Zhong, Ming; Chen, Yuguo; Tang, Mengxiong

    2013-01-01

    Activin receptor-like kinase 7 (ALK7) is a type I receptor for the TGF-β superfamily and has recently been demonstrated to play an important role in the maintenance of metabolic homeostasis. To investigate the association of the ALK7 gene polymorphism with metabolic syndrome (MetS) and cardiovascular remodeling in MetS patients. The single nucleotide polymorphism rs13010956 in the ALK7 gene was genotyped in 351 Chinese subjects undergoing carotid and cardiac ultrasonography. The associations of the ALK7 gene polymorphism with the MetS phenotype, MetS parameters, and cardiovascular ultrasonic features were analyzed. The rs13010956 polymorphism in the ALK7 gene was found to be significantly associated with the MetS phenotype in females (p < 0.05) and was also significantly associated with blood pressure in the total (p < 0.05) and female populations (p < 0.01). Further analysis revealed that rs13010956 was associated with mean intima-media thickness of the carotid arteries in females (p < 0.05). After control for body mass index, blood pressure, fasting blood glucose, and triglycerides, rs13010956 was also found to be significantly associated with left ventricular mass index in the total (p < 0.05) and female populations (p < 0.05). Our findings suggested that the ALK7 gene polymorphism rs13010956 was significantly associated with MetS risk in females and may be involved in cardiovascular remodeling in MetS patients

  4. [CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers].

    Science.gov (United States)

    Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G

    2012-01-01

    In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

  5. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  6. Polymorphisms of the prion protein gene Arabi sheep breed in Iran ...

    African Journals Online (AJOL)

    Ovine scrapie is a neurodegenerative disease caused by polymorphisms of the prion protein gene (Prnp); especially the amino acid residue alterations at codons 136, 154, and 174, in sheep have been found to be associated with susceptibility to scrapie disease. We studied Prnp polymorphisms in local sheep of ...

  7. Association of oxidative stress gene polymorphisms with presbycusis.

    Science.gov (United States)

    Manche, Santoshi Kumari; Jangala, Madhavi; Putta, Padmavathi; Koralla, Raja Meganadh; Akka, Jyothy

    2016-11-30

    Presbycusis is characterised by etiopathological changes in the cochlea of the inner ear due to genetic and environmental factors and has a serious impact on quality of life. The present study was aimed to evaluate the role of oxidant stress gene polymorphisms in the development of presbycusis. 220 subjects with confirmed presbycusis from ENT specialists of MAA ENT hospital, Hyderabad, India from 2012 to 2014 were considered for the study. 270 age and sex matched controls were included in the study. Analysis of gene polymorphisms of SNPs cytochrome P450 1A1 (CYP1A1) 3801 T>C, 2455 A>G and 2453 A>C; glutathione S transferase (GST) T1 and M1; N-acetyl transferase (NAT2) 282 C>T and 857 G>A; uncoupled proteins (UCP1) (-3826) A>G and (UCP2) (866)G>A was carried out. Variations in the allelic and genotypic frequencies obtained were computed and analysed using appropriate statistical methods. The results of the study indicated that CYP1A1 gene polymorphism at 2453 C>A (adjusted OR: 1.59, 95% CI: 1.01-2.87) and 2455 A>G (adjusted OR: 1.87, 95% CI: 1.07-3.37), double null genotype of GSTM1 and GSTT1 (adjusted OR: 8.88, 95% CI: 4.10-19.19), NAT2 gene at C282T (adjusted OR: 1.77, 95% CI: 1.02-3.11) and G590 A (adjusted OR: 1.83, 95% CI 1.20-3.63) and UCP2 (-866) G>A (adjusted OR: 12.39; 95% CI: 6.51-23.56) showed increased risk for presbycusis while CYP1A1 at 3801 T>C and UCP1 (-3286) A>G exhibited no association. The haplotype combinations of T-G-A of CYP1A1 at 3801, 2455 and 2453 positions as well as T-A of NAT2*6 at 282 and 590 positions were found to contribute significant risk for the onset of presbycusis. Gene polymorphisms of CYP1A1 (A2455G, C2453A), NAT2*6 (C282T, G590 A), GST T1/M1 (double null genotype) and UCP2 (G-866 A) were found to contribute significant risk to presbycusis. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. The relation of serotonin-related gene and COMT gene polymorphisms with criminal behavior in schizophrenic disorder.

    Science.gov (United States)

    Koh, Kyung Bong; Choi, Eun Hee; Lee, Young-joon; Han, Mooyoung; Choi, Sang-Sup; Kim, So Won; Lee, Min Goo

    2012-02-01

    It has been suggested that patients with schizophrenia might be involved in criminal behavior, such as homicidal and violent behavior. However, the relationship between criminal behavior and genes in patients with schizophrenia has not been clearly elucidated. The objective of this study was to examine the relation between criminal behavior and serotonin-related gene or catechol-O-methyltransferase (COMT) gene polymorphisms in patients with schizophrenia. Serotonin-related and COMT polymorphic markers were assessed by using single nucleotide polymorphism (SNP) genotyping. Ninety-nine crime-related inpatients with schizophrenia (57 homicidal and 42 nonhomicidal violent) and 133 healthy subjects were enrolled between October 2005 and May 2008. Diagnoses were made according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria. The genotype frequencies of tryptophan hydroxylase-1 (TPH1) A218C and COMT V158M were compared between groups. The TPH1 CC genotype had 2.7-fold higher odds of crime-related schizophrenia compared with A-carrier genotype after the analysis was controlled for sex and age (OR, 2.69; 95% CI, 1.22 - 5.91; P = .01). In addition, the TPH1 CC genotype had 3.4-fold higher odds of homicidal schizophrenia compared with A-carrier genotype after the analysis was controlled for sex and age (OR, 3.38; 95% CI, 1.40 - 8.18; P = .007). However, no significant differences were found in the frequencies of genotype of COMT polymorphism between criminal schizophrenics and healthy subjects, nor were any significant differences found between nonhomicidal schizophrenics and healthy subjects. These results indicate that the TPH1 CC recessive genotype is likely to be a genetic risk factor for criminal behavior, especially homicidal behavior in patients with schizophrenia. However, COMT gene polymorphisms were not associated with criminal behavior in schizophrenic patients. © Copyright 2012 Physicians Postgraduate Press, Inc.

  9. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

    2008-01-01

    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

  10. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian; Schaefer, Ulf; MacPherson, Cameron R.; Bajic, Vladimir B.

    2011-01-01

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  11. dPORE-miRNA: Polymorphic regulation of microRNA genes

    KAUST Repository

    Schmeier, Sebastian

    2011-02-04

    Background: MicroRNAs (miRNAs) are short non-coding RNA molecules that act as post-transcriptional regulators and affect the regulation of protein-coding genes. Mostly transcribed by PolII, miRNA genes are regulated at the transcriptional level similarly to protein-coding genes. In this study we focus on human miRNAs. These miRNAs are involved in a variety of pathways and can affect many diseases. Our interest is on possible deregulation of the transcription initiation of the miRNA encoding genes, which is facilitated by variations in the genomic sequence of transcriptional control regions (promoters). Methodology: Our aim is to provide an online resource to facilitate the investigation of the potential effects of single nucleotide polymorphisms (SNPs) on miRNA gene regulation. We analyzed SNPs overlapped with predicted transcription factor binding sites (TFBSs) in promoters of miRNA genes. We also accounted for the creation of novel TFBSs due to polymorphisms not present in the reference genome. The resulting changes in the original TFBSs and potential creation of new TFBSs were incorporated into the Dragon Database of Polymorphic Regulation of miRNA genes (dPORE-miRNA). Conclusions: The dPORE-miRNA database enables researchers to explore potential effects of SNPs on the regulation of miRNAs. dPORE-miRNA can be interrogated with regards to: a/miRNAs (their targets, or involvement in diseases, or biological pathways), b/SNPs, or c/transcription factors. dPORE-miRNA can be accessed at http://cbrc.kaust.edu.sa/dpore and http://apps.sanbi.ac.za/dpore/. Its use is free for academic and non-profit users. © 2011 Schmeier et al.

  12. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

    2016-01-01

    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

  13. Association of IL-6 and MMP-3 gene polymorphisms with ...

    Indian Academy of Sciences (India)

    comprehensively and systematically performed this meta-analysis to detect whether the two gene polymorphisms are corre- .... control studies; (ii) 'failure to provide the genes' distribution details ..... biological activity of corresponding proteins such as IL-6 .... pathic scoliosis is related to inadequate calcium intake and weight.

  14. Mitochondrial gene polymorphisms alter hepatic cellular energy metabolism and aggravate diet-induced non-alcoholic steatohepatitis

    Directory of Open Access Journals (Sweden)

    Torsten Schröder

    2016-04-01

    Full Text Available Objective: Non-alcoholic fatty liver disease (NAFLD is the most common chronic liver disease and is associated with an enhanced risk for liver and cardiovascular diseases and mortality. NAFLD can progress from simple hepatic steatosis to non-alcoholic steatohepatitis (NASH. However, the mechanisms predisposing to this progression remain undefined. Notably, hepatic mitochondrial dysfunction is a common finding in patients with NASH. Due to a lack of appropriate experimental animal models, it has not been evaluated whether this mitochondrial dysfunction plays a causative role for the development of NASH. Methods: To determine the effect of a well-defined mitochondrial dysfunction on liver physiology at baseline and during dietary challenge, C57BL/6J-mtFVB/N mice were employed. This conplastic inbred strain has been previously reported to exhibit decreased mitochondrial respiration likely linked to a non-synonymous gene variation (nt7778 G/T of the mitochondrial ATP synthase protein 8 (mt-ATP8. Results: At baseline conditions, C57BL/6J-mtFVB/N mice displayed hepatic mitochondrial dysfunction characterized by decreased ATP production and increased formation of reactive oxygen species (ROS. Moreover, genes affecting lipid metabolism were differentially expressed, hepatic triglyceride and cholesterol levels were changed in these animals, and various acyl-carnitines were altered, pointing towards an impaired mitochondrial carnitine shuttle. However, over a period of twelve months, no spontaneous hepatic steatosis or inflammation was observed. On the other hand, upon dietary challenge with either a methionine and choline deficient diet or a western-style diet, C57BL/6J-mtFVB/N mice developed aggravated steatohepatitis as characterized by lipid accumulation, ballooning of hepatocytes and infiltration of immune cells. Conclusions: We observed distinct metabolic alterations in mice with a mitochondrial polymorphism associated hepatic mitochondrial

  15. Growth Hormone Gene Polymorphism in Two Iranian Native Fowls (Short Communication

    Directory of Open Access Journals (Sweden)

    Jafari A

    1999-11-01

    Full Text Available Biochemical polymorphism study is a method of determination of genetic variation. This variability could be a basis for selection and subsequent genetic improvement in farm animals. The polymorphism in the intron 1 of chicken growth hormone (cGH gene was investigated in the Iranian native fowls by using polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP method. The genomic DNA was extracted from 217 samples (129 samples from the native fowls of Isfahan province and 88 samples from the native fowls of Mazandaran province by using modified salting out technique. The DNA fragment of the growth hormone gene with 776 bp was amplified by PCR using specific primers. Then the PCR products were digested with MspI restriction enzyme and analyzed on 2.5% agarose gel. The allelic frequency of intron 1 locus for A1, A2 and A3 alleles in  Isfahan native fowls were 0.60, 0.21 and 0.19 and those in Mazandaran native  fowls were 0.28, 0.05 and 0.67, respectively. The results of current study indicated that the intron 1 of cGH is polymorphic in Iranian native fowls and could be exploited as a candidate gene for marker-assisted selection for growth-related traits.

  16. Associations between STAT Gene Polymorphisms and Psoriasis in Northeastern China.

    Science.gov (United States)

    Zhou, Jing; Li, Yuzhen; Sun, Donglin

    2017-01-01

    Psoriasis is an autoimmune disease with genetic and environmental factors. Based on the roles of STATs (signaling transducers and activators of transcription) in autoimmune diseases, it is assumed STAT gene polymorphisms are associated with psoriasis. To study the association between STAT gene polymorphisms and psoriasis in the northeastern Chinese population. Eight single-nucleotide polymorphisms were genotyped: rs2293152, rs3816769, rs4796793, and rs744166 in STAT3, rs7574865 and rs3024866 in STAT4, and rs324011 and rs3024974 in STAT6, using SNaPshot methods. The genotype, allele, and haplotype frequencies were compared between 400 psoriasis patients and 398 healthy individuals in northeastern China. rs744166GG in STAT3 and rs7574865TT in STAT4 had higher frequencies in the case than the control group, suggesting these 2 genotypes increase the susceptibility to psoriasis (p < 0.05). Three haplotypes (H3, H6, and H7) were found to be associated with psoriasis in the study (p < 0.05). These results indicate a role of STAT genes in the pathogenesis of psoriasis. © 2017 S. Karger AG, Basel.

  17. Extensive shared polymorphism at non-MHC immune genes in recently diverged North American prairie grouse

    Science.gov (United States)

    Minias, Piotr; Bateson, Zachary W.; Whittingham, Linda A.; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O.

    2018-01-01

    Gene polymorphisms shared between recently diverged species are thought to be widespread and most commonly reflect introgression from hybridization or retention of ancestral polymorphism through incomplete lineage sorting. Shared genetic diversity resulting from incomplete lineage sorting is usually maintained for a relatively short period of time, but under strong balancing selection it may persist for millions of years beyond species divergence (balanced trans-species polymorphism), as in the case of the major histocompatibility complex (MHC) genes. However, balancing selection is much less likely to act on non-MHC immune genes. The aim of this study was to investigate the patterns of shared polymorphism and selection at non-MHC immune genes in five grouse species from Centrocercus and Tympanuchus genera. For this purpose, we genotyped five non-MHC immune genes that do not interact directly with pathogens, but are involved in signaling and regulate immune cell growth. In contrast to previous studies with MHC, we found no evidence for balancing selection or balanced trans-species polymorphism among the non-MHC immune genes. No haplotypes were shared between genera and in most cases more similar allelic variants sorted by genus. Between species within genera, however, we found extensive shared polymorphism, which was most likely attributable to introgression or incomplete lineage sorting following recent divergence and large ancestral effective population size (i.e., weak genetic drift). Our study suggests that North American prairie grouse may have attained relatively low degree of reciprocal monophyly at nuclear loci and reinforces the rarity of balancing selection in non-MHC immune genes.

  18. A meta-analysis of adiponectin gene rs22411766 T>G polymorphism and ischemic stroke susceptibility

    Directory of Open Access Journals (Sweden)

    Xiuju Chen

    2016-01-01

    Full Text Available Several studies have investigated the correlation between adiponectin gene rs22411766 T>G polymorphism and ischemic stroke risk. However, the results were not conclusive with each other. Therefore, to overcome this obstacle, we performed this meta-analysis to further explicate the adiponectin gene rs22411766 T>G polymorphism and ischemic stroke susceptibility. Case-control or cohort studies focused on adiponectin gene rs22411766 T>G polymorphism and ischemic stroke risk were electronic searched in the databases of Medline, Pubmed, Cochrane library, Excerpta Medica database(EMBASE and China National Knowledge Infrastructure (CNKI. All the potentially relevant studies were included in this meta-analysis. The association between adiponectin gene rs22411766 T>G polymorphism and ischemic stroke was expressed by odds ratio with its confidence interval. Publication bias has been assessed by begg’s funnel plot. All the analyses have been performed by Revman 5.1 statistical software. Finally, a total of six studies with 1,345 cases and 1,421 controls were included in this meta-analysis. Our results demonstrated that there was a significant association between adiponectin gene rs22411766 T>G polymorphism and ischemic stroke risk (p<0.05. People with G single nucleotide of adiponectin gene have the increased risk of developing ischemic stroke compared to T single nucleotide.

  19. Polymorphism investigation of calpastatin gene in Zel sheep ...

    African Journals Online (AJOL)

    hosein

    2012-02-14

    Feb 14, 2012 ... Meat tenderness is an important quality characteristic for which consumers are interested. ... Key words: Calpastatin gene, polymorphism, Zel sheep, meat and polymerase chain reaction- ..... correlations for bovine postrigor calpastatin activity, intramuscular fat ... expression of the mRNA in skeletal muscle.

  20. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Cytokine Gene Polymorphisms in Egyptian Cases with Brain Tumors

    International Nuclear Information System (INIS)

    Badr El-Din, N.K.; Abdel-Hady, E.K.; Salem, F.K.; Settin, A.; ALI, N.

    2009-01-01

    Background: Cytokines are proposed to play important roles in brain tumor biology as well as neuro degeneration or impaired neuronal function. Objectives: This work aimed to check the association of polymorphisms of cytokine genes in Egyptian cases with brain tumors. Methods: This work included 45 cases affected by brain tumors diagnosed as 24 benign and 21 malignant. Their median age was 45 years, and they were 20 males and 25 females. These cases were taken randomly from the Neurosurgery Department of Mansoura University Hospital, Egypt. Case genotypes were compared to 98 healthy unrelated controls from the same locality. DNA was amplified using PCR utilizing sequence specific primers (SSP) for detection of polymorphisms related to TNF-a-308 (G/A), IL-10-1082 (G/A), IL-6-174 (G/C) and IL-1Ra (VNTR) genes. Results: Cases affected with benign brain tumors showed a significant higher frequency of IL-10-1082 A/A [odds ratio (OR=8.0), p<0.001] and IL-6-174 C/C (OR=6.3, p=0.002) homozygous genotypes as compared to controls. Malignant cases, on the other hand, showed significantly higher frequency of IL-6-174 C/C (OR =4.8, p=0.002) homozygous genotype and TNF-a-308 A/A (OR=4.9, p<0.001) homozygous genotype when compared to controls. In the meantime, all cases showed no significant difference regarding the distribution of IL-1Ra VNTR genotype polymorphism compared to controls. Conclusions: Cytokine gene polymorphisms showed a pattern of association with brain tumors which may have potential impact on family counseling and disease management.

  2. Relationship between IL-10 gene -819C/T polymorphism and the ...

    African Journals Online (AJOL)

    Background: The -819C/T polymorphism in interleukin 10 (IL-10) gene has been reported to be associated with inflammatory bowel disease (IBD) ,but the previous results are conflicting. Materials and methods: The present study aimed at investigating the association between this polymorphism and risk of IBD using a ...

  3. Matrix metalloproteinase gene polymorphisms in patients with coronary artery disease

    Directory of Open Access Journals (Sweden)

    Vanessa L.N. Dalepiane

    2007-01-01

    Full Text Available Matrix metalloproteinases (MMPs play an important role in the pathogenesis of atherosclerosis, the pathology underlying the majority of coronary artery disease (CAD. In this study we tested the hypothesis that polymorphic variation in the MMP genes influences the risk of developing atherosclerosis. We analyzed functional polymorphisms in the promoter of the MMP-1, MMP-3, MMP-9 and MMP-12 genes in 183 Brazilian Caucasian individuals submitted to coronary angiography, of which 67 (37% had normal coronary arteries (control group and 116 (63% had CAD (CAD patient group. The -1607 1G/2G MMP-1, -1171 5A/6A MMP-3, -1562 C/T MMP-9, -82 A/G MMP-12 polymorphisms were analyzed by PCR followed by restriction digestion. No significant differences were observed in allele frequencies between the CAD patients and controls. Haplotype analysis showed no differences between the CAD patients and controls. There was a significant difference in the severity of CAD, as assessed by the number of diseased vessels, in MMP-1 1G/1G homozygous individuals and in those homozygous for the 6A allele of the MMP-3 polymorphism. However, multivariate analysis showed that diabetes mellitus was the only variable independently associated with CAD severity. Our findings indicated that MMP polymorphisms have no significant impact on the risk and severity of CAD.

  4. The (CTGn polymorphism in the NOTCH4 gene is not associated with schizophrenia in Japanese individuals

    Directory of Open Access Journals (Sweden)

    Okubo Takehito

    2001-06-01

    Full Text Available Abstract Background The human NOTCH4 gene is a candidate gene for schizophrenia due to its chromosomal location and neurobiological roles. In a British linkage study, NOTCH4 gene polymorphisms were highly associated with schizophrenia. In a Japanese case-control association study, however, these polymorphisms did not show significant associations with schizophrenia. We conducted a case-control study with Japanese subjects to explore an association between the triplet repeat polymorphism in the NOTCH4 gene and schizophrenia, including subtypes of schizophrenia, longitudinal disease course characteristics, and a positive family history for psychoses. Methods We examined the (CTGn repeat polymorphism in the NOTCH4 gene among 100 healthy Japanese individuals and 102 patients with schizophrenia (22 paranoid, 38 disorganized, 29 residual, 64 episodic, 31 continuous, 42 with prominent negative symptoms, and 46 with positive family histories using a polymerase chain reaction-based, single-strand conformational polymorphism analysis. Results Five different alleles consisting of 6, 9, 10, 11, and 13 repeats of CTG (Leu in patients with schizophrenia, and 4 alleles consisting of 6, 9, 10, and 11 repeats in controls were found. No significant differences in genotype or allele frequencies of repeat numbers were found between controls and patients. In addition, there were no associations between the polymorphism and schizophrenia subtypes, longitudinal disease course characteristics, or positive family history of the patients. Conclusions Our data suggest a lack of association between the NOTCH4 gene triplet repeat polymorphism and schizophrenia in Japanese individuals.

  5. Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women.

    Science.gov (United States)

    Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum

    2014-05-01

    This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P FANCA gene may increase the risk for POF in Korean women.

  6. Polymorphism in leptin receptor gene was associated with obesity in ...

    African Journals Online (AJOL)

    The mutation in leptin receptor (LEPR) gene causes splicing abnormality that resulted in truncated receptor, aberrant signal transduction, leptin resistance, and obesity. This study aims to determine the association of LEPR gene polymorphisms, rs1137100 and rs1137101, on phenotype and leptin level between obese and ...

  7. Codon 201Gly Polymorphic Type of the DCC Gene is Related to Disseminated Neuroblastoma

    Directory of Open Access Journals (Sweden)

    Xiao-Tang Kong

    2001-01-01

    Full Text Available The deleted in colorectal carcinoma (DCC gene is a potential tumor- suppressor gene on chromosome 18821.3. The relatively high frequency of loss of heterozygosity (LOH and loss of expression of this gene in neuroblastoma, especially in the advanced stages, imply the possibility of involvement of the DCC gene in progression of neuroblastoma. However, only few typical mutations have been identified in this gene, indicating that other possible mechanisms for the inactivation of this gene may exist. A polymorphic change (Arg to Gly at DCC codon 201 is related to advanced colorectal carcinoma and increases in the tumors with absent DCC protein expression. In order to understand whether this change is associated with the development or progression of neuroblastoma, we investigated codon 201 polymorphism of the DCC gene in 102 primary neuroblastomas by polymerase chain reaction single-strand conformation polymorphism. We found no missense or nonsense mutations, but a polymorphic change from CGA (Arg to GGA (Gly at codon 201 resulting in three types of polymorphism: codon 201Gly type, codon 201Arg/Gly type, and codon 201Arg type. The codon 201Gly type occurred more frequently in disseminated (stages IV and IVs neuroblastomas (72% than in localized (stages I, II, and III tumors (48% (P=.035, and normal controls (38% (P=.024. In addition, the codon 201Gly type was significantly more common in tumors found clinically (65% than in those found by mass screening (35% (P=.002. The results suggested that the codon 201Gly type of the DCC gene might be associated with a higher risk of disseminating neuroblastoma.

  8. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  9. Interleukin gene polymorphisms in Chinese Han population with breast cancer, a case-control study.

    Science.gov (United States)

    Zuo, Xiaoxiao; Li, Miao; Yang, Ya; Liang, Tiansong; Yang, Hongyao; Zhao, Xinhan; Yang, Daoke

    2018-04-06

    Cytokines are known as important regulators of the cancer involved in inflammatory and immunological responses. This fact and plethora of gene polymorphism data prompted us to investigate IL1 gene polymorphisms in breast cancer (BC) patients. Totally, 530 patients with BC and 628 healthy control women were studied. The genetic polymorphisms for IL1 were analyzed by Massarray Sequencing method. Three single nucleotide polymorphisms (SNPs) identified in IL1B, IL1R1 gene are thought to influence breast cancer risk. The results of the association between IL-1B, IL1R1 polymorphisms and breast cancer risk have significant. We found that the variant TT genotype of rs10490571 was associated with a significantly increased breast cancer risk (TT vs. CC: OR = 2.82, 95% CI = 1.12-7.08, P = 0.047 for the codominant model). For rs16944 (AG vs. GG: OR = 0.60, 95% CI = 0.41-0.90, P = 0.034 for the codominant model) and rs1143623 (CG vs. CC: OR = 0.65, 95% CI = 0.45-0.94, P = 0.023 for the codominant model) have significant associations were found in genetic models. In conclusion, the present analysis suggests a correlation of polymorphic markers within the IL-1 gene locus with the risk in developing breast cancer. Taken together with our finding that IL1B, IL1R1 gene three SNP are also associated with the risk for the disease, we suggest that inflammation via innate and adaptive immunity contributes to multifactorial hereditary predisposition to pathogenesis of the breast cancer.

  10. Effects of bovine prolactin gene polymorphism within exon 4 on milk ...

    African Journals Online (AJOL)

    In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for variation and genetic trends in milk yield and composition traits. Genomic DNAs were extracted from 268 semen samples belonged to Iranian Holstein bulls. Genotyping for the prolactin gene using PCRRFLP technique and RsaI ...

  11. Genetic association between polymorphism of mdm2 gene and symptoms and pathological types of NSCLC

    International Nuclear Information System (INIS)

    Liu Xiaolan; Wang Weili; Zhang Xueying; Hao Ming; Liu Linlin; Wu Zhenfeng; Jiang Hongwei

    2008-01-01

    Objective: To investigate the genetic association between polymorphism of mdm2 gene and symptoms and pathological types of non-small cell lung cancer (NSCLC). Methods: Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) was used to identify mdm2 genotypes. The Pearson Chi square test and Woolf statistic method were used to analyze the relative risk and 95% confidence interval (CI) in order to find the genetic association between polymorphism of mdm2 gene and symptoms and pathological types of NSCLC. Results: In the SNP rs1196337 (a G to A base change) AA genotype showed association with cough of NSCLC (P<0.05). Conclusion: The polymorphism of mdm2 gene may be associated with symptom as cough of NSCLC. (authors)

  12. Multidrug resistance 1 gene polymorphisms may determine Crohn's disease behavior in patients from Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Ana Teresa P. Carvalho

    2014-01-01

    Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut

  13. Genetic polymorphisms at the leptin receptor gene in three beef cattle breeds

    Directory of Open Access Journals (Sweden)

    Sabrina E.M. Almeida

    2008-01-01

    Full Text Available The genetic diversity of a single nucleotide polymorphism (SNP at the exon 20 (T945M of the leptin receptor gene (LEPR and of three short tandem repeats (STRs BM7225, BMS694, and BMS2145 linked to LEPR was investigated in three beef cattle herds (Brangus Ibagé, Charolais, and Aberdeen Angus. A cheap and effective new method to analyze the T945M polymorphism in cattle populations was developed and the possible role of these polymorphisms in reproduction and weight gain of postpartum cows was evaluated. High levels of genetic diversity were observed with the average heterozygosity of STRs ranging from 0.71 to 0.81. No significant association was detected between LEPR markers and reproductive parameters or daily weight gain. These negative results suggest that the LEPR gene polymorphisms, at least those herein described, do not influence postpartum cows production.

  14. Ghrelin gene polymorphisms in rheumatoid arthritis.

    Science.gov (United States)

    Ozgen, Metin; Koca, Suleyman Serdar; Etem, Ebru Onalan; Yuce, Huseyin; Aydin, Suleyman; Isik, Ahmet

    2011-07-01

    Ghrelin, an endogenous orexigenic peptide, has anti-inflammatory effects, down-regulates pro-inflammatory cytokines, and its altered levels are reported in various inflammatory diseases. The human preproghrelin (ghrelin/obestatin) gene shows several single nucleotide polymorphisms (SNPs) including Arg51Gln, Leu72Met, Gln90Leu, and A-501C. The aim of this study was to investigate the frequency, and clinical significance, of these four SNPs in a small cohort of Turkish patients with rheumatoid arthritis (RA). The study included 103 patients with RA and 103 healthy controls. In the RA group, disease activity and disease-related damage were assessed using the Disease Activity Score-28 (DAS-28), and the modified Larsen scoring (MLS) methods. In all the participants, genomic DNA was isolated and genotyped by polymerase chain reaction and restriction fragment length polymorphism analysis. The frequencies of ghrelin gene SNPs were 82.5 and 79.6% in the RA and control groups, respectively, and there were no significant differences in terms of genotype distributions and allele frequencies for these four SNPs between the groups. However, the A-501C SNP was found to be associated with early disease onset, and Gln90Leu SNP with less frequent rheumatoid factor positivity, in the RA group. A-501C SNP is associated with earlier onset of RA suggesting that genetic variations in the ghrelin gene may have an impact on RA. Copyright © 2010 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

  15. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

    Science.gov (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

    2015-09-29

    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  16. Association study of interferon gamma (IFN-γ) +874T/A gene polymorphism in patients with paranoid schizophrenia.

    Science.gov (United States)

    Paul-Samojedny, Monika; Owczarek, Aleksander; Suchanek, Renata; Kowalczyk, Malgorzata; Fila-Danilow, Anna; Borkowska, Paulina; Kucia, Krzysztof; Kowalski, Jan

    2011-03-01

    Schizophrenia is a multifactorial disease with changes affecting the immune system. Dysregulation of the cytokine network in schizophrenia has been well documented. Such changes may occur due to disturbances in cytokine levels that are linked to polymorphisms of cytokine genes. However, research in the role of cytokine gene polymorphisms in schizophrenia has been surprisingly scanty. The aim of this study was to identify, in a case control study, whether polymorphism of IFN-γ gene is a risk factor for the development of paranoid schizophrenia. To the best of our knowledge, this is the first study that examines the association between the IFN-γ gene polymorphism and psychopathological symptoms in patients with paranoid schizophrenia. Polymorphism of IFN-γ (+874T/A, rs 62559044) in schizophrenic patients (n=179), as well as healthy individuals (n=196), both Polish residents, was genotyped using AS-PCR method. Of note, when analyzing the results, we took into consideration the gender of studied individuals. Surprisingly, a single-nucleotide polymorphism in the first intron of the IFN-γ gene was found to be associated with paranoid schizophrenia in males, but not in females. The presence of allele A at position +874 in the IFN-γ gene correlates with 1.66-fold higher risk of paranoid schizophrenia development in males. Differences in the genotypes may have an important role in determining the level of I gene transcription. Because other polymorphisms have been demonstrated to influence IFN-γ transcription, further analysis is necessary to clarify the role of this gene in the pathogenesis of paranoid schizophrenia.

  17. FEATURES OF THE CLINICAL SIGNIFICANCE OF POLYMORPHIC VARIANTS OF ENOS AND AGTR2 GENES IN PATIENTS WITH CAD

    Directory of Open Access Journals (Sweden)

    A. L. Khokhlov

    2016-01-01

    Full Text Available Coronary heart disease (CHD is a major cause of mortality. Morphological substrate of CHD in most cases is atherosclerosis, which is based on structural genes polymorphism eNOS and AGTR2. The aim of the study was to study the prevalence of eNOS and AGTR2 genes in patients with coronary artery disease and the association of these genes with coronary heart disease. The study involved 187 patients aged 36 to 86 years (62,2±11,2 with different forms of CHD: stable and unstable angina, myocardial infarction and 45 people without CHD. Determination of gene polymorphisms was performed by real-time PCR analyzer of nucleic acids IQ 5 Bio-Rad. Statistical analysis was performed using Statistica 10.0. The study revealed a significant difference between the incidence of homozygous AA allelic variant gene AGTR2 group of patients with myocardial infarction and the comparison group; polymorphic variant AA AGTR2 gene is associated with earlier onset of coronary artery disease; It found that carriers of the polymorphic variant gene GA AGTR2 beginning statistically CHD occurred significantly later than in carriers of alleles GG and AA; age CHD debut TT allele carriers of the eNOS gene is associated with an earlier onset of the disease and statistically significantly different from the age of first CHD in carriers of alleles of polymorphic variants of GG and GT; revealed a positive correlation between the polymorphic allele AGTR2 gene with the presence of arterial hypertension in patients with coronary artery disease; It determined that the T allele carriers of the polymorphic gene eNOS is associated more early onset of hypertension, found the association of the polymorphic allele gene AGTR2 the need to use higher doses of ACE inhibitor — perindopril.

  18. Interleukin Gene Polymorphisms and Susceptibility to HIV Infection

    Indian Academy of Sciences (India)

    Chrysa

    vaccines, and with almost 36.7 million HIV-infected individuals worldwide .... The allelic and genotypic distribution of the IL genes SNPs are presented in .... polymorphism using the genetic model-free bivariate approach produced, as in ... Through its immuno-inhibitory and anti-inflammatory activities and, in particular, by.

  19. [Aldose reductase gene polymorphism and rate of appearance of retinopathy in non insulin dependent diabetics].

    Science.gov (United States)

    Olmos, P; Acosta, A M; Schiaffino, R; Díaz, R; Alvarado, D; O'Brien, A; Muñoz, X; Arriagada, P; Claro, J C; Vega, R; Vollrath, V; Velasco, S; Emmerich, M; Maiz, A

    1999-04-01

    Recent studies suggest that polymorphisms associated to the aldose reductase gene could be related to early retinopathy in noninsulin dependent diabetics (NIDDM). There is also new interest on the genetic modulation of coagulation factors in relation to this complication. To look for a possible relationship between the rate of appearance of retinopathy and the genotype of (AC)n polymorphic marker associated to aldose reductase gene. A random sample of 27 NIDDM, aged 68.1 +/- 10.6 years, with a mean diabetes duration of 20.7 +/- 4.8 years and a mean glycosilated hemoglobin of 10.6 +/- 1.6%, was studied. The genotype of the (AC)n, polymorphic marker associated to the 5' end of the aldose reductase (ALR2) gene was determined by 32P-PCR plus sequenciation. Mutations of the factor XIII-A gene were studied by single stranded conformational polymorphism, sequenciation and restriction fragment length polymorphism. Four patients lacked the (AC)24 and had a higher rate of appearance of retinopathy than patients with the (AC)24 allele (0.0167 and 0.0907 score points per year respectively, p = 0.047). Both groups had similar glycosilated hemoglobin (11.7 +/- 0.2 and 10.5 +/- 1.6% respectively). Factor XIII gene mutations were not related to the rate of appearance of retinopathy. Our data suggest that the absence of the (AC)24 allele of the (AC)n polymorphic marker associated to the 5' end of the aldose reductase gene, is associated to a five fold reduction of retinopathy appearance rate.

  20. Human Retrotransposon Insertion Polymorphisms Are Associated with Health and Disease via Gene Regulatory Phenotypes

    Directory of Open Access Journals (Sweden)

    Lu Wang

    2017-08-01

    Full Text Available The human genome hosts several active families of transposable elements (TEs, including the Alu, LINE-1, and SVA retrotransposons that are mobilized via reverse transcription of RNA intermediates. We evaluated how insertion polymorphisms generated by human retrotransposon activity may be related to common health and disease phenotypes that have been previously interrogated through genome-wide association studies (GWAS. To address this question, we performed a genome-wide screen for retrotransposon polymorphism disease associations that are linked to TE induced gene regulatory changes. Our screen first identified polymorphic retrotransposon insertions found in linkage disequilibrium (LD with single nucleotide polymorphisms that were previously associated with common complex diseases by GWAS. We further narrowed this set of candidate disease associated retrotransposon polymorphisms by identifying insertions that are located within tissue-specific enhancer elements. We then performed expression quantitative trait loci analysis on the remaining set of candidates in order to identify polymorphic retrotransposon insertions that are associated with gene expression changes in B-cells of the human immune system. This progressive and stringent screen yielded a list of six retrotransposon insertions as the strongest candidates for TE polymorphisms that lead to disease via enhancer-mediated changes in gene regulation. For example, we found an SVA insertion within a cell-type specific enhancer located in the second intron of the B4GALT1 gene. B4GALT1 encodes a glycosyltransferase that functions in the glycosylation of the Immunoglobulin G (IgG antibody in such a way as to convert its activity from pro- to anti-inflammatory. The disruption of the B4GALT1 enhancer by the SVA insertion is associated with down-regulation of the gene in B-cells, which would serve to keep the IgG molecule in a pro-inflammatory state. Consistent with this idea, the B4GALT1 enhancer

  1. [Association of IL-1β-511T gene rs16944 polymorphism with febrile seizures].

    Science.gov (United States)

    Ren, Xiao-Tun; Sun, Su-Zhen; Liu, Fang; Wang, Xiao-Ming

    2014-02-01

    Despite substantial research efforts worldwide, the role of inflammatory cytokine IL-1β in the onset of febrile seizures (FS) remains controversial. The aim of this study was to assess the relationship between rs16944 polymorphism of the IL-1β-511T gene and occurrence of simple FS in a sample of Han children in northern China. The IL-1β-511T gene rs16944 was genotyped by SNaPshot SNP technique in 141 FS children and 130 healthy control subjects. The genotypic and allelic frequencies in the two groups were comparatively analyzed. There were no significant differences in genotypic and allelic frequencies of rs16944 polymorphism of the IL-1β-511T gene between FS patients and control subjects (P>0.05).When the clinical data on A/A, A/G and G/G genotypes of the rs16944 polymorphism in FS patients, there was statistically significant difference in age of first onset (χ(2)=19.491, Prs16944 polymorphism of the IL-1β-511T gene and the incidence of FS in Han children in Northern China. However, the differences in genotypes of this polymorphism might be associated with pathogenesis and prognosis of simple FS in the population studied.

  2. Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

    Directory of Open Access Journals (Sweden)

    Bua-In Saowaluck

    2014-01-01

    Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

  3. [Association of muscle segment homeobox gene 1 polymorphisms with nonsyndromic cleft lip with or without cleft palate].

    Science.gov (United States)

    Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng

    2008-06-01

    Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.

  4. GGC and StuI polymorphism on the androgen receptor gene in endometrial cancer patients

    International Nuclear Information System (INIS)

    Sasaki, Masahiro; Karube, Akihiro; Karube, Yuko; Watari, Michiko; Sakuragi, Noriaki; Fujimoto, Seiichiro; Dahiya, Rajvir

    2005-01-01

    Androgens have an anti-proliferative effect on endometrial cells. Human androgen receptor (AR) gene contains two polymorphic short tandem repeats of GGC and CAG, and a single-nucleotide polymorphism on exon 1 that is recognized by the restriction enzyme, StuI. Prior studies have shown that the lengths of the CAG repeat are inversely and linearly related to AR activity and associated with endometrial cancer. However, little is known about the GGC repeat and the StuI polymorphism of the AR gene. Thus, we investigated whether these AR polymorphisms are risk factors for endometrial cancer. To test this hypothesis, the genetic distributions of these polymorphisms were investigated in blood samples from endometrial cancer patients and healthy controls. The allelic and genotyping profiles were analyzed by polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and direct DNA sequencing, and analyzed statistically. The GGC repeat was significantly longer in endometrial cancer patients as compared to normal healthy controls. In general, an increased risk of endometrial cancer was found with increasing GGC repeat. The relative risk for the 17 GGC repeat was greater than 4, as compared to controls. However, the StuI polymorphism was not significantly different between patients and controls. The findings suggest that increased numbers of GGC repeat on the AR gene may be a risk factor for endometrial cancer

  5. Polymorphisms of the ABCB1 gene in the pakistani population

    International Nuclear Information System (INIS)

    Farhat, K.; Waheed, A.

    2015-01-01

    Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

  6. IRGM gene polymorphisms and risk of gastric cancer.

    NARCIS (Netherlands)

    Burada, F.; Plantinga, T.S.; Ioana, M.; Rosentul, D.; Angelescu, C.; Joosten, L.A.B.; Netea, M.G.; Saftoiu, A.

    2012-01-01

    OBJECTIVE: The study aimed to assess the possible association of polymorphisms in the autophagy gene IRGM (rs13361189 and rs4958847) with the risk of gastric cancer. METHODS: A total of 102 patients with gastric adenocarcinoma, 52 with chronic gastritis and 351 healthy controls were included in this

  7. Impact of Maspin Polymorphism rs2289520 G/C and Its Interaction with Gene to Gene, Alcohol Consumption Increase Susceptibility to Oral Cancer Occurrence.

    Science.gov (United States)

    Yang, Po-Yu; Miao, Nae-Fang; Lin, Chiao-Wen; Chou, Ying-Erh; Yang, Shun-Fa; Huang, Hui-Chuan; Chang, Hsiu-Ju; Tsai, Hsiu-Ting

    2016-01-01

    The purpose of this study was to identify gene polymorphisms of mammary serine protease inhibitor (Maspin) specific to patients with oral cancer susceptibility and clinicopathological status. Three single-nucleotide polymorphisms (SNPs) of the Maspin gene from 741 patients with oral cancer and 601 non-cancer controls were analyzed by real-time PCR. The participants with G/G homozygotes or with G/C heterozygotes of Maspin rs2289520 polymorphism had a 2.07-fold (p = 0.01) and a 2.01-fold (p = 0.02) risk of developing oral cancer compared to those with C/C homozygotes. Moreover, gene-gene interaction increased the risk of oral cancer susceptibility among subjects expose to oral cancer related risk factors, including areca, alcohol, and tobacco consumption. G allele of Maspin rs2289520 polymorphism may be a factor that increases the susceptibility to oral cancer. The interactions of gene to oral cancer-related environmental risk factors have a synergetic effect that can further enhance oral cancer development.

  8. Correlation between the GP78 Gene Polymorphism and Coronary Atherosclerotic Heart Disease

    Directory of Open Access Journals (Sweden)

    Long Wang

    2018-01-01

    Full Text Available Objective: To study the correlation between the GP78 gene polymorphism and blood fat, blood glucose, blood pressure and coronary atherosclerotic heart disease. Methods: A total of 72 patients with coronary atherosclerotic heart disease were selected as the observation group, and 68 healthy participants were selected as the control group. The gp78 gene polymorphism of both groups was studied via polymerase chain reaction-restriction fragment length polymorphism (RFLP. At the same time, the multiple expression quantities of the GP78 gene in the tissues of both groups were tested via fluorogenic quantitative PCR, enzyme-linked immunosorbent assay (ELISA and Western-blotting assay. Furthermore, the blood fat, blood glucose and blood pressure of subjects in both groups were tested. Results: The percentages of the gp78 gene polymorphisms of Arg/Arg, Arg/Gly and Gly/Gly at the 145 locus of the study subjects in the observation group were 12.3%, 43.2% and 44.5%, respectively, while those in the control group were 74.3%, 11.2% and 14.5%, respectively, and there were significant differences between both groups. Based on the test results of the blood fat, blood glucose and blood pressure of the objects in the observation group and control group, significant differences were found between the two groups (P<0.05. Conclusion: There was a significant correlation between the 145 locus of the gp89 gene and coronary atherosclerotic heart disease, indexes of blood fat, blood glucose and blood pressure. Keywords: blood fat, blood glucose, blood pressure, coronary sclerosis, heart disease

  9. DNA repair gene polymorphisms in relation to chromosome aberration frequencies in retired radiation workers

    International Nuclear Information System (INIS)

    Wilding, Craig S.; Relton, Caroline L.; Rees, Gwen S.; Tarone, Robert E.; Whitehouse, Caroline A.; Tawn, E. Janet

    2005-01-01

    Polymorphic variation in DNA repair genes was examined in a group of retired workers from the British Nuclear Fuels plc facility at Sellafield in relation to previously determined translocation frequencies in peripheral blood lymphocytes. Variation at seven polymorphisms in four genes involved in the base excision repair (XRCC1 R194W, R399Q and a [AC] n microsatellite in the 3' UTR) and double strand break repair (XRCC3 T241M and a [AC] n microsatellite in intron 3 of XRCC3, XRCC4 I134T, and a GACTAn microsatellite located 120kb 5' of XRCC5) pathways was determined for 291 retired radiation workers who had received cumulative occupational external radiation doses of between 0 and 1873mSv. When the interaction between radiation dose and each DNA repair gene polymorphism was examined in relation to translocation frequency there was no evidence for any of the polymorphisms studied influencing the response to occupational exposure. A positive interaction observed between genotype (individuals with at least one allele >=20 repeat units) at a microsatellite locus in the XRCC3 gene and smoking status should be interpreted cautiously because interactions were investigated for seven polymorphisms and two exposures. Nonetheless, further research is warranted to examine whether this DNA repair gene variant might be associated with a sub-optimal repair response to smoking-induced DNA damage and hence an increased frequency of translocations

  10. Retracted Association of STAT4 gene polymorphism with systemic lupus erythematosus / lupus nephritis risk.

    Science.gov (United States)

    Zhou, Tian-Biao; Jiang, Zong-Pei; Qin, Yuan-Han; Zhou, Jia-Fan

    2014-04-16

    The association of STAT4 gene polymorphism with systemic lupus erythematosus (SLE) / lupus nephritis (LN) results from the published studies is still conflicting. This meta-analysis was performed to evaluate the relationship between STAT4 rs7574865, rs16833431, rs11889341, rs8179673, rs10168266, rs7582694, rs3821236, rs7601754 gene polymorphism and SLE / LN, and to explore whether STAT4 gene polymorphism could become a predictive marker for SLE / LN risk. Association studies were identified from the databases of PubMed, Embase, Cochrane Library and CBM-disc (China Biological Medicine Database) as of September 1, 2013, and eligible investigations were synthesized using meta-analysis method. 24 investigations were identified for the analysis of association between STAT4 gene polymorphism and SLE, consisting of 31190 patients with SLE and 43940 controls. In STAT4 rs7574865, there was a marked association between T allele or TT genotype and SLE susceptibility (T: OR=1.53, 95% CI: 1.30-1.79, Prs7574865 gene polymorphism was not associated with the LN risk. Our results indicate that T allele or TT homozygous is a significant risk genetic molecular marker to predict the SLE susceptibility and GG genotype is a valuable marker to against the SLE risk, but the association was not found for LN. However, more investigations are required to further clarify the association of the T allele or TT homozygous with SLE / LN susceptibility. This article is protected by copyright. All rights reserved.

  11. [G894T (NOS3) and G1958A (MTHFD1) gene polymorphisms and risk of ischemic heart disease in Yucatan, Mexico].

    Science.gov (United States)

    García-González, Igrid; Solís-Cárdenas, Alberto de Jesús; Flores-Ocampo, Jorge A; Alejos-Mex, Ricardo; Herrera-Sánchez, Luis Fernando; González-Herrera, Lizbeth Josefina

    2015-01-01

    Cardiovascular medicine is focused on the search for genetic risk markers with predictive and/or prognostic value. Among the genetic variants of interest are G894T endothelial nitric oxide synthase and G1958A methylenetetrahydrofolate dehydrogenase1 gene polymorphisms. The aim of this study was to determine the possible association between these polymorphisms and ischemic heart disease in patients from Southern of Mexico (Yucatán). Case-control study matched by age, sex and origin was designed. We studied 98 patients with coronary disease and 101 controls. Participants were evaluated for the usual risk factors. The polymorphisms were identified using the polymerase chain reaction/restriction fragment length polymorphism analysis. Informed consent was obtained from all participants. The G894T and G1958A polymorphisms were not associated with ischemic heart disease, however, the TT genotype (G894T) was associated with the angina (OR=10.2; 95%CI, 1.51-68.8; p=0.025). The genotype GT (G894T) was the most frequent in patients with family history of coronary artery disease. Multiple logistic regression analysis identified smoking (OR=5.21; 95%CI, 2.1-12.9; p=0.000), hypertension (OR=3.54; 95%CI, 1.47-8.56; p=0.005) and obesity (OR=1.16; 95%CI, 1.1-1.27; p=0.001) as risk factors predicting the ischemic heart disease. The G894T and G1958A polymorphisms showed not association with ischemic heart disease. However, homozygosis for the 894T allele (NOS3) confers at risk to develop angina on Yucatán. Copyright © 2014 Sociedad Española de Arteriosclerosis. Published by Elsevier España. All rights reserved.

  12. Effects of bovine prolactin gene polymorphism within exon 4 on milk ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-10-05

    Oct 5, 2009 ... In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for ... studied. Based on important role of prolactin gene in milk related traits and their genetic trends in dairy cattle, the aims of this study were, to screen ..... isolation and selection towards high fat and protein per-.

  13. Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

    Directory of Open Access Journals (Sweden)

    Leila ePazouki

    2015-03-01

    Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

  14. Angiotensin-II type 1 receptor gene polymorphism and diabetic microangiopathy

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P

    1996-01-01

    with proliferative retinopathy and without diabetic retinopathy was found either: 77 (50%) / 66 (42%) / 13 (8%) vs. 42 (63%) / 22 (33%) / 3 (4%) had AA/AC/CC genotypes, respectively. CONCLUSIONS: The A1166-->C polymorphism in the angiotensin-II type 1 receptor gene does not contribute to the genetic susceptibility...... is present particularly in vascular smooth muscle cells, myocardium and the kidney. A transversion of adenine to cytosine at nucleotide position 1166 in the gene coding for the angiotensin-II type 1 receptor has been associated with hypertension in the non-diabetic population. METHODS: We studied...... the relationship between the A1166-->C polymorphism in the angiotensin-II type 1 receptor gene in patients with insulin dependent diabetes mellitus (IDDM) and diabetic nephropathy (121 men, 77 women, age 41 +/- 10 years, diabetes duration 27 +/- 8 years) and in IDDM patients with normoalbuminuria (116 men, 74...

  15. A meta-analysis of the association between cytokine gene polymorphisms and systemic sclerosis.

    Science.gov (United States)

    Peng, Wen-jia; Pan, Hai-feng; Tao, Jin-hui; Wang, Bing-xiang; Lu, Man-man; Wang, Song; He, Qian; Wang, Jing

    2012-09-01

    We conducted a comprehensive meta-analysis to quantitatively evaluate the association of cytokine gene polymorphisms with systemic sclerosis (SSc) susceptibility. Electronic databases were used to identify published studies before July 2011. In total, 23 case-control studies including 3524 SSc cases and 6086 healthy controls were included in the meta-analysis. We examined the relationship between five gene polymorphisms [cytotoxic T lymphocyte associated antigen 4 (CTLA-4) -1722T/C, CTLA-4 -318C/T, CTLA-4 +49A/G, angiotensin-converting enzyme I/D, STAT-4 rs7574865] and susceptibility to SSc. The combined odds ratio (OR) with 95% confidence interval (95% CI) was calculated to estimate the strength of the association in a fixed or random effect model. Heterogeneity and publication bias were also assessed. We found a significant association between SSc and STAT rs7574865 (TT vs. GG: OR 0.44, 95% CI 0.36-0.54; TT vs. TG + GG: OR 0.48, 95% CI 0.39-0.59; TT + TG vs. GG: OR 0.74, 95% CI 0.66-0.83; T vs. G: OR 0.72, 95% CI 0.66-0.79), but there were no other statistically significant associations with other gene polymorphisms. Our study suggested that SSc is associated with STAT gene rs7574865 polymorphism.

  16. A variant of the endothelial nitric oxide synthase gene (NOS3) associated with AMS susceptibility is less common in the Quechua, a high altitude Native population.

    Science.gov (United States)

    Wang, Pei; Ha, Alice Y N; Kidd, Kenneth K; Koehle, Michael S; Rupert, Jim L

    2010-01-01

    Endothelial nitric oxide synthase (eNOS) is a vascular enzyme that produces nitric oxide, a transient signaling molecule that by vasodilatation regulates blood flow and pressure. Nitric oxide is believed to play roles in both short-term acclimatization and long-term evolutionary adaptation to environmental hypoxia. Several laboratories, including ours, have shown that variants in NOS3 (the gene encoding eNOS) are overrepresented in individuals with altitude-related illnesses such as high altitude pulmonary edema (HAPE) and acute mountain sickness (AMS), suggesting that NOS3 genotypes contribute to altitude tolerance. To further test our hypothesis that the G allele at the G894T polymorphism in NOS3 (dbSNP number: rs1799983; protein polymorphism Glu298Asp) is beneficial in hypoxic environments, we compared frequencies of this allele in an altitude-adapted Amerindian population, Quechua of the Andean altiplano, with those in a lowland Amerindian population, Maya of the Yucatan Peninsula. While common in both populations, the G allele was significantly more frequent in the highlanders. Taken together, our data suggest that this variant in NOS3, which has been previously associated with higher levels of nitric oxide, contributes to both acclimatization and adaptation to altitude.

  17. Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

    Science.gov (United States)

    Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

    2017-08-09

    Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

  18. Lack of association of TNFalpha gene polymorphisms and recurrent pregnancy loss in Caucasian women.

    Science.gov (United States)

    Pietrowski, Detlef; Bettendorf, Herta; Keck, Christoph; Bürkle, Bernd; Unfried, Gertrud; Riener, Eva-Katrin; Hefler, Lukas A; Tempfer, Clemens

    2004-02-01

    The tumor necrosis factor alpha (TNFalpha) gene plays an important role in immunology and inflammation. Variant alleles of TNFalpha are associated with altered RNA and serum protein levels in humans. Conflicting results have been obtained regarding the role of TNFalpha during pregnancy and recurrent pregnancy loss (RPL). This study investigated the relationship between RPL and two polymorphisms in the promoter of the TNFalpha gene (TNFalpha -308 and -863). Genotyping was performed in 168 RPL women and 212 ethnically matched healthy individuals. In addition, we performed analysis of TNFalpha serum protein levels. We demonstrate that neither the polymorphism -308 nor the polymorphism -863 of the TNFalpha gene is associated with RPL in Caucasian women. In addition, we did not find any association between TNFalpha serum levels and the occurrence of RPL in a subset of 36 RPL women and 36 healthy individuals. We conclude that TNFalpha polymorphisms and resting blood TNFalpha levels do not correlate with the propensity to recurrent pregnancy loss in Caucasian women.

  19. Interleukin 18 receptor 1 gene polymorphisms are associated with asthma

    DEFF Research Database (Denmark)

    Zhu, Guohua; Whyte, Moira K B; Vestbo, Jørgen

    2008-01-01

    The interleukin 18 receptor (IL18R1) gene is a strong candidate gene for asthma. It has been implicated in the pathophysiology of asthma and maps to an asthma susceptibility locus on chromosome 2q12. The possibility of association between polymorphisms in IL18R1 and asthma was examined by genotyp...

  20. Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis

    OpenAIRE

    Bao, Ji-Ming; Song, Xian-Lu; Hong, Ying-Qia; Zhu, Hai-Li; Li, Cui; Zhang, Tao; Chen, Wei; Zhao, Shan-Chao; Chen, Qing

    2014-01-01

    Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% confidence interval...

  1. N-acetyltransferase 2 gene polymorphism and presbycusis.

    Science.gov (United States)

    Unal, Murat; Tamer, Lülüfer; Doğruer, Zeynep Nil; Yildirim, Hatice; Vayisoğlu, Yusuf; Camdeviren, Handan

    2005-12-01

    The enzyme of N-acetyltransferase (NAT) is involved in the metabolism and detoxification of cytotoxic and carcinogenic compounds as well as reactive oxygen species (ROS). The excessive amount of ROS generation occurs in the ageing inner ear. The exact etiopathogenesis of presbycusis is not known, but it is generally accepted that it is the result of series of insults, such as physiologic age-related degeneration, noise exposure, medical disorders and their treatment, as well as hereditary susceptibility. The effect of aging shows a wide interindividual range; we aimed to investigate whether profiles of NAT2 genotypes may be associated with the risk of presbycusis. Hospital-based, case-control study. We examined 68 adults with presbycusis and 98 healthy controls. DNA was extracted from whole blood, and the polymorphisms of NAT2*5A, NAT2*6A, NAT2*7A/B, and NAT2*14A were determined using a real-time polymerase chain reaction and fluorescence resonance energy transfer with a Light-Cycler Instrument. Associations between specific genotypes and the development of presbycusis were examined by use of logistic regression analyses to calculate odds ratios and 95% confidence intervals. Gene polymorphisms at NAT2*5A, NAT2*7A/B, and NAT2*14A in subjects with presbycusis were not significantly different from in the controls (P > .05). However, in NAT2*6A, the risk of presbycusis was 15.2-fold more in individuals with mutant allele than subjects with wild genotype (P = .013). Individuals with NAT2*6A heterozygote allele had a 0.34-fold less risk in the development of presbycusis than subjects with mutant allele (P = .032) We demonstrated a significant association between the NAT2*6A polymorphism and age-related hearing loss in this population. However, the sample size was relatively small, and further studies need to investigate the exact role of NAT2 gene polymorphism in the etiopathogenesis of the presbycusis.

  2. Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

    International Nuclear Information System (INIS)

    Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW

    2006-01-01

    Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity

  3. Allelic polymorphism of Makoei sheep leptin gene identified by ...

    African Journals Online (AJOL)

    use

    2011-12-05

    Dec 5, 2011 ... Lord et al., 1998) have shed light on the influence of leptin on both the .... A weak correlation between leptin serum levels and cow body condition ... Detection of polymorphisms in the ovine leptin (LEP) gene: .... Signals that.

  4. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

    Science.gov (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

    2011-10-01

    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  5. Association between CD14 gene polymorphisms and cancer risk: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available BACKGROUND: Two polymorphisms, -260C/T and -651C/T, in the CD14 gene have been implicated in susceptibility to cancer. However, the results remain inconclusive. This meta-analysis aimed to investigate the association between the two polymorphisms and risk of cancer. METHODS: All eligible case-control studies published up to March 2014 were identified by searching PubMed, Web of Science, CNKI and WanFang database. Pooled odds ratio (OR with 95% confidence interval (CI were used to access the strength of this association in fixed- or random-effects model. RESULTS: 17 case-control studies from fourteen articles were included. Of those, there were 17 studies (4198 cases and 4194 controls for -260C/T polymorphism and three studies (832 cases and 1190 controls for -651C/T polymorphism. Overall, no significant associations between the two polymorphisms of CD14 gene and cancer risk were found. When stratified by ethnicity, cancer type and source of control, similar results were observed among them. In addition, in further subgroups analysis by Helicobacter pylori (H. pylori infection status and tumor location in gastric cancer subgroup, we found that the CD14 -260C/T polymorphism may increase the risk of gastric cancer in H. pylori-infected individuals. CONCLUSIONS: This meta-analysis suggests that the CD14 -260C/T polymorphism may increase the risk of gastric cancer in H. pylori-infected individuals. However, large and well-designed studies are warranted to validate our findings.

  6. Fetuin-A and vitamin D receptor gene polymorphisms in hemodialysis patients

    Directory of Open Access Journals (Sweden)

    Shahnam Valizadeh-Shahbazloo

    2014-08-01

    Full Text Available Introduction: Vascular calcification is a common complication in the chronic kidney disease (CKD patients and the leading cause of morbidity and mortality in this patient. The aim of the present study was to evaluate a possible correlation between vitamin D receptor (VDR gene FokI and ApaI polymorphisms with the expression of calcification biomarkers such as Fetuin-A and intact parathyroid hormone (iPTH in hemodialysis (HD patients. Methods: In this cross-sectional study, serums were obtained from 46 stable chronic HD patients. The serum levels of iPTH, Fetuin-A, vitamin D, calcium, phosphorus, and VDR genotyping were determined by standard methods. Results: Serum levels of Fetuin-A, calcium, and phosphorus did not differ between males and females, but significant differences in iPTH and vitamin D levels was found in the study patients [(336.8 ± 139.0 pg/dl vs. (414.7 ± 111.8 pg/dl, P = 0.040 and (24.5 ± 7.6 ng/ml vs. (19.9 ± 4.8 ng/ml, P = 0.020 respectively]. A significant correlations were found between serum phosphorus and levels of serum calcium (r = –0.4; P = 0.002, vitamin D (r = –0.5; P = 0.001 and iPTH (r = 0.4; P = 0.001. iPTH level in FokI polymorphism, were different between genotype groups in study patient (P = 0.020. There was a significant positive correlation between vitamin D and iPTH levels in patients with aa genotype (P = 0.020, r = 0.4. Conclusion: These findings suggest that FokI (rs2228570 polymorphism in exon-2 of the VDR gene may play a role in iPTH levels. Fetuin-A deficiency or high level of iPTH and its association with VDR gene polymorphisms may be useful to identify the high-risk group susceptible to renal failure and atherosclerosis. Although VDR gene FokI and ApaI polymorphisms could affect the levels of Fetuin-A and vitamin D, their direct role on atherosclerosis needs further studies in the future.

  7. An Angiopoietin-2 gene polymorphism in unexplained intrauterine fetal death: a multi-center study.

    Science.gov (United States)

    Huber, Ambros; Grimm, Christoph; Pietrowski, Detlef; Zeillinger, Robert; Bettendorf, Hertha; Husslein, Peter; Hefler, Lukas

    2005-02-01

    Angiopoietin-2 (Ang-2) is a potent regulator of angiogenesis and vascular tone. As vascular processes have been proposed to be involved in the pathogenesis of pregnancy associated complications such as late unexplained intrauterine fetal death (IUFD), we determined whether a common G/A polymorphism of the Ang-2 gene (ANGPT2) is associated with this condition. In a multicenter case-control study, we evaluated the common G/A polymorphism within exon 4 of the ANGPT2 gene using PCR in 90 women with IUFD and 90 healthy women with at least one uncomplicated full term pregnancy and no history of IUFD. Genotype (p=0.2; OR=1.4 [0.8-2.6]) and allele frequencies (p=0.1; OR=1.4 [0.9-2.1]) of the ANGPT2 polymorphism did not differ between women with IUFD and healthy women. A multivariate regression analysis with smoking habits and preexisting diabetes as covariates did not change the results. We are the first to report on a common polymorphism of the ANGPT2 gene in patients with late IUFD. The investigated ANGPT2 poylmorphism does not seem to be a candidate gene for IUFD in Caucasian women.

  8. Relationship of Serum Klotho Level With ACE Gene Polymorphism in Stable Kidney Allograft Recipients.

    Science.gov (United States)

    Zaare Nahandi, Maryam; Ardalan, Mohamad Reza; Banagozar Mohamadi, Ali; Ghorbani Haghjo, Amir; Jabbarpor Bonyadi, Morteza; Mohamadian, Tahere

    2017-03-01

    The kidney is the main source of serum Klotho production. Immunosuppressive agents could affect the kidney in this regard. The effect of the ACE gene polymorphism on Klotho production is a less studied area. This study aimed to assess serum Klotho and ACE gene in a group of stable kidney transplant recipients. In a cross-sectional study, 30 kidney transplant recipients with stable allograft function and 27 healthy young individuals were assessed for their serum Klotho levels. The ACE gene polymorphisms were studied in both groups. Klotho level was higher in kidney transplant recipients than the controls, but the difference was not significant (2.76 ± 2.41 ng/mL versus 2.01 ± 1.41 ng/mL, respectively). In both groups, serum Klotho level was higher in those with the I>I polymorphism, the men, those with higher glomerular filtration rate, and younger individuals, but the differences did not reach a significant level. Higher body mass index was significantly associated with lower serum Klotho level in both groups. Klotho level after kidney transplantation meets the range in healthy individuals, and it is not affected by the ACE gene polymorphism.

  9. Assessment of the relationship between ACE I/D gene polymorphism and renal allograft survival.

    Science.gov (United States)

    Yang, Chun-Hua; Lu, Yi; Chen, Xue-Xia; Xian, Wen-Feng; Tu, Wei-Feng; Li, Hong-Yan

    2015-12-01

    The relationship between the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and renal allograft survival after renal transplantation from the published reports are still debatable. This study was performed to evaluate the relationship between the ACE I/D gene polymorphism and renal allograft survival after renal transplantation using meta-analysis. Eligible studies were identified from PubMed and Cochrane Library on 1 November 2014, and eligible studies were recruited and synthesized using a meta-analysis methodology. Twelve investigations were included in this meta-analysis for the assessment of the relationship between the ACE I/D gene polymorphism and renal allograft survival. In this meta-analysis, the ACE I/D gene polymorphism was not associated with renal allograft survival after renal transplantation for overall populations, Caucasians, Brazilians and Africans. Interestingly, the ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. However, more studies should be performed to confirm this association. © The Author(s) 2015.

  10. E-selectin gene polymorphisms and essential hypertension in Asian population: an updated meta-analysis.

    Directory of Open Access Journals (Sweden)

    Gaojun Cai

    Full Text Available Epidemiological studies have shown that E-selectin gene polymorphisms (A561C and C1839T may be associated with essential hypertension (EH, but the results are conflicting in different ethnic populations. Thus, we performed this meta-analysis to investigate a more authentic association between E-selectin gene polymorphisms and the risk of EH.We searched the relevant studies for the present meta-analysis from the following electronic databases: PubMed, Embase, Cochrane Library, Google Scholar, Web of Science, Wanfang Data, and China National Knowledge Infrastructure (CNKI. Odds ratios (OR with 95% confidence interval (CI were used to evaluate the strength of the association between E-selectin gene polymorphisms and EH susceptibility. The pooled ORs were performed for dominant model, allelic model and recessive model. The publication bias was examined by Begg's funnel plots and Egger's test.A total of eleven studies met the inclusion criteria. All studies came from Asians. Ten studies (12 cohorts evaluated the A561C polymorphism and EH risk, including 2,813 cases and 2,817 controls. The pooled OR was 2.280 (95%CI: 1.893-2.748, P<0.001 in dominant model, 5.284 (95%CI: 2.679-10.420, P<0.001 in recessive model and 2.359 (95%CI: 1.981-2.808, P = 0.001 in allelic model. Four studies (six cohorts evaluated C1839T polymorphism and EH risk, including 1,700 cases and 1,681 controls. The pooled OR was 0.785 (95%CI: 0.627-0.983, P = 0.035 in dominant model, 1.250 (95%CI: 0.336-4.652, P = 0.739 in recessive model and 0.805 (95%CI: 0.649-0.999, P = 0.049 in allelic model.The current meta-analysis concludes that the C allele of E-selectin A561C gene polymorphism might increase the EH risk in Asian population, whereas the T allele of E-selectin C1839T gene polymorphism might decrease the EH risk.

  11. Role of tumour necrosis factor gene polymorphisms (-308 and -238) in breast cancer susceptibility and severity

    International Nuclear Information System (INIS)

    Azmy, Iman AF; Balasubramanian, Saba P; Wilson, Anthony G; Stephenson, Timothy J; Cox, Angela; Brown, Nicola J; Reed, Malcolm WR

    2004-01-01

    Genetic polymorphisms in the promoter region of the tumour necrosis factor (TNF) gene can regulate gene expression and have been associated with inflammatory and malignant conditions. We have investigated two polymorphisms in the promoter of the TNF gene (-308 G>A and -238 G>A) for their role in breast cancer susceptibility and severity by means of an allelic association study. Using a case–control study design, breast cancer patients (n = 709) and appropriate age-matched and sex-matched controls obtained from the Breast Screening Unit (n = 498) were genotyped for these TNF polymorphisms, using a high-throughput allelic discrimination method. Allele frequencies for both polymorphisms were similar in both breast cancer cases and controls. However, the -308 polymorphism was found to be associated with vascular invasion in breast tumours (P = 0.024). Comparison with other standard prognostic indices did not show any association for either genotype. We demonstrated no association between the -308G>A polymorphism and the -238G>A polymorphism in the promoter region of TNF and susceptibility to breast cancer, in a large North European population. However, the -308 G>A polymorphism was found to be associated with the presence of vascular invasion in breast tumours

  12. Oxytocin and Vasopressin Receptor Gene Polymorphisms: Role in Social and Psychiatric Traits

    Science.gov (United States)

    Aspé-Sánchez, Mauricio; Moreno, Macarena; Rivera, Maria Ignacia; Rossi, Alejandra; Ewer, John

    2016-01-01

    Oxytocin (OXT) and arginine-vasopressin (AVP) are two phylogenetically conserved neuropeptides that have been implicated in a wide range of social behaviors. Although a large body of research, ranging from rodents to humans, has reported on the effects of OXT and AVP administration on affiliative and trust behaviors, and has highlighted the genetic contributions of OXT and AVP receptor polymorphisms to both social behaviors and to diseases related to social deficits, the consequences of peptide administration on psychiatric symptoms, and the impact of receptor polymorphisms on receptor function, are still unclear. Despite the exciting advances that these reports have brought to social neuroscience, they remain preliminary and suffer from the problems that are inherent to monogenetic linkage and association studies. As an alternative, some studies are using polygenic approaches, and consider the contributions of other genes and pathways, including those involving DA, 5-HT, and reelin, in addition to OXT and AVP; a handful of report are also using genome-wide association studies. This review summarizes findings on the associations between OXT and AVP receptor polymorphism, social behavior, and psychiatric diseases. In addition, we discuss reports on the interactions of OXT and AVP receptor genes and genes involved in other pathways (such as those of dopamine, serotonin, and reelin), as well as research that has shed some light on the impact of gene polymorphisms on the volume, connectivity, and activation of specific neural structures, differential receptor expression, and plasma levels of the OXT and AVP peptides. We hope that this effort will be helpful for understanding the studies performed so far, and for encouraging the inclusion of other candidate genes not explored to date. PMID:26858594

  13. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  14. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

    2007-01-01

    from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  15. Analysis of polymorphisms in candidate’s genes for meat quality in Lidia cattle

    Energy Technology Data Exchange (ETDEWEB)

    Pelayo, P.; Valera, M.; Molina, A.; Avilés, C.B.

    2016-07-01

    The aim of this paper was to analyze the segregation of some polymorphisms in three genes (CAPN1, CAST and DGAT1) related to meat quality in the Lidia cattle breed and some of its main lineages. To that effect, 119 individuals from the Lidia breed were analyzed. Although the association between the polymorphisms and the phenotype has never been demonstrated in this breed, the absence of fixed genotypes for these polymorphisms in the studied population makes the Lidia cattle a good candidate to develop selection objectives. The clear differentiation among lineages for most of the genes studied reinforces the high reproductive isolation presented in the Lidia cattle as revealed by previous studies on the structure of the population within the Lidia breed using microsatellite markers. Considering both issues in the design of breeding schemes will be necessary to save the lineages and not to lose this valuable genetic resource. Finally, it would be necessary to carry out an in depth search for new polymorphisms in genes associated with meat quality and to perform needed association analyses between the SNPs segregating in Lidia cattle and traits of economic interest.

  16. Analysis of polymorphisms in candidate’s genes for meat quality in Lidia cattle

    International Nuclear Information System (INIS)

    Pelayo, P.; Valera, M.; Molina, A.; Avilés, C.B.

    2016-01-01

    The aim of this paper was to analyze the segregation of some polymorphisms in three genes (CAPN1, CAST and DGAT1) related to meat quality in the Lidia cattle breed and some of its main lineages. To that effect, 119 individuals from the Lidia breed were analyzed. Although the association between the polymorphisms and the phenotype has never been demonstrated in this breed, the absence of fixed genotypes for these polymorphisms in the studied population makes the Lidia cattle a good candidate to develop selection objectives. The clear differentiation among lineages for most of the genes studied reinforces the high reproductive isolation presented in the Lidia cattle as revealed by previous studies on the structure of the population within the Lidia breed using microsatellite markers. Considering both issues in the design of breeding schemes will be necessary to save the lineages and not to lose this valuable genetic resource. Finally, it would be necessary to carry out an in depth search for new polymorphisms in genes associated with meat quality and to perform needed association analyses between the SNPs segregating in Lidia cattle and traits of economic interest.

  17. Interleukin-1beta gene polymorphisms in Taiwanese patients with gout.

    Science.gov (United States)

    Chen, Man-Ling; Huang, Chung-Ming; Tsai, Chang-Hai; Tsai, Fuu-Jen

    2005-04-01

    The purpose of this study was to examine whether interleukin-1 beta (IL-1beta) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1beta promoter and IL-1beta exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1beta promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1beta promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, chi(2)=12.52, OR 7.14, 95%CI 0.012-0.22). There was also a significant difference in the genotype of IL-1beta exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1beta promoter and IL-1beta exon 5 are not related to gout patients in central Taiwan.

  18. Serum Homocysteine, Vitamin B12, Folic Acid Levels and Methylenetetrahydrofolate Reductase (MTHFR) Gene Polymorphism in Vitiligo

    Science.gov (United States)

    Yasar, Ali; Gunduz, Kamer; Onur, Ece; Calkan, Mehmet

    2012-01-01

    The aim of this study was to determine serum vitamin B12, folic acid and homocysteine (Hcy) levels as well as MTHFR (C677, A1298C) gene polymorphisms in patients with vitiligo, and to compare the results with healthy controls. Forty patients with vitiligo and 40 age and sex matched healthy subjects were studied. Serum vitamin B12 and folate levels were determined by enzyme-linked immunosorbent assay. Plasma Hcy levels and MTHFR polymorphisms were determined by chemiluminescence and real time PCR methods, respectively. Mean serum vitamin B12 and Hcy levels were not significantly different while folic acid levels were significantly lower in the control group. There was no significant relationship between disease activity and vitamin B12, folic acid and homocystein levels. No significant difference in C677T gene polymorphism was detected. Heterozygote A1298C gene polymorphism in the patient group was statistically higher than the control group. There was no significant relationship between MTHFR gene polymorphisms and vitamin B12, folic acid and homocysteine levels. In conclusion, vitamin B12, folate and Hcy levels are not altered in vitiligo and MTHFR gene mutations (C677T and A1298C) do not seem to create susceptibility for vitiligo. PMID:22846211

  19. Serum Homocysteine, Vitamin B12, Folic Acid Levels and Methylenetetrahydrofolate Reductase (MTHFR Gene Polymorphism in Vitiligo

    Directory of Open Access Journals (Sweden)

    Ali Yasar

    2012-01-01

    Full Text Available The aim of this study was to determine serum vitamin B12, folic acid and homocysteine (Hcy levels as well as MTHFR (C677, A1298C gene polymorphisms in patients with vitiligo, and to compare the results with healthy controls. Forty patients with vitiligo and 40 age and sex matched healthy subjects were studied. Serum vitamin B12 and folate levels were determined by enzyme-linked immunosorbent assay. Plasma Hcy levels and MTHFR polymorphisms were determined by chemiluminescence and real time PCR methods, respectively. Mean serum vitamin B12 and Hcy levels were not significantly different while folic acid levels were significantly lower in the control group. There was no significant relationship between disease activity and vitamin B12, folic acid and homocystein levels. No significant difference in C677T gene polymorphism was detected. Heterozygote A1298C gene polymorphism in the patient group was statistically higher than the control group. There was no significant relationship between MTHFR gene polymorphisms and vitamin B12, folic acid and homocysteine levels. In conclusion, vitamin B12, folate and Hcy levels are not altered in vitiligo and MTHFR gene mutations (C677T and A1298C do not seem to create susceptibility for vitiligo.

  20. Angiotensin II type 1 receptor (A1166C gene polymorphism and essential hypertension in Egyptian population

    Directory of Open Access Journals (Sweden)

    Marium M. Shamaa

    2016-09-01

    Full Text Available The pathogenesis of essential hypertension (EH is affected by genetic and environmental factors. Mutations in hypertension-related genes can affect blood pressure (BP via alteration of salt and water reabsorption by the nephron. The genes of the renin-angiotensin system (RAS have been extensively studied because of the well documented role of this system in the control of BP. It has been previously shown that Angiotensin II type 1 receptor (ATR1 gene polymorphism could be associated with increased risk of EH. So, in the current study, we evaluated the frequency of ATR1 (A1166C polymorphism in relation to EH in a group of Egyptian population. The study population included 83 hypertensive patients and 60 age and sex matched healthy control subjects. Restriction fragment length polymorphism – Polymerase chain reaction (RFLP – PCR was used for the analysis of A1166C polymorphism of ATR1 genes in peripheral blood samples of all patients and controls. The results revealed that there was a positive risk of developing EH when having the T allele whether in homozygous or heterozygous state. From this work, it was concluded that there was an association between ATR1 (A1166C gene polymorphism and the risk of developing EH.

  1. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  2. Vitamin D Receptor Gene Polymorphisms Influence T1D Susceptibility among Pakistanis

    Directory of Open Access Journals (Sweden)

    Maryam Mukhtar

    2017-01-01

    Full Text Available Background. The vitamin D receptor (VDR gene regulates insulin secretion from the pancreas and acts as a mediator of the immune response through vitamin D. Polymorphism in VDR causes alterations in the functioning of vitamin D, leading to type 1 diabetes (T1D predisposition. The aim of the present study was to determine VDR gene polymorphism in association with T1D in Pakistanis. Methods. The association was evaluated by selecting rs2228570 (FokΙ, rs7975232 (ApaΙ, and rs731236 (TaqΙ polymorphic sites in 102 patients and 100 controls. Genotypes were identified by DNA sequencing and PCR-RFLP. Results. The allelic and genotypic frequencies of FokΙ and ApaI were significantly associated with T1D (p0.05. CCGC, CCGG, CCTC, and CCTG haplotypes were significantly associated with disease development (p<0.05. However, CTGG haplotype was protective towards T1D (p<0.01. Conclusion. VDR polymorphisms were identified as susceptible regions for T1D development in the Pakistani population.

  3. Leptin promoter gene polymorphism on -2549 position decreases plasma leptin and increases appetite in normal weight volunteers

    Directory of Open Access Journals (Sweden)

    Sandra Bragança Coelho

    2014-05-01

    Full Text Available Introduction: Investigate whether polymorphism in the promoter region encoding leptin and leptin receptor gene, in normal weight individuals, affects hormonal and appetite responses to peanuts.Materials and methods: Appetite, anthropometric indices, body composition, physical activity, dietary intake and leptin, ghrelin and insulin levels were monitored. Polymorphism analyses were also carried out.Results: None of the treatments led to statistical differences in the analyzed hormones. No polymorphism was found for leptin receptor gene, while for leptin gene, 50% of the volunteers presented one polymorphic allele and 13% presented both polymorphic alleles. These last ones presented lower body fat mass, leptin and ghrelin plasma concentrations, and fullness rates. They also presented higher hunger, desire to eat, and desire to eat sweet and salty foods.Conclusions: Peanut did not affect appetite and presented no different hormonal responses, compared to other foods studied. Polymorphic allele carriers in both alleles presented higher probability to develop obesity. However, the magnitude of this probability could not be measured.

  4. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  5. Screening strategies for a highly polymorphic gene: DHPLC analysis of the Fanconi anemia group A gene.

    Science.gov (United States)

    Rischewski, J; Schneppenheim, R

    2001-01-30

    Patients with Fanconi anemia (Fanc) are at risk of developing leukemia. Mutations of the group A gene (FancA) are most common. A multitude of polymorphisms and mutations within the 43 exons of the gene are described. To examine the role of heterozygosity as a risk factor for malignancies, a partially automatized screening method to identify aberrations was needed. We report on our experience with DHPLC (WAVE (Transgenomic)). PCR amplification of all 43 exons from one individual was performed on one microtiter plate on a gradient thermocycler. DHPLC analysis conditions were established via melting curves, prediction software, and test runs with aberrant samples. PCR products were analyzed twice: native, and after adding a WT-PCR product. Retention patterns were compared with previously identified polymorphic PCR products or mutants. We have defined the mutation screening conditions for all 43 exons of FancA using DHPLC. So far, 40 different sequence variations have been detected in more than 100 individuals. The native analysis identifies heterozygous individuals, and the second run detects homozygous aberrations. Retention patterns are specific for the underlying sequence aberration, thus reducing sequencing demand and costs. DHPLC is a valuable tool for reproducible recognition of known sequence aberrations and screening for unknown mutations in the highly polymorphic FancA gene.

  6. DNA characterization and polymorphism of KISS1 gene in Egyptian ...

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-29

    Jul 29, 2015 ... effect on litter size performance and many studies were carried out to identify ... gene (Wang et al., 2011), kit ligand (KITLG) gene (An et al., 2012) and bone ..... An XP, Han P, HouJX, Zhao HB, Yan Y, Ma T, Fang F, MengFX, Song. YX, Wang JG ... Chu MX, Zhao XH, Zhang YJ, Jin M (2010). Polymorphisms ...

  7. Angiotensin-I converting enzyme gene and I/D polymorphism ...

    Indian Academy of Sciences (India)

    Angiotensin-I converting enzyme gene and I/D polymorphism distribution in the Greek population and a comparison with other European populations. Sekerli Eleni Katsanidis Dimitrios Papadopoulou Vaya Makedou Areti Vavatsi Norma Gatzola Magdalini. Research Note Volume 87 Issue 1 April 2008 pp 91-93 ...

  8. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

  9. [Relationship between interleukin-17A gene polymorphisms and the susceptibility to childhood asthma].

    Science.gov (United States)

    Zhong, Fang-Fang; Zou, Yan; Liu, Chun-Yan; Liu, Wen-Jun

    2016-12-01

    To explore the relationship between polymorphisms of interleukin-17A (IL-17A) gene promoter (-197G/A and -692C/T) and the susceptibility to childhood asthma, to further identify the candidate genes for asthma, and to provide a basis for early prevention of asthma in high-risk children. Sixty-five outpatients or inpatients with childhood asthma between August 2013 and August 2015 were assigned to asthma group. Seventy healthy children within the same period were assigned to control group. Using peripheral venous blood from the two groups, PCR with sequence-specific primers was carried out to determine single nucleotide polymorphisms at positions -197G/A and -692C/T in IL-17A gene promoter. A statistical analysis was used to evaluate differences in genotype and allele frequencies between the two groups. Compared with the control group, the asthma group had significantly higher frequencies of TT genotype (29% vs 16%; P=0.012) and T allele (52% vs 42%; P=0.039) at position -692C/T of IL-17A gene. Children with T allele had 1.413-fold higher risk of childhood asthma than those with C allele (OR=1.413, 95%CI: 1.015-1.917). There were no significant differences in genotype and allele frequencies at position -197G/A in IL-17A gene between the two groups (p>0.05). Polymorphisms at position -692C/T in IL-17A gene promoter is associated with the susceptibility to childhood asthma. Children with -692T allele are more susceptible to childhood asthma. There is no significant relationship between polymorphisms at position -197G/A in IL-17A gene promoter and the susceptibility to childhood asthma.

  10. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

    Science.gov (United States)

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

    2016-11-18

    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. No association between polymorphisms in the DDC gene and paranoid schizophrenia in a northern Chinese population.

    Science.gov (United States)

    Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan

    2004-09-01

    Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.

  12. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  13. Candidate gene analysis using imputed genotypes: cell cycle single-nucleotide polymorphisms and ovarian cancer risk

    DEFF Research Database (Denmark)

    Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A

    2009-01-01

    Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....

  14. Genotyping of PPAR-γ gene polymorphism in Egyptian neonates affected with sepsis disease and its severity

    Directory of Open Access Journals (Sweden)

    Rabah M. Shawky

    2018-07-01

    Full Text Available Background: Peroxisome Proliferator-Activated Receptor gamma (PPARγ is a ligand-dependent transcription factor involved in inflammatory process. PPAR-γ gene was mentioned as having a modulating role in the pathological status of sepsis.The present study aimed to make a correlation between The Pro12Ala polymorphism in PPAR-γ gene and occurrence of neonatal sepsis and its severity among a sample of Egyptian neonates suffering sepsis. Subjects and methods: This case-control study included 30 neonates (11 females and19 males newly admitted with neonatal sepsis at the intensive care unit (NICU (mean age 10.3 days ± 6.23. The control group included 50 age and sex matched neonates (23 females and 27 males (mean age 10.20 days ± 5.36 days. All the neonates (preterm and full term included were with clinical signs and laboratory data consistent with neonatal sepsis. Genotyping for PPARγ gene region harboring the Pro12Ala variant locus were carried out using Tetra ARMS technique. Results: About 56.7% of the patients group was homozygote (GG for polymorphic locus (coding for Alanine/Alanine while 30% was heterozygote for polymorphic locus (CG (coding for Proline/Alanine and up to 13.3% was homozygote for the polymorphic locus (CC (coding for Proline/Proline. Compared to the control group where homozygotes for CC were the most prevalent (90% and the CG were 10% with absence of GG genotypes. There was a strong statistical significant difference between patients and the normal control group as regards prevalence of PPAR-γ gene polymorphism in occurrence of neonatal sepsis and its severity. Also, there were strong relation between genotype GG and low birth weight, neonatal fever, prematurity and depressed neonatal reflexes. Conclusion: PPAR-γ gene has been suggested to be a candidate gene for neonatal sepsis. Therefore, Pro12Ala polymorphism might be useful in predicting the risk factor of neonatal sepsis and its severity. Keywords: Sepsis, PPAR

  15. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

    OpenAIRE

    Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

    2012-01-01

    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

  16. [The value of 5-HTT gene polymorphism for the assessment and prediction of male adolescence violence].

    Science.gov (United States)

    Yu, Yue; Liu, Xiang; Yang, Zhen-xing; Qiu, Chang-jian; Ma, Xiao-hong

    2012-08-01

    To establish an adolescent violence crime prediction model, and to assess the value of serotonin transporter (5-HTT) gene polymorphism for the assessment and prediction of violent crime. Investigative tools were used to analyze the difference in personality dimensions, social support, coping styles, aggressiveness, impulsivity, and family condition scale between 223 adolescents with violence behavior and 148 adolescents without violence behavior. The distribution of 5-HTT gene polymorphisms (5-HTTLPR and 5-HTTVNTR) was compared between the two groups. The role of 5-HTT gene polymorphism on adolescent personality, impulsion and aggression scale also was also analyzed. Stepwise logistic regression was used to establish a predictive model for adolescent violent crime. Significant difference was found between the violence group and the control group on multiple dimensions of psychology and environment scales. However, no statistical difference was found with regard to the 5-HTT genotypes and alleles between adolescents with violent behaviors and normal controls. The rate of prediction accuracy was not significantly improved when 5-HTT gene polymorphism was taken into the model. The violent crime of adolescents was closely related with social and environmental factors. No association was found between 5-HTT polymorphisms and adolescent violence criminal behavior.

  17. Association of 308G/A TNF-α gene polymorphism and spontaneous ...

    African Journals Online (AJOL)

    Background: Single nucleotide polymorphism (SNP) within tumor necrosis factor alpha (TNF-α) gene promoter (308G/A TNFA) is associated with higher gene expression. The role of this SNP as a risk factor for spontaneous preterm birth has been assessed in some regions and the findings were significantly different ...

  18. ATF5 polymorphisms influence ATF function and response to treatment in children with childhood acute lymphoblastic leukemia

    OpenAIRE

    Rousseau, Julie; Gagné, Vincent; Labuda, Malgorzata; Beaubois, Cyrielle; Sinnett, Daniel; Laverdière, Caroline; Moghrabi, Albert; Sallan, Stephen E.; Silverman, Lewis B.; Neuberg, Donna; Kutok, Jeffery L.; Krajinovic, Maja

    2011-01-01

    Asparaginase is a standard and critical component in the therapy of childhood acute lymphoblastic leukemia. Asparagine synthetase (ASNS) and the basic region leucine zipper activating transcription factor 5 (ATF5) and arginosuccinate synthase 1 (ASS1) have been shown to mediate the antileukemic effect of asparaginase and to display variable expression between leukemia cells that are resistant and sensitive to treatment. Fourteen polymorphisms in the regulatory and coding regions of these gene...

  19. A gene-gene interaction between polymorphisms in the OCT2 and MATE1 genes influences the renal clearance of metformin

    DEFF Research Database (Denmark)

    Hougaard Christensen, Mette Marie; Pedersen, Rasmus Steen; Stage, Tore Bjerregaard

    2013-01-01

    The aim of this study was to determine the association between the renal clearance (CL(renal)) of metformin in healthy Caucasian volunteers and the single-nucleotide polymorphism (SNP) c.808G>T (rs316019) in OCT2 as well as the relevance of the gene-gene interactions between this SNP and (a) the ...

  20. Do the MTHFR gene polymorphism and Down syndrome pregnancy ...

    African Journals Online (AJOL)

    Background: Down syndrome, the most common trisomy 21 arises from abnormal chromosomal segregation. The etiology includes genetic and acquired factors. The main genetic factor that is well appreciated for onset of Down syndrome pregnancy is MTHFR gene polymorphism. But till date, no final conclusion has arrived ...

  1. Association of duffy blood group gene polymorphisms with IL8 gene in chronic periodontitis.

    Directory of Open Access Journals (Sweden)

    Emília Ângela Sippert

    Full Text Available The antigens of the Duffy blood group system (DARC act as a receptor for the interleukin IL-8. IL-8 plays an important role in the pathogenesis of chronic periodontitis due to its chemotactic properties on neutrophils. The aim of this study was to investigate a possible association of Duffy blood group gene polymorphisms with the -353T>A, -845T>C and -738T>A SNPs of the IL8 gene in chronic periodontitis. One hundred and twenty-four individuals with chronic periodontitis and 187 controls were enrolled. DNA was extracted using the salting-out method. The Duffy genotypes and IL8 gene promoter polymorphisms were investigated by PCR-RFLP. Statistical analyses were conducted using the Chi square test with Yates correction or Fisher's Exact Test, and the possibility of associations were evaluated by odds ratio with a 95% confidence interval. When analyzed separately, for the Duffy blood group system, differences in the genotype and allele frequencies were not observed between all the groups analyzed; and, in nonsmokers, the -845C allele (3.6% vs. 0.4%, -845TC genotype (7.3% vs. 0.7% and the CTA haplotype (3.6% vs. 0.4% were positively associated with chronic periodontitis. For the first time to our knowledge, the polymorphisms of erythroid DARC plus IL8 -353T>A SNPs were associated with chronic periodontitis in Brazilian individuals. In Afro-Brazilians patients, the FY*02N.01 with IL8 -353A SNP was associated with protection to chronic periodontitis.

  2. Association of duffy blood group gene polymorphisms with IL8 gene in chronic periodontitis.

    Science.gov (United States)

    Sippert, Emília Ângela; de Oliveira e Silva, Cléverson; Visentainer, Jeane Eliete Laguila; Sell, Ana Maria

    2013-01-01

    The antigens of the Duffy blood group system (DARC) act as a receptor for the interleukin IL-8. IL-8 plays an important role in the pathogenesis of chronic periodontitis due to its chemotactic properties on neutrophils. The aim of this study was to investigate a possible association of Duffy blood group gene polymorphisms with the -353T>A, -845T>C and -738T>A SNPs of the IL8 gene in chronic periodontitis. One hundred and twenty-four individuals with chronic periodontitis and 187 controls were enrolled. DNA was extracted using the salting-out method. The Duffy genotypes and IL8 gene promoter polymorphisms were investigated by PCR-RFLP. Statistical analyses were conducted using the Chi square test with Yates correction or Fisher's Exact Test, and the possibility of associations were evaluated by odds ratio with a 95% confidence interval. When analyzed separately, for the Duffy blood group system, differences in the genotype and allele frequencies were not observed between all the groups analyzed; and, in nonsmokers, the -845C allele (3.6% vs. 0.4%), -845TC genotype (7.3% vs. 0.7%) and the CTA haplotype (3.6% vs. 0.4%) were positively associated with chronic periodontitis. For the first time to our knowledge, the polymorphisms of erythroid DARC plus IL8 -353T>A SNPs were associated with chronic periodontitis in Brazilian individuals. In Afro-Brazilians patients, the FY*02N.01 with IL8 -353A SNP was associated with protection to chronic periodontitis.

  3. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

    2003-01-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  4. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang

    2010-07-01

    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  5. Canine olfactory receptor gene polymorphism and its relation to odor detection performance by sniffer dogs.

    Science.gov (United States)

    Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz

    2008-01-01

    The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.

  6. Application of Various Statistical Models to Explore Gene-Gene Interactions in Folate, Xenobiotic, Toll-Like Receptor and STAT4 Pathways that Modulate Susceptibility to Systemic Lupus Erythematosus.

    Science.gov (United States)

    Rupasree, Yedluri; Naushad, Shaik Mohammad; Varshaa, Ravi; Mahalakshmi, Govindaraj Swathika; Kumaraswami, Konda; Rajasekhar, Liza; Kutala, Vijay Kumar

    2016-02-01

    In view of our previous studies showing an independent association of genetic polymorphisms in folate, xenobiotic, and toll-like receptor (TLR) pathways with the risk for systemic lupus erythematosus (SLE), we have developed three statistical models to delineate complex gene-gene interactions between folate, xenobiotic, TLR, and signal transducer and activator of transcription 4 (STAT4) signaling pathways in association with the molecular pathophysiology of SLE. We developed additive, multifactor dimensionality reduction (MDR), and artificial neural network (ANN) models. The additive model, although the simplest, suggested a moderate predictability of 30 polymorphisms of these four pathways (area under the curve [AUC] 0.66). MDR analysis revealed significant gene-gene interactions among glutathione-S-transferase (GST)T1 and STAT4 (rs3821236 and rs7574865) polymorphisms, which account for moderate predictability of SLE. The MDR model for specific auto-antibodies revealed the importance of gene-gene interactions among cytochrome P450, family1, subfamily A, polypeptide 1 (CYP1A1) m1, catechol-O-methyltransferase (COMT) H108L, solute carrier family 19 (folate transporter), member 1 (SLC19A1) G80A, estrogen receptor 1 (ESR1), TLR5, 5-methyltetrahydrofolate-homocysteine methyltransferase reductase (MTRR), thymidylate synthase (TYMS). and STAT4 polymorphisms. The ANN model for disease prediction showed reasonably good predictability of SLE risk with 30 polymorphisms (AUC 0.76). These polymorphisms contribute towards the production of SSB and anti-dsDNA antibodies to the extent of 48 and 40%, respectively, while their contribution for the production of antiRNP, SSA, and anti-cardiolipin antibodies varies between 20 and 30%. The current study highlighted the importance of genetic polymorphisms in folate, xenobiotic, TLR, and STAT4 signaling pathways as moderate predictors of SLE risk and delineates the molecular pathophysiology associated with these single nucleotide

  7. Association of HS6ST3 gene polymorphisms with obesity and ...

    Indian Academy of Sciences (India)

    Supplementary data: Association of HS6ST3 gene polymorphisms with obesity and triglycerides: gene × gender interaction. Ke-Sheng Wang, Liang Wang, Xuefeng Liu and Min Zeng. J. Genet. 92, 395–402. Table 1. Associations of 117 SNPs with obesity in the Health ABC and Marshfield samples. Minor. OR Health.

  8. Prolactin-RsaI gene polymorphism in East Anatolian Red cattle in ...

    African Journals Online (AJOL)

    The aim of the study was to determine by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method the gene and genotype frequencies of PRL gene in native East Anatolian Red (EAR) cattle, which are raised as a genetic resource in Turkey. PCR-RFLP analysis involved the use of the ...

  9. Collagen type I alpha 1 gene polymorphism in premature ovarian failure

    Directory of Open Access Journals (Sweden)

    Vujović Svetlana

    2013-01-01

    Full Text Available Introduction. Premature ovarian failure (POF is characterized by amenorrhea, hypergonadotropism and hypoestrogenism in women bellow 40 years. Osteoporosis is one of the late complications of POF. Objective. To correlate collagen type I alpha1 (COLIA1 gene polymorphism with bone mineral density (BMD in women with POF. Methods. We determined the COLIA1 genotypes SS, Ss, ss in 66 women with POF. Single nucleotide polymorphism (G to T substitution within the Sp 1-binding site in the first intron of the COLIA1 gene was assessed by polymerase chain reaction (PCR followed by single-stranded conformation polymorphism (SSCP analysis. Bone mineral density (BMD was measured at the lumbar spine region by dual X-ray absorptiometry. Statistics: Kruskal-Wallis ANOVA, Chisquare test, Spearman correlation test. Results. The relative distribution of COLIA1 genotype alleles was SS - 54.4%, Ss - 41.0% and ss - 4.5%. No significant differences were found between genotype groups in body mass index, age, duration of amenorrhea or BMD. A significant positive correlation was observed between BMI and parity. Conclusion. The COLIA1 gene is just one of many genes influencing bone characteristics. It may act as a marker for differences in bone quantity and quality, bone fragility and accelerated bone loss in older women. However, in young women with POF, COLIA1 cannot identify those at higher risk for osteoporosis. [Projekat Ministarstva nauke Republike Srbije, br. ON 173056

  10. Genetic polymorphisms in the microRNA binding-sites of the thymidylate synthase gene predict risk and survival in gastric cancer.

    Science.gov (United States)

    Shen, Rong; Liu, Hongliang; Wen, Juyi; Liu, Zhensheng; Wang, Li-E; Wang, Qiming; Tan, Dongfeng; Ajani, Jaffer A; Wei, Qingyi

    2015-09-01

    Thymidylate synthase (TYMS) plays a crucial role in folate metabolism as well as DNA synthesis and repair. We hypothesized that functional polymorphisms in the 3' UTR of TYMS are associated with gastric cancer risk and survival. In the present study, we tested our hypothesis by genotyping three potentially functional (at miRNA binding sites) TYMS SNPs (rs16430 6bp del/ins, rs2790 A>G and rs1059394 C>T) in 379 gastric cancer patients and 431 cancer-free controls. Compared with the rs16430 6bp/6bp + 6bp/0bp genotypes, the 0bp/0bp genotype was associated with significantly increased gastric cancer risk (adjusted OR = 1.72, 95% CI = 1.15-2.58). Similarly, rs2790 GG and rs1059394 TT genotypes were also associated with significantly increased risk (adjusted OR = 2.52, 95% CI = 1.25-5.10 and adjusted OR = 1.57, 95% CI = 1.04-2.35, respectively), compared with AA + AG and CC + CT genotypes, respectively. In the haplotype analysis, the T-G-0bp haplotype was associated with significantly increased gastric cancer risk, compared with the C-A-6bp haplotype (adjusted OR = 1.34, 95% CI = 1.05-1.72). Survival analysis revealed that rs16430 0bp/0bp and rs1059394 TT genotypes were also associated with poor survival in gastric cancer patients who received chemotherapy treatment (adjusted HR = 1.61, 95% CI = 1.05-2.48 and adjusted HR = 1.59, 95% CI = 1.02-2.48, respectively). These results suggest that these three variants in the miRNA binding sites of TYMS may be associated with cancer risk and survival of gastric cancer patients. Larger population studies are warranted to verify these findings. © 2014 Wiley Periodicals, Inc.

  11. Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

    Directory of Open Access Journals (Sweden)

    Yasuhito Ohsaka

    2010-01-01

    Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

  12. Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma.

    Science.gov (United States)

    Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef

    2005-07-01

    To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

  13. Relationship between ADD1 Gly460Trp gene polymorphism and essential hypertension in Madeira Island.

    Science.gov (United States)

    Sousa, Ana Célia; Palma Dos Reis, Roberto; Pereira, Andreia; Borges, Sofia; Freitas, Ana Isabel; Guerra, Graça; Góis, Teresa; Rodrigues, Mariana; Henriques, Eva; Freitas, Sónia; Ornelas, Ilídio; Pereira, Décio; Brehm, António; Mendonça, Maria Isabel

    2017-10-01

    Essential hypertension (EH) is a complex disease in which physiological, environmental, and genetic factors are involved in its genesis. The genetic variant of the alpha-adducin gene (ADD1) has been described as a risk factor for EH, but with controversial results.The objective of this study was to evaluate the association of ADD1 (Gly460Trp) gene polymorphism with the EH risk in a population from Madeira Island.A case-control study with 1614 individuals of Caucasian origin was performed, including 817 individuals with EH and 797 controls. Cases and controls were matched for sex and age, by frequency-matching method. All participants collected blood for biochemical and genotypic analysis for the Gly460Trp polymorphism. We further investigated which variables were independently associated to EH, and, consequently, analyzed their interactions.In our study, we found a significant association between the ADD1 gene polymorphism and EH (odds ratio 2.484, P = .01). This association remained statistically significant after the multivariate analysis (odds ratio 2.548, P = .02).The ADD1 Gly460Trp gene polymorphism is significantly and independently associated with EH risk in our population. The knowledge of genetic polymorphisms associated with EH is of paramount importance because it leads to a better understanding of the etiology and pathophysiology of this pathology.

  14. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

    Science.gov (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

    2013-03-01

    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  15. Association between vitamin D receptor gene polymorphism (TaqI)

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...

  16. Association between vitamin D receptor gene polymorphism (TaqI ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...

  17. Polymorphisms of the lipoprotein lipase gene as genetic markers for stroke in colombian population: a case control study.

    Science.gov (United States)

    Velásquez Pereira, Leydi Carolina; Vargas Castellanos, Clara Inés; Silva Sieger, Federico Arturo

    2016-12-30

    To analyze if there is an association between the presence of polymorphisms in the LPL gene (rs320, rs285 and rs328) with development of acute ischemic stroke in Colombian population. In a case control design, 133 acute ischemic stroke patients (clinical diagnosis and x-ray CT) and 269 subjects without stroke as controls were studied. PCR -RFLP technique was used to detect rs320, rs285 and rs328 polymorphisms in the LPL gene. In the present research was not found any association between any of the LPL gene polymorphism and acute ischemic stroke in the population studied; the allele and genotypic frequencies of the studied polymorphisms were similar in cases and controls and followed the Hardy-Weinberg equilibrium. The study was approved by the IRB and each subject signed the informed consent. LPL gene polymorphisms are not genetic markers for the development of stroke in the Colombian sample used.

  18. Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

    Science.gov (United States)

    Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

    2018-04-01

    Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

  19. Novel SNPs polymorphism of bovine CACNA2D1 gene and their ...

    African Journals Online (AJOL)

    In this study, the bovine CACNA2D1 gene was taken as a candidate gene for mastitis resistance. The objective of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine CACNA2D1 gene and evaluate the association of these SNPs with mastitis in cattle. Through DNA sequencing and PCR-RFLP ...

  20. Association of HS6ST3 gene polymorphisms with obesity and ...

    Indian Academy of Sciences (India)

    The heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene is involved in heparan sulphate and heparin metabolism, and has been reported to be associated with diabetic retinopathy in type 2 diabetes. We hypothesized that HS6ST3 gene polymorphisms might play an important role in obesity and related phenotypes (such ...

  1. Size Polymorphism in Alleles of the Myoglobin Gene from Biomphalaria Mollusks

    Directory of Open Access Journals (Sweden)

    Marcelo M. Santoro

    2010-10-01

    Full Text Available Introns are common among all eukaryotes, while only a limited number of introns are found in prokaryotes. Globin and globin-like proteins are widely distributed in nature, being found even in prokaryotes and a wide range of patterns of intron-exon have been reported in several eukaryotic globin genes. Globin genes in invertebrates show considerable variation in the positions of introns; globins can be found without introns, with only one intron or with three introns in different positions. In this work we analyzed the introns in the myoglobin gene from Biomphalaria glabrata, B. straminea and B. tenagophila. In the Biomphalaria genus, the myoglobin gene has three introns; these were amplified by PCR and analyzed by PCR-RFLP. Results showed that the size (number or nucleotides and the nucleotide sequence of the coding gene of the myoglobin are variable in the three species. We observed the presence of size polymorphisms in intron 2 and 3; this characterizes a homozygous/heterozygous profile and it indicates the existence of two alleles which are different in size in each species of Biomphalaria. This polymorphism could be explored for specific identification of Biomphalaria individuals.

  2. [Relationship of Ghrelin gene polymorphism with congenital anorectal malformation and Hirschsprung disease].

    Science.gov (United States)

    Gao, Hong; Wang, Dajia; Zhao, Xiangxuan; Mi, Jie; Bai, Yuzuo; Wang, Weilin

    2015-07-01

    To explore the relationship of Ghrelin gene polymorphism with the occurrence of human anorectal malformations (ARMs) and Hirschsprung disease(HSCR). PCR and DNA sequencing were used to detect the single nucleotide polymorphism (SNPs) of 3 loci (rs139684563, rs149447194, rs186599567) genotype of Ghrelin gene in 100 children with ARMs, 100 children with HSCR, and 100 healthy children (normal group). Genovariation and gene mutation were analyzed with case-control method. Three loci SNPs were in accordance with Hardy-Weinberg genetic equilibrium. No significant differences were found in rs139684563 allele and genotype frequencies between the cases and the normal groups (P>0.05). The allele and genotype frequencies of rs149447194 and rs186599567 were significantly different between cases and normal group (Ppolymorphism changes may be associated with the pathogenesis of ARMs and HSCR.

  3. Association study between schizophrenia and dopamine D3 receptor gene polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, Toshihisa; Takahashi, Makoto; Maeda, Masaya [Niigata Univ. (Japan)] [and others

    1996-07-26

    Crocq et al. reported the existence of an association between schizophrenia and homozygosity of a BalI polymorphism in the first exon of the dopamine D3 receptor (DRD3) gene. In response to this report, further studies were conducted; however, these studies yielded conflicting results. In the present study, we examined 100 unrelated Japanese schizophrenics and 100 normal controls to determine any association between this polymorphism and schizophrenia. Results suggest that neither allele nor genotype frequencies of the DRD3 gene in the schizophrenics as a whole are significantly different from those of the controls. Further, we found no association between any allele or genotype and any clinical subtype based on family history of schizophrenia and age-at-onset. A significantly high frequency of homozygosity of a dopamine D3 receptor gene allele was not observed in the schizophrenics as a whole, or in clinical subtypes. Our results suggest that an association between the dopamine D3 receptor gene and schizophrenia is unlikely to exist. 26 refs., 1 tab.

  4. Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2009-01-01

    Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.

  5. Blood lead levels, iron metabolism gene polymorphisms and homocysteine: a gene-environment interaction study.

    Science.gov (United States)

    Kim, Kyoung-Nam; Lee, Mee-Ri; Lim, Youn-Hee; Hong, Yun-Chul

    2017-12-01

    Homocysteine has been causally associated with various adverse health outcomes. Evidence supporting the relationship between lead and homocysteine levels has been accumulating, but most prior studies have not focused on the interaction with genetic polymorphisms. From a community-based prospective cohort, we analysed 386 participants (aged 41-71 years) with information regarding blood lead and plasma homocysteine levels. Blood lead levels were measured between 2001 and 2003, and plasma homocysteine levels were measured in 2007. Interactions of lead levels with 42 genotyped single-nucleotide polymorphisms (SNPs) in five genes ( TF , HFE , CBS , BHMT and MTR ) were assessed via a 2-degree of freedom (df) joint test and a 1-df interaction test. In secondary analyses using imputation, we further assessed 58 imputed SNPs in the TF and MTHFR genes. Blood lead concentrations were positively associated with plasma homocysteine levels (p=0.0276). Six SNPs in the TF and MTR genes were screened using the 2-df joint test, and among them, three SNPs in the TF gene showed interactions with lead with respect to homocysteine levels through the 1-df interaction test (plead levels. Blood lead levels were positively associated with plasma homocysteine levels measured 4-6 years later, and three SNPs in the TF gene modified the association. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  6. Intestinal PTGS2 mRNA Levels, PTGS2 Gene Polymorphisms, and Colorectal Carcinogenesis

    DEFF Research Database (Denmark)

    Vogel, Lotte K.; Saebo, Mona; Hoyer, Helle

    2014-01-01

    Background & Aims: Inflammation is a major risk factor for development of colorectal cancer (CRC). Prostaglandin synthase cyclooxygenase-2 (COX-2) encoded by the PTGS2 gene is the rate limiting enzyme in prostaglandin synthesis and therefore plays a distinct role as regulator of inflammation...

  7. IDE Gene Polymorphism Influences on BPSD in Mild Dementia of Alzheimer's Type

    Directory of Open Access Journals (Sweden)

    Noriko Sato

    2008-01-01

    Full Text Available Insulin degrading enzyme (IDE degrades amyloid (A, which may inhibit the accumulation of A in a brain affected with dementia of Alzheimer's type (DAT. A decrease in the activity of IDE results in changes in glucose utilization in the brain, which could affect the cognitive and psychiatric symptoms of DAT. We investigated a possible association of IDE gene polymorphism and the behavioral and psychological symptoms of dementia (BPSD in mild DAT. The genotyping for IDE and apolipoprotein E (ApoE was determined in 207 patients with mild DAT and 215 controls. The occurrence of BPSD was demonstrated using the Behavioral Pathology in Alzheimer's Disease Rating Scale (BEHAVE-AD. IDE gene polymorphism is unlikely to play a substantial role in conferring susceptibility to DAT, but it may be involved in the development of affective disturbance through the course of mild DAT, regardless of the presence of an ApoE 4 allele. The present data could be the result of a small sample size. Further investigations using larger samples are thus required to clarify the correlation between IDE gene polymorphism, susceptibility to DAT, and emergence of BPSD.

  8. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang

    2013-05-01

    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

  9. The BTNL2 G16071A gene polymorphism increases granulomatous disease susceptibility

    Science.gov (United States)

    Tong, Xiang; Ma, Yao; Niu, Xundong; Yan, Zhipeng; Liu, Sitong; Peng, Bo; Peng, Shifeng; Fan, Hong

    2016-01-01

    Abstract Objective: The butyrophilin-like 2 (BTNL2) G16071A gene polymorphism has been implicated in the susceptibility to granulomatous diseases, but the results were inconclusive. The objective of the current study was to precisely explore the relationship between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility by the meta-analysis including false-positive report probability (FPRP) test. Methods: A systematic literature search in the PubMed, Embase, and Wanfang databases, China National Knowledge Internet, and commercial Internet search engines was conducted to identify studies published up to April 1, 2016. The odds ratio (OR) with 95% confidence interval (CI) was used to assess the effect size. Statistical analysis was conducted using the STATA 12.0 software and FPRP test sheet. Results: In total, all 4324 cases and 4386 controls from 14 eligible studies were included in the current meta-analysis. By the overall meta-analysis, we found a significant association between BTNL2 G16071A gene polymorphism and granulomatous disease susceptibility (A vs G: OR = 1.25, 95% CI = 1.07–1.45, P = 0.005). The meta-regression analyses showed that a large proportion of the between-study heterogeneity was significantly attributed to the ethnicity (A vs G, P = 0.013) and the types of granulomatous diseases (A vs G, P = 0.002). By the subgroup meta-analysis, the BTNL2 G16071A gene polymorphism was associated with granulomatous disease susceptibility in Caucasians (A vs G: OR = 1.37, 95% CI = 1.18–1.58, P susceptibility (A vs G: OR = 1.52, 95% CI = 1.39–1.66, P susceptibility (A vs G, FPRP susceptibility among Caucasians (A vs G, FPRP susceptibility, especially increasing the sarcoidosis susceptibility. In addition, the polymorphism may be greatly associated with likelihood of granulomatous diseases among Caucasians. PMID:27472712

  10. Association between TNF-α-238G/A gene polymorphism and OCD susceptibility: A meta-analysis.

    Science.gov (United States)

    Jiang, Caixiao; Ma, Xinyan; Qi, Shunxiang; Han, Guangyue; Li, Yan; Liu, Yanfang; Liu, Lanfen

    2018-02-01

    Tumor necrosis factor-alpha (TNF-α) is an important cytokine and has been reported to be associated with the pathogenesis of many autoimmune and inflammatory diseases. TNF-α gene is located on a region that has been found to be associated with obsessive-compulsive disorder (OCD). We performed this meta-analysis to assess the relationship between susceptibility to OCD and the TNF-α-238G/A gene polymorphism. An extensive search of the available literature on the association between the susceptibility to OCD and the TNF gene polymorphism was conducted by searching PubMed, Web of Knowledge, Embase, Chinese Web of Knowledge, Wanfang, and Chongqing VIP database. The database was searched up to December 2016 and includes language of English and/or Chinese with the keywords of "obsessive-compulsive disorder" or "OCD," polymorphism or variant or mutation, "tumor necrosis factor" or "TNF" or "cytokine." The association between TNF-α-238G/A gene polymorphism and the susceptibility of OCD was anticipated by odds ratio (OR) with the corresponding 95% confidence interval (95% CI). Four studies including 435 cases and 1073 controls were incorporated in our meta-analysis. In general, TNF-α-238G/A gene polymorphism might lead to a decreased risk of OCD susceptibility (G vs A genotype model: OR = 1.01, 95% CI = 0.37-2.77, P = .981; GG vs AA+AG model: OR = 0.93, 95% CI = 0.37-2.36, P = .879; GG+AG vs AA model: OR = 0.22, 95% CI = 0.06-0.73, P = .014; GG vs AA model: OR = 0.21, 95% CI = 0.06-0.71, P = .012; AG vs AA model: OR = 0.29, 95% CI = 0.07-1.16, P = .081; GG+AA vs AG model: OR = 1.17, 95% CI = 0.55-2.51, P = .683). TNF-α-238G/A gene polymorphism might lead to a decreased risk of OCD susceptibility.

  11. Angiotensinogen and ACE gene polymorphisms and risk of atrial fibrillation in the general population

    DEFF Research Database (Denmark)

    Ravn, Lasse S; Benn, Marianne; Nordestgaard, Børge G

    2008-01-01

    OBJECTIVES: The renin-angiotensin system may play a role in the pathogenesis of atrial fibrillation, and renin-angiotensin system blockers reduce the risk of atrial fibrillation. We hypothesized that polymorphisms in the angiotensinogen and angiotensin-converting enzyme (ACE) genes encoding...... in the ACE gene; rare allele frequencies were 0.16, 0.40, 0.12, 0.41, and 0.49, respectively. Participants had sinus rhythm at inclusion. During 26 years of follow-up, 968 individuals developed atrial fibrillation. Multifactorially adjusted hazard ratios for atrial fibrillation for a-20c ac and cc versus aa...... proteins in this system predict risk of atrial fibrillation. METHODS AND RESULTS: We genotyped 9235 individuals from the Danish general population, The Copenhagen City Heart Study, for the a-20c, g-6a, T174M, and M235T polymorphisms in the angiotensinogen gene and the insertion/deletion (I/D) polymorphism...

  12. Association of vitamin D receptor BsmI (rs1544410) gene polymorphism with the chronic kidney disease susceptibility.

    Science.gov (United States)

    Zhou, Tian-Biao; Jiang, Zong-Pei; Huang, Miao-Fang

    2015-02-01

    Association of vitamin D receptor (VDR) BsmI (rs1544410) gene polymorphism with the chronic kidney disease (CKD) susceptibility from the published reports are still conflicting. This meta-analysis was performed to evaluate the relationship between VDR BsmI (rs1544410) gene polymorphism and the risk of CKD. The association studies were identified from PubMed, Cochrane Library and China Biological Medicine Database on 1 March 2014, and eligible investigations were included and synthesized using meta-analysis method. Nine reports were recruited into this meta-analysis for the association of VDR BsmI gene polymorphism with CKD susceptibility. In this meta-analysis for overall populations, the BsmI B allele BB genotype and bb genotype were not associated with the risk of CKD (B allele: OR = 1.12, 95% CI: 0.88-1.44, p = 0.36; BB genotype: OR = 1.15, 95% CI: 0.81-1.62, p = 0.43; bb genotype: OR = 0.86, 95% CI: 0.61-1.20, p = 0.36). Furthermore, VDR BsmI gene polymorphism was not associated with CKD susceptibility in Asians and in Caucasians. In conclusion, the BsmI gene polymorphism was not associated with CKD susceptibility in overall populations, in Asians and in Caucasians. However, more studies should be conducted to confirm it.

  13. The role of an iNOS polymorphism at the post-diagnosis diabetes development in children with Type 1 diabetes

    DEFF Research Database (Denmark)

    Johannesen, Jesper; Eriksen, Vibeke; Andersen, Marie Louise Max

    2016-01-01

    Objective: A missense polymorphism (rs2297518) of the inducible nitric oxide synthase (iNOS) gene causing a serine to leucine substitution at amino acic position 608 has previously been associated to the development of type 1 diabetes (T1DM). Activation of iNOS is a main effector pathway......: At 1 month IL-1β was detected more frequently in CC-genotype individuals as compared to CT and TT individuals, 24/168 vs. 3/75 and 0/9, respectively (p=0.03). This effect was not present at 6 and 12 months post-diagnosis. The iNOS polymorphism was not associated to diabetic ketoacidosis status...

  14. ACE Gene I/D Polymorphism and Obesity in 1,574 Patients with Type 2 Diabetes Mellitus.

    Science.gov (United States)

    Pan, Yan-Hong; Wang, Min; Huang, Yan-Mei; Wang, Ying-Hui; Chen, Yin-Ling; Geng, Li-Jun; Zhang, Xiao-Xi; Zhao, Hai-Lu

    2016-01-01

    Association between ACE gene I/D polymorphism and the risk of overweight/obesity remains controversial. We investigated the possible relationship between ACE gene I/D polymorphism and obesity in Chinese type 2 diabetes mellitus (T2DM) patients. In this study, obesity was defined as a body mass index (BMI) value ≥ 25 kg/m 2 and subjects were classified into 4 groups (lean, normal, overweight, and obese). PCR (polymerase chain reaction) was used to detect the ACE gene I/D polymorphism in T2DM patients. Metabolic measurements including blood glucose, lipid profile, and blood pressure were obtained. Frequencies of the ACE genotypes (DD, ID, and II) were not significant among the 4 groups of BMI-defined patients ( P = 0.679) while ACE II carriers showed higher systolic blood pressure (SBP) and pulse pressure (PP) (all P ACE gene I/D polymorphism with obesity is insignificant in Chinese patients with T2DM. SBP and PP might be higher in the ACE II carriers than in the DD and ID carriers.

  15. Do polymorphisms in chemosensory genes matter for human ingestive behavior?

    Science.gov (United States)

    Hayes, John E; Feeney, Emma L; Allen, Alissa L

    2013-12-01

    In the last decade, basic research in chemoreceptor genetics and neurobiology have revolutionized our understanding of individual differences in chemosensation. From an evolutionary perspective, chemosensory variations appear to have arisen in response to different living environments, generally in the avoidance of toxins and to better detect vital food sources. Today, it is often assumed that these differences may drive variable food preferences and choices, with downstream effects on health and wellness. A growing body of evidence indicates chemosensory variation is far more complex than previously believed. However, just because a genetic polymorphism results in altered receptor function in cultured cells or even behavioral phenotypes in the laboratory, this variation may not be sufficient to influence food choice in free living humans. Still, there is ample evidence to indicate allelic variation in TAS2R38 predicts variation in bitterness of synthetic pharmaceuticals (e.g., propylthiouracil) and natural plant compounds (e.g., goitrin), and this variation associates with differential intake of alcohol and vegetables. Further, this is only one of 25 unique bitter taste genes ( TAS2Rs ) in humans, and emerging evidence suggests other TAS2Rs may also contain polymorphisms that a functional with respect to ingestive behavior. For example, TAS2R16 polymorphisms are linked to the bitterness of naturally occurring plant compounds and alcoholic beverage intake, a TAS2R19 polymorphism predicts differences in quinine bitterness and grapefruit bitterness and liking, and TAS2R31 polymorphisms associate with differential bitterness of plant compounds like aristolochic acid and the sulfonyl amide sweeteners saccharin and acesulfame-K. More critically with respect to food choices, these polymorphisms may vary independently from each other within and across individuals, meaning a monolithic one-size-fits-all approach to bitterness needs to be abandoned. Nor are genetic

  16. Association of nonalcoholic fatty liver disease grades with the plasma cell antigen-1 (PC-1 gene polymorphism

    Directory of Open Access Journals (Sweden)

    Ibrahim H. Borai

    2018-07-01

    Full Text Available Background and aims: Nonalcoholic fatty liver disease (NAFLD is a complicated disease linked with dietary habitats, obesity, and a range of comorbidities correlated with insulin resistance.Although environmental parameters are essential in deciding risk of the disease, proofs from previous reports sustain the hypothesis that genetics are responsible for NAFLD developmentand progression. Plasma cell antigen-1 (PC-1 and its gene polymorphism are associated with NAFLD progression. Consequently, the object of this study was to detect the usefulness of PC-1 K121Q gene polymorphism in NAFLD progression. Subjects and methods: A total of 87 NAFLD patients were included in the study and subdivided ultrasonographically into 31 patients with grade 1 (mild NAFLD, 26 patients with grade 2 (moderate NAFLD and 30 patients with grade 3 (severe NAFLD, in addition to 47 normal controls. The detection of PC-1 K121Q gene polymorphism was accomplished by using restriction fragment length polymorphism (RFLP-PCR. Results: Lipid profile parameters were associated with the incidence of NAFLD. AlthoughPC-1 gene polymorphism didnot significantly change in parallel with NAFLD grades, PC-1 at the genetic and protein level was significantly associated with triacylglycerollevels in NAFLD patients. Conclusion: Lipid profile indices are risk factors for the incidence of NAFLD. Triacylglycerol (TAG level is the hall-mark in the NAFLD pathogenesis and in the predisposition of PC-1 gene polymorphism. Keywords: NAFLD, Triacylglycerol (TAG, Plasma cell antigen-1 (PC-1

  17. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

    Science.gov (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

    2015-12-01

    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Association of -604G/A and -501A/C Ghrelin and Obestatin Prepropeptide Gene Polymorphisms with Polycystic Ovary Syndrome.

    Science.gov (United States)

    Ghaleh, Talaat Dabbaghi; Skandari, Somayeh Saadat; Najafipour, Reza; Rashvand, Zahra; Darabi, Masoud; Sahmani, Mehdi

    2018-04-01

    Ghrelin hormone has an important role in a wide range of metabolic and non-metabolic processes. Polymorphisms of ghrelin gene could be associated with a large number of diseases. The aim of this study was to evaluate the association of -604G/A and -501A/C polymorphisms in ghrelin and obestatin prepropeptide gene (GHRL) with polycystic ovary syndrome (PCOS) in a sample of Iranian women. One hundred and fifty-two women with PCOS and 162 age-matched apparently healthy women as control group were enrolled in this study. The study subjects were genotyped for polymorphisms in the ghrelin gene using polymerase chain reaction-restriction fragment length polymorphism-based methods. Biochemical parameters, serum prolactin, luteinizing hormone, follicle stimulating hormone, estradiol, and testosterone were estimated by chemiluminescence assay. Serum lipids and lipoproteins were determined by standard enzymatic methods. The association between the risk of PCOS and ghrelin gene polymorphisms was examined using Multivariate analysis. The frequency of the -604G/A and -501A/C polymorphisms was not statistically different between patients and the control group of women (p = 0.12 and p = 0.21, respectively). A significantly higher level of LDL-C was found in the wild-type AA genotype compared with CC genotype of -501A/C polymorphism (p = 0.02). Our findings indicate that neither -604G/A and nor -501A/C polymorphisms of ghrelin gene are associated with PCOS, but suggest a relation between the presence of polymorphic allele of -501A/C polymorphism and LDL-C level in a sample of Iranian women.

  19. Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

    Science.gov (United States)

    Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

    2010-04-01

    To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

  20. Association of MC3R gene polymorphisms with body weight in the red fox and comparative gene organization in four canids.

    Science.gov (United States)

    Skorczyk, A; Flisikowski, K; Szydlowski, M; Cieslak, J; Fries, R; Switonski, M

    2011-02-01

    There are five genes encoding melanocortin receptors. Among canids, the genes have mainly been studied in the dog (MC1R, MC2R and MC4R). The MC4R gene has also been analysed in the red fox. In this report, we present a study of chromosome localization, comparative sequence analysis and polymorphism of the MC3R gene in the dog, red fox, arctic fox and Chinese raccoon dog. The gene was localized by FISH to the following chromosome: 24q24-25 in the dog, 14p16 in the red fox, 18q13 in the arctic fox and NPP4p15 in the Chinese raccoon dog. A high identity level of the MC3R gene sequences was observed among the species, ranging from 96.0% (red fox--Chinese raccoon dog) to 99.5% (red fox--arctic fox). Altogether, eight polymorphic sites were found in the red fox, six in the Chinese raccoon dog and two in the dog, while the arctic fox appeared to be monomorphic. In addition, association of several polymorphisms with body weight was analysed in red foxes (the number of genotyped animals ranged from 319 to 379). Two polymorphisms in the red fox, i.e. a silent substitution c.957A>C and c.*185C>T in the 3'-flanking sequence, showed a significant association (P < 0.01) with body weight. © 2010 The Authors, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.

  1. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-01-01

    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  2. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  3. Modulation of Colorectal Cancer Risk by Polymorphisms in 51Gln/His, 64Ile/Val, and 148Asp/Glu of APEX Gene; 23Gly/Ala of XPA Gene; and 689Ser/Arg of ERCC4 Gene

    Directory of Open Access Journals (Sweden)

    L. Dziki

    2017-01-01

    Full Text Available Polymorphisms in DNA repair genes may affect the activity of the BER (base excision repair and NER (nucleotide excision repair systems. Using DNA isolated from blood taken from patients (n=312 and a control group (n=320 with CRC, we have analyzed the polymorphisms of selected DNA repair genes and we have demonstrated that genotypes 51Gln/His and 148Asp/Glu of APEX gene and 23Gly/Ala of XPA gene may increase the risk of colorectal cancer. At the same time analyzing the gene-gene interactions, we suggest the thesis that the main factor to be considered when analyzing the impact of polymorphisms on the risk of malignant transformation should be intergenic interactions. Moreover, we are suggesting that some polymorphisms may have impact not only on the malignant transformation but also on the stage of the tumor.

  4. The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review.

    Science.gov (United States)

    Ghalandari, Hamid; Hosseini-Esfahani, Firoozeh; Mirmiran, Parvin

    2015-07-01

    Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. The keywords leptin, ghrelin, polymorphism, single-nucleotide polymorphism (SNP), obesity, overweight, Body Mass Index, metabolic syndrome, and type 2 diabetes mellitus (T2DM) (MeSH headings) were used to search in the following databases: Pubmed, Sciencedirect (Elsevier), and Google scholar. Overall, 24 case-control studies, relevant to our topic, met the criteria and were included in the review. The most prevalent leptin/leptin receptor genes (LEP/LEPR) and ghrelin/ghrelin receptor genes (GHRL/GHSR) single nucleotide polymorphisms studied were LEP G-2548A, LEPR Q223R, and Leu72Met, respectively. Nine studies of the 17 studies on LEP/LEPR, and three studies of the seven studies on GHRL/GHSR showed significant relationships. In general, our study suggests that the association between LEP/LEPR and GHRL/GHSR with overweight/obesity and the related metabolic disturbances is inconclusive. These results may be due to unidentified gene-environment interactions. More investigations are needed to further clarify this association.

  5. The CXCR2 Gene Polymorphism Is Associated with Stroke in Patients with Essential Hypertension

    Directory of Open Access Journals (Sweden)

    Yanina R. Timasheva

    2015-10-01

    Full Text Available Hypertension is the major risk factor for stroke, and genetic factors contribute to its development. Inflammation has been hypothesized to be the key link between blood pressure elevation and stroke. We performed an analysis of the association between inflammatory mediator gene polymorphisms and the incidence of stroke in patients with essential hypertension (EH. The study group consisted of 625 individuals (296 patients with noncomplicated EH, 71 hypertensive patients with ischemic stroke, and 258 control subjects. Both patients and controls were ethnic Tatars originating from the Republic of Bashkortostan (Russian Federation. The analysis has shown that the risk of ischemic stroke was associated with the CXCR2 rs1126579 polymorphism. Our results indicate that among patients with EH, the heterozygous genotype carriers had a higher risk of stroke (OR = 1.72, 95% CI 1.01-2.92, whereas the CXCR2*C/C genotype was protective against stroke (OR = 0.32, 95% CI 0.12-0.83. As shown by the gene-gene interaction analysis, the CXCR2 rs1126579 polymorphism was also present in all genotype/allele combinations associated with the risk of stroke. Genetic patterns associated with stroke also included polymorphisms in the CCL2, CCL18, CX3CR1, CCR5, and CXCL8(IL8 genes, although no association between these loci and stroke was detected by individual analysis.

  6. Impact of MCP-1 and CCR-2 gene polymorphisms on coronary artery disease susceptibility.

    Science.gov (United States)

    Lin, Hsiu-Ling; Ueng, Kwo-Chang; Hsieh, Yih-Shou; Chiang, Whei-Ling; Yang, Shun-Fa; Chu, Shu-Chen

    2012-09-01

    Coronary artery disease (CAD) was the second leading cause of death during the last 3 years in Taiwan. Smooth muscle cells, monocytes/macrophages, and endothelial cells produce monocyte chemoattractant protein-1 (MCP-1) within atherosclerotic plaques following binding to the chemokine receptor-2 (CCR-2). Previous studies have well-documented the association between MCP-1 expression and susceptibility to, or clinicopathological features, of CAD. This study investigated the relationships between MCP-1-2518A/G and CCR-2-V64I genetic polymorphisms and CAD in the Taiwanese population. A total of 608 subjects, including 392 non-CAD controls and 216 patients with CAD, were recruited and subjected to polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) to evaluate the effects of these two polymorphic variants on CAD. Results indicated a significant association between MCP-1 -2548 gene polymorphism and susceptibility to CAD. GG genotypes (OR = 1.629; 95 % CI = 1.003-2.644), or individuals with at least one G allele (OR = 1.511; 95 % CI = 1.006-2.270), had a higher risk of CAD as compared with AA genotypes. Results also revealed that subjects with at least one A allele of the V64I CCR2 gene polymorphism had significantly increased risk of CAD. G allele in MCP-1-2518 might contribute to higher prevalence of atrial fibrillation in CAD patients (OR = 4.254; p CCR-2 64I gene polymorphisms represent important factors in determining susceptibility to CAD, and the contribution of MCP-1-2518G could be through effects on atrial fibrillation in CAD patients.

  7. Polymorphism at the 3'-UTR of the thymidylate synthase gene: A potential predictor for outcomes in Caucasian patients with esophageal adenocarcinoma treated with preoperative chemoradiation

    International Nuclear Information System (INIS)

    Liao Zhongxing; Liu Hongji; Swisher, Stephen G.; Wang Luo; Wu, Tsung-Teh; Correa, Arlene M.; Roth, Jack A.; Cox, James D.; Komaki, Ritsuko; Ajani, Jaffer A.; Wei Qingyi

    2006-01-01

    Purpose: To test the hypothesis that TS3'UTR polymorphisms predict outcomes in 146 Caucasian patients with esophageal adenocarcinoma treated with preoperative 5-fluorouracil-based chemoradiation. Methods and Materials: DNA was extracted from hematoxylin-and-eosin stained histologic slides of normal esophageal or gastric mucosa sections from paraffin blocks of esophagectomy specimens. Genotypes of the TS3'UTR polymorphism were determined by polymerase chain reaction for a 6-bp insertion. The genotype groups (0bp/0bp, 6bp/0bp, and 6bp/6bp) were compared for clinical features and overall survival, recurrence-free-survival, locoregional control (LRC), and distant metastasis control. Multivariable Cox regression analyses were performed to find independent predictors for the stated outcomes. Results: There was a trend of association between 6bp/6bp genotype and a decreased risk of local regional recurrence (hazards ratio = 0.211, 95% confidence interval = 0.041-1.095, p = 0.06) compared with other genotypes. There was a trend that patients with 6bp/6bp genotype had a higher 3-year probability of LRC compared with patients with the other two genotypes combined (p = 0.07); however, the difference was not statistically significant. Conclusions: The null hypotheses were not rejected in this study, probably owing to small sample size or the single gene examined. Prospective studies with adequate statistical power analyzing a family of genes involved in the 5-fluorouracil metabolism are needed to assess genetic determinants of treatment-related outcomes in esophageal adenocarcinoma

  8. The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

    Science.gov (United States)

    Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

    2018-03-06

    Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. The Vitamin D Receptor (VDR Gene Polymorphisms in Turkish Brain Cancer Patients

    Directory of Open Access Journals (Sweden)

    Bahar Toptaş

    2013-01-01

    Full Text Available Objective. It has been stated that brain cancers are an increasingly serious issue in many parts of the world. The aim of our study was to determine a possible relationship between Vitamin D receptor (VDR gene polymorphisms and the risk of glioma and meningioma. Methods. We investigated the VDR Taq-I and VDR Fok-I gene polymorphisms in 100 brain cancer patients (including 44 meningioma cases and 56 glioma cases and 122 age-matched healthy control subjects. This study was performed by polymerase chain reaction-based restriction fragment length polymorphism (RF LP. Results. VDR Fok-I ff genotype was significantly increased in meningioma patients (15.9% compared with controls (2.5%, and carriers of Fok-I ff genotype had a 6.47-fold increased risk for meningioma cases. There was no significant difference between patients and controls for VDR Taq-I genotypes and alleles. Conclusions. We suggest that VDR Fok-I genotypes might affect the development of meningioma.

  10. Association of GSTP1 gene polymorphisms with performance traits ...

    African Journals Online (AJOL)

    sony

    The genetic variants were determined by PCR-SSCP technique. Two unique SSCP patterns were observed in fragment 1, 3, 5 and 6 of GSTP1 gene. Sequence analysis with reference to GenBank. Acc. no AC_000186.1 revealed polymorphisms at position 210, 746, 2438, 2439, 2443, 2507, 2695 and insertions between ...

  11. Association between ADAM metallopeptidase domain 33 gene polymorphism and risk of childhood asthma: a meta-analysis.

    Science.gov (United States)

    Sun, F J; Zou, L Y; Tong, D M; Lu, X Y; Li, J; Deng, C B

    2017-08-31

    This study aimed to investigate the association between ADAM metallopeptidase domain 33 (ADAM33) gene polymorphisms and the risk of childhood asthma. The relevant studies about the relationship between ADAM33 gene polymorphisms and childhood asthma were searched from electronic databases and the deadline of retrieval was May 2016. The single nucleotide polymorphisms (SNPs) of ADAM33 (rs511898, rs2280092, rs3918396, rs528557, rs2853209, rs44707, rs2280091 and rs2280089) were analyzed based on several models including the allele, codominant, recessive and dominant models. The results showed that the ADAM33 rs2280091 polymorphism in all four genetic models was associated with an increased risk of childhood asthma. Positive associations were also found between the polymorphisms rs2280090, rs2787094, rs44707 and rs528557 and childhood asthma in some genetic models. This meta-analysis suggested that ADAM33 polymorphisms rs2280091, rs2280090, rs2787094, rs44707 and rs528557 were significantly associated with a high risk of childhood asthma.

  12. Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

    Science.gov (United States)

    Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

    2015-01-01

    Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

  13. Preconception Screening for Gene Polymorphisms Associated with Thrombophilia and Hyperhomocysteinemia Risk in Healthy Young Women

    Directory of Open Access Journals (Sweden)

    Elena Yu. Glotova

    2013-09-01

    Full Text Available The frequency characteristics of the gene polymorphisms (FVL G1691A, FII G20210A, MTHFR C677T, MTHFR A1298C, MTRR A66G associated with thrombophilia, hyperhomocysteinemia risk and different perinatal or pregnancy complications were studied. This examination was conducted among 130 planned-pregnancy healthy young women aged between 19 and 29 years. A gene mutation analysis was performed using a real-time polymerase chain reaction (real-time PCR. Factor V Leiden (FVL G1691A and prothrombin gene (FII G20210A mutations were not identified in the women surveyed. The frequency of the occurrence of the heterozygous FVL 1691G/A genotype associated with the risk of thrombosis during pregnancy was very low in these women (0.8%. The frequency of the MTHFR (methylenetetrahydrofolate reductase 1298C/С mutant genotype was 11.5%, MTHFR 677T/Т – 5.4%, and MTRR (methionine synthase reductase 66G/G – 31.5%. A combination of the MTHFR 677TT/1298CC and MTHFR 677TТ/MTRR 66GG mutant genotypes, which significantly increased the risk of pregnancy loss and neural tube defects, were found to occur in 0.8% of the cases.We concluded that selective thrombophilia screening (FVL G1691A and FII G20210A based on prior personal and/or family history of venous thromboembolism was more cost-effective than a universal preconception screening in all planning pregnancy women. However, in order to decrease the risk of congenital anomalies and pregnancy complications associated with folate dependent homocysteine metabolism, preconception care should include folate supplementation

  14. Relationship between angiotensin-converting enzyme gene polymorphism and cardio-brain complications in patients with NIDDM (type 2 diabetes mellitus)

    International Nuclear Information System (INIS)

    Xu Qinfang; Zhu Yan; Ding Mingwei

    2002-01-01

    Objective: To investigate the relationship between angiotensin-converting enzyme gene polymorphism and cardio-brain complications in patients with NIDDM. Methods: The angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism in 174 patients with NIDDM and 62 controls were examined with PCR. Results: ACE gene I/D polymorphism was closely related to coronary heart disease (angina, cardiac infarction) and cerebral infarction in diabetic patients but not with hypertension. Plasma renin activity and plasma angiotensin II levels in complicated diabetic patients with ACE D/D gene were significantly higher than those in the controls (p < 0.01). Their aldosterone and endothelin contents were not significantly different. Conclusion: Examination of ACE gene I/D polymorphism was useful for the primary prevention of cardio-brain complications in diabetic patients and helpful in the early diagnosis and therapy of coronary heart disease and cerebral infarction

  15. Association between TNF-α (– 308 G → A Gene Polymorphism and Chronic

    Directory of Open Access Journals (Sweden)

    Hamidreza Mahmoudzadeh-Sagheb

    2014-02-01

    Full Text Available Background: Chronic periodontitis is an inflammatory disease caused by environmental and genetic factors. It leads to destruction of tooth supporting tissues and may cause tooth loss. Cytokine TNF-α plays a role in the development of inflammatory lesions and 3Tdevelopment3T5T and 5Tprogression of the chronic periodontitis disease. Some polymorphisms of this gene are accompanied with change in expression level. The purpose of this study was to investigate the relationship between TNF-α -308 G>A (rs1800629 polymorphism and chronic periodontitis. Materials and Methods: In this case-control study, 100 patients with chronic periodontitis and 100 normal subjects, referring to the clinic of Zahedan Dental School, were evaluated. Venous blood samples of participants were taken. DNA was extracted using salting-out technique and gene polymorphism was studied at this position using specific primers by T-ARMS PCR method. To investigate the frequency of genotypes and alleles in both groups, χ2 test was employed and pA polymorphism and chronic periodontitis in this population4T.4T

  16. Relationship between major depressive disorder and ACE gene I/D polymorphism in a Turkish population

    Directory of Open Access Journals (Sweden)

    Sema Inanir

    2016-04-01

    Full Text Available Abstract Background Major depressive disorder (MDD is a complex disease and a significant health problem that is prevalent across the world. Angiotensin-converting enzyme (ACE has an important role in renin-angiotensin system (RAS and converts inactive angiotensin I to a potent vasopressor and aldosterone-stimulating peptide angiotensin II. Levels of ACE in plasma vary according to the insertion/deletion (I/D polymorphism of ACE gene. Objective The aim of the current study was to examine the influence ACE gene I/D variations on the risk of MDD. Methods In the present case-control study, we analyzed ACE I/D polymorphism in 346 MDD patients and 210 healthy subjects using polymerase chain reaction technique. Results Comparing the two groups, no significant difference was observed with regard to either genotype distributions or allele frequencies of the I/D polymorphism of ACE gene. Discussion Our findings suggest that the ACE I/D polymorphism is not associated with MDD in Turkish case-control study. Further studies are still needed.

  17. Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

    Directory of Open Access Journals (Sweden)

    Resnanti Utami Handayani

    2014-07-01

    Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

  18. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    Science.gov (United States)

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  19. Genome-wide DNA polymorphisms in Kavuni, a traditional rice cultivar with nutritional and therapeutic properties.

    Science.gov (United States)

    Rathinasabapathi, Pasupathi; Purushothaman, Natarajan; Parani, Madasamy

    2016-05-01

    Although rice genome was sequenced in the year 2002, efforts in resequencing the large number of available accessions, landraces, traditional cultivars, and improved varieties of this important food crop are limited. We have initiated resequencing of the traditional cultivars from India. Kavuni is an important traditional rice cultivar from South India that attracts premium price for its nutritional and therapeutic properties. Whole-genome sequencing of Kavuni using Illumina platform and SNPs analysis using Nipponbare reference genome identified 1 150 711 SNPs of which 377 381 SNPs were located in the genic regions. Non-synonymous SNPs (62 708) were distributed in 19 251 genes, and their number varied between 1 and 115 per gene. Large-effect DNA polymorphisms (7769) were present in 3475 genes. Pathway mapping of these polymorphisms revealed the involvement of genes related to carbohydrate metabolism, translation, protein-folding, and cell death. Analysis of the starch biosynthesis related genes revealed that the granule-bound starch synthase I gene had T/G SNPs at the first intron/exon junction and a two-nucleotide combination, which were reported to favour high amylose content and low glycemic index. The present study provided a valuable genomics resource to study the rice varieties with nutritional and medicinal properties.

  20. Reactive metabolites and antioxidant gene polymorphisms in Type 2 diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Monisha Banerjee

    2014-01-01

    Full Text Available Type 2 diabetes mellitus (T2DM, by definition is a heterogeneous, multifactorial, polygenic syndrome which results from insulin receptor dysfunction. It is an outcome of oxidative stress caused by interactions of reactive metabolites (RMs interactions with lipids, proteins and other mechanisms of human body. Production of RMs mainly superoxide (O2·− has been found in a variety of predominating cellular enzyme systems including NAD(PH oxidase, xanthine oxidase (XO, cyclooxygenase (COX, uncoupled endothelial nitric oxide synthase (eNOS and myeloperoxidase (MPO. The four main RM related molecular mechanisms are: increased polyol pathway flux; increased advanced glycation end-product (AGE formation; activation of protein kinase C (PKC isoforms and increased hexosamine pathway flux which have been implicated in glucose-mediated vascular damage. Superoxide dismutase (SOD, catalase (CAT, glutathione peroxidase (GPx, glutathione-S-transferase (GST, nitric oxide synthase (NOS are antioxidant enzymes involved in scavenging RMs in normal individuals. Functional polymorphisms of these antioxidant enzymes have been reported to be involved in pathogenesis of T2DM individuals. The low levels of antioxidant enzymes or their non-functionality results in excessive RMs which initiate stress related pathways thereby leading to insulin resistance and T2DM. An attempt has been made to review the role of RMs and antioxidant enzymes in oxidative stress resulting in T2DM.

  1. Vitamin-D receptor (VDR) gene polymorphisms (Taq-I & Apa-I) in Syrian healthy population.

    Science.gov (United States)

    Haddad, Shaden

    2014-12-01

    The vitamin D endocrine system regulates bone metabolism and calcium homeostasis as well as cellular proliferation and differentiation. Vitamin D receptor (VDR) mediates Vit-D activity, thus VDR gene polymorphisms may correlate with different diseases. This study aimed to determine the distribution of VDR gene (Taq-I and Apa-I) polymorphisms using a RFLP in unrelated normal healthy individuals of Syrian population. Allelic frequencies were 65% vs 35% and 66% vs 34% for T vs t and A vs a alleles, respectively. Genotype distribution was 36%, 58% and 6% for TT, Tt and tt and 42%, 47% and 10% for AA, Aa and aa, respectively. These results demonstrate that the frequency and distribution of the VDR polymorphisms in Syrian population are different from other populations worldwide.

  2. An Investigation of the Relationship between PPP1R3 Gene Polymorphism and Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Soyar Sari

    2017-07-01

    Full Text Available Background and Objectives: PPP1R3 is one of the genes confirmed to be associated with type 2 diabetes. This gene is located on the long arm of chromosome 7 and encodes protein phosphatase 1 (PP1, which has serine/threonine phosphatase activity. There is a polymorphic region in the 3'UTR region of this gene, which creates ARE1 and ARE2 alleles. The aim of this study was to determine the relationship between PPP1R3 gene polymorphism and type 2 diabetes. Methods: In this case-control study, 100 patients with type 2 diabetes and 100 healthy individuals, were randomly selected from the study population. PPP1R3 gene polymorphism was analyzed using PCR-RFLP method. Comparison of variables between healthy and patient groups, was performed by t-test, allele frequency by counting, and calculation of their ratio by chi-square test, and the population was confirmed to be in Hardy-Weinberg equilibrium. Distribution of genotypes and alleles was compared between healthy and patient groups. Results: In this study, there was no significant difference between the frequency of genotypes and frequency of alleles in subjects with type 2 diabetes and healthy control subjects. Conclusion: The findings of this study indicated that polymorphisms in the 3'UTR region of PPP1R3 gene is not associated with type 2 diabetes.

  3. Plasma ghrelin levels and polymorphisms of ghrelin gene in Chinese obese children and adolescents.

    Science.gov (United States)

    Zhu, J F; Liang, L; Zou, C C; Fu, J F

    2010-09-01

    To evaluate the role of fasting plasma ghrelin levels [ln(ghrelin)] and polymorphisms of ghrelin gene in Chinese obese children. Genotyping for ghrelin polymorphism was performed in 230 obese and 100 normal weight children. Among them, plasma ghrelin levels were measured in 91 obese and 23 health subjects. (1) Bivariate correlation analysis showed the ln(ghrelin) was inversely correlated with abnormality of glucose metabolism (r = -0.240, P = 0.023). Stepwise multiple regression analysis showed that abnormality of glucose metabolism was an independent determinant of plasma ghrelin levels (P = 0.023). (2) There was no difference in frequency of Leu72Met polymorphisms between obese and control groups (36.09 vs. 41.00%). Ghrelin is associated with obesity in childhood, especially associated with the glucose homeostasis. Lower ghrelin levels might be a result of obesity, but not a cause of obesity. The Leu72Met polymorphism of ghrelin gene is not associated with obesity and metabolic syndrome in Chinese children.

  4. Functional polymorphisms in the P2X7 receptor gene are associated with osteoporosis

    DEFF Research Database (Denmark)

    Husted, L B; Harsløf, T; Stenkjær, L

    2013-01-01

    variant allele, which has been associated with increased receptor function in monocytes, was associated with increased total hip BMD in women. With the exception of His155Tyr for which we found conflicting results in men and women, our results are consistent with the phenotype of the knockout mouse......UNLABELLED: The P2X(7) receptor is an ATP-gated cation channel. We investigated the effect of both loss-of-function and gain-of-function polymorphisms in the P2X(7) receptor gene on BMD and risk of vertebral fractures and found that five polymorphisms and haplotypes containing three...... of these polymorphisms were associated with BMD and fracture risk. INTRODUCTION: The P2X(7) receptor is an ATP-gated cation channel. P2X(7) receptor knockout mice have reduced total bone mineral content, and because several functional polymorphisms have been identified in the human P2X(7) receptor gene, we wanted...

  5. Interleukin-1 gene polymorphisms in chronic gastritis patients infected with Helicobacter pylori as risk factors of gastric cancer development.

    Science.gov (United States)

    Hnatyszyn, Andrzej; Wielgus, Karolina; Kaczmarek-Rys, Marta; Skrzypczak-Zielinska, Marzena; Szalata, Marlena; Mikolajczyk-Stecyna, Joanna; Stanczyk, Jerzy; Dziuba, Ireneusz; Mikstacki, Adam; Slomski, Ryszard

    2013-12-01

    Epidemiological investigations indicated association of the Helicobacter pylori infections with the occurrence of inflammatory conditions of the gastric mucosa and development of chronic gastritis and intestinal type of gastric cancer. IL1A and IL1B genes have been proposed as key factors in determining risk of gastritis and malignant transformation. The aim of this paper was to evaluate association of interleukin-1 gene polymorphisms with chronic gastritis, atrophy, intestinal metaplasia, dysplasia and intestinal type of gastric cancer in H. pylori-infected patients. Patients subjected to analysis represent group of 144 consecutive cases that suffered from dyspepsia with coexisting infection of H. pylori and chronic gastritis, chronic atrophic gastritis, intestinal metaplasia, dysplasia or gastric cancer. Molecular studies involved analysis of -889C>T polymorphism of IL1A gene and +3954C>T polymorphism of IL1B gene. Statistical analysis of association of polymorphism -889C>T of gene IL1A with changes in gastric mucosa showed lack of significance, whereas +3954C>T polymorphism of IL1B gene showed significant association. Frequency of allele T of +3954C>T polymorphism of IL1B gene was higher in group of patients with chronic gastritis, atrophy, intestinal metaplasia, dysplasia or intestinal type of gastric cancer (32.1 %) as compared with population group (23 %), χ(2) = 4.61 and p = 0.03. This corresponds to odds ratio: 1.58, 95 % CI: 1.04-2.4. Our results indicate that +3954C>T polymorphism of IL1B gene increase susceptibility to inflammatory response of gastric mucosa H. pylori-infected patients and plays a significant role in the development of chronic gastritis, atrophy, intestinal metaplasia, dysplasia and the initiation of carcinogenesis.

  6. Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

    Science.gov (United States)

    Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

    2017-12-01

    An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

  7. Peculiarities of bronchial asthma management in children with allelic GSTT1, GSTM1 gene polymorphism

    Directory of Open Access Journals (Sweden)

    O. K. Коloskova

    2018-01-01

    Full Text Available Content of peculiarities of basic anti-inflammatory therapy and its efficacy in children with available or absent deletion polymorphism of GSTM1  and GSTT1 genes coding II phase enzymes of GSTM1 and GSTT1 xenobiotic detoxication considering their acetylation status. It is established that in patients of a school age suffering from bronchial asthma with available deletion polymorphism of GSTT1 and GSTМ1 genes associated with slow acetylation phenotype anti-inflammatory therapy should be intensified emphasizing on much higher “step” or by means of addition of other anti-inflammatory drugs. In patients without deletion polymorphism of the examined genes in terms of quick acetylation phenotype average daily doses of iGCS have a tendency to prevailing over the similar ones in patients from the groups of comparison, and their triple administration is reliably higher

  8. Polymorphisms in genes involved in the estrogen pathway and mammographic density

    Directory of Open Access Journals (Sweden)

    Dumas Isabelle

    2010-11-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs in genes involved in the estrogen pathway appear to be associated with breast cancer risk and possibly with mammographic density (MD, but little is known of these associations among premenopausal women. This study examines the association of 11 polymorphisms in five estrogen-related genes (estrogen receptors alpha and beta (ERα, ERβ, 17β-hydroxysteroid dehydrogenase 1 (HSD17B1, catechol-O-methyltransferase (COMT, cytochrome P450 1B1 (CYP1B1 with premenopausal MD. Effect modification of four estrogen-related factors (parity, age at menarche, hormonal derivatives use and body mass index (BMI on this relation is also assessed. Methods Polymorphisms were genotyped in 741 premenopausal Caucasian women whose MD was measured in absolute density (AD, cm2 and percent density using a computer-assisted method. Multivariate linear models were used to examine the associations (Ptrend and interactions (Pi. Results None of the SNPs showed a statistically significant association with AD. However, each additional rare allele of rs1056836 CYP1B1 was associated with a reduction in AD among nulliparous women (Ptrend = 0.004, while no association was observed among parous women (Ptrend = 0.62; Pi = 0.02. An increase in the number of rare alleles of the HSD17B1 SNP (rs598126 and rs2010750 was associated with an increase in AD among women who never used hormonal derivatives (Ptrend = 0.06 and Ptrend = 0.04, respectively, but with a decrease in AD among past hormonal derivatives users (Ptrend = 0.04; Pi = 0.02 and Ptrend = 0.08; Pi = 0.01, respectively. Moreover, a negative association of rs598126 HSD17B1 SNP with AD was observed among women with higher BMI (>median (Ptrend = 0.01; Pi = 0.02. A negative association between an increased number of rare alleles of COMT rs4680 SNP and AD was limited to women who never used hormonal derivatives (Ptrend = 0.02; Pi = 0.03 or with late age at menarche (>median

  9. Polymorphisms in genes involved in the estrogen pathway and mammographic density

    International Nuclear Information System (INIS)

    Dumas, Isabelle; Diorio, Caroline

    2010-01-01

    Single nucleotide polymorphisms (SNPs) in genes involved in the estrogen pathway appear to be associated with breast cancer risk and possibly with mammographic density (MD), but little is known of these associations among premenopausal women. This study examines the association of 11 polymorphisms in five estrogen-related genes (estrogen receptors alpha and beta (ERα, ERβ), 17β-hydroxysteroid dehydrogenase 1 (HSD17B1), catechol-O-methyltransferase (COMT), cytochrome P450 1B1 (CYP1B1)) with premenopausal MD. Effect modification of four estrogen-related factors (parity, age at menarche, hormonal derivatives use and body mass index (BMI)) on this relation is also assessed. Polymorphisms were genotyped in 741 premenopausal Caucasian women whose MD was measured in absolute density (AD, cm 2 ) and percent density using a computer-assisted method. Multivariate linear models were used to examine the associations (P trend ) and interactions (P i ). None of the SNPs showed a statistically significant association with AD. However, each additional rare allele of rs1056836 CYP1B1 was associated with a reduction in AD among nulliparous women (P trend = 0.004), while no association was observed among parous women (P trend = 0.62; P i = 0.02). An increase in the number of rare alleles of the HSD17B1 SNP (rs598126 and rs2010750) was associated with an increase in AD among women who never used hormonal derivatives (P trend = 0.06 and P trend = 0.04, respectively), but with a decrease in AD among past hormonal derivatives users (P trend = 0.04; P i = 0.02 and P trend = 0.08; P i = 0.01, respectively). Moreover, a negative association of rs598126 HSD17B1 SNP with AD was observed among women with higher BMI (>median) (P trend = 0.01; P i = 0.02). A negative association between an increased number of rare alleles of COMT rs4680 SNP and AD was limited to women who never used hormonal derivatives (P trend = 0.02; P i = 0.03) or with late age at menarche (>median) (P trend = 0.03; P i

  10. RETRACTED: Relationship between the ACE I/D gene polymorphism and T1DN susceptibility/risk of T1DM developing into T1DN in the Caucasian population.

    Science.gov (United States)

    Zhou, Tian-Biao; Guo, Xue-Feng; Jiang, Zongpei; Li, Hong-Yan

    2015-12-01

    26, 2015 doi: 10.1177/1470320314566019 Tian-Biao Zhou, Xue-Feng Guo, Zongpei Jiang, and Hong-Yan Li Relationship between the ACE I/D gene polymorphism and T1DN susceptibility/risk of T1DM developing into T1DN in the Caucasian population Journal of Renin-Angiotensin-Aldosterone System 1470320314563425, first published on February 1, 2015 doi: 10.1177/1470320314563425 Chun-Hua Yang and Tian-Biao Zhou Relationship between the angiotensinogen A1166C gene polymorphism and the risk of diabetes mellitus developing into diabetic nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314566221, first published on February 1, 2015 doi: 10.1177/1470320314566221 Chun-Hua Yang and Tian-Biao Zhou Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression Journal of Renin-Angiotensin-Aldosterone System 1470320314568521, first published on February 3, 2015 doi: 10.1177/1470320314568521 Articles published in an issue Guohui Liu, Tian-Biao Zhou, Zongpei Jiang, and Dongwen Zheng Association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in a Caucasian population Journal of Renin-Angiotensin-Aldosterone System March 2015 16: 165-171, first published on November 14, 2014 doi: 10.1177/1470320314557849 Weiqiang Zhong, Zhongliang Huang, Yong Wu, Zongpei Jiang, and Tian-Biao Zhou Association of aldosterone synthase (CYP11B2) gene polymorphism with IgA nephropathy risk and progression of IgA nephropathy Journal of Renin-Angiotensin-Aldosterone System September 2015 16: 660-665, first published on August 20, 2014 doi: 10.1177/1470320314524011.

  11. AB126. Association between FOX03A gene polymorphisms and human longevity: a meta-analysis

    OpenAIRE

    Zhao, Shanchao; Bao, Jiming; Song, Xianlu

    2016-01-01

    Objective Numerous studies have shown associations between the FOX03A gene, encoding the forkhead box 03 transcription factor, and human or specifically male longevity. However, the associations of specific FOX03A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. Methods A comprehensive search was conducted to identify studies of FOX03A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% c...

  12. Relationship between gene polymorphisms and development of physical qualities in athletes (based on the material of speed skating

    Directory of Open Access Journals (Sweden)

    Анна Ильютик

    2017-09-01

    Full Text Available The paper summarizes the results of the studies on the identification of the relationship between the polymorphisms in a number of genes with the manifestation of speed-strength qualities and endurance in speed skaters. The theoretical and experimental substantiation is presented for the algorithm of determining the sports specialization of athletes specializing in speed skating on the basis of the results of polymorphism analysis of the genes ACE, NOS3, BDKRB2, ACTN3, PPARG, and CYP17A1. The algorithm consists of determining both the polymorphism of individual genes and the combinations of gene polymorphisms, thus making it possible to estimate the number of alleles and genotypes associated with endurance and/or speed-strength qualities. The use of this algorithm enables identifying physical qualities, to the development of which there is the greatest genetic predisposition, and choosing on their basis a skating specialization of the athlete.

  13. Study of the HFE gene common polymorphisms in French patients with sporadic amyotrophic lateral sclerosis.

    Science.gov (United States)

    Praline, Julien; Blasco, Hélène; Vourc'h, Patrick; Rat, Valérian; Gendrot, Chantal; Camu, William; Andres, Christian R

    2012-06-15

    Our objective was to investigate whether the C282Y (p.Cys 282 Tyr) and H63D (p. His 63 Asp) HFE polymorphisms were associated with sporadic amyotrophic lateral sclerosis (SALS) in the French population. We searched for a relation of HFE polymorphisms with the clinical characteristics of the disease. The HFE polymorphisms were studied in 824 patients with SALS and 583 controls. We compared the frequency of the polymorphisms between SALS and controls groups by univariate and multivariate statistics, taking into account gender, site, age-at-onset and survival. We did not observe significant difference in the frequency of H63D polymorphism between SALS and control group. We observed a significant difference for C282Y between patients and controls with a low frequency of the Y allele in patients (3.2%) compared to our control group (5.9%). Disease duration, distribution of gender, site-of-onset, age-at-onset did not differ between groups taking into account genotypes of each polymorphism. Our results in this large cohort of ALS patients indicate that H63D polymorphism is not associated with SALS in the French population. This conclusion does not exclude a weak effect of the HFE gene polymorphisms in certain ALS populations, or an effect of other rare HFE gene variants. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. WDR1 and CLNK gene polymorphisms correlate with serum glucose and high-density lipoprotein levels in Tibetan gout patients.

    Science.gov (United States)

    Lan, Bing; Chen, Peng; Jiri, Mutu; He, Na; Feng, Tian; Liu, Kai; Jin, Tianbo; Kang, Longli

    2016-03-01

    Current evidence suggests heredity and metabolic syndrome contributes to gout progression. Specifically, the WDR1 and CLNK genes may play a role in gout progression in European ancestry populations. However, no studies have focused on Chinese populations, especially Tibetan individuals. This study aims to determine whether variations in these two genes correlate with gout-related indices in Chinese-Tibetan gout patients. Eleven single-nucleotide polymorphisms in the WDR1 and CLNK genes were detected in 319 Chinese-Tibetan gout patients and 318 controls. We used one-way analysis of variance to evaluate the polymorphisms' effects on gout based on mean serum levels of metabolism indicators, such as albumin, glucose (GLU), triglycerides, cholesterol, high-density lipoproteins (HDL-C), creatinine, and uric acid, from fasting venous blood samples. All p values were Bonferroni corrected. Polymorphisms of the WDR1 and CLNK genes affected multiple risk factors for gout development. Significant differences in serum GLU levels were detected between different genotypic groups with WDRI polymorphisms rs4604059 (p = 0.005) and rs12498927 (p = 0.005). In addition, significant differences in serum HDL-C levels were detected between different genotypic groups with the CLNK polymorphism rs2041215 (p = 0.001). Polymorphisms of CLNK also affected levels of albumin, triglycerides, and creatinine. This study is the first to investigate and identify positive correlations between WDR1 and CLNK gene polymorphisms in Chinese-Tibetan populations. Our findings provide significant evidence for the effect of genetic polymorphisms on gout-related factors in Chinese-Tibetan populations.

  15. Association of ACE, FABP2 and GST genes polymorphism with essential hypertension risk among a North Indian population.

    Science.gov (United States)

    Abbas, Shania; Raza, Syed Tasleem; Chandra, Anu; Rizvi, Saliha; Ahmed, Faisal; Eba, Ale; Mahdi, Farzana

    2015-01-01

    Hypertension has a multi-factorial background based on genetic and environmental interactive factors. ACE, FABP2 and GST genes have been suggested to be involved in the development of hypertension. However, the results have been inconsistent. The present study was carried out to investigate the association of ACE (rs4646994), FABP2 (rs1799883) and GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphism with essential HTN cases and controls. This study includes 138 essential hypertension (HTN) patients and 116 age-, sex- and ethnicity-matched control subjects. GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphisms were evaluated by multiplex PCR, ACE (rs4646994) gene polymorphisms by PCR and FABP2 (rs1799883) gene polymorphisms by PCR-RFLP method. Significant differences were obtained in the frequencies of ACE DD, II genotype (p = 0.006, 0.003), GSTT1 null, GSTM1 positive genotype (p = 0.048, 0.010) and FABP2 Ala54/Ala54 genotype (p = 0.049) between essential HTN cases and controls. It is concluded that ACE (rs 4646994), FABP2 (rs1799883) and GST (GSTM1 null or positive genotype and GSTT1 null or positive genotype) genes polymorphism are associated with HTN. Further investigation with a larger sample size may be required to validate this study.

  16. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  17. Role of TLR4 gene polymorphisms in the colorectal cancer risk ...

    African Journals Online (AJOL)

    Role of TLR4 gene polymorphisms in the colorectal cancer risk modulation in ethnic Kashmiri population – A case–control study. Saniya Nissar, Aga Syed Sameer, Roohi Rasool, Qurteeba Qadri, Nissar A. Chowdri, Fouzia Rashid ...

  18. Polymorphisms of the prion protein gene Arabi sheep breed in Iran

    African Journals Online (AJOL)

    Novin

    2011-11-09

    Nov 9, 2011 ... Key words: Prion protein gene (Prnp), polymorphisms, susceptibility, scrapie. INTRODUCTION. Scrapie is an invariably fatal .... consists of a DNA denaturation step (5 min at 95°C), followed by 30 amplification cycles ...

  19. Role of MTHFR A1298C gene polymorphism in the etiology of ...

    African Journals Online (AJOL)

    Various studies have performed to evaluate the role of MTHFR A1298C gene polymorphism to the risk of prostate cancer and the results were inconclusive and inconsistent. A meta-analysis of published case-control studies, up to December 2014, was performed to investigate the association between MTHFR A1298C gene ...

  20. High-density polymorphisms analysis of 23 candidate genes for association with bone mineral density.

    Science.gov (United States)

    Giroux, Sylvie; Elfassihi, Latifa; Clément, Valérie; Bussières, Johanne; Bureau, Alexandre; Cole, David E C; Rousseau, François

    2010-11-01

    Osteoporosis is a bone disease characterized by low bone mineral density (BMD), a highly heritable and polygenic trait. Women are more prone than men to develop osteoporosis due to a lower peak bone mass and accelerated bone loss at menopause. Peak bone mass has been convincingly shown to be due to genetic factors with heritability up to 80%. Menopausal bone loss has been shown to have around 38% to 49% heritability depending on the site studied. To have more statistical power to detect small genetic effects we focused on premenopausal women. We studied 23 candidate genes, some involved in calcium and vitamin-D regulation and others because estrogens strongly induced their gene expression in mice where it was correlated with humerus trabecular bone density. High-density polymorphisms were selected to cover the entire gene variability and 231 polymorphisms were genotyped in a first sample of 709 premenopausal women. Positive associations were retested in a second, independent, sample of 673 premenopausal women. Ten polymorphisms remained associated with BMD in the combined samples and one was further associated in a large sample of postmenopausal women (1401 women). This associated polymorphism was located in the gene CSF3R (granulocyte colony stimulating factor receptor) that had never been associated with BMD before. The results reported in this study suggest a role for CSF3R in the determination of bone density in women. Copyright © 2010 Elsevier Inc. All rights reserved.

  1. Tumor necrosis factor-alpha and interleukin-4 gene polymorphisms in Chinese patients with gout.

    Science.gov (United States)

    Chen, M-L; Tsai, F-J; Tsai, C-H; Huang, C-M

    2007-01-01

    The purpose of this study was to examine whether polymorphisms of interleukin-4 (IL-4) (promoter-590 and intron 3) and tumor necrosis factor-alpha (TNF-alpha) promoter-308 genes are markers of susceptibility to or clinical manifestations of gout in Taiwanese patients. The study included 196 Taiwanese patients with gout and 103 unrelated healthy control subjects living in central Taiwan. Polymorphisms of the IL-4 (promoter-590 and intron 3) and TNF-alpha (promoter-308) genes were typed from genomic DNA. Allelic frequencies and carriage rates were then compared between gout patients and control subjects. The correlation between allelic frequencies, carriage rates and clinical manifestations of gout were evaluated. No significant differences were observed in the allelic frequencies and carriage rates of the IL-4 (promoter-590 and intron 3) and TNF-alpha gene polymorphisms between patients with gout and healthy control subjects. Furthermore, the IL-4 (promoter-590 and intron 3) and TNF-alpha genotypes were not found to be associated with the clinical and laboratory profiles in gout patients. However, there was a significant difference in the TNF-alphapolymorphism genotype between patients with and without hypertriglyceridemia (P=0.001, xi2=11.47, OR=10.3, 95%CI=3.57-29.7). The results of our study suggest that polymorphisms of the IL-4 (promoter-590 and intron 3) and TNF-alpha promoter-308 genes are not related to gout in Chinese patients in Taiwan.

  2. A polymorphism (rs1042522) in TP53 gene is a risk factor for Down Syndrome in Sicilian mothers.

    Science.gov (United States)

    Salemi, Michele; Barone, Concetta; Salluzzo, Maria Grazia; Giambirtone, Mariaconcetta; Scillato, Francesco; Galati Rando, Rosanna; Romano, Carmelo; Morale, Maria Concetta; Ridolfo, Federico; Romano, Corrado

    2017-11-01

    Trisomy 21 is the most frequent genetic cause of intellectual disability. Tumor Protein 53 (TP53) gene down-regulation triggers chromosomal instability. A TP53 gene polymorphism c.215G > C (rs1042522) is associated with accumulation of aneuploid cells. We analyzed the TP53 c.215G > C (rs1042522) polymorphism in Sicilian mothers of subjects with Down Syndrome (DS) within a case-control study. Nucleotide polymorphism was detected by pyrosequencing technology. The distribution of TP53 c.215G > C polymorphism showed significant difference between mothers of subjects with DS and controls. Our data show that TP53 c.215G > C polymorphism is a risk factor for DS in Sicilian mothers.

  3. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....

  4. Evaluation of TNFRSF11B Gene Polymorphism in Patients with Acute Stroke

    Directory of Open Access Journals (Sweden)

    Pınar Çoğaş

    2016-06-01

    Full Text Available Objective: Tumor necrosis factor receptor superfamily, member 11b (TNFRSF11B has been suggested to be a risk fac­tor for atherosclerosis and cardiovascular diseases because of the observation of osteoporosis and vascular diseases together in human, and the high levels of serum TNFRSF11B in these patients in clinical trials. In this study, we aimed to investigate the association between TNFRSF11B gene 1181G˃C polymorphism and acute stroke as a cerebrovascular disease. Methods: In this study, the DNAs of 107 acute stroke patients and 100 healthy controls have been analyzed by poly­merase chain reaction (PCR and restriction fragment length polymorphism (RFLP. Statistical analyses were performed by using chi-square and analysis of variance tests. Results: When we compared the genotype and allele frequencies of patients and controls, any statistically significant differences was not found between them (p=0.476 and p=0.622, respectively. Any association also was not observed when demographical and clinical characteristics of patients was compared with TNFRSF11B gene 1181G˃C polymor­phism (p>0.05. Conclusion: As a result, our findings showed that there was no association between TNFRSF11B gene 1181G>C poly­morphism and acute stroke. However, further studies can reveal more clearly whether there is a relationship between TNFRSF11B gene polymorphism and acute stroke in Turkish population.

  5. Fat phenotype, associated factors and rs9939609 polymorphism of the FTO gene

    Directory of Open Access Journals (Sweden)

    William Alves Lima

    2010-02-01

    Full Text Available The purpose of this work was to review the main results of studies that have analysed the relationship between the rs9939609 single nucleotide polymorphism (SNP of the FTO gene and the manifestation of overweight/obesity with its associated co-morbidity, and to discuss the interaction of this polymorphism with the other factors which cause obesity. The search was performed using the MEDLINE, Highwire, Science Direct and SciELO databases, applying the following key words: FTO rs9939609, obesity genetic, gene associated obesity, FTO contributes obesity. Inclusion criteria were: original articles where the search was performed in humans and including the rs9939609. Articles that analysed the FTO gene associated with preinstalled hormonal diseases were excluded. Of the several SNP associated with the FTO gene, rs9939609 has been the most researched (studied. This SNP comprises the A and T alleles, with the A homozygote being most susceptible to the development of overweight/obesity in all age ranges, especially in the caucasian population. In this situation, the control of environmental factors (alimentation and physical activity can prevent the excessive build up of fats. Obesity is related to the development of non-transmissible chronic illnesses. Association of rs9939609 polymorphism with the lipidic profile and glycemia were observed. The practicing of physical exercise and feeding habits seem to be the main contributors in the development of overweight/obesity and its resulting co-morbidity.

  6. Promoter polymorphisms in genes involved in porcine myogenesis influence their transcriptional activity.

    Science.gov (United States)

    Bongiorni, Silvia; Tilesi, Francesca; Bicorgna, Silvia; Iacoponi, Francesca; Willems, Daniela; Gargani, Maria; D'Andrea, MariaSilvia; Pilla, Fabio; Valentini, Alessio

    2014-11-07

    Success of meat production and selection for improvement of meat quality is among the primary aims in animal production. Meat quality traits are economically important in swine; however, the underlying genetic nature is very complex. Therefore, an improved pork production strongly depends on identifying and studying how genetic variations contribute to modulate gene expression. Promoters are key regions in gene modulation as they harbour several binding motifs to transcription regulatory factors. Therefore, polymorphisms in these regions are likely to deeply affect RNA levels and consequently protein synthesis. In this study, we report the identification of single nucleotide polymorphisms (SNPs) in promoter regions of candidate genes involved in development, cellular differentiation and muscle growth in Sus scrofa. We identified SNPs in the promoter regions of genes belonging to the Myogenic Regulatory Factors (MRF) gene family (the Myogenic Differentiation gene, MYOD1) and to Growth and Differentiation Factors (GDF) gene family (Myostatin gene, MSTN, GDF8), in Casertana and Large White breeds. The purpose of this study was to investigate if polymorphisms in the promoters could affect the transcriptional activity of these genes. With this aim, we evaluated in vitro the functional activity of the luciferase reporter gene luc2 activity, driven by two constructs carrying different promoter haplotypes. We tested the effects of the G302A (U12574) transition on the promoter efficiency in MYOD1 gene. We ascertained a difference in transcription efficiency for the two variants. A stronger activity of the A-carrying construct is more evident in C2C12. The luciferase expression driven by the MYOD1-A allelic variant displayed a 3.8-fold increased transcriptional activity. We investigated the activity of two haplotype variants (AY527152) in the promoter of GDF8 gene. The haploptype-1 (A435-A447-A879) up-regulated the expression of the reporter gene by a two-fold increase, and

  7. Glypican-4 gene polymorphism (rs1048369) and susceptibility to Epstein-Barr virus-associated and -negative gastric carcinoma.

    Science.gov (United States)

    Zhao, Danrui; Liu, Shuzhen; Sun, Lingling; Zhao, Zhenzhen; Liu, Song; Kuang, Xiaojing; Shu, Jun; Luo, Bing

    2016-07-15

    Gastric cancer (GC) is one of the most common malignant tumors in China and single nucleotide polymorphisms (SNPs) have been found to be highly related to GC carcinogenesis. Glypican-4 (GPC4), a member of the heparan sulphate proteoglycan family, plays an important role in the regulation of cell growth and differentiation. However, little is known about polymorphisms of GPC4 gene and their associated susceptibility to GC, especially to Epstein-Barr virus-associated GC (EBVaGC). Here we studied the GPC4 polymorphism (rs1048369) in GC individuals, especially those with EBVaGC, and we explored an association between the GPC4 gene polymorphism (rs1048369) and susceptibility to EBVaGC and Epstein-Barr virus-negative GC (EBVnGC) in a population from Northern China. The GPC4 gene polymorphism (rs1048369) was detected in 54 cases of EBVaGC and 73 cases of EBVnGC using polymerase chain reaction (PCR). One hundred and seven peripheral blood samples from healthy individuals were also measured as a control group. There were significant differences in both the genotype and allelic frequency of GPC4 gene (rs1048369) between the EBVaGC and EBVnGC patients. Meanwhile, the distribution of genotype and allelic frequency of GPC4 (rs1048369) differed between EBVaGC and control groups. Distribution of the GPC4 genotype also revealed differences between EBVnGC and control groups, no significant differences in the allelic frequency of the GPC4 gene (rs1048369) were observed. The frequency of the T allele in EBVaGC group was significantly higher than that in control and EBVnGC groups. The GPC4 gene polymorphism and the allele of GPC4 are both associated with susceptibility to EBVaGC. The T allele of GPC4 may represent a risk factor for EBVaGC. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Association of impulsivity and polymorphic microRNA-641 target sites in the SNAP-25 gene.

    Directory of Open Access Journals (Sweden)

    Nóra Németh

    Full Text Available Impulsivity is a personality trait of high impact and is connected with several types of maladaptive behavior and psychiatric diseases, such as attention deficit hyperactivity disorder, alcohol and drug abuse, as well as pathological gambling and mood disorders. Polymorphic variants of the SNAP-25 gene emerged as putative genetic components of impulsivity, as SNAP-25 protein plays an important role in the central nervous system, and its SNPs are associated with several psychiatric disorders. In this study we aimed to investigate if polymorphisms in the regulatory regions of the SNAP-25 gene are in association with normal variability of impulsivity. Genotypes and haplotypes of two polymorphisms in the promoter (rs6077690 and rs6039769 and two SNPs in the 3' UTR (rs3746544 and rs1051312 of the SNAP-25 gene were determined in a healthy Hungarian population (N = 901 using PCR-RFLP or real-time PCR in combination with sequence specific probes. Significant association was found between the T-T 3' UTR haplotype and impulsivity, whereas no association could be detected with genotypes or haplotypes of the promoter loci. According to sequence alignment, the polymorphisms in the 3' UTR of the gene alter the binding site of microRNA-641, which was analyzed by luciferase reporter system. It was observed that haplotypes altering one or two nucleotides in the binding site of the seed region of microRNA-641 significantly increased the amount of generated protein in vitro. These findings support the role of polymorphic SNAP-25 variants both at psychogenetic and molecular biological levels.

  9. Association between vitamin D receptor gene polymorphisms and breast cancer risk: a meta-analysis of 39 studies.

    Directory of Open Access Journals (Sweden)

    Kai Zhang

    Full Text Available BACKGROUND: The associations between vitamin D receptor (VDR gene polymorphisms and breast cancer risk were comprehensively investigated to clarify issues that remain controversial. METHODOLOGY/PRINCIPAL FINDINGS: An electronic search was conducted of several databases, including PubMed, the Cochrane library, Web of Science, EMBASE, CBM and CNKI, for papers that describe the association between Fok1, poly-A repeat, Bsm1, Taq1 or Apa1 polymorphisms of the VDR gene and breast cancer risk. Summary odds ratios and 95% confidence intervals (CI were estimated based on a fixed-effect model (FEM or random-effect model (REM, depending on the absence or presence of significant heterogeneity. A total of 39 studies met the inclusion criteria. A meta-analysis of high-quality studies showed that the Fok1 polymorphism of the VDR gene was associated with an increased risk of breast cancer (ff vs. Ff+FF, OR: 1.09, 95%CI: 1.02 to 1.16, p = 0.007. No significant associations were observed between the other polymorphisms and breast cancer risk. No positive results were detected by pooling the results of all relevant studies. CONCLUSION: A meta-analysis of high-quality studies demonstrated that the Fok1 polymorphism of the VDR gene was closely associated with breast cancer risk.

  10. Interleukin-21 gene polymorphism rs2221903 is associated with disease activity in patients with rheumatoid arthritis.

    Science.gov (United States)

    Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof; Pawlik, Andrzej

    2017-08-01

    Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04-2.28; p = 0.035). The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity.

  11. Angiotensin-converting enzyme gene insertion/deletion polymorphism studies in Asian Indian pregnant women biochemically identifies gestational diabetes mellitus.

    Science.gov (United States)

    Khan, Imran A; Jahan, Parveen; Hasan, Qurratulain; Rao, Pragna

    2014-12-01

    Gestational diabetes mellitus (GDM) is defined as glucose intolerance first recognized during pregnancy. Insertion/deletion (I/D) polymorphism of a 287 bp Alu repetitive sequence in intron 16 of the angiotensin-converting enzyme (ACE) gene has been widely investigated in Asian Indian populations with different ethnic origins. The present study examined possible association between I/D polymorphism of the ACE gene and GDM in Asian Indian pregnant women. A total of 200 pregnant women (100 GDM and 100 non-GDM) were recruited in this study and I/D polymorphism of a 287 bp Alu1 element inside intron 16 of the ACE gene was examined by polymerase chain reaction (PCR)-based gel electrophoresis. The distribution of the variants like II, ID, and DD genotypes of ACE gene showed differences between normal GDM versus non-GDM subjects, and the frequency of the ID+ DD Vs II genotype was significant (p=0.0002) in the GDM group. ACE gene polymorphism was associated with GDM in Asian Indian pregnant women. © The Author(s) 2013.

  12. Associations between interleukin-1 gene polymorphisms and coronary heart disease risk: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Liang Zhou

    Full Text Available OBJECTIVE: A great number of studies regarding the associations between IL-1B-511, IL-1B+3954 and IL-1RN VNTR polymorphisms within the IL-1gene cluster and coronary heart disease (CHD have been published. However, results have been inconsistent. In this study, a meta-analysis was performed to investigate the associations. METHODS: Published literature from PubMed and Embase databases were searched for eligible publications. Pooled odds ratios (ORs with 95% confidence intervals (CIs were calculated using random- or fixed- effect model. RESULTS: Thirteen studies (3,219 cases/2,445 controls for IL-1B-511 polymorphism, nine studies (1,828 cases/1,818 controls for IL-1B+3954 polymorphism and twelve studies (2,987 cases/ 2,208 controls for IL-1RN VNTR polymorphism were included in this meta analysis. The results indicated that both IL-1B-511 and IL-1B+3954 polymorphisms were not associated with CHD risk (IL-1B-511 T vs. C: OR = 0.98, 95%CI 0.87-1.09; IL-1B+3954 T vs. C: OR = 1.06, 95%CI 0.95-1.19. Similarly, there was no association between IL-1RN VNTR polymorphism and CHD risk (*2 vs. L: OR = 1.00, 95%CI 0.85-1.17. CONCLUSIONS: This meta-analysis suggested that there were no associations between IL-1 gene cluster polymorphisms and CHD.

  13. Polymorphisms in the vitamin D receptor gene and the androgen receptor gene and the risk of benign prostatic hyperplasia

    NARCIS (Netherlands)

    Bousema, J. T.; Bussemakers, M. J.; van Houwelingen, K. P.; Debruyne, F. M.; Verbeek, A. L.; de la Rosette, J. J.; Kiemeney, L. A.

    2000-01-01

    Little is known about risk factors for the development of benign prostatic hyperplasia (BPH). Recently, associations were observed between prostate cancer (CaP) risk and polymorphisms in the vitamin D receptor (VDR) gene and the androgen receptor (AR) gene. Since both receptors are relevant for

  14. Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects

    OpenAIRE

    Ahmed, Radwan H.; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D.; Al-absi, Boshra; Muniandy, Sekaran

    2016-01-01

    Background Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Method Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 co...

  15. Combination of interleukin-10 gene promoter polymorphisms with HLA-DRB1*15 allele is associated with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Majid Shahbazi

    2017-01-01

    Interpretation & conclusions: The IL-10 and HLA-DRB1*15 polymorphisms were associated with the susceptibility to MS in Iranian patients. Our results suggest that gene-gene interaction of IL-10 polymorphisms and HLA-DRB1*15 alleles may be important factors in the development of MS.

  16. Association of eNOS and HSP70 gene polymorphisms with glaucoma in Pakistani cohorts.

    NARCIS (Netherlands)

    Ayub, H.; Khan, M.I.; Micheal, S.; Akhtar, F.; Ajmal, M.; Shafique, S.; Ali, S.H.; Hollander, A.I. den; Ahmed, A.; Qamar, R.

    2010-01-01

    PURPOSE: To investigate the involvement of stress-regulating genes, endothelial nitric oxide synthase (eNOS) and heat shock protein 70 (HSP70) with primary open angle glaucoma (POAG) and primary closed angle glaucoma (PCAG). METHODS: POAG and PCAG patients recruited from different areas of Pakistan

  17. Codon 129 polymorphism of prion protein gene in is not a risk factor for Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Jerusa Smid

    2013-07-01

    Full Text Available Interaction of prion protein and amyloid-b oligomers has been demonstrated recently. Homozygosity at prion protein gene (PRNP codon 129 is associated with higher risk for Creutzfeldt-Jakob disease. This polymorphism has been addressed as a possible risk factor in Alzheimer disease (AD. Objective To describe the association between codon 129 polymorphisms and AD. Methods We investigated the association of codon 129 polymorphism of PRNP in 99 AD patients and 111 controls, and the association between this polymorphism and cognitive performance. Other polymorphisms of PRNP and additive effect of apolipoprotein E gene (ApoE were evaluated. Results Codon 129 genotype distribution in AD 45.5% methionine (MM, 42.2% methionine valine (MV, 12.1% valine (VV; and 39.6% MM, 50.5% MV, 9.9% VV among controls (p>0.05. There were no differences of cognitive performance concerning codon 129. Stratification according to ApoE genotype did not reveal difference between groups. Conclusion Codon 129 polymorphism is not a risk factor for AD in Brazilian patients.

  18. Association between methylene tetrahydrofolate reductase gene C677T polymorphism with preeclampsia in south-east of Iran

    Directory of Open Access Journals (Sweden)

    Mohsen Saravani

    2011-12-01

    Full Text Available Background: Preeclampsia (PE is a serious problem of pregnancy and its etiology is still unknown. There are some evidence that vascular complications play an important role in development of PE. Methylenetetrahydrofolate reductase (MTHFR is a key enzyme in folate metabolism and the C677T polymorphism of the MTHFR gene is associated with decreased MTHFR activity. The aim of this study was to evaluate the relationship between MTHFR gene C677T polymorphism with PE development in south-east of Iran.Materials and method: This study was performed in 106 preeclamptic pregnant women and 107 control individuals. The C677T polymorphism of the MTHFR gene was determined by PCR-RFLP method. Results: The CC, CT and TT genotypes frequency of C677T polymorphism of MTHFR gene were 77, 22 and 1 percent in preeclamptic women and 73, 19.5 and 7.5 percent in control group. They were not significantly different (p=0.06. However, the frequency of TT genotype was significantly higher in control group (OR=8.5; 95% CI 1.1-71; p=.018. There was not any significant difference in T allele distribution between preeclamptic women (12% and control group (17%. Conclusion: Our results showed that there was not any correlation between the C677T polymorphism and PE but the TT genotype of C677T polymorphism seems to be a protective factor for preeclampsia

  19. MBL, P2X7, and SLC11A1 gene polymorphisms in patients with oropharyngeal tularemia.

    Science.gov (United States)

    Somuk, Battal Tahsin; Koc, Sema; Ates, Omer; Göktas, Göksel; Soyalic, Harun; Uysal, Ismail Onder; Gurbuzler, Levent; Sapmaz, Emrah; Sezer, Saime; Eyibilen, Ahmet

    2016-11-01

    A significant association was found of oropharyngeal tularemia with SLC11A1 allele polymorphism (INT4 G/C) and MBL2 C + 4T (P/Q). These results indicate C allele and Q allele might be a risk factor for the development of oropharyngeal tularemia. This study aimed to investigate the relationship of SLC11A1, MBL, and P2X 7 gene polymorphism with oropharyngeal tularemia. The study included totally 120 patients who were diagnosed with oropharyngeal tularemia. Frequencies of polymorphisms in the following genes were analyzed both in the patient and control groups in the study: SLC11A1 (5'(GT) n Allele 2/3, Int4 G/C, 3' UTR, D543N G/A), MBL (MBL2 C + 4T (P/Q), and P2X 7 (-762 C/T and 1513 A/C). Among all polymorphisms that were investigated in this study, SLC11A1 gene showed a significance in the distriburtion of polymorphism allelle frequency at the INT4 region. Frequency of C allele was 54 (28%) in patients with oropharyngeal tularemia, and 31 (13%) in the control group (p = 0.006 and OR = 1.96 (1.21-3.20)). An association was detected between MBL2 C + 4T (P/Q) gene polymorphism and oropharyngeal tularemia (p tularemia in this study (p > 0.05).

  20. An association between apo-A4 gene polymorphism (Thr347Ser ...

    African Journals Online (AJOL)

    Pramod Kumar

    Objective: We aimed at studying the relationship between apoA4 gene polymorphisms (Thr347Ser and ... showed significant association with lipid risk factors like high levels of ..... in German population showed that Ser347 allele is associated.

  1. Association of peroxisome proliferator-activated receptor single-nucleotide polymorphisms and gene-gene interactions with the lipoprotein(a)

    Institute of Scientific and Technical Information of China (English)

    解惠坚

    2014-01-01

    Objective To examine the associations of 10 singlenucleotide polymorphisms(SNPs)in peroxisome proliferator-activated receptor(PPARs)gene with lipoprotein(a)level,and to investigate if there is gene-gene interaction among the SNPs on lipoprotein(a)level.Methods Totally 644 subjects(234 men and 410 women)were enrolled from Prevention of Multiple Metabolic Disorders and Metabolic Syndrome Study Cohort,which was an urban community survey study conducted in Jiangsu province.Ten SNPs in PPARα(rs135539,rs4253778,

  2. Polymorphism in leptin receptor gene was associated with obesity in ...

    African Journals Online (AJOL)

    Pramudji Hastuti

    2016-01-11

    Jan 11, 2016 ... This study aims to determine the association of LEPR gene polymorphisms, rs1137100 and rs1137101, on .... and that leptin levels were correlated with type 2 diabetes mel- .... Research using statistical meta-analysis [36,37] found ... and changes in glucose homeostasis in response to regular exercise.

  3. IL-1RN gene polymorphism is associated with peri-implantitis

    NARCIS (Netherlands)

    Laine, Marja L.; Leonhardt, Asa; Roos-Jansaker, Ann-Marie; Salvador Pena, A.; van Winkelhoff, Arie Jan; Winkel, Edwin G.; Renvert, Stefan

    Objectives: Interleukin (IL)-1 alpha, IL-1 beta and their natural specific inhibitor IL-1 receptor antagonist (IL-1ra) play a key role in the regulation of the inflammatory response in periodontal tissues. Polymorphisms in the IL-1 gene cluster have been associated with severe adult periodontitis.

  4. Polymorphisms in Dopamine System Genes Are Associated with Individual Differences in Attention in Infancy

    Science.gov (United States)

    Holmboe, Karla; Nemoda, Zsofia; Fearon, R. M. Pasco; Csibra, Gergely; Sasvari-Szekely, Maria; Johnson, Mark H.

    2010-01-01

    Knowledge about the functional status of the frontal cortex in infancy is limited. This study investigated the effects of polymorphisms in four dopamine system genes on performance in a task developed to assess such functioning, the Freeze-Frame task, at 9 months of age. Polymorphisms in the catechol-O-methyltransferase ("COMT") and the…

  5. RETRACTED: Association between the ACE I/D gene polymorphism and T2DN susceptibility: The risk of T2DM developing into T2DN in the Asian population.

    Science.gov (United States)

    Zhong, Weiqiang; Jiang, Zongpei; Zhou, Tian-Biao

    2015-12-01

    .1177/1470320314566019 Tian-Biao Zhou, Xue-Feng Guo, Zongpei Jiang, and Hong-Yan Li Relationship between the ACE I/D gene polymorphism and T1DN susceptibility/risk of T1DM developing into T1DN in the Caucasian population Journal of Renin-Angiotensin-Aldosterone System 1470320314563425, first published on February 1, 2015 doi: 10.1177/1470320314563425 Chun-Hua Yang and Tian-Biao Zhou Relationship between the angiotensinogen A1166C gene polymorphism and the risk of diabetes mellitus developing into diabetic nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314566221, first published on February 1, 2015 doi: 10.1177/1470320314566221 Chun-Hua Yang and Tian-Biao Zhou Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression Journal of Renin-Angiotensin-Aldosterone System 1470320314568521, first published on February 3, 2015 doi: 10.1177/1470320314568521 Articles published in an issue Guohui Liu, Tian-Biao Zhou, Zongpei Jiang, and Dongwen Zheng Association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in a Caucasian population Journal of Renin-Angiotensin-Aldosterone System March 2015 16: 165-171, first published on November 14, 2014 doi: 10.1177/1470320314557849 Weiqiang Zhong, Zhongliang Huang, Yong Wu, Zongpei Jiang, and Tian-Biao Zhou Association of aldosterone synthase (CYP11B2) gene polymorphism with IgA nephropathy risk and progression of IgA nephropathy Journal of Renin-Angiotensin-Aldosterone System September 2015 16: 660-665, first published on August 20, 2014 doi: 10.1177/1470320314524011.

  6. 4G/5G Variant of Plasminogen Activator Inhibitor-1 Gene and Severe Pregnancy-Induced Hypertension: Subgroup Analyses of Variants of Angiotensinogen and Endothelial Nitric Oxide Synthase

    Science.gov (United States)

    Kobashi, Gen; Ohta, Kaori; Yamada, Hideto; Hata, Akira; Minakami, Hisanori; Sakuragi, Noriaki; Tamashiro, Hiko; Fujimoto, Seiichiro

    2009-01-01

    Background Pregnancy-induced hypertension (PIH) is a common cause of perinatal mortality. It is believed to result from the interaction of several factors, including those related to the blood coagulation system. We performed genotyping and subgroup analyses to determine if the 4G/5G genotypes of the plasminogen activator inhibitor-1 gene (PAI-1) play a role in the pathogenesis of PIH, and to evaluate possible interactions of the PAI-1 polymorphisms with those of the angiotensinogen gene (AGT) and the endothelial nitric oxide synthase gene (NOS3). Methods An association study of PAI-1 polymorphism, and subgroup analyses of common variants of AGT and NOS3, among 128 patients with PIH and 376 healthy pregnant controls. Results No significant differences were found between the cases and controls in the frequencies of allele 4G or the 4G/4G genotype. In subgroup analyses, after adjustment for multiple comparison, a significant association with the AGT TT genotype was found among women with the PAI-1 4G/4G genotype, and an association with the NOS3 GA+AA genotype was found among women with the 5G/5G or 4G/5G genotypes. Conclusions Our findings suggest that there are at least 2 pathways in the pathogenesis of severe PIH. However, with respect to early prediction and prevention of severe PIH, although the PAI-1 4G/4G genotype alone was not a risk factor for severe PIH, the fact that PAI-1 genotypes are associated with varying risks for severe PIH suggests that PAI-1 genotyping of pregnant women, in combination with other tests, may be useful in the development of individualized measures that may prevent severe PIH. PMID:19838007

  7. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  8. [Association of polymorphisms in toll-like receptor genes with atopic dermatitis in the Republic of Bashkortostan].

    Science.gov (United States)

    Gimalova, G F; Karunas, A S; Fedorova, Iu Iu; Gumennaia, É R; Levasheva, S V; Khismatullina, Z R; Prans, E; Koks, S; Étkina, É I; Khusnutdinova, É K

    2014-01-01

    Atopic dermatitis (AD) is a prevalent chronic inflammatory skin disease developing as a result of the interaction between genetic predisposition and environmental factors. Considerable role in allergic diseases development is played by polymorphisms of genes of pattern-recognition receptors (PRR) which are capable of recognizing conservative standard molecular structures (patterns) unique for large pathogen groups. In this study polymorphic variants of PRR genes--Toll-like receptors (TLR1, TLR2, TLR4, TLR5, TLR6, TLR9, TLR10), NOD-like receptors (NOD1, NOD2), lipopolysaccharide receptor CD14 gene, and C11orf30 and LRRC32 genes, located in 11q13.5 region, have been investigated in AD patients and control subjects from the Republic of Bashkortostan. An association of TLR1 (rs5743571 and rs5743604), TLR6 (rs5743794) and TLR10 (rs11466617) with AD was found. Our results confirm an important role of the innate immune system in the pathogenesis of AD and the significance of polymorphisms within the Toll-like receptor 2 subfamily genes in AD development.

  9. The SPO11-C631T gene polymorphism and male infertility risk: a meta-analysis.

    Science.gov (United States)

    Ren, Zheng-Ju; Ren, Peng-Wei; Yang, Bo; Liao, Jian; Liu, Sheng-Zhuo; Fang, Kun; Ren, Shang-Qing; Liu, Liang-Ren; Dong, Qiang

    2017-11-01

    To evaluate the association between the SPO11 gene C631T polymorphism and the risk of male infertility. We conducted a search on PubMed, Embase, Web of Science, Chinese National Knowledge Infrastructure (CNKI), China biology medical literature database (CBM), VIP, and Chinese literature database (Wan Fang) on 31 March 2016. Odds ratio (OR) and 95% confidence interval (95%CI) were used to assess the strength of associations. A total of five studies including 542 cases and 510 controls were involved in this meta-analysis. The pooled results indicated that the SPO11 gene C631T polymorphism was significantly associated with increased risk of male infertility (TT + CT vs. CC: OR = 4.14, 95%CI = 2.48-6.89; CT vs. CC: OR = 4.34, 95%CI = 2.56-7.34; T vs. C: OR = 4.35, 95%CI = 2.58-7.34). Subgroup analysis of different countries proved the relationship between SPO11 gene C631T polymorphism and male infertility risk in Chinese, but not in Iranian peoples. In conclusion, this study suggested that SPO11 gene C631T polymorphism may contribute as a genetic factor susceptible to cause male infertility. Furthermore, more large sample and representative population-based cases and well-matched controls are needed to validate our results.

  10. A polymorphism in the IGF-I gene influences the age-related decline in circulating total IGF-I levels

    NARCIS (Netherlands)

    I. Rietveld (Ingrid); J.A.M.J.L. Janssen (Joseph); A. Hofman (Albert); C.M. van Duijn (Cornelia); S.W.J. Lamberts (Steven); H.A.P. Pols (Huib)

    2003-01-01

    markdownabstractOBJECTIVE: Recent studies have demonstrated an association between a 192 bp polymorphism of the IGF-I gene and total IGF-I serum levels, birth weight, body height and the risk of developing diabetes and cardiovascular diseases later on in life. This IGF-I gene polymorphism in the

  11. Reward dependence is related to norepinephrine transporter T-182C gene polymorphism in a Korean population.

    Science.gov (United States)

    Ham, Byung-Joo; Choi, Myoung-Jin; Lee, Heon-Jeong; Kang, Rhee-Hun; Lee, Min-Soo

    2005-06-01

    It is well established that approximately 50% of the variance in personality traits is genetic. The goal of this study was to investigate a relationship between personality traits and the T-182C polymorphism in the norepinephrine transporter gene. The participants included 115 healthy adults with no history of psychiatric disorders and other physical illness during the past 6 months. All participants were tested with the Temperament and Character Inventory and genotyped norepinephrine transporter gene polymorphism. Differences on the Temperament and Character Inventory dimensions among three groups were examined with one-way analysis of variance. Our study suggests that the norepinephrine transporter T-182C gene polymorphism is associated with reward dependence in Koreans, but the small number of study participants and their sex and age heterogeneity limits generalization of our results. Further studies are necessary with a larger number of homogeneous participants to confirm whether the norepinephrine transporter gene is related to personality traits.

  12. [Study on association of CTLA4 gene polymorphism with Grave's disease in Guangxi Zhuang nationality population].

    Science.gov (United States)

    Liang, Xing-huan; Qin, Ying-fen; Ma, Yan; Xie, Xin-rong; Xie, Kai-qing; Luo, Zuo-jie

    2006-06-01

    To investigate the relationship between the polymorphic (AT)n repeats in 3ountranslated region of exon 4 of CTLA4 gene [CTLA4(AT)n] and Graveso disease (GD) in Zhuang nationality population of Guangxi province. The studied groups comprised 48 patients with GD and 44 normal controls. Amplification of target DNA was carried out by polymerase chain reaction (PCR). The amplified products were run by 8% polyacrylamide gel electrophoresis, and then followed by 0.1% silver staining. Some of amplified products were sequenced directly. Nineteen alleles of CTLA4 gene microsatellite polymorphism were found in Guangxi Zhuang nationality individuals. The 106 bp long allele was apparently increased in patients with GD of Zhuang nationality but not in healthy controls (Pdisease in Zhuang nationality population of Guangxi province. CTLA4(AT)n 106 bp may be the susceptible gene in GD patients of Zhuang nationality in Guangxi; 19 alleles of CTLA4 gene microsatellite polymorphism were found in Guangxi Zhuang nationality individuals.

  13. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi

    2010-10-01

    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  14. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    Science.gov (United States)

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  15. Uterine leiomyoma is associated with a polymorphism in the interleukin 1-beta gene.

    Science.gov (United States)

    Pietrowski, Detlef; Thewes, Roberta; Sator, Michael; Denschlag, Dominik; Keck, Christoph; Tempfer, Clemens

    2009-08-01

    To investigate whether polymorphisms in the interleukin-1beta (IL-1beta) gene are associated with uterine leiomyoma. Case-control study in a collective of 131 patients and 280 controls. Genotyping of the IL-1beta-511 and IL-1beta-3954 polymorphism was performed by PCR amplification and subsequent RFLP analysis. A significant difference in the allele frequencies of the IL-1beta-511 Cpolymorphism was found. Allele frequencies of the IL-1beta-511 Cpolymorphism were 70.6% (C allele) in the patient group and 57.1% in the control group [P < 0.0002; odds ratio (OR) 1.81; 95% confidence interval (CI): 1.32-2.47]. The genotype distributions showed also differences using a dominant genotype model (C/C vs. C/T+T/T; P < 0.0002; OR 2.73; 95% CI: 1.77-4.2). No difference was found in the IL-1beta-3954 polymorphism. The IL-1beta-511 promoter polymorphism is related to an increased susceptibility to uterine leiomyoma, suggesting that this polymorphism does contribute to the development of this disease.

  16. R229Q Polymorphism of NPHS2 Gene in Group of Iraqi Children with Steroid-Resistant Nephrotic Syndrome

    Directory of Open Access Journals (Sweden)

    Shatha Hussain Ali

    2017-01-01

    Full Text Available Background. The polymorphism R229Q is one of the most commonly reported podocin sequence variations among steroid-resistant nephrotic syndromes (SRNS. Aim of the Study. We investigated the frequency and risk of this polymorphism among a group of Iraqi children with SRNS and steroid-sensitive nephrotic syndrome (SSNS. Patients and Methods. A prospective case control study which was conducted in Al-Imamein Al-Kadhimein Medical City, spanning the period from the 1st of April 2015 to 30th of November 2015. Study sample consisted of 54 children having NS, divided into 2 groups: patients group consisted of 27 children with SRNS, and control group involved 27 children with SSNS. Both were screened by real time polymerase chain reaction for R229Q in exon 5 of NPHS2 gene. Results. Molecular study showed R229Q polymorphism in 96.3% of SRNS and 100% of SSNS. There were no phenotypic or histologic characteristics of patients bearing homozygous R229Q polymorphism and the patients with heterozygous R229Q polymorphism. Conclusion. Polymorphism R229Q of NPHS2 gene is prevalent in Iraqi children with SRNS and SSNS. Further study needs to be done, for other exons and polymorphism of NPHS2 gene in those patients.

  17. Insulin gene polymorphisms in type 1 diabetes, Addison's disease and the polyglandular autoimmune syndrome type II

    Directory of Open Access Journals (Sweden)

    Hahner Stefanie

    2008-07-01

    Full Text Available Abstract Background Polymorphisms within the insulin gene can influence insulin expression in the pancreas and especially in the thymus, where self-antigens are processed, shaping the T cell repertoire into selftolerance, a process that protects from β-cell autoimmunity. Methods We investigated the role of the -2221Msp(C/T and -23HphI(A/T polymorphisms within the insulin gene in patients with a monoglandular autoimmune endocrine disease [patients with isolated type 1 diabetes (T1D, n = 317, Addison's disease (AD, n = 107 or Hashimoto's thyroiditis (HT, n = 61], those with a polyglandular autoimmune syndrome type II (combination of T1D and/or AD with HT or GD, n = 62 as well as in healthy controls (HC, n = 275. Results T1D patients carried significantly more often the homozygous genotype "CC" -2221Msp(C/T and "AA" -23HphI(A/T polymorphisms than the HC (78.5% vs. 66.2%, p = 0.0027 and 75.4% vs. 52.4%, p = 3.7 × 10-8, respectively. The distribution of insulin gene polymorphisms did not show significant differences between patients with AD, HT, or APS-II and HC. Conclusion We demonstrate that the allele "C" of the -2221Msp(C/T and "A" -23HphI(A/T insulin gene polymorphisms confer susceptibility to T1D but not to isolated AD, HT or as a part of the APS-II.

  18. Polymorphism of the renalase gene in gestational diabetes mellitus.

    Science.gov (United States)

    Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna

    2017-01-01

    Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.

  19. IHH gene polymorphism among three horse breeds and its application for association test in horses with osteochondrosis.

    Science.gov (United States)

    Zabek, T; Golonka, P; Fornal, A; Semik, E

    2013-06-01

    Genetic polymorphism of IHH gene were investigated in Angloarabian, Polish Coldblood and Polish Halfbred horses with the inclusion of a group of Polish Halfbreds affected by osteochondrosis. IHH is a good candidate gene for association study of developmental disorders mainly affecting skeleton development. DNA sequence spanning IHH gene annotated in the horse genome and its putative promoter were investigated using SANGER sequencing. Analysis of genetic variability at polymorphic sites in the IHH gene body and the promoter region confirmed genetic differences between warmblood and coldblood horse breeds. A test for allelic and genotypic association at particular SNP sites revealed no association with osteochondrosis in investigated group of Polish Halfbreds. It was concluded that participation of different warmblood breeds in pedigrees of Polish Halfbreds make it difficult to search for genetic variants being associated with this complex disorder in this breed. IHH gene polymorphism investigated among three different horse populations would be valuable for further studies on equine bone developmental disorders. © 2013 The Authors.

  20. Assessment of the rs4340 ACE gene polymorphism in acute coronary syndrome in a Western Mexican population.

    Science.gov (United States)

    Valdez-Haro, A; Valle, Y; Valdes-Alvarado, E; Casillas-Muñoz, F; Muñoz-Valle, J F; Reynoso-Villalpando, G L; Flores-Salinas, H E; Padilla-Gutiérrez, J R

    2017-09-27

    Acute coronary syndrome (ACS) is considered one of the main causes of death worldwide. Contradictory findings concerning the impact of the angiotensin-converting enzyme (ACE) gene on cardiovascular diseases have been reported. Previous conclusions point out that the variability in results depends on ethnicity and genetic polymorphisms to determine the association of rs4340 polymorphisms of the ACE gene and ACE circulating levels in ACS. Genotyping of rs4340 polymorphisms was performed in a total of 600 individuals from Western Mexico divided into two groups: the ACS and the control group (CG). The polymorphisms were identified by polymerase chain reaction. Serum ACE concentration was determined by enzyme-linked immunosorbent assay. D/D carriers had higher ACE levels than I/I carriers (3.6 vs 2.8 ng/mL, P ACE concentration levels; however, the polymorphism was not associated with ACS.

  1. Methylenetetrahydrofolate reductase C677T gene polymorphism in Turkish patients with polycystic ovary syndrome.

    Science.gov (United States)

    Karadeniz, Muammer; Erdogan, Mehmet; Zengi, Ayhan; Eroglu, Zuhal; Tamsel, Sadik; Olukman, Murat; Saygili, Fusun; Yilmaz, Candeger

    2010-08-01

    Higher Levels of Hcy are associated with several clinical conditions, among them non-insulin-dependent diabetes mellitus, endometrial dysplasia and hypertension with insulin resistance, and polycystic ovary syndrome. The purpose of this study was to investigate the serum homocystein levels and other metabolic parameters in relationship with the MTHFR C677T gene polymorphism in patients with PCOS. Our study included 86 young women with PCOS constituting the study group and 70 healthy women constituting the control group. Homocystein levels, metabolic, and hormonal parameters were measured, and genetic analysis of the MTHFR C677T gene polymorphism was performed in all the subjects. A statistically significant difference was observed in mean homocystein levels between patients with PCOS when compared to the control group. The MTHFR 677 CC genotypes had significantly higher proportions in the control group compared to the PCOS patients (χ(2) = 21.381, P homocystein levels were higher than normal subjects in patients with PCOS and that the MTHFR C677T gene polymorphism does not influence homocystein levels of patients with PCOS.

  2. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

    2008-01-01

    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  3. Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Ji-Ming Bao

    2014-06-01

    Full Text Available Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs and 95% confidence intervals (CIs were calculated by comparing the minor and major alleles. A total of seven articles reporting associations of FOXO3A polymorphisms with longevity were identified and included in this meta-analysis. These comprised 11 independent studies with 5241 cases and 5724 controls from different ethnic groups. rs2802292, rs2764264, rs13217795, rs1935949 and rs2802288 polymorphisms were associated with human longevity (OR = 1.36, 95% CI = 1.10-1.69, P= 0.005; OR = 1.20, 95% CI = 1.04-1.37, P= 0.01; OR = 1.27, 95% CI = 1.10-1.46, P= 0.001; OR = 1.14, 95% CI = 1.01-1.27 and OR = 1.24, 95% CI = 1.07-1.43, P= 0.003, respectively. Analysis stratified by gender indicated significant associations between rs2802292, rs2764264 and rs13217795 and male longevity (OR = 1.54, 95% CI = 1.33-1.79, P < 0.001; OR = 1.38, 95% CI = 1.15-1.66, P= 0.001; and OR = 1.39, 95% CI = 1.15-1.67, P= 0.001, but rs2802292, rs2764264 and rs1935949 were not linked to female longevity. Moreover, our study showed no association between rs2153960, rs7762395 or rs13220810 polymorphisms and longevity. In conclusion, this meta-analysis indicates a significant association of five FOXO3A gene polymorphisms with longevity, with the effects of rs2802292 and rs2764264 being male-specific. Further investigations are required to confirm these findings.

  4. Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis.

    Science.gov (United States)

    Bao, Ji-Ming; Song, Xian-Lu; Hong, Ying-Qia; Zhu, Hai-Li; Li, Cui; Zhang, Tao; Chen, Wei; Zhao, Shan-Chao; Chen, Qing

    2014-01-01

    Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% confidence intervals (CIs) were calculated by comparing the minor and major alleles. A total of seven articles reporting associations of FOXO3A polymorphisms with longevity were identified and included in this meta-analysis. These comprised 11 independent studies with 5241 cases and 5724 controls from different ethnic groups. rs2802292, rs2764264, rs13217795, rs1935949 and rs2802288 polymorphisms were associated with human longevity (OR = 1.36, 95% CI = 1.10-1.69, P= 0.005; OR = 1.20, 95% CI = 1.04-1.37, P= 0.01; OR = 1.27, 95% CI = 1.10-1.46, P= 0.001; OR = 1.14, 95% CI = 1.01-1.27 and OR = 1.24, 95% CI = 1.07-1.43, P= 0.003, respectively). Analysis stratified by gender indicated significant associations between rs2802292, rs2764264 and rs13217795 and male longevity (OR = 1.54, 95% CI = 1.33-1.79, P < 0.001; OR = 1.38, 95% CI = 1.15-1.66, P= 0.001; and OR = 1.39, 95% CI = 1.15-1.67, P= 0.001), but rs2802292, rs2764264 and rs1935949 were not linked to female longevity. Moreover, our study showed no association between rs2153960, rs7762395 or rs13220810 polymorphisms and longevity. In conclusion, this meta-analysis indicates a significant association of five FOXO3A gene polymorphisms with longevity, with the effects of rs2802292 and rs2764264 being male-specific. Further investigations are required to confirm these findings.

  5. Dopamine D2 receptor gene polymorphisms and externalizing behaviors in children and adolescents.

    Science.gov (United States)

    Della Torre, Osmar Henrique; Paes, Lúcia Arisaka; Henriques, Taciane Barbosa; de Mello, Maricilda Palandi; Celeri, Eloisa Helena Rubello Valler; Dalgalarrondo, Paulo; Guerra-Júnior, Gil; Santos-Júnior, Amilton Dos

    2018-05-02

    Dopamine is involved in several cerebral physiological processes, and single nucleotide polymorphisms (SNP) in the dopamine D2 receptor gene (DRD2) have been associated with numerous neurological and mental disorders, including those involving alterations in cognitive and emotional processes. The aim of this study was to evaluate the association between the SNPs c.957C > T (rs6277) and c.-585A > G (rs1799978) in the DRD2 gene and behavioral characteristics of children and adolescents based on an inventory of the Child Behavior Checklist (CBCL). Children and adolescents between 8 and 20 years old who were clinically followed-up were genotyped for the SNPs c.957C > T and c.-585A > G, and related to data of the CBCL/6-18 scale assessment performed with the help of caregivers. The chi-squared test was used to assess the differences in the frequencies of the C and T alleles in the polymorphism c.957C > T and of the A and G alleles in the polymorphism c.-585A > G with respect to the grouped CBCL scores at a significance level of 5%. Multiple logistic regression models were performed, to control whether sex and/or ethnicity could influence the results. Eighty-five patients were assessed overall, and the presence of the T allele (C/T and T/T) of DRD2 c.957C > T polymorphism was found to be significantly associated with the occurrence of defiant and oppositional problems and with attention and hyperactivity problems. There were no associations detected with polymorphism DRD2 c.-585A > G polymorphism. Both SNPs were in Hardy-Weinberg-equilibrium. Although the findings of this study are preliminary, due to its small number of participants, the presence of T allele (C/T, T/T) in c.957C > T SNP was associated with difficulty in impulse control, self-control of emotions, and conduct adjustment, which can contribute to improving the identification of mental and behavioral phenotypes associated with gene expression.

  6. TIMP2 gene polymorphism as a potential tool to infer Brazilian population origin

    Directory of Open Access Journals (Sweden)

    da Silva RA

    2013-12-01

    Full Text Available Rodrigo Augusto da Silva,1 André Luis Shinohara,2 Denise Carleto Andia,1 Ariadne Letra,3 Regina Célia Peres,1 Ana Paula de Souza11Department of Morphology, Piracicaba Dental School, State University of Campinas, 2Oral Biology Program, Bauru Dental School, State University of São Paulo, São Paulo, Brazil; 3Department of Endodontics and Center for Craniofacial Research, School of Dentistry, University of Texas Health Science Center, Houston, TX, USAAbstract: Single nucleotide polymorphisms are genome variations that can be used as population-specific markers to infer genetic background and population origin. The Brazilian population is highly admixed due to immigration from several other populations. In particular, the state of São Paulo is recognized for the presence of Japanese individuals who seem likely to have contributed to a substantial proportion of ancestry in the modern Brazilian population. In the present study, we analyzed allele and genotype frequencies and associations of the –418G>C (rs8179090 single nucleotide polymorphism in the TIMP2 gene promoter in Brazilian and Japanese subjects, as well as in Japanese descendants from southeastern Brazil. The allele and genotype frequency analyses among groups demonstrated statistical significance (PC single nucleotide polymorphism of the TIMP2 gene, have a high probability of being Japanese or Japanese descendants. In addition to other genetic polymorphisms, the −418G>C TIMP2 polymorphism could be a population marker to assist in predicting Japanese ancestry, both in Japanese individuals and in admixed populations.Keywords: Brazilian, Japanese, polymorphism, allele, TIMP2

  7. The Association of Polymorphisms in Leptin/Leptin Receptor Genes and Ghrelin/Ghrelin Receptor Genes With Overweight/Obesity and the Related Metabolic Disturbances: A Review

    OpenAIRE

    Ghalandari; Hosseini-Esfahani; Mirmiran

    2015-01-01

    Context Leptin and ghrelin are two important appetite and energy balance-regulating peptides. Common polymorphisms in the genes coding these peptides and their related receptors are shown to be associated with body weight, different markers of obesity and metabolic abnormalities. This review article aims to investigate the association of common polymorphisms of these genes with overweight/obesity and the metabolic disturbances related to it. E...

  8. Association of polymorphism of the alpha 1-antitrypsin gene with ...

    African Journals Online (AJOL)

    In order to determine the relationship between the polymorphisms of the AAT gene and milk production traits and SCS, the General Linear Model (GLM) procedure from the Statistical Analysis Software was used. SNP5504 affected milk fat percentage, SNP8178 affected milk protein percentage and SNP5609 and SNP5624 ...

  9. Polymorphisms in the selenoprotein S gene: lack of association with autoimmune inflammatory diseases

    Directory of Open Access Journals (Sweden)

    Díaz-Rubio Manuel

    2008-07-01

    Full Text Available Abstract Background Selenoprotein S (SelS protects the functional integrity of the endoplasmic reticulum against the deleterious effects of metabolic stress. SEPS1/SelS polymorphisms have been involved in the increased release of pro-inflammatory cytokines interleukin (IL-1β, tumor necrosis factor (TNF-α and IL-6 in macrophages. We aimed at investigating the role of the SEPS1 variants previously associated with higher plasma levels of these cytokines and of the SEPS1 haplotypes in the susceptibility to develop immune-mediated diseases characterized by an inflammatory component. Results Six polymorphisms distributed through the SEPS1 gene (rs11327127, rs28665122, rs4965814, rs12917258, rs4965373 and rs2101171 were genotyped in more than two thousand patients suffering from type 1 diabetes, rheumatoid arthritis or inflammatory bowel diseases and 550 healthy controls included in the case-control study. Conclusion Lack of association of SEPS1 polymorphisms or haplotypes precludes a major role of this gene increasing predisposition to these inflammatory diseases.

  10. Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

    NARCIS (Netherlands)

    Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

    2000-01-01

    The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

  11. [Correlation of angiotensin-converting enzyme 2 gene polymorphism with antihypertensive effects of benazepril].

    Science.gov (United States)

    Chen, Qing; Tang, Xun; Yu, Can-qing; Chen, Da-fang; Tian, Jun; Cao, Yang; Fan, Wen-yi; Cao, Wei-hua; Zhan, Si-yan; Lv, Jun; Guo, Xiao-xia; Li, Li-ming; Hu, Yong-hua

    2010-06-18

    To explore the correlation of rs2106809 from angiotensin-converting enzyme 2 gene with antihypertensive effects of benazepril, as well as its interactions with polymorphisms of angiotensinogen(AGT) and angiotensin II type 1 receptor(AGTR1) gene. Correlation between rs2106809 and blood pressure reduction was estimated based on a field trail with 1 831 hypertensive patients using benazepril for 2 weeks. Generalized multifactor dimensionality reduction (GMDR) was used to explore the interactions of rs2106809 and 8 single nucleotide polymorphisms (SNPs) of AGTR1 gene and 3 SNPs of AGT gene. rs2106809 was found to be associated with reduction in systolic blood pressure and pulse pressure in women, as well as pulse pressure reduction in men. T allele carriers presented more blood pressure reduction (1.4, 1.3 and 0.9 mmHg/T allele respectively). Gene-gene interactions involving rs2106809 were found in systolic blood pressure reduction of men, and the response to benazepril of non-sensitive genotypes carriers was 8.2 (95% confidence interval: 6.6-9.7) mmHg, lower than that of sensitive genotypes carriers. rs2106809 might act as an independent influencing factor or component of gene-gene interaction in blood pressure reducing effects of benazepril.

  12. Association of Human Methionine Synthase-A2756G Transition With Prostate Cancer: A Case-Control Study and in Silico Analysis

    Directory of Open Access Journals (Sweden)

    Arezou Ebrahimi

    2017-07-01

    Full Text Available Methionine synthase (MTR is one of the key enzymes of folate pathway, which play a key role in the construction, repair, and methylation of DNA. In this study, an association of MTR A2756G gene transition with prostate cancer in men populations of Kashan-Iran was investigated by a case-control study and an in silico analysis. The 200 samples including 100 patients with prostate cancer, as case group and 100 healthy men, as control group included in this study. MTR-A2756G genotyping was performed by PCR-RFLP technique. Some in silico tools used to evaluate the effects of A2756G transition on the structure and function of MTR. Results showed that the AG genotype (OR: 2.4014, 95% CI: 1.3216-4.3636, P=0.0040, and GG genotype (OR: 3.6324, 95% CI: 1.2629-10.4475, P=0.0167 and G allele (OR: 2.0120, 95% CI: 1.3098-3.0905, P=0.0014 were associated with prostate cancer. In silico analysis showed that polymorphisms of the enzyme protein might change properties of MTR such as relative mutability and flexibility, which leads to alteration of stability and function of the enzyme. Based on the results, an MTR-A2756G polymorphism which changes activity and stability of the methionine synthase associated with prostate cancer in men. It is a preliminary study and is presenting data for future comprehensive study for making a clinical conclusion that this gene transition is a biomarker for susceptibility to prostate cancer.

  13. The association between Interleukin (IL)-4 gene intron 3 VNTR polymorphism and alopecia areata (AA) in Turkish population.

    Science.gov (United States)

    Kalkan, Göknur; Karakus, Nevin; Baş, Yalçın; Takçı, Zennure; Ozuğuz, Pınar; Ateş, Omer; Yigit, Serbulent

    2013-09-25

    Alopecia areata (AA) is hypothesized to be an organ-specific autoimmune disease of hair follicles mediated by T cells. As immunological and genetic factors have been implicated in the pathogenesis of AA, the purpose of the present study was to investigate possible associations between the functional Interleukin (IL)-4 gene intron 3 VNTR polymorphism and AA susceptibility and disease progression in Turkish population. The study group consisted of 116 unrelated patients with AA and 125 unrelated healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers. No association was observed between AA patients and controls according to genotype distribution (p=0.051). The allele distribution of IL-4 gene intron 3 VNTR polymorphism was statistically different between AA patients and control group (p=0.026). The frequency of P1 allele in patients was significantly higher than that in the control group. When the P2P2 genotype was compared with P1P2+P1P1 genotypes, a statistically significant difference was observed between patients and controls (p=0.036). Intron 3 VNTR polymorphism in the IL-4 gene was found to be associated with AA susceptibility in Turkish population. The results suggest that IL-4 VNTR polymorphism in the intron 3 region may be a risk factor for the development of AA among Turkish population. This is the first to report that intron 3 VNTR polymorphism in the IL-4 gene is associated with AA susceptibility. © 2013.

  14. Association between MASP-2 gene polymorphism and risk of infection diseases: A meta-analysis.

    Science.gov (United States)

    Fu, Jie; Wang, Jingqiu; Luo, Yanping; Zhang, Lifeng; Zhang, Yuan; Dong, Xinfang; Yu, Hongjuan; Cao, Mingqiang; Ma, Xingming

    2016-11-01

    The role of MASP-2 is vital in the process of complement activation by the lectin pathway. It is generally considered that the functional activation of MASP-2 contribute to the infection disease development process. To analyze the association between MASP-2 functional gene (rs72550870) polymorphism and the infection disease risk by a meta-analysis. Relevant case-control studies were identified by searching Cochrane Library, PubMed, Emabase, DOAJ, CAB Abstracts, CSA, CINAHL, EBSCO, Scopus, Global Health, Index Copernicus, CA, China National Knowledge Infrastructure (CNKI) databases up to 10th January 2016. The data were extracted and the methodological quality of studies were evaluated. The STATA 12.0 software was used to perform statistical analysis. 9 studies were included. There was no significant association between masp-2 gene (p.D120G, rs72550870) polymorphism and the risk of infection disease under the allele model (G vs. A: OR = 0.89, 95%CI = 0.66-1.21)(P = 0.445>0.05) and the recessive model (AG + GG vs.AA: OR = 0.88, 95%CI = 0.65-1.20) (P = 0.428>0.05). This is the first comprehensive meta-analysis indicates that the MASP-2 functional gene (rs72550870) polymorphism is not associated with the infection diseases, and the key functional gene polymorphism of rs72550870 did not increase susceptibility to the infection diseases. Similarly, there were no obvious difference in subgroup analysis based on geographical areas and pathogenic microorganisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Diet-gene interactions between dietary fat intake and common polymorphisms in determining lipid metabolism

    Energy Technology Data Exchange (ETDEWEB)

    Corella, D.

    2009-07-01

    Current dietary guidelines for fat intake have not taken into consideration the possible genetic differences underlying the individual variability in responsiveness to dietary components. Genetic variability has been identified in humans for all the known lipid metabolism-related genes resulting in a plethora of candidate genes and genetic variants to examine in diet-gene interaction studies focused on fat consumption. Some examples of fat-gene interaction are reviewed. These include: the interaction between total intake and the 14C/T in the hepatic lipase gene promoter in determining high-density lipoprotein cholesterol (HDL-C) metabolism; the interaction between polyunsaturated fatty acids (PUFA) and the 5G/A polymorphism in the APOA1 gene plasma HDL-C concentrations; the interaction between PUFA and the L162V polymorphism in the PPARA gene in determining triglycerides and APOC3 concentrations; and the interaction between PUFA intake and the -1131T>C in the APOA5 gene in determining triglyceride metabolism. Although hundreds of diet-gene interaction studies in lipid metabolism have been published, the level of evidence to make specific nutritional recommendations to the population is still low and more research in nutrigenetics has to be undertaken. (Author) 31 refs.

  16. Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis.

    Science.gov (United States)

    Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J

    2010-01-01

    Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

  17. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

    Science.gov (United States)

    Lane, Courtney E; Benton, Michael G

    2015-12-01

    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

    Science.gov (United States)

    Ober, Dietrich; Hartmann, Thomas

    1999-01-01

    Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

  19. Cytotoxic T lymphocyte associated molecule -4 (CTLA-4 gene polymorphisms in ovarian cancer patients

    Directory of Open Access Journals (Sweden)

    Sirous Naeimi

    2010-09-01

    Full Text Available Background: Ovarian cancer is a relatively common cancer among postmenopausal women. Nowadays, there is controversy about immunotherapy of ovarian cancer patients with interleukins such as interferon to reach better out come in prognosis of patients under chemotherapy. CTLA-4 is a gene, which has an important role in homeostasis and regulation of immune response. Inhibitory nature of CTLA-4 is proved to be of significance in autoimmune diseases as well as in cancer. In this study we intend to find out the relationship between polymorphisms of this gene at the sites of +49 A/G and -318 C/T and ovarian cancer.Methods: The polymorphisms of the CTLA-4 gene at the sites of +49 A/G exon and -318 C/T promoter were investigated. Blood samples of 73 patients with ovarian cancer and 115 healthy subjects used for DNA extraction. Two groups genotypes and alleles were determined using PCR method and compared by statistical t-student test.Results: There was no statistically significant difference in genotypes and alleles prevalence of +49 A/G and -317 C/T between two groups (p>0.05.Conclusion: Further researches with larger sample size while paying attention to the relation between the gene polymorphism and stage and type of tumor is recommended.

  20. Prenatal alcohol exposure, CYP17 gene polymorphisms and fetal growth restriction

    NARCIS (Netherlands)

    Delpisheh, Ali; Topping, Joanne; Reyad, Manal; Tang, Aiwei; Brabin, Bernard J.

    2008-01-01

    OBJECTIVE: To determine the association of maternal CYP17 gene polymorphisms and prenatal alcohol consumption with intrauterine growth restriction (IUGR). STUDY DESIGN: A case-control study in singleton livebirths was conducted at the Liverpool Women's Hospital between 2004 and 2005. Cases (n=90)

  1. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  2. Polymorphism of glucagon-like peptide-1 receptor gene (rs1042044 ...

    African Journals Online (AJOL)

    Previous investigations indicated that glucagon-like peptide-1 (GLP-1) played important roles in bone turnover via GLP-1 receptors (GLP1Rs) in postmenopausal state. Furthermore, polymorphisms in GLP1R gene were suggested to affect the function of GLP1Rs and be associated with many diseases. However, the ...

  3. PRDM16 Gene Polymorphism Is Associated with Obesity and Blood Lipids Profiles in Saudi Population

    Directory of Open Access Journals (Sweden)

    Aishah AlAmrani

    2018-06-01

    Full Text Available Aims: The PR domain containing 16 (PRDM16 gene and the Phosphodiesterase 4D (PDE4 gene are both an essential regulators in the thermogenesis process in the brown adipose tissues (BAT. The influence of polymorphisms in those genes on obesity and blood lipids profile is unknown particularly in the Saudi population, so the current study is aiming to explore that. Methods: A case control format was used that involved 89 obese individual and 84 non-obese (control. The PRDM16 (rs2651899 and PDE4D (rs295978 polymorphisms were genotyped using KASP™ (Competitive Allele-Specific PCR method. Results: The distributions of the AA, GG, and AG genotypes of PRDM16 (rs2651899 polymorphism were 0.19, 0.26 and 0.54, respectively. While the distribution of the mutated allele A was 0.7 in the obese group comparing to 0.34 in the non-obese group. Participants with the mutated genotypes, AA and AG, of PRDM16 (rs2651899 polymorphism were significantly more likely to be obese as compared to participants with wild type genotype (OR = 21, 95% CI = 5.4190 to 84.4231, p value < 0.0001 and OR = 44.6, 95% CI = 11.5984 to 172.0157, p value < 0.0001, respectively. The wild type GG genotype of this polymorphism was associated with higher blood cholesterol, HDL and LDL but lower blood triglyceride compared with the mutated genotypes (p = 0.003, p = 0.008, p = 0.02 and p = 0.003, respectively. In contrast, PDE4D (rs295978 polymorphism was not associated with risk of obesity and had no effects on blood lipids profile. Conclusions: We found that the PRDM16 polymorphism (rs2651899 is a risk factor for obesity and influence blood lipids profiles significantly in Saudi population. While the PDE4D (rs295978 polymorphism didn’t show significant effect on risk of obesity or blood lipids profiles.

  4. Polymorphism of BMP4 gene in Indian goat breeds differing in prolificacy.

    Science.gov (United States)

    Sharma, Rekha; Ahlawat, Sonika; Maitra, A; Roy, Manoranjan; Mandakmale, S; Tantia, M S

    2013-12-10

    Bone morphogenetic proteins (BMPs) are members of the TGF-β (transforming growth factor-beta) superfamily, of which BMP4 is the most important due to its crucial role in follicular growth and differentiation, cumulus expansion and ovulation. Reproduction is a crucial trait in goat breeding and based on the important role of BMP4 gene in reproduction it was considered as a possible candidate gene for the prolificacy of goats. The objective of the present study was to detect polymorphism in intronic, exonic and 3' un-translated regions of BMP4 gene in Indian goats. Nine different goat breeds (Barbari, Beetal, Black Bengal, Malabari, Jakhrana (Twinning>40%), Osmanabadi, Sangamneri (Twinning 20-30%), Sirohi and Ganjam (Twinning<10%)) differing in prolificacy and geographic distribution were employed for polymorphism scanning. Cattle sequence (AC_000167.1) was used to design primers for the amplification of a targeted region followed by direct DNA sequencing to identify the genetic variations. Single nucleotide polymorphisms (SNPs) were not detected in exon 3, the intronic region and the 3' flanking region. A SNP (G1534A) was identified in exon 2. It was a non-synonymous mutation resulting in an arginine to lysine change in a corresponding protein sequence. G to A transition at the 1534 locus revealed two genotypes GG and GA in the nine investigated goat breeds. The GG genotype was predominant with a genotype frequency of 0.98. The GA genotype was present in the Black Bengal as well as Jakhrana breed with a genotype frequency of 0.02. A microsatellite was identified in the 3' flanking region, only 20 nucleotides downstream from the termination site of the coding region, as a short sequence with more than nineteen continuous and repeated CA dinucleotides. Since the gene is highly evolutionarily conserved, identification of a non-synonymous SNP (G1534A) in the coding region gains further importance. To our knowledge, this is the first report of a mutation in the coding

  5. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  6. Impact of Gene rs7422339 Polymorphism in Argentine Patients With Hyperhomocysteinemia

    Directory of Open Access Journals (Sweden)

    Silene M. Silvera-Ruiz BSc

    2015-05-01

    Full Text Available Carbamoyl phosphate synthetase 1 ( CPS1 is a key gene in the first step of urea cycle and has been correlated with nitric oxide level and vascular smooth muscle activity. A functional single-nucleotide polymorphism C/A at position 4217 in CPS1 (National Center for Biotechnology Information SNP database no. rs7422339, T1405N was reported to be associated with high homocysteine (Hcy plasma values. Although genetic variants of methylenetetrahydrofolate reductase ( MTHFR gene are known to influence Hcy concentration, other genetic determinants of Hcy remain largely unknown. The association between the CPS1 rs7422339 and the risk of hyperhomocysteinemia in Latin American populations is unknown. Here, we study this association in 100 patients having hyperhomocysteinemia without MTHFR c.677C>T polymorphism and 100 controls. CPS1 rs7422339 was studied using polymerase chain reaction and enzymatic restriction. Comparisons of the CPS1 rs7422339 genotype distributions revealed a significant difference between groups ( P = 2.3 × 10 −3 . Patients carrying polymorphic allele showed almost 3 times higher risk (odds ratio [OR] = 2.47 of hyperhomocysteinemia than wild-type allele, suggesting that rs7422339 SNP is associated with high Hcy levels in the Argentine population.

  7. The impact of Folate Pathway Polymorphisms Combined to Nutritional Deficiency As a Maternal Predisposition Factor for Down Syndrome

    Directory of Open Access Journals (Sweden)

    C. B. Santos-Rebouças

    2008-01-01

    Full Text Available Polymorphisms in genes encoding folate metabolizing enzymes have been linked to an increased risk of maternal chromosomal nondisjunction in several populations. With the purpose of evaluating this relationship, we compared the frequencies of 677C>T and 1298A>C polymorphisms in the methylenetetrahydrofolate reductase gene (MTHFR and 66A>G in the methionine synthase reductase gene (MTRR between 103 young mothers of Down syndrome (DS individuals and 108 control mothers, whose offspring was karyotypically normal, correlating it with an estimative of folate and – related micronutrients levels intake. Maternal and paternal transmission frequencies of MTHFR 677T allele were also examined to access potential parent-of-origin effects. PCR-RFLP for genomic DNA was accomplished and allele/genotype frequencies differences were determined using the x2 test, whereas pattern of transmission of the MTHFR 677 allele was analyzed by transmission disequilibrium test. None of the polymorphisms seemed to be more frequent in case mothers than in controls, either individually or combined. The estimative of nutritional intake revealed that folate consumption median was inadequate in both groups, whereas methionine and zinc consumption medians were significantly greater in control mothers. It suggests that such interaction between genetic profile and environment could predispose this sub group of women to have a DS child. Additional studies focusing the interaction between nutritional intakes, biochemical data and folate pathway polymorphisms are needed to confirm the present results. The possibility of neutralize the biochemical negative effects of folate-related polymorphisms through oral supplementation could provide new targets for DS prevention.

  8. A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

    Science.gov (United States)

    Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

    2016-12-28

    The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

  9. Might there be a link between intron 3 VNTR polymorphism in the XRCC4 DNA repair gene and the etiopathogenesis of rheumatoid arthritis?

    Science.gov (United States)

    Pehlivan, Sacide; Balci, Sibel Oguzkan; Aydeniz, Ali; Pehlivan, Mustafa; Sever, Tugce; Gursoy, Savas

    2015-01-01

    DNA repair genes are involved in several diseases such as cancers and autoimmune diseases. Previous studies indicated that a DNA repair system was involved in the development of rheumatoid arthritis (RA). In this study, we aimed to examine whether four polymorphisms in the DNA repair genes (xeroderma pigmentosum complementation group D [XPD], X-ray repair cross-complementing group 1 [XRCC1], and X-ray repair cross-complementing group 4 [XRCC4]) were associated with RA. Sixty-five patients with RA and 70 healthy controls (HCs) were examined for XPD (A-751G), XRCC1 (A399G), and XRCC4 (intron 3 VNTR and G-1394T) polymorphisms. All polymorphisms were genotyped by PCR and/or PCR-RFLP. The association between the polymorphisms and RA was analyzed using the chi-square test and de Finetti program. The intron 3 VNTR polymorphism in the XRCC4 gene showed an association with RA patients. The DI genotype was found lower in RA patients (χ(2)=8.227; p=0.0021), while the II genotype was higher in RA patients (χ(2)=5.285; p=0.010). There were deviations from the Hardy-Weinberg Equilibrium (HWE) in both intron 3 VNTR and G-1394T polymorphisms in the XRCC4 gene and in the polymorphism in the XRCC1 gene, and the observed genotype counts deviated from those expected according to the HWE (p=0.027, 0.004, and 0.002, respectively); however, there was no deviation in the other gene polymorphisms. There is no statistical difference between the RA patients and HCs for XPD (A-751G), XRCC1 (A399G), and XRCC4 (G-1394T) gene polymorphisms (p>0.05). Although XPD (A-751G), XRCC1 (A399G), and XRCC4 (G-1394T) gene polymorphisms have been extensively investigated in different clinical pictures, this is the first study to evaluate the role of these polymorphisms in the genetic etiopathogenesis of RA in Turkish patients. In conclusion, we suggested that the intron 3 VNTR polymorphism in the XRCC4 gene may be associated with the etiopathogenesis of RA as a marker of immune aging.

  10. Identification of a new human mtDNA polymorphism (A14290G in the NADH dehydrogenase subunit 6 gene

    Directory of Open Access Journals (Sweden)

    M. Houshmand

    2006-06-01

    Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally inherited form of retinal ganglion cell degeneration leading to optic atrophy in young adults. Several mutations in different genes can cause LHON (heterogeneity. The ND6 gene is one of the mitochondrial genes that encodes subunit 6 of complex I of the respiratory chain. This gene is a hot spot gene. Fourteen Persian LHON patients were analyzed with single-strand conformational polymorphism and DNA sequencing techniques. None of these patients had four primary mutations, G3460A, G11788A, T14484C, and G14459A, related to this disease. We identified twelve nucleotide substitutions, G13702C, T13879C, T14110C, C14167T, G14199T, A14233G, G14272C, A14290G, G14365C, G14368C, T14766C, and T14798C. Eleven of twelve nucleotide substitutions had already been reported as polymorphism. One of the nucleotide substitutions (A14290G has not been reported. The A14290G nucleotide substitution does not change its amino acid (glutamic acid. We looked for base conservation using DNA star software (MEGALIGN program as a criterion for pathogenic or nonpathogenic nucleotide substitution in A14290G. The results of ND6 gene alignment in humans and in other species (mouse, cow, elegans worm, and Neurospora crassa mold revealed that the 14290th base was not conserved. Fifty normal controls were also investigated for this polymorphism in the Iranian population and two had A14290G polymorphism (4%. This study provides evidence that the mtDNA A14290G allele is a new nonpathogenic polymorphism. We suggest follow-up studies regarding this polymorphism in different populations.

  11. [Effect of FABP2 gene G54A polymorphism on lipid and glucose metabolism in simple obesity children].

    Science.gov (United States)

    Xu, Yunpeng; Rao, Xiaojiao; Hao, Min; Hou, Lijuan; Zhu, Xiaobo; Chang, Xiaotong

    2016-01-01

    To explore the relationship between intestinal fatty acid binding protein (FABP2) gene G54A polymorphism and simple childhood obesity, the effect of mutant 54A FABP2 gene on serum lipids and glucose metabolism. The total of 83 subjects with overweight/obesity and 100 subjects with healthy/normal weight were involved in this study. The G54A FABP2 gene allele and genotype frequencies between control group and overweight/obesity group were detected using polymerase chain reaction (PCR) -restriction fragment length polymorphism (RFLP) technology, and DNA sequences were confirmed by DNA sequencing. The automatic biochemical analyzer was used to detect fasting blood glucose (FBG), triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) levels. Plasma insulin (Ins) was detected by radiation immune method, free fatty acids (FFA) was tested by ELISA method, insulin resistance index ( HOMA-IR ) was also calculated. The correlation between FABP2 G54A polymorphism and the development of children' obesity was analyzed. The relation between FABP2 G54A polymorphism and abnormal blood lipid and insulin resistance was assessed. The results of study on FABP2 gene polymorphism revealed as followed. In overweight/obese groups, the frequencies of GG, GA, AA genotypes was 33.7%, 49.4% and 16.9%, respectively. In control group, the frequencies of GG, GA, AA genotypes was 51. 0% , 40. 0% and 9. 0% , respectively. The differences between two groups was statistically significant (Χ2 = 6.27, P 0.05). The FABP2 gene G54A polymorphism is related to simple children obesity and lipid metabolism abnormality. The allele encoding in FABP2 gene may be a potential factor contributing to promoting lipid metabolism abnormality of and insulin resistance.

  12. Effect modification by apoptosis-related gene polymorphisms on the associations of phthalate exposure with spermatozoa apoptosis and semen quality.

    Science.gov (United States)

    Yang, Pan; Gong, Ya-Jie; Wang, Yi-Xin; Liang, Xin-Xiu; Liu, Qing; Liu, Chong; Chen, Ying-Jun; Sun, Li; Lu, Wen-Qing; Zeng, Qiang

    2017-12-01

    Human studies indicate that phthalate exposure is associated with adverse male reproductive health, and this association may be modified by genetic polymorphisms. We investigated whether apoptosis-related gene polymorphisms modified the associations of phthalate exposure with spermatozoa apoptosis and semen quality. In this Chinese population who sought for semen examination in an infertility clinic, we measured 8 phthalate metabolites in two urine samples to assess the individual's exposure levels. Apoptosis-related gene (Fas, FasL, and caspase3) polymorphisms were performed by real-time PCR. Spermatozoa apoptosis and semen quality parameters were evaluated by Annexin V/PI assay and computer-aided semen analysis, respectively. We found that Fas rs2234767, FasL rs763110, and caspase3 rs12108497 gene polymorphisms significantly modified the associations between urinary phthalate metabolites and spermatozoa apoptosis. For example, urinary monobutyl phthalate (MBP) associated with an increased percentage of Annexin V + /PI - spermatozoa of 25.11% (95% CI: 4.08%, 50.53%) were only observed among men with CT/TT genotype of FasL rs763110. In addition, we found that caspase3 rs12108497 gene polymorphisms significantly modified the associations of urinary mono (2-ethyl-5-hydroxyhexyl) phthalate (MEHHP) with decreased sperm concentration and sperm count (both p-values for interactions = 0.02). Our results provided the first evidence that apoptosis-related gene polymorphisms might contribute to the effects of phthalate exposure on male reproductive health. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Association of HS6ST3 gene polymorphisms with obesity and triglycerides: gene x gender interaction.

    Science.gov (United States)

    Wang, Ke-Sheng; Wang, Liang; Liu, Xuefeng; Zeng, Min

    2013-12-01

    The heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene is involved in heparan sulphate and heparin metabolism, and has been reported to be associated with diabetic retinopathy in type 2 diabetes.We hypothesized that HS6ST3 gene polymorphisms might play an important role in obesity and related phenotypes (such as triglycerides). We examined genetic associations of 117 single-nucleotide polymorphisms (SNPs) within the HS6ST3 gene with obesity and triglycerides using two Caucasian samples: the Marshfield sample (1442 obesity cases and 2122 controls), and the Health aging and body composition (Health ABC) sample (305 cases and 1336 controls). Logistic regression analysis of obesity as a binary trait and linear regression analysis of triglycerides as a continuous trait, adjusted for age and sex, were performed using PLINK. Single marker analysis showed that six SNPs in the Marshfield sample and one SNP in the Health ABC sample were associated with obesity (P triglycerides in the Marshfield sample (P triglycerides in the Marshfield sample. These findings contribute new insights into the pathogenesis of obesity and triglycerides and demonstrate the importance of gender differences in the aetiology.

  14. Hypertension-Related Gene Polymorphisms of G-Protein-Coupled Receptor Kinase 4 Are Associated with NT-proBNP Concentration in Normotensive Healthy Adults

    Directory of Open Access Journals (Sweden)

    Junichi Yatabe

    2012-01-01

    Full Text Available G protein-coupled receptor kinase 4 (GRK4 with activating polymorphisms desensitize the natriuric renal tubular D1 dopamine receptor, and these GRK4 polymorphisms are strongly associated with salt sensitivity and hypertension. Meanwhile, N-terminal pro-B-type natriuretic peptide (NT-proBNP may be useful in detecting slight volume expansion. However, relations between hypertension-related gene polymorphisms including GRK4 and cardiovascular indices such as NT-proBNP are not clear, especially in healthy subjects. Therefore, various hypertension-related polymorphisms and cardiovascular indices were analyzed in 97 normotensive, healthy Japanese adults. NT-proBNP levels were significantly higher in subjects with two or more GRK4 polymorphic alleles. Other hypertension-related gene polymorphisms, such as those of renin-angiotensin-aldosterone system genes, did not correlate with NT-proBNP. There was no significant association between any of the hypertension-related gene polymorphisms and central systolic blood pressure, cardioankle vascular index, augmentation index, plasma aldosterone concentration, or an oxidative stress marker, urinary 8-OHdG. Normotensive individuals with GRK4 polymorphisms show increased serum NT-proBNP concentration and may be at a greater risk of developing hypertension and cardiovascular disease.

  15. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

    2006-01-01

    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  16. Haemochromatosis HFE gene polymorphisms as potential modifiers of hereditary nonpolyposis colorectal cancer risk and onset age.

    Science.gov (United States)

    Shi, Zumin; Johnstone, Daniel; Talseth-Palmer, Bente A; Evans, Tiffany-Jane; Spigelman, Allan D; Groombridge, Claire; Milward, Elizabeth A; Olynyk, John K; Suchy, Janina; Kurzawski, Grzegorz; Lubinski, Jan; Scott, Rodney J

    2009-07-01

    Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by germline mutations in DNA mismatch repair genes; however, variation in disease expression suggests that there are potential modifying factors. Polymorphisms of the HFE gene, which cause the iron overload disorder hereditary haemochromatosis, have been proposed as potential risk factors for the development of colorectal cancer (CRC). To understand the relationship between HNPCC disease phenotype and polymorphisms of the HFE gene, a total of 362 individuals from Australia and Poland with confirmed causative MMR gene mutations were genotyped for the HFE C282Y and H63D polymorphisms. A significantly increased risk of developing CRC was observed for H63D homozygotes when compared with combined wild-type homozygotes and heterozygotes (hazard ratio = 2.93, p = 0.007). Evidence for earlier CRC onset was also observed in H63D homozygotes with a median age of onset 6 years earlier than wild type or heterozygous participants (44 vs. 50 years of age). This effect was significant by all tests used (log-rank test p = 0.026, Wilcoxon p = 0.044, Tarone-Ware p = 0.035). No association was identified for heterozygosity of either polymorphism and limitations on power-prevented investigation of C282Y homozygosity or compound C282Y/H63D heterozygosity. In the Australian sample only, women had a significantly reduced risk of developing CRC when compared with men (hazard ratio = 0.58, p = 0.012) independent of HFE genotype for either single nucleotide polymorphisms. In conclusion, homozygosity for the HFE H63D polymorphism seems to be a genetic modifier of disease expression in HNPCC. Understanding the mechanisms by which HFE interrelates with colorectal malignancies could lead to reduction of disease risk in HNPCC.

  17. Oxytocin and Opioid Receptor Gene Polymorphisms Associated with Greeting Behavior in Dogs

    Directory of Open Access Journals (Sweden)

    Enikő Kubinyi

    2017-09-01

    Full Text Available Meeting humans is an everyday experience for most companion dogs, and their behavior in these situations and its genetic background is of major interest. Previous research in our laboratory reported that in German shepherd dogs the lack of G allele, and in Border collies the lack of A allele, of the oxytocin receptor gene (OXTR 19208A/G single nucleotide polymorphism (SNP was linked to increased friendliness, which suggests that although broad traits are affected by genetic variability, the specific links between alleles and behavioral variables might be breed-specific. In the current study, we found that Siberian huskies with the A allele approached a friendly unfamiliar woman less frequently in a greeting test, which indicates that certain polymorphisms are related to human directed behavior, but that the relationship patterns between polymorphisms and behavioral phenotypes differ between populations. This finding was further supported by our next investigation. According to primate studies, endogenous opioid peptide (e.g., endorphins receptor genes have also been implicated in social relationships. Therefore, we examined the rs21912990 of the OPRM1 gene. Firstly, we found that the allele frequencies of Siberian huskies and gray wolves were similar, but differed from that of Border collies and German shepherd dogs, which might reflect their genetic relationship. Secondly, we detected significant associations between the OPRM1 SNP and greeting behavior among German shepherd dogs and a trend in Border collies, but we could not detect an association in Siberian huskies. Although our results with OXTR and OPRM1 gene variants should be regarded as preliminary due to the relatively low sample size, they suggest that (1 OXTR and OPRM1 gene variants in dogs affect human-directed social behavior and (2 their effects differ between breeds.

  18. Oxytocin and Opioid Receptor Gene Polymorphisms Associated with Greeting Behavior in Dogs.

    Science.gov (United States)

    Kubinyi, Enikő; Bence, Melinda; Koller, Dora; Wan, Michele; Pergel, Eniko; Ronai, Zsolt; Sasvari-Szekely, Maria; Miklósi, Ádám

    2017-01-01

    Meeting humans is an everyday experience for most companion dogs, and their behavior in these situations and its genetic background is of major interest. Previous research in our laboratory reported that in German shepherd dogs the lack of G allele, and in Border collies the lack of A allele, of the oxytocin receptor gene (OXTR) 19208A/G single nucleotide polymorphism (SNP) was linked to increased friendliness, which suggests that although broad traits are affected by genetic variability, the specific links between alleles and behavioral variables might be breed-specific. In the current study, we found that Siberian huskies with the A allele approached a friendly unfamiliar woman less frequently in a greeting test, which indicates that certain polymorphisms are related to human directed behavior, but that the relationship patterns between polymorphisms and behavioral phenotypes differ between populations. This finding was further supported by our next investigation. According to primate studies, endogenous opioid peptide (e.g., endorphins) receptor genes have also been implicated in social relationships. Therefore, we examined the rs21912990 of the OPRM1 gene. Firstly, we found that the allele frequencies of Siberian huskies and gray wolves were similar, but differed from that of Border collies and German shepherd dogs, which might reflect their genetic relationship. Secondly, we detected significant associations between the OPRM1 SNP and greeting behavior among German shepherd dogs and a trend in Border collies, but we could not detect an association in Siberian huskies. Although our results with OXTR and OPRM1 gene variants should be regarded as preliminary due to the relatively low sample size, they suggest that (1) OXTR and OPRM1 gene variants in dogs affect human-directed social behavior and (2) their effects differ between breeds.

  19. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Methylenetetrahydrofolate reductase 677C>T and methionine synthase 2756A>G mutations: no impact on survival, cognitive functioning, or cognitive decline in nonagenarians

    DEFF Research Database (Denmark)

    Bathum, Lise; von Bornemann Hjelmborg, Jacob; Christiansen, Lene

    2007-01-01

    BACKGROUND: Several reports have shown an association between homocysteine, cognitive functioning, and survival among the oldest-old. Two common polymorphisms in the genes coding for methylenetetrahydrofolate reductase (MTHFR 677C>T) and methionine synthase (MTR 2756A>G) have an impact on plasma...... homocysteine level. METHODS: We examined the effect of the MTHFR 677C>T and MTR 2756A>G genotypes on baseline cognitive functioning, cognitive decline over 5 years measured in three assessments, and survival in a population-based cohort of 1581 nonagenarians. Cognitive functioning was assessed by using...