
Sample records for synthase gene polymorphism

  1. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)

    Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

  2. Endothelial nitric oxide synthase gene polymorphisms associated ...

    African Journals Online (AJOL)



    May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

  3. Endothelial nitric oxide synthase gene Glu298Asp polymorphism ...

    African Journals Online (AJOL)



    Sep 12, 2011 ... Figure 1. The Glu298Asp polymorphism of eNOS gene was shown by .... mechanisms by which eNOS Asp298 polymorphism ... Asp298 is exposed to selective proteolytic cleavage in ... grounds, inclusion and exclusion criteria for PE women ... attention to meta analysis study, it is more probable that.

  4. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms ...

    African Journals Online (AJOL)

    maintenance of pregnancy, but it is rather controversial whether polymorphisms of the gene encoding for eNOS are associated ... specific human leukocyte antigen alleles that seem to be ... prevents the contractions of the uterine myometrium directly or by an ... an anatomical factor, to avoid this possible bias all candidates.

  5. Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients. (United States)

    Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh


    Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

  6. [Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae]. (United States)

    Boris, K V; Kochieva, E Z; Kudryavtsev, A M


    The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

  7. Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

    Directory of Open Access Journals (Sweden)

    R. Vasudevan


    Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

  8. Aldosterone-Synthase Gene Polymorphism is Associated with Blood Pressure Levels and Left Ventricle Mass Index

    Czech Academy of Sciences Publication Activity Database

    Horký, K.; Jáchymová, M.; Heller, S.; Linhart, A.; Hlubocká, Z.; Umnerová, V.; Peleška, Jan; Pavlíková, Markéta; Jindra, A.


    Roč. 204, 1 suppl. (2004), s. 35 ISSN 0014-2565. [World Congress of Internal Medicine /27./. 26.09.2004-01.10.2004, Granada] R&D Projects: GA MŠk LN00B107 Keywords : aldosterone synthase (CYP11B) * genetic polymorphism * arterial hypertension * left ventricular hypertrophy Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery

  9. Association of Nitric Oxide Synthase2 gene polymorphisms with leprosy reactions in northern Indian population. (United States)

    Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja


    The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species. (United States)

    Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing


    Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.


    Directory of Open Access Journals (Sweden)

    G. V. Matyushin


    Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups  and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group.  In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men,  this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.

  12. Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea. (United States)

    Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby


    Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular

  13. Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content (United States)

    Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng


    Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

  14. Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

    Directory of Open Access Journals (Sweden)

    T. Angeline


    Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

  15. Promoter polymorphisms in the nitric oxide synthase 3 gene are associated with ischemic stroke susceptibility in young black women. (United States)

    Howard, Timothy D; Giles, Wayne H; Xu, Jianfeng; Wozniak, Marcella A; Malarcher, Ann M; Lange, Leslie A; Macko, Richard F; Basehore, Monica J; Meyers, Deborah A; Cole, John W; Kittner, Steven J


    Endothelial nitric oxide exerts a variety of protective effects on endothelial cells and blood vessels, and therefore the nitric oxide synthase 3 gene (NOS3) is a logical candidate gene for stroke susceptibility. We used the population-based Stroke Prevention in Young Women case-control study to assess the association of five NOS3 polymorphisms in 110 cases (46% black) with ischemic stroke and 206 controls (38% black), 15 to 44 years of age. Polymorphisms included 3 single nucleotide polymorphisms (SNPs) in the promoter region (-1468 T>A, -922 G>A, -786 T>C), 1 SNP in exon 7 (G894T), and 1 insertion/deletion polymorphism within intron 4. Significant associations with both the -922 G>A and -786 T>C SNPs with ischemic stroke were observed in the black, but not the white, population. This association was attributable to an increased prevalence of the -922 A allele (OR=3.0, 95% CI=1.3 to 6.8; P=0.005) and the -786 T allele (OR=2.9, 95% CI=1.3 to 6.4; P=0.005) in cases versus controls. These 2 SNPs were in strong linkage disequilibrium (D'=1.0), making it impossible to determine, within the confines of this genetic study, whether 1 or both of these polymorphisms are functionally related to NOS3 expression. Two sets of haplotypes were also identified, 1 of which may confer an increased susceptibility to stroke in blacks, whereas the other appears to be protective. Promoter variants in NOS3 may be associated with ischemic stroke susceptibility among young black women.

  16. Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

    Directory of Open Access Journals (Sweden)

    Linda Koshy


    Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

  17. Association between Polymorphism of Endothelial Nitric Oxide Synthase Gene (Glu298Asp) and Chronic Heart Failure in Patients with Ischemic Heart Disease and Obesity


    O.I. Kadykova; P.P. Kravchun


    The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...

  18. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification. (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata


    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  19. Association of a neuronal nitric oxide synthase gene polymorphism with levodopa-induced dyskinesia in Parkinson's disease. (United States)

    Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor


    Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Endothelial nitric oxide synthase gene polymorphisms and cardiovascular damage in hypertensive subjects: an Italian case-control study

    Directory of Open Access Journals (Sweden)

    Pizzo Federica


    Full Text Available Abstract Background Nitric oxide (NO synthesized by endothelial nitric oxide synthase (eNOS plays an important role in regulation of endothelial function and in the control of blood pressure. However, the results from some studies on the association between three clinically relevant eNOS gene polymorphisms (G894T, T786C and intron 4b/a and essential hypertension are unclear. We designed a case-control study to evaluate the influence of eNOS polymorphisms on target organ damage in 127 hypertensives and 67 normotensives. Clinical evaluation, biochemical parameters, Urinary Albumin Excretion (UAE and echocardiogram were performed to characterize target organ damage. eNOS polymorphism were recognized by PCR method. Results The distribution of eNOS genotypes was similar in hypertensives and normotensives but 4aa was present in the 2.5% of hypertensives and completely absent in normotensives. Subjects with 4bb, G894T, and T786C genotypes showed an increased prevalence of target organ damage. Moreover prevalence of G894T and introne 4 variants was significantly higher in hypertensives than in normotensives both with cardiovascular damage. Logistic regression analysis didn't show any association between eNOS polymorphisms, Body Mass Index (BMI, hypertension, gender and cardiovascular damage. Only the age (OR 1.11; IC 95% 1.06–1.18 was predictive of cardiovascular damage in our population. Conclusion Our results seem to indicate a lack of association with eNOS variants and cardiovascular damage onset.

  1. Association of endothelial nitric oxide synthase gene polymorphisms with coronary artery disease: an updated meta-analysis and systematic review.

    Directory of Open Access Journals (Sweden)

    Himanshu Rai

    Full Text Available Several association studies of endothelial nitric oxide synthase (NOS3 gene polymorphisms with respect to coronary artery disease (CAD have been published in the past two decades. However, their association with the disease, especially among different ethnic subgroups, still remains controversial. This prompted us to conduct a systematic review and an updated structured meta-analysis, which is the largest so far (89 articles, 132 separate studies, and a sample size of 69,235, examining association of three polymorphic forms of the NOS3 gene (i.e. Glu298Asp, T786-C and 27 bp VNTR b/a with CAD. In a subgroup analysis, we tested their association separately among published studies originating predominantly from European, Middle Eastern, Asian, Asian-Indian and African ancestries. The pooled analysis confirmed the association of all the three selected SNP with CAD in three different genetic models transcending all ancestries worldwide. The Glu298Asp polymorphism showed strongest association (OR range = 1.28-1.52, and P<0.00001 for all comparisons, followed by T786-C (OR range = 1.34-1.42, and P<0.00001 for all comparisons and 4b/a, (OR range = 1.19-1.41, and P ≤ 0.002 for all comparisons in our pooled analysis. Subgroup analysis revealed that Glu298Asp (OR range = 1.54-1.87, and P<0.004 for all comparisons and 4b/a (OR range = 1.71-3.02, and P<0.00001 for all comparisons have highest degree of association amongst the Middle Easterners. On the other hand, T786-C and its minor allele seem to carry a highest risk for CAD among subjects of Asian ancestry (OR range = 1.61-1.90, and P ≤ 0.01 for all comparisons.

  2. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review)


    Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.


    Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...

  3. The Role of ?786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome


    Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard


    Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 su...

  4. Study of exon 12 polymorphism of the human thromboxane synthase (CYP5A1) gene in Egyptian stroke patients

    International Nuclear Information System (INIS)

    Soliman, S.E.T.; Zaater, M.K.


    Thromboxane synthase (CYP5A1) catalyzes the conversion of prostaglandin H2 to thromboxane A2, a potent mediator of platelet aggregation, vasoconstriction and bronchoconstriction. It has been implicated in the patho-physiological process of a variety of diseases, such as atherosclerosis, myocardial infarction, stroke and asthma. On the basis of the hypothesis that variations of the CYP5A1 gene may play an important role in human diseases, we performed screening for the prevalence of exon12 polymorphism of the human Thromboxane synthase (CYP5A1) gene among Egyptian normal and stroke patients. Using sequence-specific PCR, we examined the allelic prevalence in 70 Egyptian patients with ischemic strokes and in 70 controls. In addition, we compared the CYP5A1 allelic prevalence in 30 patients with stroke recurrence despite Aspirin use, in comparison with patients who have not experienced recurrent stroke while taking Aspirin. The frequencies of the CYP5A1*9 mutant (substitution of guanine by adenine near the heme-binding catalytic domain) and of the wild-type allele were 0.197(19.7%) and 0.803 (80.3%) respectively; they did not differ significantly between stroke patients and controls. The CYP5A1*9 mutant was significantly more prevalent among stroke patients with history of previous cerebrovascular attacks; even after adjusting for the common risk factors for cardiovascular disease (odds ratio (OR)1.73, 95%, confidence interval ( CI) 1.10-2.73; p=0.017). Among stroke patients, the presence of the CYP5A1 wild type allele was more frequent among the hypertensives (OR 1.68, 95% CI, 1.01-2.79; p=0.045), and less frequent among the diabetics (OR 0.55, 95%, CI 0.36-0.84; p=0.006). Also among stroke patients, the CYP5A1*9 mutant was significantly more prevalent among those, who failed secondary Aspirin prophylaxis compared to those with successful secondary Aspirin prophylaxis (OR 1.49, 95%, CI 1.06-2.11). This study provides evidence for high prevalence of the CYP5A1*9 mutant

  5. Association of endothelial nitric oxide synthase gene polymorphism with the risk of Henoch-Schönlein purpura/Henoch-Schönlein purpura nephritis. (United States)

    Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei


    Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.

  6. The T -786C, G894T, and Intron 4 VNTR (4a/b) Polymorphisms of the Endothelial Nitric Oxide Synthase Gene in Prostate Cancer Cases. (United States)

    Diler, S B; Öden, A


    In previously conducted some studies it has been revealed that nitric oxide (NO) and nitric oxide synthase (NOS) system play a significant role in carcinogenesis. Nitric oxide (NO) is regulated by endothelial nitric oxide synthase (eNOS) enzyme which is one of the isoenzymes of NO synthase (NOS). In this study we have tried to come to a conclusion about whether eNOS gene T -786C, G894T and Intron 4 VNTR (4a/b) polymorphisms might be considered as a risk factor causing prostate cancer (PCa) or not. A total of 200 subjects were included in this research. 84 patients with PCa (mean age 70.0 ± 6.4) and 116 healthy controls (mean age 69.9 ± 7.5) were recruited in this case-control study. Genomic DNA was extracted using the QIAamp DNA Blood Mini Kit (QIAGEN GmbH, Maryland, USA), according to the manufacturer's guidelines. The T-786C, G894T and Intron 4 VNTR (4a/b) polymorphisms were amplified using polymerase chain reation (PCR), detected by restriction fragment length polymorphism (RFLP). For T -786C polymorphism CC genotype [odds ratio (OR): 0.34, 95% confidence interval (CI): 0.15-0.78, P = 0.009)] and allele frequency (OR: 0.631, CI: 0.421-0.946, P = 0.026) is significant for control. In patients with PCa eNOS G894T polymorphism, both GT (OR: 0.069, CI: 0.027-0.174; P = 0.0001) and TT (OR: 0.040, CI: 0.013-0.123; P = = 0.0001) genotype distribution, and also T allele frequency (OR: 0.237, CI: 0.155-0.362, P = 0.0001) were considered significant statistically. While genotype distribution for the other polymorphism eNOS, intron 4 VNTR (4a/b), is insignificant statistically, "a" allele frequency was found out to be significant (OR: 2.223, CI: 1.311-3.769, P = 0.003). In this study we indicated that genotype and allele frequencies of eNOS T -786C and G894T polymorphisms are statistically significant in patients with PCa. eNOS T -786C and G894T polymorphisms may be associated with PCa susceptibility in the Turkish population. In contrast, intron 4 VNTR (4a

  7. The joint effect of the endothelin receptor B gene (EDNRB polymorphism rs10507875 and nitric oxide synthase 3 gene (NOS3 polymorphism rs869109213 in Slovenian patients with type 2 diabetes mellitus and diabetic retinopathy

    Directory of Open Access Journals (Sweden)

    Dejan Bregar


    Full Text Available Increasing evidence suggests that endothelin and nitric oxide synthase genes and their products exert biological effects on the vasculature via the nitric oxide or endothelin pathway. The aim of the study was to evaluate the association of rs10507875 and rs869109213 (alone or in interaction with diabetic retinopathy (DR in subjects with type 2 diabetes mellitus (T2DM. We genotyped the single nucleotide polymorphism rs10507875 of the endothelin receptor B gene (EDNRB and variable number tandem repeats rs869109213 of the nitric oxide synthase 3 gene (NOS3 in 270 Slovenian patients with DR and T2DM and 256 controls with T2DM without clinical signs of DR. The genotyping was performed using either real-time polymerase chain reaction (PCR or standard PCR. We found a significant association between the genotypes of NOS3 rs869109213 polymorphism and the risk of DR in the co-dominant model (4a4b genotype; 1.99-fold increased risk [1.09-3.65]; 95% confidence interval [CI]; p = 0.02, co-dominant model (4a4a genotype; 4.16-fold increased risk [1.03-16.74]; 95% CI; p = 0.04, and dominant model (4a4a and 4a4b genotypes; 2.22-fold increased risk [1.26-3.92]; 95% CI; p = 0.01 compared to the 4b4b genotype. Moreover, the joint effect of the two polymorphisms on DR risk was greater than the individual effect of each polymorphism in the analyzed genetic models. Additionally, adjusted odds ratio showed an increased risk in dominant × dominant (4.15-fold [1.40-12.26]; 95% CI; p = 0.01 and recessive × dominant (2.24-fold [1.25-4.01]; 95% CI; p = 0.02 genotype combinations of the two polymorphisms. In conclusion, our results indicate that NOS3 rs869109213 polymorphism alone or in a combination with EDNRB rs10507875 polymorphism may be associated with DR in Slovenian patients with T2DM.

  8. A66G and C524T polymorphisms of methionine synthase reductase gene are linked to the development of acyanotic congenital heart diseases in Egyptian children. (United States)

    Hassan, Fahima M; Khattab, Ahmad A; Abo El Fotoh, Wafaa Moustafa M; Zidan, Reham S


    Methionine synthase reductase (MTRR) is one of the main regulatory enzymes in the homocysteine/folate pathway. Genes involved in this pathway may play an important role in the development of congenital heart diseases (CHDs). C524T and A66G polymorphisms of MTRR gene may play an imperative role in the development of acyanotic CHDs. This study carried out on 200 children equally divided into 2 groups: group I: 100 children with acyanotic CHDs; and group II: 100 healthy children served as controls. PCR-RFLP method carried out to amplify the A66G and C524T polymorphisms of MTRR gene digested with Xho1and NdeI enzymes. A significant difference(P=0.015) in genotype frequencies of C524T polymorphism between cases and controls, where CC, CT, and TT were 14.0%, 40.0% and 46.0% in patients compared to 38.0,36.0% and 26.0% in controls. Again, a significant difference (P=0.010) in genotype frequencies of A66G polymorphism between the two groups as AA, AG and GG were 26.0%, 32.0% and42.0% in patients compared to 48.0, 36.0% and 16.0% in controls. Also, MTRR A66G and C524T polymorphisms were associated with a higher CHD risk in the homozygote comparison of wild and mutant genotypes and also in heterozygote and mutant comparison. So A66G and C524T polymorphisms of MTRR gene are associated with increased risk of acyanotic CHDs. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    International Nuclear Information System (INIS)

    Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat


    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate

  10. Pharmacogenetic Study in Rectal Cancer Patients Treated With Preoperative Chemoradiotherapy: Polymorphisms in Thymidylate Synthase, Epidermal Growth Factor Receptor, GSTP1, and DNA Repair Genes

    Energy Technology Data Exchange (ETDEWEB)

    Paez, David, E-mail: [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)


    Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk

  11. Analysis of T-786C and 4a/b endothelial nitric oxide synthase gene polymorphisms in retinopathy of prematurity

    Directory of Open Access Journals (Sweden)

    Pantelić Jelica R.


    Full Text Available Retinopathy of prematurity (ROP is a vascular proliferative disorder of retina, that causes visual impairment in premature children. Beside well known risk factors such as short gestational age, low birth weight and early oxygen exposure, genetic susceptibility is considered as a risk factor for development of the disease. The aim of our study was to explore the association of T-786C and 4a/b eNOS gene polymorphisms with the development of severe ROP. Study included 174 preterm infants, 84 with ROP and 90 as a control group. No differences have been observed in genotypes and alleles distributions of eNOS T-786C and eNOS 4a/b polymorphisms between two analyzed groups. There was significant difference in female infants by dominant model for 4a/b genotypes (4bb/4ba+4aa. Namely, female infants in ROP group were more frequently carriers of 4ba and 4aa genotypes than female infants in control group (p=0.037. Analysis of association between 4a/b eNOS polymorphism and ROP among preterm infants have not shown statistically significant association (p=0.288. Gestational age values by recessive model (4bb+4ba/4aa were significantly lower in infants with 4aa genotype (t=2.034 p=0.044. Almost all detected 4aa genotypes were present in the group of infants with gestational age under 30 weeks (p=0.032, but multivariate linear regression analysis does not show association of 4a/b genotypes with gestational age of premature infants. According to results of the present study T-786C and 4a/b polymorphisms of the eNOS gene may not be the risk factors for the manifestation of severe ROP in Serbian infants. [Projekat Ministarstva nauke Republike Srbije, br. 175091

  12. Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review

    Directory of Open Access Journals (Sweden)

    S.N. Koval


    Full Text Available Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL, enzyme aldosterone synthase (AS, which takes a direct part in the formation of this hormone, as well as gene polymorphisms of AS, which have not only molecular genetic, but also differential diagnostic and therapeutic significance for secondary forms of arterial hypertension, abdominal obesity (AO, metabolic syndrome (MS, adrenal pathology and other endocrine disorders. AL is a steroid (mineralocorticoid hormone of the adrenal cortex, which is synthesized from cholesterol (CH, mainly in the glomerular zone of the adrenal glands, is released under the action of angiotensin II (A II and potassium ions (K+. AL acti­vity is mediated through the corresponding mineralocorticoid receptors (MKR. The particular importance in AH and MS development belongs to AL activation and MKR density in adipocytes, this phenomenon is accompanied by increased expression of pro-inflammatory cytokines, leptin, an adipogenic effect, and the inhibition of MCR activity is accompanied by increased production of adiponectin, which is more pronounced in patients with AH. Aldosterone synthase, a mitochondrial human enzyme encoded by the CYP11B2 gene (cytochrome P450, family 11, subfamily B, polypeptide 2 is located on the 8th chromosome. AS belongs to the superfamily of cytochrome P450 and regulates the synthesis of AL hormone. The CYP11B2 gene encodes the key enzyme for the synthesis of AL 18-hydroxylase. In scientific papers, single nucleotide polymorphism (SNP of AS gene is often studied, such as 5312T, Intron 2, Lys-173/Arg; T-344C, 3097 C/A. 227 SNP of the AS gene were identified in different

  13. The Role of −786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome

    Directory of Open Access Journals (Sweden)

    Blazej Misiak


    Full Text Available Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS. Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT and intima-media thickness of carotid arteries were significantly higher in −786CC homozygotes, in comparison with −786TC and −786TT patients. Regarding current smoking status, −786C allele was associated with higher CHOLT than −786T allele. Conclusion. Our study indicates the putative role of −786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking.

  14. The Role of −786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome (United States)

    Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard


    Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT) and intima-media thickness of carotid arteries were significantly higher in −786CC homozygotes, in comparison with −786TC and −786TT patients. Regarding current smoking status, −786C allele was associated with higher CHOLT than −786T allele. Conclusion. Our study indicates the putative role of −786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking. PMID:22164159

  15. The Role of -786T/C Polymorphism in the Endothelial Nitric Oxide Synthase Gene in Males with Clinical and Biochemical Features of the Metabolic Syndrome. (United States)

    Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard


    Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of -786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT) and intima-media thickness of carotid arteries were significantly higher in -786CC homozygotes, in comparison with -786TC and -786TT patients. Regarding current smoking status, -786C allele was associated with higher CHOLT than -786T allele. Conclusion. Our study indicates the putative role of -786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking.

  16. ACC synthase genes are polymorphic in watermelon (Citrullus spp.) and differentially expressed in flowers and in response to auxin and gibberellin. (United States)

    Salman-Minkov, Ayelet; Levi, Amnon; Wolf, Shmuel; Trebitsh, Tova


    The flowering pattern of watermelon species (Citrullus spp.) is either monoecious or andromonoecious. Ethylene is known to play a critical role in floral sex determination of cucurbit species. In contrast to its feminizing effect in cucumber and melon, in watermelon ethylene promotes male flower development. In cucumber, the rate-limiting enzyme of ethylene biosynthesis, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS), regulates unisexual flower development. To investigate the role of ethylene in flower development, we isolated four genomic sequences of ACS from watermelon (CitACS1-4). Both CitACS1 and CitACS3 are expressed in floral tissue. CitACS1 is also expressed in vegetative tissue and it may be involved in cell growth processes. Expression of CitACS1 is up-regulated by exogenous treatment with auxin, gibberellin or ACC, the immediate precursor of ethylene. No discernible differential floral sex-dependent expression pattern was observed for this gene. The CitACS3 gene is expressed in open flowers and in young staminate floral buds (male or hermaphrodite), but not in female flowers. CitACS3 is also up-regulated by ACC, and is likely to be involved in ethylene-regulated anther development. The expression of CitACS2 was not detected in vegetative or reproductive organs but was up-regulated by auxin. CitACS4 transcript was not detected under our experimental conditions. Restriction fragment length polymorphism (RFLP) and sequence tagged site (STS) marker analyses of the CitACS genes showed polymorphism among and within the different Citrullus groups, including watermelon cultivars, Citrullus lanatus var. lanatus, the central subspecies Citrullus lanatus var. citroides, and the desert species Citrullus colocynthis (L).

  17. Inducible nitric oxide synthase gene polymorphisms are associated with a risk of nephritis in Henoch-Schönlein purpura children. (United States)

    Jiang, Jue; Duan, Wuqiong; Shang, Xu; Wang, Hua; Gao, Ya; Tian, Peijun; Zhou, Qi


    Henoch-Schönlein purpura (HSP) is the most common form of systemic small-vessel vasculitis in children, and HSP nephritis (HSPN) is a major complication of HSP and is the primary cause of morbidity and mortality. Previous studies have suggested that inducible nitric oxide synthase (iNOS) may play an important role in the pathogenesis of HSP. In this study, we performed a detailed analysis to investigate the potential association between iNOS polymorphisms and the risk of HSP and the tendency for children with HSP to develop HSPN in a Chinese Han population. A promoter pentanucleotide repeat (CCTTT)n and 10 functional single-nucleotide polymorphisms (SNPs) from 532 healthy controls and 513 children with HSP were genotyped using the MassARRAY system and GeneScan. The results suggested that the allelic and genotypic frequencies of the rs3729508 polymorphism were nominally associated with susceptibility to HSP. In addition, there was a significant difference in the allelic distribution of the (CCTTT)12 repeats and rs2297518 between the HSP children with and without nephritis; the HSP children with nephritis exhibited a significantly higher frequency of the (CCTTT)12 repeats and A allele of rs2297518 than the HSP children without nephritis (P FDR  = 0.033, OR = 1.624, 95% CI = 1.177-2.241 and P FDR  = 0.030, OR = 1.660, 95% CI = 1.187-2.321, respectively). Our results support that iNOS polymorphisms are associated with the risk of HSP and may strongly contribute to the genetic basis of individual differences in the progression to nephritis among children with HSP in the Chinese Han population. What is Known: • The etiology of HSP is unknown, but the genetic factors may play an important role in the pathogenesis of HSP. • iNOS could contribute to the development and clinical manifestations of HSP, and this has not been studied extensively so far. What is New: • Our results support that iNOS polymorphisms not only are associated with HSP risk but also

  18. Nitric oxide synthase gene G298 allele

    International Nuclear Information System (INIS)

    Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar


    Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

  19. Analysis of prostaglandin-endoperoxide synthase-2 gene polymorphisms and risk of cervical cancer in an East Indian population: A case–control study

    Directory of Open Access Journals (Sweden)

    Dipanshu Sur


    Conclusions: PTGS-2 genotype rs689466:—1195A/G gene polymorphism demonstrated strongly associated with cervical cancer disease. However, exon1-+837T > C polymorphism was not associated with cancer risk in East Indian women. Further studies evaluating the role of PTGS-2 gene polymorphisms in ethnically diverse populations and a larger cohort may help in understanding the etiopathogenesis of cervical cancer in women worldwide.

  20. Endothelial nitric oxide synthase polymorphism G298T in ...

    Indian Academy of Sciences (India)

    Supplementary data: Endothelial nitric oxide synthase polymorphism G298T in association with oxidative DNA damage in coronary atherosclerosis. Rajesh G. Kumar, Mrudula K. Spurthi, Kishore G. Kumar, Sanjib K. Sahu and Surekha H. Rani. J. Genet. 91, 349–352. Table 1. The demographic and clinical data of the CHD ...

  1. Polymorphism at the 3'-UTR of the thymidylate synthase gene: A potential predictor for outcomes in Caucasian patients with esophageal adenocarcinoma treated with preoperative chemoradiation

    International Nuclear Information System (INIS)

    Liao Zhongxing; Liu Hongji; Swisher, Stephen G.; Wang Luo; Wu, Tsung-Teh; Correa, Arlene M.; Roth, Jack A.; Cox, James D.; Komaki, Ritsuko; Ajani, Jaffer A.; Wei Qingyi


    Purpose: To test the hypothesis that TS3'UTR polymorphisms predict outcomes in 146 Caucasian patients with esophageal adenocarcinoma treated with preoperative 5-fluorouracil-based chemoradiation. Methods and Materials: DNA was extracted from hematoxylin-and-eosin stained histologic slides of normal esophageal or gastric mucosa sections from paraffin blocks of esophagectomy specimens. Genotypes of the TS3'UTR polymorphism were determined by polymerase chain reaction for a 6-bp insertion. The genotype groups (0bp/0bp, 6bp/0bp, and 6bp/6bp) were compared for clinical features and overall survival, recurrence-free-survival, locoregional control (LRC), and distant metastasis control. Multivariable Cox regression analyses were performed to find independent predictors for the stated outcomes. Results: There was a trend of association between 6bp/6bp genotype and a decreased risk of local regional recurrence (hazards ratio = 0.211, 95% confidence interval = 0.041-1.095, p = 0.06) compared with other genotypes. There was a trend that patients with 6bp/6bp genotype had a higher 3-year probability of LRC compared with patients with the other two genotypes combined (p = 0.07); however, the difference was not statistically significant. Conclusions: The null hypotheses were not rejected in this study, probably owing to small sample size or the single gene examined. Prospective studies with adequate statistical power analyzing a family of genes involved in the 5-fluorouracil metabolism are needed to assess genetic determinants of treatment-related outcomes in esophageal adenocarcinoma

  2. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne


    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  3. Genetic polymorphisms in the microRNA binding-sites of the thymidylate synthase gene predict risk and survival in gastric cancer. (United States)

    Shen, Rong; Liu, Hongliang; Wen, Juyi; Liu, Zhensheng; Wang, Li-E; Wang, Qiming; Tan, Dongfeng; Ajani, Jaffer A; Wei, Qingyi


    Thymidylate synthase (TYMS) plays a crucial role in folate metabolism as well as DNA synthesis and repair. We hypothesized that functional polymorphisms in the 3' UTR of TYMS are associated with gastric cancer risk and survival. In the present study, we tested our hypothesis by genotyping three potentially functional (at miRNA binding sites) TYMS SNPs (rs16430 6bp del/ins, rs2790 A>G and rs1059394 C>T) in 379 gastric cancer patients and 431 cancer-free controls. Compared with the rs16430 6bp/6bp + 6bp/0bp genotypes, the 0bp/0bp genotype was associated with significantly increased gastric cancer risk (adjusted OR = 1.72, 95% CI = 1.15-2.58). Similarly, rs2790 GG and rs1059394 TT genotypes were also associated with significantly increased risk (adjusted OR = 2.52, 95% CI = 1.25-5.10 and adjusted OR = 1.57, 95% CI = 1.04-2.35, respectively), compared with AA + AG and CC + CT genotypes, respectively. In the haplotype analysis, the T-G-0bp haplotype was associated with significantly increased gastric cancer risk, compared with the C-A-6bp haplotype (adjusted OR = 1.34, 95% CI = 1.05-1.72). Survival analysis revealed that rs16430 0bp/0bp and rs1059394 TT genotypes were also associated with poor survival in gastric cancer patients who received chemotherapy treatment (adjusted HR = 1.61, 95% CI = 1.05-2.48 and adjusted HR = 1.59, 95% CI = 1.02-2.48, respectively). These results suggest that these three variants in the miRNA binding sites of TYMS may be associated with cancer risk and survival of gastric cancer patients. Larger population studies are warranted to verify these findings. © 2014 Wiley Periodicals, Inc.

  4. Polymorphism in the Methylenetetrahydrofolate Reductase and Thymidylate Synthase Gene Predicts for Response to Fluorouracil-based Chemotherapy in Advanced Gastric Cancer Patients

    Directory of Open Access Journals (Sweden)

    Jianwei Lu


    Full Text Available Objective: Fluorouracil (5-FU is widely used in the treatment of gastric cancer. Methylenetetrahydrofolate reductase (MTHFR and thymidylate synthetase (TS are important targets of many antimetabolites, including 5-FU. The relationship between polymorphism in the MTHFR (C677T, A1298C and TS (5`-TUR, 3`-UTR genotypes and sensitivity of gastric cancer to 5-FU-based chemotherapy is investigated in the present study. Methods: 173 patients with advanced gastric cancer were analyzed. All patients were treated with 5-FU-based chemotherapy (FOLFOX, FP and DCF regimen. DNA from peripheral blood leukocytes was obtained before the treatment. All genotypes were detected by PCR-RFLP. 12 germline polymorphisms within 2 genes were analyzed. The genotypes of MTHFR C677T, A1298C and TS 3`-TUR were analyzed in 173 patients while TS 5`-TUR in 135 patients. Results: The overall response rate (RR was 35.8%. The RR of the DCF regimen group was significantly higher than that of the FP and FOLFOX regimen groups (55.8% vs. 27.1%, 31.1%; P=0.006. The RR of the MTHFR C677T T/T genotype was significantly higher than that of the C/ C and C/T genotypes (73.3% vs. 28.0%; P=0.000. In MTHFR A1298C, a higher RR was observed in A/A genotype compared with the C/C and A/C genotypes (41.8% vs. 21.6%, P=0.011. The RR of -6/-6 bp and -6/+6 bp genotypes in TS 3`UTR was significantly higher than that of +6/+6 bp genotype (40.3% vs. 17.6%, P=0.014. There was no difference in RR according to TS 5`UTR polymorphism (2R/2R and 2R/3R: 41.7% vs. 3R/3R: 36.8%, P=0.487. The RR of MTHFR C677T T/T genotypes in FOLFOX or FP regimens was significantly higher than that of C/C and C/T genotypes (P=0.008, P=0.000 while no difference in DCF regimen. The RR of DCF regimen wassignificantly higher than that of FOLFOX and FP regimens in C/T and C/C genotypes (P=0.000. The MTHFR C677T T/T genotypes had a significantly higher incidence of grade 3/4 emesis (66.7% and stomatitis (30.0% than patients with C/T or

  5. Inflammatory Gene Polymorphisms in Lung Cancer Susceptibility. (United States)

    Eaton, Keith D; Romine, Perrin E; Goodman, Gary E; Thornquist, Mark D; Barnett, Matt J; Petersdorf, Effie W


    Chronic inflammation has been implicated in carcinogenesis, with increasing evidence of its role in lung cancer. We aimed to evaluate the role of genetic polymorphisms in inflammation-related genes in the risk for development of lung cancer. A nested case-control study design was used, and 625 cases and 625 well-matched controls were selected from participants in the β-Carotene and Retinol Efficacy Trial, which is a large, prospective lung cancer chemoprevention trial. The association between lung cancer incidence and survival and 23 polymorphisms descriptive of 11 inflammation-related genes (interferon gamma gene [IFNG], interleukin 10 gene [IL10], interleukin 1 alpha gene [IL1A], interleukin 1 beta gene [IL1B], interleukin 2 gene [IL2], interleukin 4 receptor gene [IL4R], interleukin 4 gene [IL4], interleukin 6 gene [IL6], prostaglandin-endoperoxide synthase 2 gene [PTGS2] (also known as COX2), transforming growth factor beta 1 gene [TGFB1], and tumor necrosis factor alpha gene [TNFA]) was evaluated. Of the 23 polymorphisms, two were associated with risk for lung cancer. Compared with individuals with the wild-type (CC) variant, individuals carrying the minor allele variants of the IL-1β-511C>T promoter polymorphism (rs16944) (CT and TT) had decreased odds of lung cancer (OR = 0.74, [95% confidence interval (CI): 0.58-0.94] and OR = 0.71 [95% CI: 0.50-1.01], respectively, p = 0.03). Similar results were observed for the IL-1β-1464 C>G promoter polymorphism (rs1143623), with presence of the minor variants CG and CC having decreased odds of lung cancer (OR = 0.75 [95% CI: 0.59-0.95] and OR = 0.69 [95% CI: 0.46-1.03], respectively, p = 0.03). Survival was not influenced by genotype. This study provides further evidence that IL1B promoter polymorphisms may modulate the risk for development of lung cancer. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  6. The Eucalyptus terpene synthase gene family. (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J


    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  7. Gene polymorphisms in chronic periodontitis

    NARCIS (Netherlands)

    Laine, M.L.; Loos, B.G.; Crielaard, W.


    We aimed to conduct a review of the literature for gene polymorphisms associated with chronic periodontitis (CP) susceptibility. A comprehensive search of the literature in English was performed using the keywords: periodontitis, periodontal disease, combined with the words genes, mutation, or

  8. Role of Polymorphisms of Inducible Nitric Oxide Synthase and Endothelial Nitric Oxide Synthase in Idiopathic Environmental Intolerances

    Directory of Open Access Journals (Sweden)

    Chiara De Luca


    Full Text Available Oxidative stress and inflammation play a pathogenetic role in idiopathic environmental intolerances (IEI, namely, multiple chemical sensitivity (MCS, fibromyalgia (FM, and chronic fatigue syndrome (CFS. Given the reported association of nitric oxide synthase (NOS gene polymorphisms with inflammatory disorders, we aimed to investigate the distribution of NOS2A −2.5 kb (CCTTTn as well as Ser608Leu and NOS3 −786T>C variants and their correlation with nitrite/nitrate levels, in a study cohort including 170 MCS, 108 suspected MCS (SMCS, 89 FM/CFS, and 196 healthy subjects. Patients and controls had similar distributions of NOS2A Ser608Leu and NOS3 −786T>C polymorphisms. Interestingly, the NOS3 −786TT genotype was associated with increased nitrite/nitrate levels only in IEI patients. We also found that the NOS2A −2.5 kb (CCTTT11 allele represents a genetic determinant for FM/CFS, and the (CCTTT16 allele discriminates MCS from SMCS patients. Instead, the (CCTTT8 allele reduces by three-, six-, and tenfold, respectively, the risk for MCS, SMCS, and FM/CFS. Moreover, a short number of (CCTTT repeats is associated with higher concentrations of nitrites/nitrates. Here, we first demonstrate that NOS3 −786T>C variant affects nitrite/nitrate levels in IEI patients and that screening for NOS2A −2.5 kb (CCTTTn polymorphism may be useful for differential diagnosis of various IEI.

  9. Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

    DEFF Research Database (Denmark)

    Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh


    of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...


    Directory of Open Access Journals (Sweden)

    M. A. Slugina


    Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.

  11. Sequence analysis of cereal sucrose synthase genes and isolation ...

    African Journals Online (AJOL)



    Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.

  12. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013


    Steven Steven; Yoni F Syukriani; Julius B Dewanto


    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  13. The Tomato Terpene Synthase Gene Family1[W][OA (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran


    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  14. Characterization of the human gene (TBXAS1) encoding thromboxane synthase. (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T


    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  15. A simple, high-throughput method to detect Plasmodium falciparum single nucleotide polymorphisms in the dihydrofolate reductase, dihydropteroate synthase, and P. falciparum chloroquine resistance transporter genes using polymerase chain reaction- and enzyme-linked immunosorbent

    DEFF Research Database (Denmark)

    Alifrangis, Michael; Enosse, Sonia; Pearce, Richard


    Single nucleotide polymorphisms (SNPs) in the Plasmodium falciparum dihydrofolate reductase (dhfr), and dihydropteroate synthetase (dhps), and chloroquine resistance transporter (Pfcrt) genes are used as molecular markers of P. falciparum resistance to sulfadoxine/pyrimethamine and chloroquine....... However, to be a practical tool in the surveillance of drug resistance, simpler methods for high-throughput haplotyping are warranted. Here we describe a quick and simple technique that detects dhfr, dhps, and Pfcrt SNPs using polymerase chain reaction (PCR)- and enzyme-linked immunosorbent assay (ELISA...

  16. Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak

    Directory of Open Access Journals (Sweden)

    Marić Slađana


    Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.

  17. Endothelial nitric oxide synthase single nucleotide polymorphism and left ventricular function in early chronic kidney disease.

    Directory of Open Access Journals (Sweden)

    Sourabh Chand

    Full Text Available Chronic kidney disease (CKD is associated with accelerated cardiovascular disease and heart failure. Endothelial nitric oxide synthase (eNOS Glu298Asp single nucleotide polymorphism (SNP genotype has been associated with a worse phenotype amongst patients with established heart failure and in patients with progression of their renal disease. The association of a cardiac functional difference in non-dialysis CKD patients with no known previous heart failure, and eNOS gene variant is investigated.140 non-dialysis CKD patients, who had cardiac magnetic resonance (CMR imaging and tissue doppler echocardiography as part of two clinical trials, were genotyped for eNOS Glu298Asp SNP retrospectively.The median estimated glomerular filtration rate (eGFR was 50 mls/min and left ventricular ejection fraction (LVEF was 74% with no overt diastolic dysfunction in this cohort. There were significant differences in LVEF across eNOS genotypes with GG genotype being associated with a worse LVEF compared to other genotypes (LVEF: GG 71%, TG 76%, TT 73%, p = 0.006. After multivariate analysis, (adjusting for age, eGFR, baseline mean arterial pressure, contemporary CMR heart rate, total cholesterol, high sensitive C-reactive protein, body mass index and gender GG genotype was associated with a worse LVEF, and increased LV end-diastolic and systolic index (p = 0.004, 0.049 and 0.009 respectively.eNOS Glu298Asp rs1799983 polymorphism in CKD patients is associated with relevant sub-clinical cardiac remodelling as detected by CMR. This gene variant may therefore represent an important genetic biomarker, and possibly highlight pathways for intervention, in these patients who are at particular risk of worsening cardiac disease as their renal dysfunction progresses.

  18. Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

    DEFF Research Database (Denmark)

    Huang, Laurence; Crothers, Kristina; Atzori, Chiara


    in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

  19. Methylenetetrahydrofolate reductase gene polymorphism in type 1 ...

    African Journals Online (AJOL)

    In patients with type-I diabetes mellitus folate deficiency is associated with endothelial dysfunction. So, polymorphism in genes involved in folate metabolism may have a role in vascular disease. This study was designed to evaluate the relationship between methylenetetrahydrofolate reductase (MTHFR) gene polymorphism ...

  20. Analysis of polymorphisms and haplotype structure of the human thymidylate synthase genetic region: a tool for pharmacogenetic studies.

    Directory of Open Access Journals (Sweden)

    Soma Ghosh

    Full Text Available 5-Fluorouracil (5FU, a widely used chemotherapeutic drug, inhibits the DNA replicative enzyme, thymidylate synthase (Tyms. Prior studies implicated a VNTR (variable numbers of tandem repeats polymorphism in the 5'-untranslated region (5'-UTR of the TYMS gene as a determinant of Tyms expression in tumors and normal tissues and proposed that these VNTR genotypes could help decide fluoropyrimidine dosing. Clinical associations between 5FU-related toxicity and the TYMS VNTR were reported, however, results were inconsistent, suggesting that additional genetic variation in the TYMS gene might influence Tyms expression. We thus conducted a detailed genetic analysis of this region, defining new polymorphisms in this gene including mononucleotide (poly A:T repeats and novel single nucleotide polymorphisms (SNPs flanking the VNTR in the TYMS genetic region. Our haplotype analysis of this region used data from both established and novel genetic variants and found nine SNP haplotypes accounting for more than 90% of the studied population. We observed non-exclusive relationships between the VNTR and adjacent SNP haplotypes, such that each type of VNTR commonly occurred on several haplotype backgrounds. Our results confirmed the expectation that the VNTR alleles exhibit homoplasy and lack the common ancestry required for a reliable marker of a linked adjacent locus that might govern toxicity. We propose that it may be necessary in a clinical trial to assay multiple types of genetic polymorphisms in the TYMS region to meaningfully model linkage of genetic markers to 5FU-related toxicity. The presence of multiple long (up to 26 nt, polymorphic monothymidine repeats in the promoter region of the sole human thymidylate synthetic enzyme is intriguing.

  1. Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP. (United States)

    Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica


    Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  2. Beta-Glucan Synthase Gene Expression in Pleurotus sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Nie, H.J.


    Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)

  3. Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

    DEFF Research Database (Denmark)

    Edman, U; Edman, J C; Lundgren, B


    The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

  4. gene polymorphism and its serum lev

    Indian Academy of Sciences (India)


    polymorphisms and its serum level with the risk of MetS as well as their ... population for quantifying insulin resistance and β-cell function (Matthews et al. 1985). .... of IL-10 -819 C >T gene polymorphism (Co-dominant model) was significantly.

  5. gene polymorphism and its serum lev

    Indian Academy of Sciences (India)


    Association of Interleukin-10 (-1082 A>G, -819 C >T and -592 C >A) gene polymorphism and its ... Th2 induced component of anti-β cell immunity is mediated principally by IL-10 (Lee et al. ..... promoter polymorphisms influence the clinical outcome of diffuse large B-cell lymphoma. ... Bone Marrow Transplant 36, 1089-1095.

  6. Cystathionine β-synthase T833C/844INS68 polymorphism: a family-based study on mentally retarded children

    Directory of Open Access Journals (Sweden)

    Mukhopadhyay Jotideb


    Full Text Available Abstract Background Cystathionine β-synthase (CBS mediates conversion of homocysteine to cystathionine and deficiency in enzyme activity may lead to hyperhomocysteinemia/homocystinuria, which are often associated with mental retardation (MR. A large number of polymorphisms have been reported in the CBS gene, some of which impair its activity and among these, a T833C polymorphism in cis with a 68 bp insertion at 844 in the exon 8 is found to be associated with mild hyperhomocysteinemia in different ethnic groups. Methods The present study is aimed at investigating the association between T833C/844ins68 polymorphism and MR. One hundred and ninety MR cases were recruited after psychometric evaluation. Hundred and thirty-eight control subjects, two hundred and sixty-seven parents of MR probands and thirty cardiovascular disorder (CVD patients were included for comparison. Peripheral blood was collected after obtaining informed written consent. The T833C/844ins68 polymorphism was investigated by PCR amplification of genomic DNA and restriction fragment length polymorphism analysis, followed by statistical analysis. Results The genotypic distribution of the polymorphism was within the Hardy-Weinberg equilibrium. A slightly increased genotypic frequency was observed in the Indian control population as compared to other Asian populations. Both haplotype-based haplotype relative risk analysis and transmission disequilibrium test reveled lack of association of the T833C/844ins68 polymorphism with MR; nevertheless, the relative risk calculated was higher (>1 and in a limited number of informative MR families, preferential transmission of the double mutant from heterozygous mothers to the MR probands was noticed (χ2 = 4.00, P Conclusion This is the first molecular genetic study of CBS gene dealing with T833C/844ins68 double mutation in MR subjects. Our preliminary data indicate lack of association between T833C/844ins68 polymorphism with MR. However

  7. Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Gnanasambandan Ramanathan


    Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

  8. The geranylgeranyl pyrophosphate synthase gene from Ginkgo ...

    African Journals Online (AJOL)



    Apr 6, 2009 ... Ginkgo biloba is one of the oldest living plant species and often referred to as “a .... GbGGDPS were analyzed and the sequence comparison was conducted ... function of plant GGDPS genes (Zhu et al., 1997) and human and.

  9. The anthocyanidin synthase gene from sweetpotato [Ipomoea ...

    African Journals Online (AJOL)



    Jun 21, 2010 ... The tissue expression profiles of IbANS indicated that it could be expressed in all tissues but at different ... al., 1997). Likewise, transcripts of the apple ANS gene are detected ... electrophoresis (EC250-90, E-C Apparatus Corporation) and ... Instruments Inc.) analyses and the RNA samples were stored in a.

  10. Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species. (United States)

    Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W


    Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

  11. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others


    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  12. Influence of leukotriene gene polymorphisms on chronic rhinosinusitis

    Directory of Open Access Journals (Sweden)

    Duval Melanie


    Full Text Available Abstract Background Chronic rhinosinusitis (CRS is increasingly viewed as an inflammatory condition of the sinonasal mucosa interacting with bacteria and/or fungi. However, factors conferring susceptibility to disease remain unknown. Advances in genomics offer powerful tools to explore this disorder. The goal of this study was to evaluate the effect of single nucleotide polymorphisms (SNP on CRS in a panel of genes related to cysteinyl leukotriene metabolism. Methods Severe cases of CRS and postal code match controls were recruited prospectively. A total of 206 cases and 200 controls were available for the present study. Using a candidate gene approach, five genes related to cysteinyl leukotriene metabolism were assessed. For each gene, we selected the maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. These SNPs are in arachidonate 5-lipoxygenase (ALOX5, arachidonate 5-lipoxygenase-activating protein (ALOX5AP, leukotriene C4 synthase (LTC4S, cysteinyl leukotriene receptor 1 (CYSLTR1 and cysteinyl leukotriene receptor 2 (CYSLTR2 genes. Results A total of 59 SNPs were genotyped to capture the common genetic variations within these genes. Three SNPs located within the ALOX5, CYSLTR1 and ALOX5AP genes reached the nominal p-value threshold (p Conclusion While these initial results do not support that polymorphsims in genes assessed involved in the leukotriene pathways are contributing to the pathogenesis of CRS, this initial study was not powered to detect polymorphisms with relative risk of 2.0 or less, where we could expect many gene effects for complex diseases to occur. Thus, despite this lack of significant association noted in this study, we believe that validation with external populations and the use of better-powered studies in the future may allow more conclusive findings.


    Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B


    A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.

  14. Metabolism and gene polymorphisms of the folate pathway in Brazilian women with history of recurrent abortion. (United States)

    Boas, Wendell Vilas; Gonçalves, Rozana Oliveira; Costa, Olívia Lúcia Nunes; Goncalves, Marilda Souza


    To investigate the association between polymorphisms in genes that encode enzymes involved in folate- and vitamin B12-dependent homocysteine metabolism and recurrent spontaneous abortion (RSA). We investigated the C677T and A1298C polymorphisms of the methylenetetrahydrofalate reductase gene (MTHFR), the A2756G polymorphism of the methionine synthase gene (MS) and the 844ins68 insertion of the cystathionine beta synthetase gene (CBS). The PCR technique followed by RFLP was used to assess the polymorphisms; the serum levels of homocysteine, vitamin B12 and folate were investigated by chemiluminescence. The EPI Info Software version 6.04 was used for statistical analysis. Parametric variables were compared by Student's t-test and nonparametric variables by the Wilcoxon rank sum test. The frequencies of gene polymorphisms in 89 women with a history of idiopathic recurrent miscarriage and 150 controls were 19.1 and 19.6% for the C677T, insertion, 20.8 and 26% for the A1298C insertion, 14.2 and 21.9% for the A2756G insertion, and 16.4 and 18% for the 844ins68 insertion, respectively. There were no significant differences between case and control groups in any of the gene polymorphisms investigated. However, the frequency of the 844ins68 insertion in the CBS gene was higher among women with a history of loss during the third trimester of pregnancy (p=0.003). Serum homocysteine, vitamin B12 and folate levels id not differ between the polymorphisms studied in the case and control groups. However, linear regression analysis showed a dependence of serum folate levels on the maintenance of tHcy levels. The investigated gene polymorphisms and serum homocysteine, vitamin B12 and folate levels were not associated with idiopathic recurrent miscarriage in the present study. Further investigations are needed in order to confirm the role of the CBS 844ins68 insertion in recurrent miscarriage.

  15. Promotor polymorphisms in leukotriene C4 synthase and risk of ischemic cerebrovascular disease

    DEFF Research Database (Denmark)

    Freiberg, J.J.; Tybjaerg-Hansen, A.; Sillesen, H.


    OBJECTIVE: Cysteinyl leukotrienes are involved in inflammation and possibly in early carotid atherosclerosis. We tested the hypothesis that the -444 A/C and -1072 G/A polymorphisms of the leukotriene C(4) synthase associate with risk of ischemic cerebrovascular disease. METHODS AND RESULTS: We...... genotyped 10 592 individuals from the Danish general population, the Copenhagen City Heart Study. During 24 years of follow-up, 557 individuals developed ischemic cerebrovascular disease. The allele frequency was 0.07 for -1072 A and 0.29 for -444 C. Cumulative incidence for ischemic cerebrovascular disease...... was higher for -1072 AA versus GG genotype (log-rank: P=0.002), and lower for -444 CC versus AA genotype (log-rank: P=0.008). Combined genotypes showed corresponding cumulative incidence differences (log-rank: P=0.003). Multifactorially adjusted hazard ratios for ischemic cerebrovascular disease were 2...

  16. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis. (United States)

    Noar, Roslyn D; Daub, Margaret E


    Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

  17. Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

    Directory of Open Access Journals (Sweden)

    Roslyn D Noar

    Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

  18. Polymorphism of the VEGF gene and its association with growth ...

    African Journals Online (AJOL)


    Keywords: VEGF gene, caprine, single nucleotide polymorphism (SNP), genetic variation, PCR-SSCP ... This field is strongly focusing on gene loci and polymorphisms that have ..... Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining. Anal.

  19. Polymorphism at codon 36 of the p53 gene. (United States)

    Felix, C A; Brown, D L; Mitsudomi, T; Ikagaki, N; Wong, A; Wasserman, R; Womer, R B; Biegel, J A


    A polymorphism at codon 36 in exon 4 of the p53 gene was identified by single strand conformation polymorphism (SSCP) analysis and direct sequencing of genomic DNA PCR products. The polymorphic allele, present in the heterozygous state in genomic DNAs of four of 100 individuals (4%), changes the codon 36 CCG to CCA, eliminates a FinI restriction site and creates a BccI site. Including this polymorphism there are four known polymorphisms in the p53 coding sequence.

  20. Thymidylate synthase genetic polymorphism and plasma total homocysteine level in a group of Turkish patients with rheumatoid arthritis: relationship with disease activity and methotrexate toxicity. (United States)

    Borman, Pınar; Taşbaş, Özgur; Karabulut, Halil; Tukun, Ajlan; Yorgancıoğlu, Rezan


    The polymorphism of thymidylate synthase (TS) gene and homocysteine are reported to have a relationship to methotrexate (MTX) metabolism, with conflicting results. The aim of this study was to determine homocysteine levels and the frequency of TS gene triple repeat (TS3R) and double repeat (TS2R) polymorphisms in a group of Turkish RA patients and evaluate its association with MTX toxicity and disease activity. Sixty-four patients with RA and 31 control subjects with a mean age of 48.7 ± 12.5 and 46.2 ± 13.4 years, were enrolled to the study. Demographic characteristics were obtained and number of patients with MTX-related adverse affects, were recorded in the patient group. The homocysteine levels and TS2R/TS3R polymorphisms of the TS gene were analyzed and the distribution of genotypes according to MTX toxicity and disease activity, were determined. The demographic properties were similar between the patient and control subjects. Folic acid supplementation with a mean dose of 5mg folic acid/week, was present in all patients. Thirty-six of the 64 patients showed adverse effects to MTX treatment. The frequency of TS2R and TS3R polymorphisms were found to be similar in the patient and control groups. TS2R and TS3R gene polymorphisms were found to be similar in patients with and without MTX-related adverse events. The mean homocysteine level was also similar in patients with and without TS gene polymorphism, but was found to be higher (12.45μmol/L vs 10.7μmol/L) in patients with MTX-related side effects than in patients without side effects. The mean level of homocysteine was correlated with levels of ESR in the patient group. In conclusion, homocysteine levels might effect the disease activity and toxicity of MTX but 2R and 3R polymorphisms in the TS gene, were not related with MTX-related toxicity in RA patients receiving folate supplementation. Further studies are needed to illuminate the polymorphisms in other enzymes that might be responsible from the MTX

  1. Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus. (United States)

    Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T


    Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

  2. Do prion protein gene polymorphisms induce apoptosis in non ...

    Indian Academy of Sciences (India)


    Aug 26, 2016 ... Genetic variations such as single nucleotide polymorphisms (SNPs) in prion protein coding gene, Prnp, greatly affect susceptibility to prion diseases in mammals. Here, the coding region of Prnp was screened for polymorphisms in redeared turtle, Trachemys scripta. Four polymorphisms, L203V, N205I, ...

  3. [Features of allele polymorphism of genes involved in homocysteine and folate metabolism in patients with atherosclerosis of the lower extremity arteries]. (United States)

    Klenkova, N A; Kapustin, S I; Saltykova, N B; Shmeleva, V M; Blinov, M N


    Under study were features of allele polymorphism of genes of methylenetetrahydrofolate reductase (MTHFR C677T and A1298C), methionine synthase (MS A 2756G), methionine synthase reductase (MTRR A66G) and methylenetetrahydrofolate dehydrogenase (MTHFD G1958A) in patients with atherosclerosis of the lower extremity arteries (ALEA). Patients with hyperhomocysteinemia (HHcy) had statistically significant increase of allele MTHFR 677T and MTRR 66GG as compared both with the control group and with the group of patients without HHcy. It suggests that polymorphism of genes involved in homocystein and folate metabolism might affect the risk of HHcy in patients with ALEA.

  4. A meta-analysis of eNOS and ACE gene polymorphisms and risk of pre-eclampsia in women. (United States)

    Shaik, A P; Sultana, A; Bammidi, V K; Sampathirao, K; Jamil, K


    A meta-analyses of endothelial nitric oxide synthase (eNOS) and angiotensin-converting enzyme (ACE) gene polymorphisms in pre-eclampsia was performed. We shortlisted 33 studies (17 for ACE; 16 for eNOS gene polymorphisms), of which 29 articles (16 for ACE and 15 for eNOS) were analysed. Overall, 1,620 cases with pre-eclampsia and 2,158 controls were analysed for intron 16 insertion-deletion polymorphism in ACE gene. A total of 1,610 subjects with pre-eclampsia and 2,875 controls were analysed for the Glu298Asp in eNOS gene. Overall, the random-effects odds ratio (OR) with Glu298Asp in eNOS gene was 0.958 (95% confidence intervals, CI 0.747-1.228, p > 0.05), and for the insertion-deletion/ACE polymorphism was 0.987 (95% CI 0.698-1.395, p > 0.05). Significant heterogeneity was observed in the studies that evaluated polymorphisms in ACE (Q value = 55.6; I(2) = 73; p value = 0.000); and eNOS (Q value = 37.2; I(2) = 62.4; p value = 0.001) polymorphisms. No significant risk of pre-eclampsia was observed in both eNOS and ACE genes with these polymorphisms.

  5. STAT4 gene polymorphism in patients after renal allograft transplantation


    D?browska-?amojcin, Ewa; Dziedziejko, Violetta; Safranow, Krzysztof; Doma?ski, Leszek; S?uczanowska-G?abowska, Sylwia; Pawlik, Andrzej


    Introduction STAT4 (signal transducer and activator of transcription 4) is involved in the regulation of innate and adaptive immune responses. Some studies have suggested that STAT4 may be involved in the immune response after graft transplantation. Several polymorphisms in the STAT4 gene have been identified. The most commonly studied polymorphism in the STAT4 gene is rs7574865. In our study, we examined whether this polymorphism is associated with the early and late functions of renal allog...

  6. Ghrelin gene polymorphisms in rheumatoid arthritis. (United States)

    Ozgen, Metin; Koca, Suleyman Serdar; Etem, Ebru Onalan; Yuce, Huseyin; Aydin, Suleyman; Isik, Ahmet


    Ghrelin, an endogenous orexigenic peptide, has anti-inflammatory effects, down-regulates pro-inflammatory cytokines, and its altered levels are reported in various inflammatory diseases. The human preproghrelin (ghrelin/obestatin) gene shows several single nucleotide polymorphisms (SNPs) including Arg51Gln, Leu72Met, Gln90Leu, and A-501C. The aim of this study was to investigate the frequency, and clinical significance, of these four SNPs in a small cohort of Turkish patients with rheumatoid arthritis (RA). The study included 103 patients with RA and 103 healthy controls. In the RA group, disease activity and disease-related damage were assessed using the Disease Activity Score-28 (DAS-28), and the modified Larsen scoring (MLS) methods. In all the participants, genomic DNA was isolated and genotyped by polymerase chain reaction and restriction fragment length polymorphism analysis. The frequencies of ghrelin gene SNPs were 82.5 and 79.6% in the RA and control groups, respectively, and there were no significant differences in terms of genotype distributions and allele frequencies for these four SNPs between the groups. However, the A-501C SNP was found to be associated with early disease onset, and Gln90Leu SNP with less frequent rheumatoid factor positivity, in the RA group. A-501C SNP is associated with earlier onset of RA suggesting that genetic variations in the ghrelin gene may have an impact on RA. Copyright © 2010 Société française de rhumatologie. Published by Elsevier SAS. All rights reserved.

  7. X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

    International Nuclear Information System (INIS)

    Lamas, Maria J.; Duran, Goretti; Gomez, Antonio; Balboa, Emilia; Anido, Urbano; Bernardez, Beatriz; Rana-Diez, Pablo; Lopez, Rafael; Carracedo, Angel; Barros, Francisco


    Purpose: 5-Fluorouracil–based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m 2 /d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62–10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10–6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR C 677 and MTHFR A 1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

  8. X-Ray Cross-Complementing Group 1 and Thymidylate Synthase Polymorphisms Might Predict Response to Chemoradiotherapy in Rectal Cancer Patients

    Energy Technology Data Exchange (ETDEWEB)

    Lamas, Maria J., E-mail: [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Duran, Goretti [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Gomez, Antonio [Department of Oncology Radiotherapy, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Balboa, Emilia [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Anido, Urbano [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Bernardez, Beatriz [Oncology Pharmacy Unit, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Rana-Diez, Pablo [Molecular Medicine Unit, Fundacion Publica Galega de Medicina Xenomica, Choupana S/N, Santiago de Compostela (Spain); Lopez, Rafael [Department of Medical Oncology, Complejo Hospitalario Universitario of Santiago (CHUS), Choupana S/N, Santiago de Compostela (Spain); Carracedo, Angel; Barros, Francisco [Fundacion Publica Galega de Medicina Xenomica and Genomic Medicine Group-CIBERER, University of Santiago de Compostela, Calle San Fransisco S/N, Santiago de Compostela (Spain)


    Purpose: 5-Fluorouracil-based chemoradiotherapy before total mesorectal excision is currently the standard treatment of Stage II and III rectal cancer patients. We used known predictive pharmacogenetic biomarkers to identify the responders to preoperative chemoradiotherapy in our series. Methods and Materials: A total of 93 Stage II-III rectal cancer patients were genotyped using peripheral blood samples. The genes analyzed were X-ray cross-complementing group 1 (XRCC1), ERCC1, MTHFR, EGFR, DPYD, and TYMS. The patients were treated with 225 mg/m{sup 2}/d continuous infusion of 5-fluorouracil concomitantly with radiotherapy (50.4 Gy) followed by total mesorectal excision. The outcomes were measured by tumor regression grade (TRG) as a major response (TRG 1 and TRG 2) or as a poor response (TRG3, TRG4, and TRG5). Results: The major histopathologic response rate was 47.3%. XRCC1 G/G carriers had a greater probability of response than G/A carriers (odds ratio, 4.18; 95% confidence interval, 1.62-10.74, p = .003) Patients with polymorphisms associated with high expression of thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) showed a greater pathologic response rate compared with carriers of low expression (odds ratio, 2.65; 95% confidence interval, 1.10-6.39, p = .02) No significant differences were seen in the response according to EGFR, ERCC1, MTHFR{sub C}677 and MTHFR{sub A}1298 expression. Conclusions: XRCC1 G/G and thymidylate synthase (2R/3G, 3C/3G, and 3G/3G) are independent factors of a major response. Germline thymidylate synthase and XRCC1 polymorphisms might be useful as predictive markers of rectal tumor response to neoadjuvant chemoradiotherapy with 5-fluorouracil.

  9. Polymorphism of the prolactin gene and its association with egg ...

    African Journals Online (AJOL)


    In this study, polymorphism of the prolactin gene was screened in six Chinese native ... Prolactin (PRL) is a single-chain polypeptide hormone that belongs to the growth hormone gene ..... Enhance the efficiency of single-strand conformation polymorphism analysis by short polyacrylamide gel and modified silver staining.

  10. Association of transforming growth factor-ß3 gene polymorphism ...

    African Journals Online (AJOL)

    Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

  11. DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...

    African Journals Online (AJOL)

    The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...

  12. Tetra primer ARMS-PCR relates folate/homocysteine pathway genes and ACE gene polymorphism with coronary artery disease. (United States)

    Masud, Rizwan; Qureshi, Irfan Zia


    Cardiovascular disorders and coronary artery disease (CAD) are significant contributors to morbidity and mortality in heart patients. As genes of the folate/homocysteine pathway have been linked with the vascular disease, we investigated association of these gene polymorphisms with CAD/myocardial infarction (MI) using the novel approach of tetraprimer ARMS-PCR. A total of 230 participants (129 MI cases, 101 normal subjects) were recruited. We genotyped rs1801133 and rs1801131 SNPs in 5'10' methylenetetrahydrofolate reductase (MTHFR), rs1805087 SNP in 5' methyltetrahydrofolate homocysteine methyltransferase (MTR), rs662 SNP in paroxanse1 (PON1), and rs5742905 polymorphism in cystathionine beta synthase (CBS). Angiotensin converting enzyme (ACE) insertion/deletion polymorphism was detected through conventional PCR. Covariates included blood pressure, fasting blood sugar, serum cholesterol, and creatinine concentrations. Our results showed allele frequencies at rs1801133, rs1801131, rs1805087 and the ACE insertion/deletion (I/D) polymorphism varied between cases and controls. Logistic regression, after adjusting for covariates, demonstrated significant associations of rs1801133 and rs1805087 with CAD in the additive, dominant, and genotype model. In contrast, ACE I/D polymorphism was significantly related with CAD where recessive model was applied. Gene-gene interaction against the disease status revealed two polymorphism groups: rs1801133, rs662, and rs1805087; and rs1801131, rs662, and ACE I/D. Only the latter interaction maintained significance after adjusted for covariates. Our study concludes that folate pathway variants exert contributory influence on susceptibility to CAD. We further suggest that tetraprimer ARMS-PCR successfully resolves the genotypes in selected samples and might prove to be a superior technique compared to the conventional approach.

  13. Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium. (United States)

    Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un


    Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

  14. Tumor Necrosis Factor (TNF -308G>A, Nitric Oxide Synthase 3 (NOS3 +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available Conflicting data have been reported on the association between tumor necrosis factor (TNF -308G>A and nitric oxide synthase 3 (NOS3 +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF -308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine.We performed an updated meta-analysis for TNF -308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR and 95% confidence intervals (95% CI assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates.Eleven studies in 6682 migraineurs and 22591 controls for TNF -308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the "A" allele of the TNF -308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 - 2.87. The risk of migraine with aura (MA was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the "T" allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 - 3.88.Our findings appear to support the hypothesis that the TNF -308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians.

  15. Prevalence of endothelial nitric oxide synthase (eNOS) gene exon 7 Glu298Asp variant in North Eastern India (United States)

    Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish


    Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032

  16. A novel haplotype of low-frequency variants in the aldosterone synthase gene among northern Han Chinese with essential hypertension. (United States)

    Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun


    Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.

  17. Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia. (United States)

    Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W


    Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

  18. Lack of association between methionine synthase A2756G polymorphism and digestive system cancer risk: evidence from 3,9327 subjects.

    Directory of Open Access Journals (Sweden)

    Yuan Zhao

    Full Text Available BACKGROUND: Polymorphisms in genes involved in the metabolism of folate and methyl groups have been implicated with risk of digestive system cancer. Methionine synthase (MTR plays a central role in folate metabolism, thereby affecting DNA methylation. The association between A2756G polymorphism (rs1805087 in MTR and digestive system cancer susceptibility was inconsistent in previous studies. To investigate this inconsistency, we performed this meta-analysis. METHODS: Databases including Pubmed, EMBASE, ISI Web of Science and China National Knowledge Infrastructure (CNKI were searched to find relevant studies. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the strength of association. Potential sources of heterogeneity were also assessed by subgroup analysis and meta-regression. RESULTS: A total of 29 articles with 15,368 patients and 23,959 controls were included. We found no association between MTR A2756G polymorphism and digestive system cancer in overall population (G allele: OR = 1.03, 95% CI = 0.98-1.09, P = 0.25; dominant model: OR = 1.03, 95% CI = 0.97-1.10, P = 0.33; recessive model: OR = 1.02, 95% CI = 0.89-1.17, P = 0.79. In the stratified analyses according to cancer type, sample size and genotyping method, no evidence of any gene-disease association was obtained in almost all genetic models. However, marginal significant associations were found for East Asians and hospital-based studies. CONCLUSIONS: This meta-analysis suggests that there is no significant association between the MTR A2756G polymorphism and digestive system cancer risk.

  19. Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model (United States)

    Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.


    Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

  20. A genetic polymorphism in the sex-linked ATP5A1 gene is associated with individual fitness in Ovenbirds (Seiurus aurocapilla) (United States)

    Judith D. Toms; Lori S. Eggert; Wayne J. Arendt; John Faaborg


    While testing genetic sexing techniques in Ovenbirds (Seiurus aurocapilla),we found a genetic polymorphism in the ATP5A1 gene in 38% of individuals. The Z ' allele included changes in both intronic and exonic portions of the sequenced region, but there was no evidence that this changed the resulting ATP synthase product. Males that had one or more copies of...

  1. Analysis of renin-angiotensin aldosterone system gene polymorphisms in malaysian essential hypertensive and type 2 diabetic subjects


    Ramachandran, Vasudevan; Ismail, Patimah; Stanslas, Johnson; Shamsudin, Norashikin


    Abstract Background The renin-angiotensin aldosterone system (RAAS) plays an important role in regulating the blood pressure and the genetic polymorphisms of RAAS genes has been extensively studied in relation to the cardiovascular diseases in various populations with conflicting results. The aim of this study was to determine the association of five genetic polymorphisms (A6G and A20C of angiotensinogen (AGT), MboI of renin, Gly460Trp of aldosterone synthase and Lys173Arg of adducin) of RAAS...

  2. The Serotonin Transporter Gene Polymorphisms and Risk of Ischemic Stroke

    DEFF Research Database (Denmark)

    Mortensen, Janne Kærgård; Kraglund, Kristian Lundsgaard; Johnsen, Søren Paaske


    may influence platelet activity, as they result in different levels of transporters and thereby different levels of serotonin in platelets. SERT gene polymorphisms have thus been associated with the risk of myocardial infarction. A similar association may exist between SERT gene polymorphisms...... and stroke. However, to our knowledge, this potential association has not previously been studied. We therefore aimed to investigate the association between polymorphisms in the SERT gene and the risk of ischemic stroke/transitory ischemic attack (TIA). MATERIALS AND METHODS: We conducted a case...

  3. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli


    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.


    Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

  4. Neuronal Nitric Oxide Synthase (NOS1) Polymorphisms Interact with Financial Hardship to Affect Depression Risk (United States)

    Sarginson, Jane E; Deakin, JF William; Anderson, Ian M; Downey, Darragh; Thomas, Emma; Elliott, Rebecca; Juhasz, Gabriella


    There is increasing evidence that genetic factors have a role in differential susceptibility to depression in response to severe or chronic adversity. Studies in animals suggest that nitric oxide (NO) signalling has a key role in depression-like behavioural responses to stress. This study investigated whether genetic variation in the brain-expressed nitric oxide synthase gene NOS1 modifies the relationship between psychosocial stress and current depression score. We recruited a population sample of 1222 individuals who provided DNA and questionnaire data on symptoms and stress. Scores on the List of Life-Threatening Experiences (LTE) questionnaire for the last year and self-rated current financial hardship were used as measures of recent/ongoing psychosocial stress. Twenty SNPs were genotyped. Significant associations between eight NOS1 SNPs, comprising two regional haplotypes, and current depression score were identified that survived correction for multiple testing when current financial hardship was used as the interaction term. A smaller three-SNP haplotypes (rs10507279, rs1004356 and rs3782218) located in a regulatory region of NOS1 showed one of the strongest effects, with the A-C-T haplotype associating with higher depression scores at low adversity levels but lower depression scores at higher adversity levels (p=2.3E-05). These results suggest that NOS1 SNPs interact with exposure to economic and psychosocial stressors to alter individual's susceptibility to depression. PMID:24917196

  5. Neuronal nitric oxide synthase (NOS1) polymorphisms interact with financial hardship to affect depression risk. (United States)

    Sarginson, Jane E; Deakin, J F William; Anderson, Ian M; Downey, Darragh; Thomas, Emma; Elliott, Rebecca; Juhasz, Gabriella


    There is increasing evidence that genetic factors have a role in differential susceptibility to depression in response to severe or chronic adversity. Studies in animals suggest that nitric oxide (NO) signalling has a key role in depression-like behavioural responses to stress. This study investigated whether genetic variation in the brain-expressed nitric oxide synthase gene NOS1 modifies the relationship between psychosocial stress and current depression score. We recruited a population sample of 1222 individuals who provided DNA and questionnaire data on symptoms and stress. Scores on the List of Life-Threatening Experiences (LTE) questionnaire for the last year and self-rated current financial hardship were used as measures of recent/ongoing psychosocial stress. Twenty SNPs were genotyped. Significant associations between eight NOS1 SNPs, comprising two regional haplotypes, and current depression score were identified that survived correction for multiple testing when current financial hardship was used as the interaction term. A smaller three-SNP haplotypes (rs10507279, rs1004356 and rs3782218) located in a regulatory region of NOS1 showed one of the strongest effects, with the A-C-T haplotype associating with higher depression scores at low adversity levels but lower depression scores at higher adversity levels (p=2.3E-05). These results suggest that NOS1 SNPs interact with exposure to economic and psychosocial stressors to alter individual's susceptibility to depression.

  6. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Bechard Matthew E.


    Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  7. Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli. (United States)

    Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.


    Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

  8. Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants (United States)

    Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE


    Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  9. Polymorphisms in human DNA repair genes and head and neck ...

    Indian Academy of Sciences (India)

    Abstract. Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and ... Such studies may benefit from analysis of multiple genes or polymorphisms and from the ... low survival and high morbidity when diagnosed in advanced ...... racial and/or ethnic cohort.

  10. Association of genetic polymorphism in GH gene with milk ...

    Indian Academy of Sciences (India)

    Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various ...

  11. Cytokine gene polymorphisms and their association with cervical ...

    African Journals Online (AJOL)

    Materials and methods: The present study was undertaken to evaluate association of cytokine gene polymorphisms with cervical cancer in a north Indian population. Genotyping of single nucleotide polymorphisms (SNPs) viz. IL 6-597G/A (rs1800797), IL-1b-511C/T (rs16944) and TNF-a-308G/A (rs1800629) was carried out ...

  12. Polymorphism of growth hormone gene and its association with ...

    African Journals Online (AJOL)

    sunny t


    Apr 6, 2016 ... recorded to be more frequent (83.3, 92.86 and 90%) than pattern II (16.7, 7.14 and 10%) in Barki,. Rahmani ... Key words: Sheep, wool, growth hormone (GH) gene, polymorphism, single strand conformation polymorphism. (SSCP). ... electrophoresis and chemical and ribonuclease cleavage,. SSCP has ...

  13. Association of -330 interleukin-2 gene polymorphism with oral cancer. (United States)

    Singh, Prithvi Kumar; Kumar, Vijay; Ahmad, Mohammad Kaleem; Gupta, Rajni; Mahdi, Abbas Ali; Jain, Amita; Bogra, Jaishri; Chandra, Girish


    Cytokines play an important role in the development of cancer. Several single-nucleotide polymorphisms (SNPs) of cytokine genes have been reported to be associated with the development and severity of inflammatory diseases and cancer predisposition. This study was undertaken to evaluate a possible association of interleukin 2 (IL-2) (- 330A>C) gene polymorphisms with the susceptibility to oral cancer. The SNP in IL-2 (-330A>C) gene was genotyped in 300 oral cancer patients and in similar number of healthy volunteers by polymerase chain reaction (PCR)-restriction fragment length polymorphism and the association of the gene with the disease was evaluated. IL-2 (-330A>C) gene polymorphism was significantly associated with oral cancer whereas it was neither associated with clinicopathological status nor with cancer pain. The AC heterozygous genotype was significantly associated with oral cancer patients as compared to controls [odds ratio (OR): 3.0; confidence interval (CI): 2.14-4.20; Poral cancer (OR: 1.80; CI: 1.39-2.33; PC) gene polymorphism was also associated with oral cancer in tobacco smokers and chewers. Our results showed that oral cancer patients had significantly higher frequency of AA genotype but significantly lower frequency of AC genotype and C allele compared to controls. The IL-2 AC genotype and C allele of IL-2 (-330A>C) gene polymorphisms could be potential protective factors and might reduce the risk of oral cancer in Indian population.

  14. Allelic polymorphism of Makoei sheep leptin gene identified by ...

    African Journals Online (AJOL)



    Dec 5, 2011 ... Lord et al., 1998) have shed light on the influence of leptin on both the .... A weak correlation between leptin serum levels and cow body condition ... Detection of polymorphisms in the ovine leptin (LEP) gene: .... Signals that.

  15. Cytokine gene polymorphisms and their association with cervical ...

    African Journals Online (AJOL)

    Maneesh Kumar Gupta


    Nov 17, 2015 ... gene polymorphisms with cervical cancer in a north Indian population. Genotyping of ... diseases like coronary heart disease, breast cancer, cervical cancer etc ...... Environmental risk factors for prevention and molecular inter-.

  16. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  17. Polymorphism of calpastatin gene in Arabic sheep using PCR- RFLP

    African Journals Online (AJOL)

    Calpastatin has been known as candidate gene in muscle growth efficiency and meat quality. This gene has been located to chromosome 5 of sheep. In order to evaluate the calpastatin gene polymorphism, random blood sample were collected from 111 Arabic ram sheep from different regions. The DNA extraction was ...

  18. Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants. (United States)

    Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako


    Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

  19. Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing. (United States)

    Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey


    Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Mutation in the gene encoding 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4) led to andromonoecy in watermelon. (United States)

    Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong


    Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.

  1. [Prevalence of dyslipidemia in middle-aged adults with NOS3 gene polymorphism and low cardiorespiratory fitness]. (United States)

    Malagrino, Pamella A; Sponton, Carlos H G; Esposti, Rodrigo D; Franco-Penteado, Carla F; Fernandes, Romulo A; Bezerra, Marcos André C; Albuquerque, Dulcinéia M; Rodovalho, Cynara M; Bacci, Maurício; Zanesco, Angelina


    To evaluate the influence of the interaction between endothelial nitric oxide synthase gene (NOS3) polymorphisms at positions -786T>C, Glu298Asp and intron 4b/a, and cardiorespiratory fitness on plasma nitrite/nitrate levels, blood pressure, lipid profile, and prevalence of cardiometabolic disorders. Ninety-two volunteers were genotyped for NOS3 polymorphisms at positions (-786T>C and Glu298Asp) and (intron 4b/a) and divided according to the genotype: non-polymorphic (NP) and polymorphic (P). After that, they were subdivided according to the cardiorespiratory fitness associated with genotype: high (HNP and HP) and low (LNP and LP). The subjects with polymorphism for the interactions at positions Glu298Asp + intron 4b/a, and Glu298Asp+-786T>C showed the highest values in total cholesterol, as well as dyslipidemia. Our findings show that NOS3 gene polymorphisms at positions -786T>C, Glu298Asp, and intron 4b/a exert negative effects on the lipid profile compared with those who do not carry polymorphisms.

  2. Association between FASN gene polymorphisms ultrasound carcass traits and intramuscular fat in Qinchuan cattle. (United States)

    Raza, Sayed Haidar Abbas; Gui, Linsheng; Khan, Rajwali; Schreurs, Nicola M; Xiaoyu, Wang; Wu, Sen; Mei, Chugang; Wang, Li; Ma, Xueyao; Wei, Dawei; Guo, Hongfang; Zhang, Song; Wang, Xingping; Kaleri, Hubdar Ali; Zan, Linsen


    Fatty acid synthase (FASN) is an enzyme involved with fat deposition and fatty acid composition in cattle. This study was conducted to detect single nucleotide polymorphisms (SNPs) of the FASN gene and explore their relationships with ultrasound carcass traits in order to assess the potential use of the FASN gene for the breeding selection of Qinchuan cattle for desirable carcass traits. The frequencies of SNP g.12740C>T, g.13192T>C and g.13232C>T were identified in 525 individual Qinchuan cattle which were also assessed for backfat depth, eye muscle area and intramuscular fat by ultrasound. According to the PIC values, g.13192T>C possessed an intermediate polymorphism (0.25T, g.12740C>T possessed low polymorphism (PICC were in Hardy-Weinberg disequilibrium (c2C was associated with a greater eye muscle area and the TT genotype at g.13232C>T was associated with greater intramuscular fat. When these genotypes were combined there was no difference in eye muscle area and intramuscular fat between the diplotypes. The H 2 H 2 diplotype was associated with carcass traits that are likely to provide economic advantage in Qinchuan cattle. Variations in the FASN genes and their corresponding genotypes may be considered as molecular markers for economic traits in cattle breeding. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Association of nNOS Gene Polymorphism with Ischemic Stroke in Han Chinese of North China

    Directory of Open Access Journals (Sweden)

    Yingjie Dai


    Full Text Available Nitric oxide (NO is an important messenger molecule and effector molecule. This study aimed to investigate the relation of neuronal nitric oxide synthase (nNOS gene polymorphism with ischemic stroke in Han Chinese of North China. This was a case-control study. A total of 413 patients with ischemic stroke were recruited from Han Chinese of North China. There were 201 males and 212 females. In addition, 477 healthy subjects served as controls including 224 males and 253 females. Multiplex SNaPshot was employed to detect nNOS gene polymorphism (rs2293050, rs2139733, rs7308402, and rs1483757. Results showed that the rs1483757, rs2139733, and rs2293050 genotypes and allele frequencies were comparable between patients and controls. However, ischemic stroke patients had significantly reduced AG genotype and A allele frequency when compared with controls (P=0.037, P=0.041. After adjusting confounding factors (gender, age, smoking, history of drinking, hypertension, and diabetes, AG genotype and A allele were still related to ischemic stroke (OR=0.572, 95% CI: 0.335–0.978, P=0.041; OR=0.611, 95% C: 0.378–0.985, and P=0.041 and both were found to be protective factors. Our results showed that rs7308402 gene polymorphism of nNOS is related to ischemic stroke in Han Chinese of North China.

  4. Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia. (United States)

    Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D


    The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

  5. TRPA1 gene polymorphisms and childhood asthma. (United States)

    Gallo, Valentina; Dijk, F Nicole; Holloway, John W; Ring, Susan M; Koppelman, Gerard H; Postma, Dirkje S; Strachan, David P; Granell, Raquel; de Jongste, Johan C; Jaddoe, Vincent W V; den Dekker, Herman T; Duijts, Liesbeth; Henderson, A John; Shaheen, Seif O


    Animal data have suggested that the transient receptor potential ankyrin-1 (TRPA1) ion channel plays a key role in promoting airway inflammation in asthma and may mediate effects of paracetamol on asthma, yet confirmatory human data are lacking. To study associations of TRPA1 gene variants with childhood asthma and total IgE concentration, and interactions between TRPA1 and prenatal paracetamol exposure on these outcomes. We analysed associations between 31 TRPA1 single nucleotide polymorphisms (SNPs) and current doctor-diagnosed asthma and total IgE concentration at 7.5 years in the Avon Longitudinal Study of Parents and Children (ALSPAC) birth cohort. We sought to confirm the most significant associations with comparable outcomes in the Prevention and Incidence of Asthma and Mite Allergy (PIAMA) and Generation R birth cohorts. In ALSPAC, we explored interactions with prenatal paracetamol exposure. In ALSPAC, there was strong evidence for association between six SNPs and asthma: rs959974 and rs1384001 (per-allele odds ratio for both: 1.30 (95% CI: 1.15-1.47), p = 0.00001), rs7010969 (OR 1.28 (1.13-1.46), p = 0.00004), rs3735945 (OR 1.30 (1.09-1.55), p = 0.003), rs920829 (OR 1.30 (1.09-1.54), p = 0.004) and rs4738202 (OR 1.22 (1.07-1.39), p = 0.004). In a meta-analysis across the three cohorts, the pooled effect estimates confirmed that all six SNPs were significantly associated with asthma. In ALSPAC, TRPA1 associations with asthma were not modified by prenatal paracetamol, although associations with IgE concentration were. This study suggests that TRPA1 may play a role in the development of childhood asthma. (249 words). © 2016 The Authors Pediatric Allergy and Immunology Published by John Wiley & Sons Ltd.

  6. TS gene polymorphisms are not good markers of response to 5-FU therapy in stage III colon cancer patients. (United States)

    Fariña-Sarasqueta, A; Gosens, M J E M; Moerland, E; van Lijnschoten, I; Lemmens, V E P P; Slooter, G D; Rutten, H J T; van den Brule, Adriaan J C


    Although the predictive and prognostic value of thymidylate synthase (TS) expression and gene polymorphism in colon cancer has been widely studied, the results are inconclusive probably because of methodological differences. With this study, we aimed to elucidate the role of TS gene polymorphisms genotyping in therapy response in stage III colon carcinoma patients treated with 5-FU adjuvant chemotherapy. 251 patients diagnosed with stage III colon carcinoma treated with surgery followed by 5-FU based adjuvant therapy were selected. The variable number of tandem repeats (VNTR) and the single nucleotide polymorphism (SNP) in the 5'untranslated region of the TS gene were genotyped. There was a positive association between tumor T stage and the VNTR genotypes (p = 0.05). In both univariate and multivariate survival analysis no effects of the studied polymorphisms on survival were found. However, there was an association between both polymorphisms and age. Among patients younger than 60 years, the patients homozygous for 2R seemed to have a better overall survival, whereas among the patients older than 67 this longer survival was seen by the carriers of other genotypes. We conclude that the TS VNTR and SNP do not predict response to 5-FU therapy in patients with stage III colon carcinoma. However, age appears to modify the effects of TS polymorphisms on survival.

  7. Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

    Directory of Open Access Journals (Sweden)

    Mirian Perez Maluf


    Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

  8. Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

    Directory of Open Access Journals (Sweden)

    Yan Yang


    Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

  9. Leptin gene polymorphism in Indian Sahiwal cattle by single strand ...

    African Journals Online (AJOL)

    These leptin gene variants can be sequenced and screened in the entire population to develop single nucleotide polymorphisms (SNPs) for association studies with different productive and reproductive performances and marker assisted selection. Keywords: Leptin gene, PCR-SSCP, genetic variability, dairy cattle

  10. Interleukin 18 receptor 1 gene polymorphisms are associated with asthma

    DEFF Research Database (Denmark)

    Zhu, Guohua; Whyte, Moira K B; Vestbo, Jørgen


    The interleukin 18 receptor (IL18R1) gene is a strong candidate gene for asthma. It has been implicated in the pathophysiology of asthma and maps to an asthma susceptibility locus on chromosome 2q12. The possibility of association between polymorphisms in IL18R1 and asthma was examined by genotyp...

  11. Association of IL-6 and MMP-3 gene polymorphisms with ...

    Indian Academy of Sciences (India)

    comprehensively and systematically performed this meta-analysis to detect whether the two gene polymorphisms are corre- .... control studies; (ii) 'failure to provide the genes' distribution details ..... biological activity of corresponding proteins such as IL-6 .... pathic scoliosis is related to inadequate calcium intake and weight.

  12. Polymorphism in leptin receptor gene was associated with obesity in ...

    African Journals Online (AJOL)

    The mutation in leptin receptor (LEPR) gene causes splicing abnormality that resulted in truncated receptor, aberrant signal transduction, leptin resistance, and obesity. This study aims to determine the association of LEPR gene polymorphisms, rs1137100 and rs1137101, on phenotype and leptin level between obese and ...

  13. Association of porcine UCP3 gene polymorphisms with fatness traits ...

    African Journals Online (AJOL)



    Apr 25, 2011 ... ... for fatness traits in pig. Polymorphism in UCP3 gene may change the function ... NM_214049) and human UCP3 gene DNA sequence (GenBank accession No. NC_000011). ..... Sleep, 29: 645-649. Zhao J, Li H, Kong X, ...

  14. Cloning and characterization of ATP synthase CF1 α gene from ...

    African Journals Online (AJOL)

    ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

  15. Chalcone synthase genes from milk thistle (Silybum marianum)

    Indian Academy of Sciences (India)

    ... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...

  16. Genetic polymorphisms of the TYMS gene are not associated with congenital cardiac septal defects in a Han Chinese population.

    Directory of Open Access Journals (Sweden)

    Jian-Yuan Zhao

    Full Text Available BACKGROUND: Clinical research indicates that periconceptional administration of folic acid can reduce the occurrence of congenital cardiac septal defects (CCSDs. The vital roles of folate exhibits in three ways: the unique methyl donor for DNA expression regulation, the de novo biosynthesis of purine and pyrimidine for DNA construction, and the serum homocysteine removal. Thymidylate synthase (TYMS is the solo catalysis enzyme for the de novo synthesis of dTMP, which is the essential precursor of DNA biosynthesis and repair process. To examine the role of TYMS in Congenital Cardiac Septal Defects (CCSDs risk, we investigated whether genetic polymorphisms in the TYMS gene associated with the CCSDs in a Han Chinese population. METHOD: Polymorphisms in the noncoding region of TYMS were identified via direct sequencing in 32 unrelated individuals composed of half CCSDs and half control subjects. Nine SNPs and two insertion/deletion polymorphisms were genotyped from two independent case-control studies involving a total of 529 CCSDs patients and 876 healthy control participants. The associations were examined by both single polymorphism and haplotype tests using logistic regression. RESULT: We found that TYMS polymorphisms were not related to the altered CCSDs risk, and even to the changed risk of VSDs subgroup, when tested in both studied groups separately or in combination. In the haplotype analysis, there were no haplotypes significantly associated with risks for CCSDs either. CONCLUSION: Our results show no association between common genetic polymorphisms of the regulatory region of the TYMS gene and CCSDs in the Han Chinese population.

  17. PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

    International Nuclear Information System (INIS)

    Enan, M. R.; Bashandy, S.A.


    Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

  18. MTHFR Gene C677T Polymorphism in Autism Spectrum Disorders

    Directory of Open Access Journals (Sweden)

    Elif Funda Sener


    Full Text Available Aim. Autism is a subgroup of autism spectrum disorders, classified as a heterogeneous neurodevelopmental disorder and symptoms occur in the first three years of life. The etiology of autism is largely unknown, but it has been accepted that genetic and environmental factors may both be responsible for the disease. Recent studies have revealed that the genes involved in the folate/homocysteine pathway may be risk factors for autistic children. In particular, C677T polymorphism in the MTHFR gene as a possible risk factor for autism is still controversial. We aimed to investigate the possible effect of C677T polymorphism in a Turkish cohort. Methods. Autism patients were diagnosed by child psychiatrists according to DSM-IV and DSM-V criteria. A total of 98 children diagnosed as autistic and 70 age and sex-matched children who are nonautistic were tested for C677T polymorphism. This polymorphism was studied by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP methods. Results. MTHFR 677T-allele frequency was found to be higher in autistic children compared with nonautistic children (29% versus 24%, but it was not found statistically significant. Conclusions. We conclude that other MTHFR polymorphisms such as A1298C or other folate/homocysteine pathway genes may be studied to show their possible role in autism.

  19. Tumor Necrosis Factor (TNF) –308G>A, Nitric Oxide Synthase 3 (NOS3) +894G>T Polymorphisms and Migraine Risk: A Meta-Analysis (United States)

    Chen, Min; Tang, Wenjing; Hou, Lei; Liu, Ruozhuo; Dong, Zhao; Han, Xun; Zhang, Xiaofei; Wan, Dongjun; Yu, Shengyuan


    Background and Objective Conflicting data have been reported on the association between tumor necrosis factor (TNF) –308G>A and nitric oxide synthase 3 (NOS3) +894G>T polymorphisms and migraine. We performed a meta-analysis of case-control studies to evaluate whether the TNF –308G>A and NOS3 +894G>T polymorphisms confer genetic susceptibility to migraine. Method We performed an updated meta-analysis for TNF –308G>A and a meta-analysis for NOS3 +894G>T based on studies published up to July 2014. We calculated study specific odds ratios (OR) and 95% confidence intervals (95% CI) assuming allele contrast, dominant model, recessive model, and co-dominant model as pooled effect estimates. Results Eleven studies in 6682 migraineurs and 22591 controls for TNF –308G>A and six studies in 1055 migraineurs and 877 controls for NOS3 +894G>T were included in the analysis. Neither indicated overall associations between gene polymorphisms and migraine risk. Subgroup analyses suggested that the “A” allele of the TNF –308G>A variant increases the risk of migraine among non-Caucasians (dominant model: pooled OR = 1.82; 95% CI 1.15 – 2.87). The risk of migraine with aura (MA) was increased among both Caucasians and non-Caucasians. Subgroup analyses suggested that the “T” allele of the NOS3 +894G>T variant increases the risk of migraine among non-Caucasians (co-dominant model: pooled OR = 2.10; 95% CI 1.14 – 3.88). Conclusions Our findings appear to support the hypothesis that the TNF –308G>A polymorphism may act as a genetic susceptibility factor for migraine among non-Caucasians and that the NOS3 +894G>T polymorphism may modulate the risk of migraine among non-Caucasians. PMID:26098763

  20. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*


    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying


    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

  1. [Homocysteine levels and polymorphisms of MTHFR and CBS genes in Colombian patients with superficial and deep venous thrombosis]. (United States)

    Ayala, Claudia; García, Reggie; Cruz, Edith; Prieto, Karol; Bermúdez, Marta


    Thrombosis develops when the hemostatic system is incorrectly activated due to the unbalance between procoagulant, anticoagulant and fibrinolytic mechanisms allowing the formation of a clot within a blood vessel. The risk factors of this pathology can be acquired or can be genetic. To analyze in a Colombian population with diagnosis of venous thrombosis, lipid profile, glucose and homocystein levels, to calculate the alleles and genotypic frequencies of polymorphisms c.699 C>T, c.1080 C>T, c.844ins68 of the cystathionine ß synthase and the c.677 C>T of the methylenetetrahydrofolate reductase (MTHFR) genes. Thirty three patients and their controls were studied. The biochemical test was carried out by colorimetric methods and immunoassay. In this survey we used the restriction fragments longitude polymorphism (RLFP) technique to identify the polymorphisms mentioned. The association study was performed through the chi square test. We confirmed that gene alterations increase risk for pathology; we found statistically significant differences in the group with hypercholesterolemia in presence of the polymorphism c.699 C>T in the CBS gene, showing a protective effect in the individuals carrying this genetic variation. Likewise, we found a statistical trend for an eventual protective effect of the CBS c.844ins68 polymorphism to venous thrombotic disease. There were not any statistically significant differences in homocystein levels between cases and controls; nevertheless, the variability in the plasma concentrations was greater in the group of cases.

  2. Two methylenetetrahydrofolate reductase gene (MTHFR) polymorphisms, schizophrenia and bipolar disorder

    DEFF Research Database (Denmark)

    Jönsson, Erik G; Larsson, Kristina; Vares, Maria


    disorder. In a replication attempt the MTHFR C677T and A1298C SNPs were analyzed in three Scandinavian schizophrenia case-control samples. In addition, Norwegian patients with bipolar disorder were investigated. There were no statistically significant allele or genotype case-control differences....... The present Scandinavian results do not verify previous associations between the putative functional MTHFR gene polymorphisms and schizophrenia or bipolar disorder. However, when combined with previous studies in meta-analyses there is still evidence for association between the MTHFR C677T polymorphism......Recent meta-analyses of the methylenetetrahydrofolate reductase gene (MTHFR) have suggested association between two of its functional single gene polymorphisms (SNPs; C677T and A1298C) and schizophrenia. Studies have also suggested association between MTHFR C677T and A1298C variation and bipolar...

  3. Inflammatory bowel disease: the role of inflammatory cytokine gene polymorphisms

    Directory of Open Access Journals (Sweden)

    Joanna Balding


    Full Text Available THE mechanisms responsible for development of inflammatory bowel disease (IBD have not been fully elucidated, although the main cause of disease pathology is attributed to up-regulated inflammatory processes. The aim of this study was to investigate frequencies of polymorphisms in genes encoding pro-inflammatory and anti-inflammatory markers in IBD patients and controls. We determined genotypes of patients with IBD (n=172 and healthy controls (n=389 for polymorphisms in genes encoding various cytokines (interleukin (IL-1β, IL-6, tumour necrosis factor (TNF, IL-10, IL-1 receptor antagonist. Association of these genotypes to disease incidence and pathophysiology was investigated. No strong association was found with occurrence of IBD. Variation was observed between the ulcerative colitis study group and the control population for the TNF-α-308 polymorphism (p=0.0135. There was also variation in the frequency of IL-6-174 and TNF-α-308 genotypes in the ulcerative colitis group compared with the Crohn's disease group (p=0.01. We concluded that polymorphisms in inflammatory genes are associated with variations in IBD phenotype and disease susceptibility. Whether the polymorphisms are directly involved in regulating cytokine production, and consequently pathophysiology of IBD, or serve merely as markers in linkage disequilibrium with susceptibility genes remains unclear.

  4. STAT4 gene polymorphism in patients after renal allograft transplantation. (United States)

    Dąbrowska-Żamojcin, Ewa; Dziedziejko, Violetta; Safranow, Krzysztof; Domański, Leszek; Słuczanowska-Głabowska, Sylwia; Pawlik, Andrzej


    STAT4 (signal transducer and activator of transcription 4) is involved in the regulation of innate and adaptive immune responses. Some studies have suggested that STAT4 may be involved in the immune response after graft transplantation. Several polymorphisms in the STAT4 gene have been identified. The most commonly studied polymorphism in the STAT4 gene is rs7574865. In our study, we examined whether this polymorphism is associated with the early and late functions of renal allografts. A total of 270 recipients of first renal transplants were included in the study. Single nucleotide polymorphisms (SNPs) within the STAT4 gene were genotyped using TaqMan genotyping assays. There were no statistically significant associations between the STAT4 gene rs7574865 polymorphism and delayed graft function, acute rejection, chronic allograft dysfunction, post-transplant diabetes mellitus, or creatinine serum concentrations after transplantation. Our results suggest a lack of association between the STAT4 rs7574865 SNP and kidney allograft function in the Polish population.

  5. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny


    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  6. Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

    DEFF Research Database (Denmark)

    Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P


    To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

  7. Polymorphisms in folate metabolism genes are associated with susceptibility to presbycusis. (United States)

    Manche, Santoshi Kumari; Jangala, Madhavi; Dudekula, Dinesh; Koralla, Meganadh; Akka, Jyothy


    Presbycusis or age related hearing loss is caused by several extrinsic and intrinsic factors that damage the auditory system. Gene polymorphisms in folate metabolism were found to play an important role in the etiology of presbycusis. The present study aimed to investigate the role of 5,10-methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MTR) and thymidylate synthase (TYMS) gene polymorphisms in the onset of presbycusis in a South Indian population. A total of 220 subjects confirmed with presbycusis along with 270 age and sex matched healthy controls visiting MAA ENT Hospitals, Hyderabad, India were enrolled for the study. Genotyping of MTHFR C677T (rs180133) and A1298C (rs1801131), MTR A2756G (rs1805087), TSER (rs1801136) and TS1494indel6 bp (rs16430) was carried out using PCR & PCR-RFLP methods. The 'TT' genotype of MTHFR C677T and '152 bp/152 bp' genotype of TS1494indel6 bp showed statistically significant risk for presbycusis while CC genotype of MTHFR A1298C, '2R/2R' genotype of TSER at 3'UTR and 6 bp ins/6 bp ins of TYMS at 5'UTR were found to be protective. The T-A-A haplotype combination of MTHFR C677T, MTHFR A1298C and MTR A2756G as well as 3R- 152 bp of TYMS at 5'UTR and 3'UTR were also found to contribute significant risk for the onset of presbycusis. Further, the combination of SNP loci TSER: TS1494indel6 bp exhibited moderate linkage in presbycusis. The present pilot study identified the significant association of gene variants of MTHFR and TYMS with presbycusis. These findings aid in early diagnosis of hearing loss in the elderly population. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)



    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  9. Depressive symptoms in schizophrenia and dopamine and serotonin gene polymorphisms. (United States)

    Peitl, Vjekoslav; Štefanović, Mario; Karlović, Dalibor


    Although depressive symptoms seem to be frequent in schizophrenia they have received significantly less attention than other symptom domains. As impaired serotonergic and dopaminergic neurotransmission is implicated in the pathogenesis of depression and schizophrenia this study sought to investigate the putative association between several functional gene polymorphisms (SERT 5-HTTLPR, MAO-A VNTR, COMT Val158Met and DAT VNTR) and schizophrenia. Other objectives of this study were to closely examine schizophrenia symptom domains by performing factor analysis of the two most used instruments in this setting (Positive and negative syndrome scale - PANSS and Calgary depression rating scale - CDSS) and to examine the influence of investigated gene polymorphisms on the schizophrenia symptom domains, focusing on depressive scores. A total of 591 participants were included in the study (300 schizophrenic patients and 291 healthy volunteers). 192 (64%) of schizophrenic patients had significant depressive symptoms. Genotype distribution revealed no significant differences regarding all investigated polymorphisms except the separate gender analysis for MAO-A gene polymorphism which revealed significantly more allele 3 carriers in schizophrenic males. Factor analysis of the PANSS scale revealed the existence of five separate factors (symptom domains), while the CDSS scale revealed two distinct factors. Several investigated gene polymorphisms (mostly SERT and MAO-A, but also COMT) significantly influenced two factors from the PANSS (aggressive/impulsive and negative symptoms) and one from the CDSS scale (suicidality), respectively. Depressive symptoms in schizophrenic patients may be influenced by functional gene polymorphisms, especially those implicated in serotonergic neurotransmission. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Analysis of renin-angiotensin aldosterone system gene polymorphisms in malaysian essential hypertensive and type 2 diabetic subjects

    Directory of Open Access Journals (Sweden)

    Stanslas Johnson


    Full Text Available Abstract Background The renin-angiotensin aldosterone system (RAAS plays an important role in regulating the blood pressure and the genetic polymorphisms of RAAS genes has been extensively studied in relation to the cardiovascular diseases in various populations with conflicting results. The aim of this study was to determine the association of five genetic polymorphisms (A6G and A20C of angiotensinogen (AGT, MboI of renin, Gly460Trp of aldosterone synthase and Lys173Arg of adducin of RAAS genes in Malaysian essential hypertensive and type 2 diabetic subjects. Methods RAAS gene polymorphisms were determined using mutagenically separated PCR and PCR-RFLP method in a total of 270 subjects consisting of 70 hypertensive subjects without type 2 diabetes mellitus (T2DM, 60 T2DM, 65 hypertensive subjects with T2DM and 75 control subjects. Results There was significant difference found in age, body mass index, systolic/diastolic blood pressure, fasting plasma glucose and high density lipoprotein cholesterol levels between the hypertensive subjects with or without T2DM and control subjects. No statistically significant differences between groups were found in the allele frequency and genotype distribution for A20C variant of AGT gene, MboI of renin, Gly460Trp of aldosterone and Lys173Arg of adducin (p > 0.05. However, the results for A6G of AGT gene revealed significant differences in allele and genotype frequencies in essential hypertension with or without T2DM (p Conclusion Among the five polymorphisms of RAAS genes only A6G variant of AGT gene was significantly associated in Malaysian essential hypertensive and type 2 diabetic subjects. Therefore, A6G polymorphism of the AGT gene could be a potential genetic marker for increased susceptibility to essential hypertension with or without T2DMin Malaysian subjects.

  11. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

    Directory of Open Access Journals (Sweden)

    Olga Y. Yurkevich


    Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  12. Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA) Genes in Flax (Linum usitatissimum L.). (United States)

    Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V


    Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

  13. Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

    International Nuclear Information System (INIS)

    Rothenberg, M.; Hanson, M.R.


    A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

  14. Serotonin transporter (SERT gene polymorphism in Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Mahmut Özkaya


    Full Text Available Background: Parkinson disease (PD is the second most common neurodegenerative disorder with a prevalence of about 2% in persons older than 65 years of age. Neurodegenerative process in PD is not restricted to the dopaminergic neurons of the substantia nigra but also affects serotoninergic neurons. It has been shown that PD brains with Lewy bodies in the substantia nigra also had Lewy bodies in the raphe nuclei. The re-uptake of 5HT released into the synaptic cleft is mediated by the 5HT transporter (SERT. The SERT gene has been mapped to the chromosome of 17q11.1-q12 and has two main polymorphisms: intron two VNTR polymorphism and promoter region 44 bp insertion/deletion polymorphism. Objective: In this study we investigated whether two polymorphic regions in the serotonin transporter gene are associated with PD. Material and Method: After obtaining informed consent, blood samples were collected from 76 patients and 54 healthy volunteers. Genomic DNA was extracted from peripheral leucocytes using standard methods. The SERT gene genotypes were determined using polymerase chain reaction (PCR method. Results: Based on the intron 2 VNTR polymorphism of SERT gene, the distribution of 12/12, 12/10 and 10/10 genotypes were found as, 56.6 %, 35.5 %, 7.9 % in patients whereas this genotype distribution in control group was 40.7 %, 46.3 % and 13 %, respectively. According to 5-HTTLPR polymorphism, the distribution of L/L, L/S and S/S genotypes were found as 27.6 % 51.3 % and 21.1 % in patients whereas this genotype distribution in control group was 33.4 %, 50.0 % and 16.6 %, respectively. Despite the fact that the genotype distribution of SERT gene polymorphism in patients and control group seemed to be different from each other, this difference was not found to be statistically significant. Conclusion: This finding suggests that polymorphisms within the SERT gene do not play a major role in PD susceptibility in the Turkish population.

  15. Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

    Energy Technology Data Exchange (ETDEWEB)

    Somerville, Chris R.; Scieble, Wolf


    Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

  16. [Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)]. (United States)

    Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V


    Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

  17. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)


    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  18. Chalcone synthase genes from milk thistle (Silybum marianum ...

    Indian Academy of Sciences (India)

    In the current research, fragments of CHS genes were amplified ... transcript level in petals in the early flowering stage and in the stem of five upper leaves, followed by five upper leaves in the ..... First strand cDNA was amplified by 1 μg of.

  19. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

    DEFF Research Database (Denmark)

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina


    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

  20. Association of GSTP1 gene polymorphisms with performance traits ...

    African Journals Online (AJOL)


    The genetic variants were determined by PCR-SSCP technique. Two unique SSCP patterns were observed in fragment 1, 3, 5 and 6 of GSTP1 gene. Sequence analysis with reference to GenBank. Acc. no AC_000186.1 revealed polymorphisms at position 210, 746, 2438, 2439, 2443, 2507, 2695 and insertions between ...

  1. Polymorphism in leptin receptor gene was associated with obesity in ...

    African Journals Online (AJOL)

    Pramudji Hastuti


    Jan 11, 2016 ... This study aims to determine the association of LEPR gene polymorphisms, rs1137100 and rs1137101, on .... and that leptin levels were correlated with type 2 diabetes mel- .... Research using statistical meta-analysis [36,37] found ... and changes in glucose homeostasis in response to regular exercise.

  2. Association between vitamin D receptor gene polymorphism (TaqI ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...

  3. Interleukin-10 gene promoter polymorphism as a potential host ...

    African Journals Online (AJOL)

    10) gene have been associated with altered levels of circulating IL-10, a Th2 cytokine that plays a key role in the pathogenesis of TB. We analyzed the frequencies of IL-10 promoter polymorphisms in 82 TB patients and 99 healthy Pakistani ...

  4. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  5. Association between vitamin D receptor gene polymorphism (TaqI)

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...

  6. Association of polymorphism of the alpha 1-antitrypsin gene with ...

    African Journals Online (AJOL)

    In order to determine the relationship between the polymorphisms of the AAT gene and milk production traits and SCS, the General Linear Model (GLM) procedure from the Statistical Analysis Software was used. SNP5504 affected milk fat percentage, SNP8178 affected milk protein percentage and SNP5609 and SNP5624 ...

  7. IRGM gene polymorphisms and risk of gastric cancer.

    NARCIS (Netherlands)

    Burada, F.; Plantinga, T.S.; Ioana, M.; Rosentul, D.; Angelescu, C.; Joosten, L.A.B.; Netea, M.G.; Saftoiu, A.


    OBJECTIVE: The study aimed to assess the possible association of polymorphisms in the autophagy gene IRGM (rs13361189 and rs4958847) with the risk of gastric cancer. METHODS: A total of 102 patients with gastric adenocarcinoma, 52 with chronic gastritis and 351 healthy controls were included in this

  8. Polymorphism investigation of calpastatin gene in Zel sheep ...

    African Journals Online (AJOL)



    Feb 14, 2012 ... Meat tenderness is an important quality characteristic for which consumers are interested. ... Key words: Calpastatin gene, polymorphism, Zel sheep, meat and polymerase chain reaction- ..... correlations for bovine postrigor calpastatin activity, intramuscular fat ... expression of the mRNA in skeletal muscle.

  9. Interleukin Gene Polymorphisms and Susceptibility to HIV Infection

    Indian Academy of Sciences (India)


    vaccines, and with almost 36.7 million HIV-infected individuals worldwide .... The allelic and genotypic distribution of the IL genes SNPs are presented in .... polymorphism using the genetic model-free bivariate approach produced, as in ... Through its immuno-inhibitory and anti-inflammatory activities and, in particular, by.


    Directory of Open Access Journals (Sweden)

    E. L. Nazarova


    Full Text Available Previous studies with some solid tumors has shown that polymorphisms of certain cytokine genes may be used as predictors of clinical outcome in the patients. It seemed important to evaluate potential correlations between production of certain pro- and anti-inflammatory cytokines and co-receptor molecules, and promoter polymorphism of the cytokine genes involved into regulation of cell proliferation, differentiation, apoptosis, lipid metabolism and blood clotting in the patients with hematological malignancies. The article contains our results concerning associations between of IL-1β, -2, -4, -10, -17, TNFα, and allelic polymorphisms of their genes in 62 patients with B cell lymphoid malignancies in an ethnically homogenous group (self-identified as Russians. We have shown that the GА and AA genotypes of the G-308A polymorphism in TNFα gene are significantly associated with increased production of this cytokine, being more common in aggressive non-Hodgkin lymphomas, more rare in multiple myeloma and in indolent non-Hodgkin lymphomas.

  11. Do the MTHFR gene polymorphism and Down syndrome pregnancy ...

    African Journals Online (AJOL)

    Background: Down syndrome, the most common trisomy 21 arises from abnormal chromosomal segregation. The etiology includes genetic and acquired factors. The main genetic factor that is well appreciated for onset of Down syndrome pregnancy is MTHFR gene polymorphism. But till date, no final conclusion has arrived ...

  12. DNA characterization and polymorphism of KISS1 gene in Egyptian ...

    African Journals Online (AJOL)



    Jul 29, 2015 ... effect on litter size performance and many studies were carried out to identify ... gene (Wang et al., 2011), kit ligand (KITLG) gene (An et al., 2012) and bone ..... An XP, Han P, HouJX, Zhao HB, Yan Y, Ma T, Fang F, MengFX, Song. YX, Wang JG ... Chu MX, Zhao XH, Zhang YJ, Jin M (2010). Polymorphisms ...


    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella


    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  14. Matrix metalloproteinase gene polymorphisms in patients with coronary artery disease

    Directory of Open Access Journals (Sweden)

    Vanessa L.N. Dalepiane


    Full Text Available Matrix metalloproteinases (MMPs play an important role in the pathogenesis of atherosclerosis, the pathology underlying the majority of coronary artery disease (CAD. In this study we tested the hypothesis that polymorphic variation in the MMP genes influences the risk of developing atherosclerosis. We analyzed functional polymorphisms in the promoter of the MMP-1, MMP-3, MMP-9 and MMP-12 genes in 183 Brazilian Caucasian individuals submitted to coronary angiography, of which 67 (37% had normal coronary arteries (control group and 116 (63% had CAD (CAD patient group. The -1607 1G/2G MMP-1, -1171 5A/6A MMP-3, -1562 C/T MMP-9, -82 A/G MMP-12 polymorphisms were analyzed by PCR followed by restriction digestion. No significant differences were observed in allele frequencies between the CAD patients and controls. Haplotype analysis showed no differences between the CAD patients and controls. There was a significant difference in the severity of CAD, as assessed by the number of diseased vessels, in MMP-1 1G/1G homozygous individuals and in those homozygous for the 6A allele of the MMP-3 polymorphism. However, multivariate analysis showed that diabetes mellitus was the only variable independently associated with CAD severity. Our findings indicated that MMP polymorphisms have no significant impact on the risk and severity of CAD.

  15. RETRACTED: Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression. (United States)

    Yang, Chun-Hua; Zhou, Tian-Biao


    Jiang, and Hong-Yan Li Relationship between the ACE I/D gene polymorphism and T1DN susceptibility/risk of T1DM developing into T1DN in the Caucasian population Journal of Renin-Angiotensin-Aldosterone System 1470320314563425, first published on February 1, 2015 doi: 10.1177/1470320314563425 Chun-Hua Yang and Tian-Biao Zhou Relationship between the angiotensinogen A1166C gene polymorphism and the risk of diabetes mellitus developing into diabetic nephropathy Journal of Renin-Angiotensin-Aldosterone System 1470320314566221, first published on February 1, 2015 doi: 10.1177/1470320314566221 Chun-Hua Yang and Tian-Biao Zhou Association of the ACE I/D gene polymorphism with sepsis susceptibility and sepsis progression Journal of Renin-Angiotensin-Aldosterone System 1470320314568521, first published on February 3, 2015 doi: 10.1177/1470320314568521 Articles published in an issue Guohui Liu, Tian-Biao Zhou, Zongpei Jiang, and Dongwen Zheng Association of ACE I/D gene polymorphism with T2DN susceptibility and the risk of T2DM developing into T2DN in a Caucasian population Journal of Renin-Angiotensin-Aldosterone System March 2015 16: 165-171, first published on November 14, 2014 doi: 10.1177/1470320314557849 Weiqiang Zhong, Zhongliang Huang, Yong Wu, Zongpei Jiang, and Tian-Biao Zhou Association of aldosterone synthase (CYP11B2) gene polymorphism with IgA nephropathy risk and progression of IgA nephropathy Journal of Renin-Angiotensin-Aldosterone System September 2015 16: 660-665, first published on August 20, 2014 doi: 10.1177/1470320314524011.

  16. A PCR marker linked to a THCA synthase polymorphism is a reliable tool to discriminate potentially THC-rich plants of Cannabis sativa L. (United States)

    Staginnus, Christina; Zörntlein, Siegfried; de Meijer, Etienne


    Neither absolute THC content nor morphology allows the unequivocal discrimination of fiber cultivars and drug strains of Cannabis sativa L. unequivocally. However, the CBD/THC ratio remains constant throughout the plant's life cycle, is independent of environmental factors, and considered to be controlled by a single locus (B) with two codominant alleles (B(T) and B(D)). The homozygous B(T)/B(T) genotype underlies the THC-predominant phenotype, B(D)/B(D) is CBD predominant, and an intermediate phenotype is induced by the heterozygous state (B(T)/B(D)). Using PCR-based markers in two segregating populations, we proved that the THCA synthase gene represents the postulated B locus and that specific sequence polymorphisms are absolutely linked either to the THC-predominant or the THC-intermediate chemotype. The absolute linkage provides an excellent reliability of the marker signal in forensic casework. For validation, the species-specific marker system was applied to a large number of casework samples and fiber hemp cultivars. © 2014 American Academy of Forensic Sciences.

  17. Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize


    Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei


    Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

  18. Mapping and polymorphism of bovine ghreline gene


    Colinet, Frédéric; Eggen, André; Halleux, Caroline; Arnould, Valérie; Portetelle, Daniel; Renaville, Robert


    Bovine ghrelin, a 27-amino-acid peptide has been identified in bovine oxyntic glands of the abomasum. It is an endogenous growth hormone secretagogue. Total mRNA was extracted from abomasum and complete ghrelin mRNA was sequenced by rapid amplification of cDNA ends. The gene contains five exons and four introns with a short noncoding first exon of 17 bp similar to mouse and human ghrelin gene. Using a radiation hybrid panel, the gene was mapped to chromosome 22 near microsat...

  19. Polymorphisms in inflammation pathway genes and endometrial cancer risk (United States)

    Delahanty, Ryan J.; Xiang, Yong-Bing; Spurdle, Amanda; Beeghly-Fadiel, Alicia; Long, Jirong; Thompson, Deborah; Tomlinson, Ian; Yu, Herbert; Lambrechts, Diether; Dörk, Thilo; Goodman, Marc T.; Zheng, Ying; Salvesen, Helga B.; Bao, Ping-Ping; Amant, Frederic; Beckmann, Matthias W.; Coenegrachts, Lieve; Coosemans, An; Dubrowinskaja, Natalia; Dunning, Alison; Runnebaum, Ingo B.; Easton, Douglas; Ekici, Arif B.; Fasching, Peter A.; Halle, Mari K.; Hein, Alexander; Howarth, Kimberly; Gorman, Maggie; Kaydarova, Dylyara; Krakstad, Camilla; Lose, Felicity; Lu, Lingeng; Lurie, Galina; O’Mara, Tracy; Matsuno, Rayna K.; Pharoah, Paul; Risch, Harvey; Corssen, Madeleine; Trovik, Jone; Turmanov, Nurzhan; Wen, Wanqing; Lu, Wei; Cai, Qiuyin; Zheng, Wei; Shu, Xiao-Ou


    Background Experimental and epidemiological evidence have suggested that chronic inflammation may play a critical role in endometrial carcinogenesis. Methods To investigate this hypothesis, a two-stage study was carried out to evaluate single nucleotide polymorphisms (SNPs) in inflammatory pathway genes in association with endometrial cancer risk. In stage 1, 64 candidate pathway genes were identified and 4,542 directly genotyped or imputed SNPs were analyzed among 832 endometrial cancer cases and 2,049 controls, using data from the Shanghai Endometrial Cancer Genetics Study. Linkage disequilibrium of stage 1 SNPs significantly associated with endometrial cancer (PAsian- and European-ancestry samples. Conclusions These findings lend support to the hypothesis that genetic polymorphisms in genes involved in the inflammatory pathway may contribute to genetic susceptibility to endometrial cancer. Impact Statement This study adds to the growing evidence that inflammation plays an important role in endometrial carcinogenesis. PMID:23221126

  20. Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

    Directory of Open Access Journals (Sweden)

    Kattina Zavala

    Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

  1. Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.). (United States)

    Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav


    Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

  2. Gene-gene interactions and gene polymorphisms of VEGFA and EG-VEGF gene systems in recurrent pregnancy loss. (United States)

    Su, Mei-Tsz; Lin, Sheng-Hsiang; Chen, Yi-Chi; Kuo, Pao-Lin


    Both vascular endothelial growth factor A (VEGFA) and endocrine gland-derived vascular endothelial growth factor (EG-VEGF) systems play major roles in angiogenesis. A body of evidence suggests VEGFs regulate critical processes during pregnancy and have been associated with recurrent pregnancy loss (RPL). However, little information is available regarding the interaction of these two major major angiogenesis-related systems in early human pregnancy. This study was conducted to investigate the association of gene polymorphisms and gene-gene interaction among genes in VEGFA and EG-VEGF systems and idiopathic RPL. A total of 98 women with history of idiopathic RPL and 142 controls were included, and 5 functional SNPs selected from VEGFA, KDR, EG-VEGF (PROK1), PROKR1 and PROKR2 were genotyped. We used multifactor dimensionality reduction (MDR) analysis to choose a best model and evaluate gene-gene interactions. Ingenuity pathways analysis (IPA) was introduced to explore possible complex interactions. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL (P<0.01). The MDR test revealed that the KDR (Q472H) polymorphism was the best loci to be associated with RPL (P=0.02). IPA revealed EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3 signaling pathways. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL. EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3.

  3. Metabolic gene polymorphism frequencies in control populations

    DEFF Research Database (Denmark)

    Garte, Seymour; Gaspari, Laura; Alexandrie, Anna-Karin


    Using the International Project on Genetic Susceptibility to Environmental Carcinogens (GSEC) database containing information on over 15,000 control (noncancer) subjects, the allele and genotype frequencies for many of the more commonly studied metabolic genes (CYP1A1, CYP2E1, CYP2D6, GSTM1, GSTT1...

  4. Glucocorticoid receptor gene polymorphism and juvenile idiopathic arthritis

    Directory of Open Access Journals (Sweden)

    Scheplyagina Larisa A


    Full Text Available Abstract Background The glucocorticoid receptor gene (NR3C1 has been suggested as a candidate gene affecting juvenile idiopathic arthritis (JIA course and prognosis. The purpose of this study is to investigate the glucocorticoid receptor gene BclI polymorphism (rs41423247 in JIA patients, the gene's role in susceptibility to juvenile idiopathic arthritis, and its associations with JIA activity, course and bone mineralization. Methods One hundred twenty-two Caucasian children with JIA and 143 healthy ethnically matched controls were studied. We checked markers of clinical and laboratory activity: morning stiffness, Ritchie Articular Index (RAI, swollen joint count (SJC, tender joint count (TJC, physician's visual analog scale (VAS, hemoglobin level (Hb, leukocyte count (L, platelet count (Pl, Westergren erythrocyte sedimentation rate (ESR, C-reactive protein (CRP, albumin, DAS and DAS28. Bone mineralization was measured by dual-energy X-ray absorptiometry (DXA of lumbar spine L1-L4. Assessments of bone metabolism included osteocalcin, C-terminal telopeptide (CTT, parathyroid hormone (PTH, total and ionized calcium, inorganic phosphate and total alkaline phosphatase (TAP. BclI polymorphism was genotyped by polymerase chain reaction restriction fragment length polymorphism. Results No association was observed between glucocorticoid receptor gene polymorphism and the presence or absence of JIA. In girls with JIA, the presence of the G allele was associated with an unfavorable arthritis course, a younger age of onset of arthritis (p = 0.0017, and higher inflammatory activity. The higher inflammatory activity was demonstrated by the following: increased time of morning stiffness (p = 0.02, VAS (p = 0.014, RAI (p = 0.048, DAS (p = 0.035, DAS28 (p = 0.05, Pl (p = 0.003, L (p = 0.046, CRP (p = 0.01. In addition, these patients had bone metabolism disturbances as follows: decreased BA (p = 0.0001, BMC (p = 0.00007, BMD (0.005 and Z score (p = 0.002; and

  5. Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

    Directory of Open Access Journals (Sweden)

    Yanjing Su


    Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

  6. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.). (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq


    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus. (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong


    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Polymorphism in ABC transporter genes of Dirofilaria immitis

    Directory of Open Access Journals (Sweden)

    Thangadurai Mani


    Full Text Available Dirofilaria immitis, a filarial nematode, causes dirofilariasis in dogs, cats and occasionally in humans. Prevention of the disease has been mainly by monthly use of the macrocyclic lactone (ML endectocides during the mosquito transmission season. Recently, ML resistance has been confirmed in D. immitis and therefore, there is a need to find new classes of anthelmintics. One of the mechanisms associated with ML resistance in nematodes has been the possible role of ATP binding cassette (ABC transporters in reducing drug concentrations at receptor sites. ABC transporters, mainly from sub-families B, C and G, may contribute to multidrug resistance (MDR by active efflux of drugs out of the cell. Gene products of ABC transporters may thus serve as the targets for agents that may modulate susceptibility to drugs, by inhibiting drug transport. ABC transporters are believed to be involved in a variety of physiological functions critical to the parasite, such as sterol transport, and therefore may also serve as the target for drugs that can act as anthelmintics on their own. Knowledge of polymorphism in these ABC transporter genes in nematode parasites could provide useful information for the process of drug design. We have identified 15 ABC transporter genes from sub-families A, B, C and G, in D. immitis, by comparative genomic approaches and analyzed them for polymorphism. Whole genome sequencing data from four ML susceptible (SUS and four loss of efficacy (LOE pooled populations were used for single nucleotide polymorphism (SNP genotyping. Out of 231 SNPs identified in those 15 ABC transporter genes, 89 and 75 of them were specific to the SUS or LOE populations, respectively. A few of the SNPs identified may affect gene expression, protein function, substrate specificity or resistance development and may be useful for transporter inhibitor/anthelmintic drug design, or in order to anticipate resistance development. Keywords: Dirofilaria immitis

  9. Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Em Sutrisna


    Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

  10. Interleukin-1beta gene polymorphisms in Taiwanese patients with gout. (United States)

    Chen, Man-Ling; Huang, Chung-Ming; Tsai, Chang-Hai; Tsai, Fuu-Jen


    The purpose of this study was to examine whether interleukin-1 beta (IL-1beta) promoter and exon 5 gene polymorphisms are markers of susceptibility or clinical manifestations in Taiwanese patients with gout. The study included 196 patients in addition to 103 unrelated healthy control subjects living in central Taiwan. From genomic DNA, polymorphisms of the gene for IL-1beta promoter and IL-1beta exon 5 were typed. Allelic frequencies were compared between the two groups, and the relationship between allelic frequencies and clinical manifestations of gout was evaluated. No significant differences were observed in the allelic frequencies of the IL-1beta promoter between patients with gout and healthy control subjects. Additionally, we did not detect any association of the IL-1beta promoter genotype with the clinical and laboratory profiles of gout patients. However, there was a significant difference between the two groups in terms of hypertriglyceridemia (P=0.0004, chi(2)=12.52, OR 7.14, 95%CI 0.012-0.22). There was also a significant difference in the genotype of IL-1beta exon 5 polymorphism between patients with and without hypertriglyceridemia. Results of the present study suggest that polymorphisms of the IL-1beta promoter and IL-1beta exon 5 are not related to gout patients in central Taiwan.

  11. Angiotensinogen gene polymorphisms in IDDM patients with diabetic nephropathy

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P


    Genotypic abnormalities of the renin-ANG system have been suggested as a risk factor for the development of diabetic nephropathy. Cleavage of angiotensinogen is the rate-limiting step in the activation of the renin-ANG system. The TT genotype of a polymorphism encoding threonine instead of methio......Genotypic abnormalities of the renin-ANG system have been suggested as a risk factor for the development of diabetic nephropathy. Cleavage of angiotensinogen is the rate-limiting step in the activation of the renin-ANG system. The TT genotype of a polymorphism encoding threonine instead...... of methionine (M235T) has been associated not only with increased plasma angiotensinogen concentration but also with essential hypertension. In addition, a polymorphism in the angiotensinogen gene substituting methionine for threonine (T174M) has been associated with hypertension in nondiabetic populations. We...... studied the relationship between these polymorphisms in the angiotensinogen gene in IDDM patients with diabetic nephropathy (121 men, 74 women, age 40.9 +/- 10 years, diabetes duration 27 +/- 8 years). There was no difference in M235T genotype distribution between IDDM patients with diabetic nephropathy...

  12. Vitamin D Receptor Gene Polymorphisms Associated with Childhood Autism. (United States)

    Cieślińska, Anna; Kostyra, Elżbieta; Chwała, Barbara; Moszyńska-Dumara, Małgorzata; Fiedorowicz, Ewa; Teodorowicz, Małgorzata; Savelkoul, Huub F J


    Autism spectrum disorder (ASD) is a group of heterogeneous, behaviorally defined disorders whereby currently no biological markers are common to all affected individuals. A deregulated immune response may be contributing to the etiology of ASD. The active metabolite of vitamin D₃ has an immunoregulatory role mediated by binding to the vitamin D receptor (VDR) in monocyte, macrophages, and lymphocytes. The effects of vitamin D and interaction with the VDR may be influenced by polymorphism in the VDR gene. Genetic association of four different VDR polymorphisms (Apa-I, Bsm-I, Taq-I, Fok-I) associated with susceptibility to the development of autism in children was investigated. We uniquely found an association between the presence of the T allele at position Taq-I and presence of the a allele at position Apa-I of the VDR gene with decreased ASD incidence. There was also an association between female gender and the presence of the T allele. We found no statistical significant correlation between VDR single nucleotide polymorphisms (SNPs) and vitamin D₃ concentration in serum of ASD children. Genetic polymorphism in two SNP in VDR may be correlated with development of ASD symptoms by influencing functionality of vitamin D₃ metabolism, while vitamin D₃ levels were not significantly different between ASD and non-ASD children.

  13. Surfactant gene polymorphisms and interstitial lung diseases

    Directory of Open Access Journals (Sweden)

    Pantelidis Panagiotis


    Full Text Available Abstract Pulmonary surfactant is a complex mixture of phospholipids and proteins, which is present in the alveolar lining fluid and is essential for normal lung function. Alterations in surfactant composition have been reported in several interstitial lung diseases (ILDs. Furthermore, a mutation in the surfactant protein C gene that results in complete absence of the protein has been shown to be associated with familial ILD. The role of surfactant in lung disease is therefore drawing increasing attention following the elucidation of the genetic basis underlying its surface expression and the proof of surfactant abnormalities in ILD.

  14. Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata) (United States)

    Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru


    Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

  15. Interleukin 17 Receptor Gene Polymorphism in Periimplantitis and Chronic Periodontitis

    Directory of Open Access Journals (Sweden)

    Mahdi Kadkhodazadeh


    Full Text Available Gene polymorphism of cytokines influencing their function has been known as a contributing factor in the pathogenesis of inflammatory diseases of the tooth and implant supporting tissues. The aim of this study was to investigate the association of IL-17R gene polymorphism (rs879576 with chronic periodontitis and periimplantitis in an Iranian population. 73 patients with chronic periodontitis, 37 patients with periimplantitis and 83 periodontally healthy patients were enrolled in this study. 5cc blood was obtained from each subject’s arm vein and transferred to tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP technique. Chi-square and Kruskal Wallis tests were used to analyze differences in the expression of genotypes and frequency of alleles in disease and control groups (P-Value less than 0.05 was considered statistically significant. There were no significant differences between periodontitis, periimplantitis with AA, GG, GA genotype of IL-17R gene (P=0.8239. Also comparison of frequency of alleles in SNP rs879576 of IL-17R gene between the chronic periodontitis group and periimplantitis group did not revealed statistically significant differences (P=0.8239. The enigma of IL-17 and its polymorphism-role in periodontitis and periimplantitis is yet to be investigated more carefully throughout further research but this article demonstrates that polymorphism of IL-17R plays no significant role in incidence of chronic periodontitis and Periimplantitis.

  16. Interleukin 17 receptor gene polymorphism in periimplantitis and chronic periodontitis.

    Directory of Open Access Journals (Sweden)

    Mahdi Kadkhodazadeh


    Full Text Available Gene polymorphism of cytokines influencing their function has been known as a contributing factor in the pathogenesis of inflammatory diseases of the tooth and implant supporting tissues. The aim of this study was to investigate the association of IL-17R gene polymorphism (rs879576 with chronic periodontitis and periimplantitis in an Iranian population. 73 patients with chronic periodontitis, 37 patients with periimplantitis and 83 periodontally healthy patients were enrolled in this study. 5cc blood was obtained from each subject's arm vein and transferred to tubes containing EDTA. Genomic DNA was extracted using Miller's Salting Out technique. The DNA was transferred into 96 division plates, transported to Kbioscience Institute in United Kingdom and analyzed using the Kbioscience Competitive Allele Specific PCR (KASP technique. Chi-square and Kruskal Wallis tests were used to analyze differences in the expression of genotypes and frequency of alleles in disease and control groups (P-Value less than 0.05 was considered statistically significant. There were no significant differences between periodontitis, periimplantitis with AA, GG, GA genotype of IL-17R gene (P=0.8239. Also comparison of frequency of alleles in SNP rs879576 of IL-17R gene between the chronic periodontitis group and periimplantitis group did not revealed statistically significant differences (P=0.8239. The enigma of IL-17 and its polymorphism-role in periodontitis and periimplantitis is yet to be investigated more carefully throughout further research but this article demonstrates that polymorphism of IL-17R plays no significant role in incidence of chronic periodontitis and Periimplantitis.

  17. A novel polymorphism of resistin gene and its association with meat ...

    African Journals Online (AJOL)

    Searching for candidate gene polymorphisms and their relationship with meat quality traits is an important issue for Bos taurus industry. In this study, we evaluated polymorphism of resistin (RETN) gene involved in energy metabolism. Using the polymerase chain reaction-single strand conformation polymorphism ...

  18. Effects of Growth Hormone Gene Polymorphism on Lipogenic Gene Expression Levels in Diaphragm Tissues of Japanese Black Heifers

    Directory of Open Access Journals (Sweden)

    Astrid Ardiyanti


    Full Text Available Two SNPs, i.e. L127V and T172M, of bovine growth hormone (GH causing the presence of GH gene haplotypes A, B, and C was previously shown to alter intramuscular fatty acid (FA composition in Japanese Black (JB heifers. To determine the SNP effect on somatotropic hormone concentration and lipogenesis, we measured plasma GH, insulin, and insulin-like growth factor-1 (IGF-1 concentrations. We also measured mRNA levels of fatty acid synthase (FASN, stearoyl-coA desaturase (SCD, and sterol regulatory element binding proteins-1 (SREBP-1 and FA composition in diaphragm tissues. Heifers with genotype CC had the lowest plasma insulin concentration and FASN and SCD mRNA levels among genotypes. FASN mRNA levels in haplotype A tended to positively correlate with saturated FA (SFA content and negatively correlated with C18:2 and unsaturated FA (USFA contents. SCD mRNA levels in haplotype A positively correlated with monounsaturated FA (MUFA contents and negatively correlated with C18:0 content. They also tended to positively correlate with C16:1, C18:1, and USFA contents and USFA/SFA ratio and negatively correlate with SFA content. Taken together, GH gene polymorphism affects the lipogenic genes expression levels and their relationships with fatty acid compositions in diaphragm tissues of JB heifers at 31 months of age.

  19. Polymorphisms of the ABCB1 gene in the pakistani population

    International Nuclear Information System (INIS)

    Farhat, K.; Waheed, A.


    Objective: To investigate the frequency of the single nucleotide polymorphism C1236Tin exon 12 of the ABCB1 gene in Pakistani population and to compare it with published data on Asian and Caucasian populations. Study Design: Across-sectional observational study. Place and Duration of Study: Combined Military Hospital, Rawalpindi and Institute of Biomedical and Genetic Engineering (IBGE), Islamabad, from August 2012 to May 2013. Methodology: C1236T polymorphism was investigated in 426 Pakistani subjects. The frequency was compared with the published data on other Asian and Caucasian populations. Results: The frequencies of ABCB1 C1236T were 16.4% for CC, 44.1% for CT and 39.4% for TT. Pakistanis differed significantly from all the European populations compared in the distribution of the TT genotype of C1236TABCB1 (p < 0.05). The Pakistani population also differed significantly from some of the European populations in the distribution of CC and CT genotype (p < 0.05). Conclusion: There was significant difference in the genotype frequency of the ABCB1 gene compared to other populations. This study has provided a framework for future pharmacogenetic and pharmacokinetic studies on this polymorphic variant of ABCB1 gene in the Pakistani population. (author)

  20. Associations between STAT Gene Polymorphisms and Psoriasis in Northeastern China. (United States)

    Zhou, Jing; Li, Yuzhen; Sun, Donglin


    Psoriasis is an autoimmune disease with genetic and environmental factors. Based on the roles of STATs (signaling transducers and activators of transcription) in autoimmune diseases, it is assumed STAT gene polymorphisms are associated with psoriasis. To study the association between STAT gene polymorphisms and psoriasis in the northeastern Chinese population. Eight single-nucleotide polymorphisms were genotyped: rs2293152, rs3816769, rs4796793, and rs744166 in STAT3, rs7574865 and rs3024866 in STAT4, and rs324011 and rs3024974 in STAT6, using SNaPshot methods. The genotype, allele, and haplotype frequencies were compared between 400 psoriasis patients and 398 healthy individuals in northeastern China. rs744166GG in STAT3 and rs7574865TT in STAT4 had higher frequencies in the case than the control group, suggesting these 2 genotypes increase the susceptibility to psoriasis (p < 0.05). Three haplotypes (H3, H6, and H7) were found to be associated with psoriasis in the study (p < 0.05). These results indicate a role of STAT genes in the pathogenesis of psoriasis. © 2017 S. Karger AG, Basel.

  1. AT1 Receptor Gene Polymorphisms in relation to Postprandial Lipemia

    Directory of Open Access Journals (Sweden)

    B. Klop


    Full Text Available Background. Recent data suggest that the renin-angiotensin system may be involved in triglyceride (TG metabolism. We explored the effect of the common A1166C and C573T polymorphisms of the angiotensin II type 1 receptor (AT1R gene on postprandial lipemia. Methods. Eighty-two subjects measured daytime capillary TG, and postprandial lipemia was estimated as incremental area under the TG curve. The C573T and A1166C polymorphisms of the AT1R gene were determined. Results. Postprandial lipemia was significantly higher in homozygous carriers of the 1166-C allele (9.39±8.36 mM*h/L compared to homozygous carriers of the 1166-A allele (2.02±6.20 mM*h/L (P<0.05. Postprandial lipemia was similar for the different C573T polymorphisms. Conclusion. The 1166-C allele of the AT1R gene seems to be associated with increased postprandial lipemia. These data confirm the earlier described relationships between the renin-angiotensin axis and triglyceride metabolism.

  2. Malassezia Yeast and Cytokine Gene Polymorphism in Atopic Dermatitis. (United States)

    Jain, Charu; Das, Shukla; Ramachandran, V G; Saha, Rumpa; Bhattacharya, S N; Dar, Sajad


    Atopic Dermatitis (AD) is a recurrent chronic condition associated with microorganism and their interaction with the susceptible host. Malassezia yeast is a known commensal which is thought to provoke the recurrent episodes of symptoms in atopic dermatitis patients. Malassezia immunomodulatory properties along with defective skin barrier in such host, results in disease manifestation. Here, we studied Single Nucleotide Polymorphism (SNP) in IL10 and IFN γ genes of the host and its relation with susceptibility to Malassezia infection. To isolate Malassezia yeast from AD patients and compare the genetic susceptibility of the host by correlating the cytokine gene polymorphism with the control subjects. Study was conducted from January 2012 to January 2013. It was a prospective observational study done in Department of Microbiology and Department of Dermatology and Venereology in University College of Medical Sciences and GTB Hospital, Delhi. Sample size comprised of 38 cases each of AD. Skin scrapings were used for fungal culture on Sabouraud Dextrose Agar (SDA) and Modified Dixon Agar (MDA) and isolated were identified as per conventional phenotypic methods. Genomic DNA was extracted from blood samples collected from all study subjects. Cytokine genotyping was carried out by Amplification Refractory Mutations System- Polymerase Chain Reaction (ARMS-PCR) with sequence specific primers. Three SNPs (IL10-1082A/G; IL10-819/592C/T; IFN-γ+874A/T) in two cytokine genes were assessed in all the patients and healthy controls. Chi-Square Test or Fisher's-Exact Test and Bonferroni's correction. In AD group, Malassezia yeasts were cultured in 24 out of 38 samples and thus the identification rate was 63.1 percent as compared to healthy group, 52.6 percent (20/38). Significant difference in allele, or genotype distribution were observed in IL10-819/592C/T and IFN-γ+874A/T gene polymorphism in AD group. Higher isolation rate in cases as compared to control group highlights the

  3. PTH Gene Polymorphism and Breast Cancer Risk in Kazakhstan

    Directory of Open Access Journals (Sweden)

    Nurgul Sikhayeva


    Full Text Available Introduction. Breast cancer is the most common type of cancer among women. In Kazakhstan, breast cancer holds first place among causes of women death caused by cancer in the 45-55 year age group . Many studies have shown that the risk of acquiring breast cancer may be related to the level of calcium in the blood serum. One of the important regulators of calcium metabolism in the body is the parathyroid hormone. Single nucleotide polymorphisms in the gene encoding the parathyroid hormone (PTH are associated with breast cancer development risk, and may modify the associative interaction between the levels of calcium intake and breast cancer. Experimental studies have shown that PTH gene has a carcinogenic effect. At least three studies showed a weak positive correlation between the risk of acquiring breast cancer and primary hyperparathyroidism, a state with high levels of PTH and often high levels of calcium. The aim of this investigation was to evaluate potential association between PTH gene polymorphism and breast cancer risk among Kazakhstani women.Methods. Female breast cancer patients (n = 429 and matched control women (n = 373 were recruited into a case – control study,. Genomic DNA was extracted from peripheral venous blood of study participants using Wizard® Genomic DNA Purification Kit (Promega, USA. Detection of PTH gene polymorphism (rs1459015 was done by means of the TaqMan® SNP Genotyping Assay of real-time PCR. Statistical analysis was conducted using SPSS 19.0.Results. PTH gene alleles were in Hardy–Weinberg equilibrium (p > 0.05. Distribution was 59% CC, 35% CT, 6% TT in the group with breast cancer and 50% CC, 43% CT, 6% TT in the control group. Total difference (between the group with breast cancer and the control group in allele frequencies for PTH polymorphism was not significant (p > 0.05. No association was found between rs1459015 TT and breast cancer risk (OR = 1.039; 95%, CI 0.740 - 1.297; p = 0.893.Conclusion. We

  4. The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS. (United States)

    von Wettstein-Knowles, Penny


    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

  5. Analysis of genetic variation of inducible nitric oxide synthase and ...

    African Journals Online (AJOL)

    The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

  6. Do polymorphisms in chemosensory genes matter for human ingestive behavior? (United States)

    Hayes, John E; Feeney, Emma L; Allen, Alissa L


    In the last decade, basic research in chemoreceptor genetics and neurobiology have revolutionized our understanding of individual differences in chemosensation. From an evolutionary perspective, chemosensory variations appear to have arisen in response to different living environments, generally in the avoidance of toxins and to better detect vital food sources. Today, it is often assumed that these differences may drive variable food preferences and choices, with downstream effects on health and wellness. A growing body of evidence indicates chemosensory variation is far more complex than previously believed. However, just because a genetic polymorphism results in altered receptor function in cultured cells or even behavioral phenotypes in the laboratory, this variation may not be sufficient to influence food choice in free living humans. Still, there is ample evidence to indicate allelic variation in TAS2R38 predicts variation in bitterness of synthetic pharmaceuticals (e.g., propylthiouracil) and natural plant compounds (e.g., goitrin), and this variation associates with differential intake of alcohol and vegetables. Further, this is only one of 25 unique bitter taste genes ( TAS2Rs ) in humans, and emerging evidence suggests other TAS2Rs may also contain polymorphisms that a functional with respect to ingestive behavior. For example, TAS2R16 polymorphisms are linked to the bitterness of naturally occurring plant compounds and alcoholic beverage intake, a TAS2R19 polymorphism predicts differences in quinine bitterness and grapefruit bitterness and liking, and TAS2R31 polymorphisms associate with differential bitterness of plant compounds like aristolochic acid and the sulfonyl amide sweeteners saccharin and acesulfame-K. More critically with respect to food choices, these polymorphisms may vary independently from each other within and across individuals, meaning a monolithic one-size-fits-all approach to bitterness needs to be abandoned. Nor are genetic

  7. Association study of ghrelin receptor gene polymorphisms in rheumatoid arthritis. (United States)

    Robledo, G; Rueda, B; Gonzalez-Gay, M A; Fernández, B; Lamas, J R; Balsa, A; Pascual-Salcedo, D; García, A; Raya, E; Martín, J


    Ghrelin is a newly characterised growth hormone (GH) releasing peptide widely distributed that may play an important role in the regulation of metabolic balance in inflammatory diseases such as rheumatoid arthritis (RA) by decreasing the pro-inflammatory Th1 responses. In this study we investigated the possible contribution of several polymorphisms in the functional Ghrelin receptor to RA susceptibility. A screening of 3 single nucleotide polymorphisms (SNPs) was performed in a total of 950 RA patients and 990 healthy controls of Spanish Caucasian origin. Genotyping of all 3 SNPs was performed by real-time polymerase chain reaction technology, using the TaqMan 5'-allele discrimination assay. We observed no statistically significant deviation between RA patients and controls for the GHSR SNPs analysed. In addition, we performed a haplotype analysis that did not reveal an association with RA susceptibility. The stratification analysis for the presence of shared epitope (SE), rheumatoid factor (RF) or antibodies anti cyclic citrullinated peptide (anti-CCP) did not detect significant association of the GHSR polymorphisms with RA. These findings suggest that the GHSR gene polymorphisms do not appear to play a major role in RA genetic predisposition in our population.

  8. Cytokine Gene Polymorphisms in Egyptian Cases with Brain Tumors

    International Nuclear Information System (INIS)

    Badr El-Din, N.K.; Abdel-Hady, E.K.; Salem, F.K.; Settin, A.; ALI, N.


    Background: Cytokines are proposed to play important roles in brain tumor biology as well as neuro degeneration or impaired neuronal function. Objectives: This work aimed to check the association of polymorphisms of cytokine genes in Egyptian cases with brain tumors. Methods: This work included 45 cases affected by brain tumors diagnosed as 24 benign and 21 malignant. Their median age was 45 years, and they were 20 males and 25 females. These cases were taken randomly from the Neurosurgery Department of Mansoura University Hospital, Egypt. Case genotypes were compared to 98 healthy unrelated controls from the same locality. DNA was amplified using PCR utilizing sequence specific primers (SSP) for detection of polymorphisms related to TNF-a-308 (G/A), IL-10-1082 (G/A), IL-6-174 (G/C) and IL-1Ra (VNTR) genes. Results: Cases affected with benign brain tumors showed a significant higher frequency of IL-10-1082 A/A [odds ratio (OR=8.0), p<0.001] and IL-6-174 C/C (OR=6.3, p=0.002) homozygous genotypes as compared to controls. Malignant cases, on the other hand, showed significantly higher frequency of IL-6-174 C/C (OR =4.8, p=0.002) homozygous genotype and TNF-a-308 A/A (OR=4.9, p<0.001) homozygous genotype when compared to controls. In the meantime, all cases showed no significant difference regarding the distribution of IL-1Ra VNTR genotype polymorphism compared to controls. Conclusions: Cytokine gene polymorphisms showed a pattern of association with brain tumors which may have potential impact on family counseling and disease management.

  9. Effects of MTHFR and MS gene polymorphisms on baseline blood pressure and Benazepril effectiveness in Chinese hypertensive patients. (United States)

    Jiang, S; Yu, Y; Venners, S A; Zhang, Y; Xing, H; Wang, X; Xu, X


    The development of essential hypertension (EH) and inter-individual differences in response to antihypertensive treatment may partly result from genetic heterogeneity. In this study, we conducted an investigation of the combined effects of 5, 10-methylenetetrahydrofolate reductase (MTHFR) C677T and methionine synthase (MS) A2756G polymorphisms on baseline blood pressure (BP) and BP response to antihypertensive Benazepril treatment in 823 Chinese hypertensive patients with a fixed daily dosage of 10 mg for 15 consecutive days. When MTHFR C677T and MS A2756G polymorphisms were modelled together with adjustment for important covariates, only MTHFR C677T was associated with baseline systolic BP (SBP) (β (s.e.)=2.84 (1.10), P=0.0096) or baseline diastolic BP (DBP) (β (s.e.)=2.19 (0.65), P=0.0008). Modelled together with adjustment for important covariates, MTHFR C677T and MS A2756G polymorphisms were both independently associated with increased DBP response (baseline minus post-treatment) to Benazepril treatment (C677T: β (s.e.)=1.58 (0.76), P=0.038; A2756G: β (s.e.)=2.14 (0.89), P=0.016). Neither polymorphism was associated with SBP response to Benazepril treatment. There were no significant interactions or effect modification between MTHFR C677T and MS A2756G gene polymorphisms in models of baseline SBP, baseline DBP or DBP response to Benazepril treatment. Our results suggest that the effects of MTHFR C677T and MS A2756G gene polymorphisms may have pivotal roles in the aetiology of EH and BP response to Benazepril treatment.

  10. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean


    Good, Laura Lee


    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  11. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk


    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  12. High polymorphism in Est-SSR loci for cellulose synthase and β-amylase of sugarcane varieties (Saccharum spp.) used by the industrial sector for ethanol production. (United States)

    Augusto, Raphael; Maranho, Rone Charles; Mangolin, Claudete Aparecida; Pires da Silva Machado, Maria de Fátima


    High and low polymorphisms in simple sequence repeats of expressed sequence tag (EST-SSR) for specific proteins and enzymes, such as β-amylase, cellulose synthase, xyloglucan endotransglucosylase, fructose 1,6-bisphosphate aldolase, and fructose 1,6-bisphosphatase, were used to illustrate the genetic divergence within and between varieties of sugarcane (Saccharum spp.) and to guide the technological paths to optimize ethanol production from lignocellulose biomass. The varieties RB72454, RB867515, RB92579, and SP813250 on the second stage of cutting, all grown in the state of Paraná (PR), and the varieties RB92579 and SP813250 cultured in the PR state and in Northeastern Brazil, state of Pernambuco (PE), were analyzed using five EST-SSR primers for EstC66, EstC67, EstC68, EstC69, and EstC91 loci. Genetic divergence was evident in the EstC67 and EstC69 loci for β-amylase and cellulose synthase, respectively, among the four sugarcane varieties. An extremely high level of genetic differentiation was also detected in the EstC67 locus from the RB82579 and SP813250 varieties cultured in the PR and PE states. High polymorphism in SSR of the cellulose synthase locus may explain the high variability of substrates used in pretreatment and enzymatic hydrolysis processes, which has been an obstacle to effective industrial adaptations.

  13. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.). (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui


    In higher plants, sucrose synthase (Sus, EC is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  14. Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Rinker, Torri E.; Baker, Scott E.


    Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

  15. Glutathione S-transferase gene polymorphisms in presbycusis. (United States)

    Ateş, Nurcan Aras; Unal, Murat; Tamer, Lülüfer; Derici, Ebru; Karakaş, Sevim; Ercan, Bahadir; Pata, Yavuz Selim; Akbaş, Yücel; Vayisoğlu, Yusuf; Camdeviren, Handan


    Glutathione and glutathione-related antioxidant enzymes are involved in the metabolism and detoxification of cytotoxic and carcinogenic compounds as well as reactive oxygen species. Reactive oxygen species generation occurs in prolonged relative hypoperfusion conditions such as in aging. The etiology of presbycusis is much less certain; however, a complex genetic cause is most likely. The effect of aging shows a wide interindividual range; we aimed to investigate whether profiles of (glutathione S-transferase (GST) M1, T1 and P1 genotypes may be associated with the risk of age-related hearing loss. We examined 68 adults with presbycusis and 69 healthy controls. DNA was extracted from whole blood, and the GSTM1, GSTT1 and GSTP1 polymorphisms were determined using a real-time polymerase chain reaction and fluorescence resonance energy transfer with a Light-Cycler Instrument. Associations between specific genotypes and the development of presbycusis were examined by use of logistic regression analyses to calculate odds ratios and 95% confidence intervals. Gene polymorphisms at GSTM1, GSTT1, and GSTP1 in subjects with presbycusis were not significantly different than in the controls (p > 0.05). Also, the combinations of different GSTM1, GSTT1, and GSTP1 genotypes were not an increased risk of presbycusis (p > 0.05). We could not demonstrate any significant association between the GSTM1, GSTT1, and GSTP1 polymorphism and age-related hearing loss in this population. This may be because of our sample size, and further studies need to investigate the exact role of GST gene polymorphisms in the etiopathogenesis of the presbycusis.

  16. Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

    Directory of Open Access Journals (Sweden)

    Bin Wang


    Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

  17. Association of oxidative stress gene polymorphisms with presbycusis. (United States)

    Manche, Santoshi Kumari; Jangala, Madhavi; Putta, Padmavathi; Koralla, Raja Meganadh; Akka, Jyothy


    Presbycusis is characterised by etiopathological changes in the cochlea of the inner ear due to genetic and environmental factors and has a serious impact on quality of life. The present study was aimed to evaluate the role of oxidant stress gene polymorphisms in the development of presbycusis. 220 subjects with confirmed presbycusis from ENT specialists of MAA ENT hospital, Hyderabad, India from 2012 to 2014 were considered for the study. 270 age and sex matched controls were included in the study. Analysis of gene polymorphisms of SNPs cytochrome P450 1A1 (CYP1A1) 3801 T>C, 2455 A>G and 2453 A>C; glutathione S transferase (GST) T1 and M1; N-acetyl transferase (NAT2) 282 C>T and 857 G>A; uncoupled proteins (UCP1) (-3826) A>G and (UCP2) (866)G>A was carried out. Variations in the allelic and genotypic frequencies obtained were computed and analysed using appropriate statistical methods. The results of the study indicated that CYP1A1 gene polymorphism at 2453 C>A (adjusted OR: 1.59, 95% CI: 1.01-2.87) and 2455 A>G (adjusted OR: 1.87, 95% CI: 1.07-3.37), double null genotype of GSTM1 and GSTT1 (adjusted OR: 8.88, 95% CI: 4.10-19.19), NAT2 gene at C282T (adjusted OR: 1.77, 95% CI: 1.02-3.11) and G590 A (adjusted OR: 1.83, 95% CI 1.20-3.63) and UCP2 (-866) G>A (adjusted OR: 12.39; 95% CI: 6.51-23.56) showed increased risk for presbycusis while CYP1A1 at 3801 T>C and UCP1 (-3286) A>G exhibited no association. The haplotype combinations of T-G-A of CYP1A1 at 3801, 2455 and 2453 positions as well as T-A of NAT2*6 at 282 and 590 positions were found to contribute significant risk for the onset of presbycusis. Gene polymorphisms of CYP1A1 (A2455G, C2453A), NAT2*6 (C282T, G590 A), GST T1/M1 (double null genotype) and UCP2 (G-866 A) were found to contribute significant risk to presbycusis. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Polymorphisms in the prion protein gene and in the doppel gene increase susceptibility for Creutzfeldt-Jakob disease

    NARCIS (Netherlands)

    E.A. Croes (Esther); B.Z. Alizadeh (Behrooz); A.M. Bertoli Avella (Aida); T.A.M. Rademaker (Tessa); J. Vergeer-Drop (Jeannette); B. Dermaut (Bart); J.J. Houwing-Duistermaat (Jeanine); D.P.W.M. Wientjens (Dorothee); A. Hofman (Albert); C. van Broeckhoven (Christine); C.M. van Duijn (Cornelia)


    textabstractThe prion protein gene (PRNP) plays a central role in the origin of Creutzfeldt-Jakob disease (CJD), but there is growing interest in other polymorphisms that may be involved in CJD. Polymorphisms upstream of PRNP that may modulate the prion protein production as well as polymorphisms in

  19. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat. (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T


    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Polymorphism of the renalase gene in gestational diabetes mellitus. (United States)

    Fatima, Syeda Sadia; Jamil, Zehra; Alam, Faiza; Malik, Hajira Zafar; Madhani, Sarosh Irfan; Ahmad, Muhammad Saad; Shabbir, Tayyab; Rehmani, Muhammed Noman; Rabbani, Amna


    Renalase is considered as a novel candidate gene for type 2 diabetes. In this study, we aimed to investigate the relationship of serum renalase and two single nucleotide polymorphisms with gestational diabetes mellitus. One hundred and ninety-eight normotensive pregnant females (n = 99 gestational diabetes mellitus; n = 99 euglycemic pregnant controls) were classified according to the International Association of the Diabetes and Pregnancy Study criteria. Fasting and 2-h post glucose load blood levels and anthropometric assessment was performed. Serum renalase was measured using enzyme-linked immunosorbent assay, whereas DNA samples were genotyped for renalase single nucleotide polymorphisms rs2576178 and rs10887800 using Polymerase chain reaction-Restriction fragment length polymorphism method. In an age-matched case control study, no difference was observed in the serum levels of renalase (p > 0.05). The variant rs10887800 showed an association with gestational diabetes mellitus and remained significant after multiple adjustments (p gestational diabetes. Although gestational diabetes mellitus is self-reversible, yet presence of this minor G allele might predispose to metabolic syndrome phenotypes in near the future.

  1. T cell cytokine gene polymorphisms in canine diabetes mellitus. (United States)

    Short, Andrea D; Catchpole, Brian; Kennedy, Lorna J; Barnes, Annette; Lee, Andy C; Jones, Chris A; Fretwell, Neale; Ollier, William E R


    Insulin-deficiency diabetes in dogs shares some similarities with human latent autoimmune diabetes of adults (LADA). Canine diabetes is likely to have a complex pathogenesis with multiple genes contributing to overall susceptibility and/or disease progression. An association has previously been shown between canine diabetes and MHC class II genes, although other genes are also likely to contribute to the genetic risk. Potential diabetes susceptibility genes include immuno-regulatory TH1/TH2 cytokines such as IFNgamma, IL-12, IL-4 and IL-10. We screened these candidate genes for single nucleotide polymorphisms (SNPs) in a range of different dog breeds using dHPLC analysis and DNA sequencing. Thirty-eight of the SNPs were genotyped in crossbreed dogs and seven other breed groups (Labrador Retriever, West Highland White Terrier, Collie, Schnauzer, Cairn Terrier, Samoyed and Cavalier King Charles Spaniel), which demonstrated substantial intra-breed differences in allele frequencies. When SNPs were examined for an association with diabetes by case:control analysis significant associations were observed for IL-4 in three breeds, the Collie, Cairn Terrier and Schnauzer and for IL-10 in the Cavalier King Charles Spaniel. These results suggest that canine cytokine genes regulating the TH1/TH2 immune balance might play a contributory role in determining susceptibility to diabetes in some breeds.

  2. Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines. (United States)

    Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif


    Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

  3. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites* (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying


    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

  4. Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites. (United States)

    Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying


    To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

  5. The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase. (United States)

    Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S


    Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

  6. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi


    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  7. Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi. (United States)

    Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei


    Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

    Directory of Open Access Journals (Sweden)

    Meng eWang


    Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.


    Directory of Open Access Journals (Sweden)

    Svitlana B. Drozdovska


    Full Text Available Athletic performance is a polygenic trait influenced by both environmental and genetic factors. Objective: to investigate individually and in combination the association of common gene polymorphisms with athlete status in Ukrainians. Methods: A total of 210 elite Ukrainian athletes (100 endurance-oriented and 110 power-orientated athletes and 326 controls were genotyped for ACE I/D, HIF1A Pro582Ser, NOS3 –786 T/C, PPARA intron 7 G/C, PPARG Pro12Ala and PPARGC1B Ala203Pro gene polymorphisms, most of which were previously reported to be associated with athlete status or related intermediate phenotypes in different populations. Results: Power-oriented athletes exhibited an increased frequency of the HIF1A Ser (16.1 vs. 9.420P = 0.034 and NOS3 T alleles (78.3 vs. 66.220P = 0.0019 in comparison with controls. Additionally, we found that the frequency of the PPARG Ala allele was significantly higher in power-oriented athletes compared with the endurance-oriented athletes (24.7 vs. 13.520P = 0.0076. Next, we determined the total genotype score (TGS, from the accumulated combination of the three polymorphisms, with a maximum value of 100 for the theoretically optimal polygenic score in athletes and controls. The mean TGS was significantly higher in power-oriented athletes (39.1 ± 2.3 vs. 32.6 ± 1.5; P = 0.0142 than in controls. Conclusions: We found that the HIF1A Ser, NOS3 T and PPARG Ala alleles were associated with power athlete status in Ukrainians.

  10. Association between polymorphisms in the TSHR gene and Graves' orbitopathy.

    Directory of Open Access Journals (Sweden)

    Beata Jurecka-Lubieniecka

    Full Text Available BACKGROUND: Graves' orbitopathy (GO as well as Graves' disease (GD hyperthyroidism originate from an autoimmune reaction against the common auto-antigen, thyroid-stimulating hormone receptor (TSHR. GO phenotype is associated with environmental risk factors, mainly nicotinism, as well as genetic risk factors which initiate an immunologic reaction. In some patients GO is observed before diagnosis of GD hyperthyroidism, while it can also be observed far after diagnosis. The intensity of GO symptoms varies greatly in these patients. Thus, the pathogenesis of GD and GO may correlate with different genetic backgrounds, which has been confirmed by studies of correlations between GO and polymorphisms in cytokines involved in orbit inflammation. The aim of our analysis was to assess genetic predisposition to GO in young patients (age of diagnosis ≤30 years of age, for whom environmental effects had less time to influence outcomes than in adults. METHODS: 768 GD patients were included in the study. 359 of them had clinically evident orbitopathy (NOSPECS ≥2. Patients were stratified by age at diagnosis. Association analyses were performed for genes with a known influence on development of GD - TSHR, HLA-DRB1, cytotoxic T-lymphocyte antigen 4 (CTLA4 and lymphoid protein tyrosine phosphatase (PTPN22. RESULTS: The rs179247 TSHR polymorphism was associated with GO in young patients only. In young GO-free patients, allele A was statistically more frequent and homozygous carriers had a considerable lower risk of disease incidence than patients with AG or GG genotypes. Those differences were not found in either elderly patients or the group analyzed as a whole. CONCLUSIONS: Allele A of the rs179247 polymorphism in the TSHR gene is associated with lower risk of GO in young GD patients.

  11. The role of ERBB2 gene polymorphisms in leprosy susceptibility

    Directory of Open Access Journals (Sweden)

    Jamile Leão Rêgo


    Full Text Available Mycobacterium leprae infects skin and peripheral nerves causing deformities and disability. The M. leprae bacterium binds to ErbB2 on the Schwann cell surface causing demyelination and favoring spread of the bacilli and causing nerve injury. Polymorphisms at the ERBB2 gene were previously investigated as genetic risk factors for leprosy in two Brazilian populations but with inconsistent results. Herein we extend the analysis of ERBB2 variants to a third geographically distinct population in Brazil. Our results show that there is no association between the genotyped SNPs and the disease (p > 0.05 in this population. A gene set or pathway analysis under the genomic region of ERBB2 will be necessary to clarify its regulation under M. leprae stimulus.

  12. Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

    Directory of Open Access Journals (Sweden)

    Bhubalan, K.


    Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

  13. Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

    DEFF Research Database (Denmark)

    Vestergaard, H; Lund, S; Bjørbaek, C


    We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

  14. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)


    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  15. Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

    International Nuclear Information System (INIS)

    Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.


    The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

  16. Novel cystathionine β-synthase gene mutations in a Filipino patient with classic homocystinuria. (United States)

    Silao, Catherine Lynn T; Fabella, Terence Diane F; Rama, Kahlil Izza D; Estrada, Sylvia C


    Classic homocystinuria due to cystathionine β-synthase (CBS) deficiency is an autosomal recessive disorder of sulfur metabolism. Clinical manifestations include mental retardation, dislocation of the optic lens (ectopia lentis), skeletal abnormalities and a tendency to thromboembolic episodes. We present the first mutational analysis of CBS in a Filipino patient with classic homocystinuria. Genomic DNA was extracted from peripheral blood collected from a diagnosed Filipino patient with classic homocystinuria. The entire coding region of CBS (17 exons) was amplified using polymerase chain reaction and bidirectionally sequenced using standard protocols. The patient was found to be compound heterozygous for two novel mutations, g.13995G>A [c.982G>A; p.D328K] and g.15860-15868dupGCAGGAGCT [c.1083-1091dupGCAGGAGCT; p. Q362-L364dupQEL]. Four known single-nucleotide polymorphisms (rs234706, rs1801181, rs706208 and rs706209) were also detected in the present patient's CBS. The patient was heterozygous for all the identified alleles. This is the first mutational analysis of CBS done in a Filipino patient with classic homocystinuria who presented with a novel duplication mutation and a novel missense mutation. Homocystinuria due to CBS deficiency is a heterogeneous disorder at the molecular level. © 2015 Japan Pediatric Society.

  17. Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6). (United States)

    Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine


    Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Evaluation of inflammation-related genes polymorphisms in Mexican with Alzheimer’s disease: a pilot study

    Directory of Open Access Journals (Sweden)

    Danira eToral-Rios


    Full Text Available Amyloid peptide is able to promote the activation of microglia and astrocytes in Alzheimer’s disease (AD, and this stimulates the production of pro-inflammatory cytokines. Inflammation contributes to the process of neurodegeneration and therefore is a key factor in the development of AD. Some of the most important proteins involved in AD inflammation are: clusterin (CLU, complement receptor 1 (CR1, C reactive protein (CRP, tumor necrosis factor α (TNF- α, the interleukins 1α (IL - 1α, 6 (IL-6, 10 (IL-10 and cyclooxygenase 2 (COX-2. In particular, COX-2 is encoded by the prostaglandin-endoperoxide synthase 2 gene (PTGS2. Since variations in the genes that encode these proteins may modify gene expression or function, it is important to investigate whether these variations may change the developing AD. The aim of this study was to determine whether the presence of polymorphisms in the genes encoding the aforementioned proteins is associated Mexican patients with AD. Fourteen polymorphisms were genotyped in 96 subjects with AD and the differences in allele, genotype and haplotype frequencies were analyzed. Additionally, an ancestry analysis was conducted to exclude differences in genetic ancestry among groups as a confounding factor in the study. Significant differences in frequencies between AD and controls were found for the SNP rs20417 within the PTGS2 gene. Ancestry analysis revealed no significant differences in the ancestry of the compared groups, and the association was significant even after adjustment for ancestry and correction for multiple testing, which strengthens the validity of the results. We conclude that this polymorphism plays an important role in the development of the AD pathology and further studies are required, including their proteins.

  19. Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

    Directory of Open Access Journals (Sweden)

    Yue Ming


    Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

  20. Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism. (United States)

    Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling


    Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  1. Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation. (United States)

    El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia


    Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.


    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo


    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  3. Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality

    Directory of Open Access Journals (Sweden)

    Anastasia K Armeni


    Full Text Available Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA gene polymorphism (rs2234693-PvuII (T→C substitution and oxytocin receptor gene polymorphism (rs53576 (G→A substitution with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20–25 years of age, sexually active, with normal menstrual cycles (28–35 days, were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs, polycystic ovary syndrome (PCOS, thyroid diseases as well as drugs that are implicated in hypothalamus–pituitary–gonadal axis. T allele (wildtype of rs2234693 (PvuII polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic of rs53576 (OXTR polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII and A allele of rs53576 (OXTR polymorphisms (T + A group was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences.

  4. N-acetyltransferase 2 gene polymorphism and presbycusis. (United States)

    Unal, Murat; Tamer, Lülüfer; Doğruer, Zeynep Nil; Yildirim, Hatice; Vayisoğlu, Yusuf; Camdeviren, Handan


    The enzyme of N-acetyltransferase (NAT) is involved in the metabolism and detoxification of cytotoxic and carcinogenic compounds as well as reactive oxygen species (ROS). The excessive amount of ROS generation occurs in the ageing inner ear. The exact etiopathogenesis of presbycusis is not known, but it is generally accepted that it is the result of series of insults, such as physiologic age-related degeneration, noise exposure, medical disorders and their treatment, as well as hereditary susceptibility. The effect of aging shows a wide interindividual range; we aimed to investigate whether profiles of NAT2 genotypes may be associated with the risk of presbycusis. Hospital-based, case-control study. We examined 68 adults with presbycusis and 98 healthy controls. DNA was extracted from whole blood, and the polymorphisms of NAT2*5A, NAT2*6A, NAT2*7A/B, and NAT2*14A were determined using a real-time polymerase chain reaction and fluorescence resonance energy transfer with a Light-Cycler Instrument. Associations between specific genotypes and the development of presbycusis were examined by use of logistic regression analyses to calculate odds ratios and 95% confidence intervals. Gene polymorphisms at NAT2*5A, NAT2*7A/B, and NAT2*14A in subjects with presbycusis were not significantly different from in the controls (P > .05). However, in NAT2*6A, the risk of presbycusis was 15.2-fold more in individuals with mutant allele than subjects with wild genotype (P = .013). Individuals with NAT2*6A heterozygote allele had a 0.34-fold less risk in the development of presbycusis than subjects with mutant allele (P = .032) We demonstrated a significant association between the NAT2*6A polymorphism and age-related hearing loss in this population. However, the sample size was relatively small, and further studies need to investigate the exact role of NAT2 gene polymorphism in the etiopathogenesis of the presbycusis.

  5. Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression. (United States)

    Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud


    Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

  6. Gene polymorphisms and increased DNA damage in morbidly obese women. (United States)

    Luperini, B C O; Almeida, D C; Porto, M P; Marcondes, J P C; Prado, R P; Rasera, I; Oliveira, M R M; Salvadori, D M F


    Obesity is characterized by increased adipose tissue mass resulting from a chronic imbalance between energy intake and expenditure. Furthermore, there is a clearly defined relationship among fat mass expansion, chronic low-grade systemic inflammation and reactive oxygen species (ROS) generation; leading to ROS-related pathological events. In the past years, genome-wide association studies have generated convincing evidence associating genetic variation at multiple regions of the genome with traits that reflect obesity. Therefore, the present study aimed to evaluate the relationships among the gene polymorphisms ghrelin (GHRL-rs26802), ghrelin receptor (GHSR-rs572169), leptin (LEP-rs7799039), leptin receptor (LEPR-rs1137101) and fat mass and obesity-associated (FTO-rs9939609) and obesity. The relationships among these gene variants and the amount of DNA damage were also investigated. Three hundred Caucasian morbidly obese and 300 eutrophic (controls) women were recruited. In summary, the results demonstrated that the frequencies of the GHRL, GHSR, LEP and LEPR polymorphisms were not different between Brazilian white morbidly obese and eutrophic women. Exceptions were the AA-FTO genotype and allele A, which were significantly more frequent in obese women than in the controls (0.23% vs. 0.10%; 0.46 vs. 0.36, respectively), and the TT-FTO genotype and the T allele, which were less frequent in morbidly obese women (p<0.01). Furthermore, significant differences in the amount of genetic lesions associated with FTO variants were observed only in obese women. In conclusion, this study demonstrated that the analyzed SNPs were not closely associated with morbid obesity, suggesting they are not the major contributors to obesity. Therefore, our data indicated that these gene variants are not good biomarkers for predicting risk susceptibility for obesity, whereas ROS generated by the inflammatory status might be one of the causes of DNA damage in obese women, favoring

  7. Association between Polymorphisms in Antioxidant Genes and Inflammatory Bowel Disease.

    Directory of Open Access Journals (Sweden)

    Cristiana Costa Pereira

    Full Text Available Inflammation is the driving force in inflammatory bowel disease (IBD and its link to oxidative stress and carcinogenesis has long been accepted. The antioxidant system of the intestinal mucosa in IBD is compromised resulting in increased oxidative injury. This defective antioxidant system may be the result of genetic variants in antioxidant genes, which can represent susceptibility factors for IBD, namely Crohn's disease (CD and ulcerative colitis (UC. Single nucleotide polymorphisms (SNPs in the antioxidant genes SOD2 (rs4880 and GPX1 (rs1050450 were genotyped in a Portuguese population comprising 436 Crohn's disease and 367 ulcerative colitis patients, and 434 healthy controls. We found that the AA genotype in GPX1 is associated with ulcerative colitis (OR = 1.93, adjusted P-value = 0.037. Moreover, we found nominal significant associations between SOD2 and Crohn's disease susceptibility and disease subphenotypes but these did not withstand the correction for multiple testing. These findings indicate a possible link between disease phenotypes and antioxidant genes. These results suggest a potential role for antioxidant genes in IBD pathogenesis and should be considered in future association studies.

  8. [Prevalence of gene polymorphisms associated with immune-dependent diseases in the populations of North Eurasia]. (United States)

    Cherednichenko, A A; Trifonova, E A; Vagaitseva, K V; Bocharova, A V; Varzari, A M; Radzhabov, M O; Stepanov, V A


    The data on distribution of genetic diversity in gene polymorphisms associated with autoimmune and allergic diseases and with regulation of immunoglobulin E and cytokines levels in 26 populations of the Northern Eurasia is presented. Substantial correlation between the values of average expected heterozygosity by 44 gene polymorphisms with climatic and geographical factors has not been revealed. Clustering of population groups in correspondence with their geographic locations is observed. The degree of gene differentiation among populations and the selective neutrality of gene polymorphisms have been assessed. The results of our work evidence the substantial genetic diversity and differentiation of human populations by studied genes.

  9. Gene Expression and Polymorphism of Myostatin Gene and its Association with Growth Traits in Chicken. (United States)

    Dushyanth, K; Bhattacharya, T K; Shukla, R; Chatterjee, R N; Sitaramamma, T; Paswan, C; Guru Vishnu, P


    Myostatin is a member of TGF-β super family and is directly involved in regulation of body growth through limiting muscular growth. A study was carried out in three chicken lines to identify the polymorphism in the coding region of the myostatin gene through SSCP and DNA sequencing. A total of 12 haplotypes were observed in myostatin coding region of chicken. Significant associations between haplogroups with body weight at day 1, 14, 28, and 42 days, and carcass traits at 42 days were observed across the lines. It is concluded that the coding region of myostatin gene was polymorphic, with varied levels of expression among lines and had significant effects on growth traits. The expression of MSTN gene varied during embryonic and post hatch development stage.

  10. Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes

    Directory of Open Access Journals (Sweden)

    van Oost Bernard A


    Full Text Available Abstract Background Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. Results We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. α-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan δ, titin cap, α-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. Conclusion The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.

  11. Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes. (United States)

    Wiersma, Anje C; Leegwater, Peter Aj; van Oost, Bernard A; Ollier, William E; Dukes-McEwan, Joanna


    Dilated cardiomyopathy is a myocardial disease occurring in humans and domestic animals and is characterized by dilatation of the left ventricle, reduced systolic function and increased sphericity of the left ventricle. Dilated cardiomyopathy has been observed in several, mostly large and giant, dog breeds, such as the Dobermann and the Great Dane. A number of genes have been identified, which are associated with dilated cardiomyopathy in the human, mouse and hamster. These genes mainly encode structural proteins of the cardiac myocyte. We present the annotation of, and marker development for, 14 of these genes of the dog genome, i.e. alpha-cardiac actin, caveolin 1, cysteine-rich protein 3, desmin, lamin A/C, LIM-domain binding factor 3, myosin heavy polypeptide 7, phospholamban, sarcoglycan delta, titin cap, alpha-tropomyosin, troponin I, troponin T and vinculin. A total of 33 Single Nucleotide Polymorphisms were identified for these canine genes and 11 polymorphic microsatellite repeats were developed. The presented polymorphisms provide a tool to investigate the role of the corresponding genes in canine Dilated Cardiomyopathy by linkage analysis or association studies.

  12. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

    Directory of Open Access Journals (Sweden)

    Bin Tang


    Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

  13. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  14. Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

    International Nuclear Information System (INIS)

    Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.


    Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

  15. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang


    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  16. Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

    Directory of Open Access Journals (Sweden)

    Jianrong Wang


    Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

  17. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide. (United States)

    Jain, Parul; Tar'an, Bunyamin


    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  18. Preconception Screening for Gene Polymorphisms Associated with Thrombophilia and Hyperhomocysteinemia Risk in Healthy Young Women

    Directory of Open Access Journals (Sweden)

    Elena Yu. Glotova


    Full Text Available The frequency characteristics of the gene polymorphisms (FVL G1691A, FII G20210A, MTHFR C677T, MTHFR A1298C, MTRR A66G associated with thrombophilia, hyperhomocysteinemia risk and different perinatal or pregnancy complications were studied. This examination was conducted among 130 planned-pregnancy healthy young women aged between 19 and 29 years. A gene mutation analysis was performed using a real-time polymerase chain reaction (real-time PCR. Factor V Leiden (FVL G1691A and prothrombin gene (FII G20210A mutations were not identified in the women surveyed. The frequency of the occurrence of the heterozygous FVL 1691G/A genotype associated with the risk of thrombosis during pregnancy was very low in these women (0.8%. The frequency of the MTHFR (methylenetetrahydrofolate reductase 1298C/С mutant genotype was 11.5%, MTHFR 677T/Т – 5.4%, and MTRR (methionine synthase reductase 66G/G – 31.5%. A combination of the MTHFR 677TT/1298CC and MTHFR 677TТ/MTRR 66GG mutant genotypes, which significantly increased the risk of pregnancy loss and neural tube defects, were found to occur in 0.8% of the cases.We concluded that selective thrombophilia screening (FVL G1691A and FII G20210A based on prior personal and/or family history of venous thromboembolism was more cost-effective than a universal preconception screening in all planning pregnancy women. However, in order to decrease the risk of congenital anomalies and pregnancy complications associated with folate dependent homocysteine metabolism, preconception care should include folate supplementation

  19. IL6 gene promoter polymorphisms and type 2 diabetes

    DEFF Research Database (Denmark)

    Huth, Cornelia; Heid, Iris M; Vollmert, Caren


    Several lines of evidence indicate a causal role of the cytokine interleukin (IL)-6 in the development of type 2 diabetes in humans. Two common polymorphisms in the promoter of the IL-6 encoding gene IL6, -174G>C (rs1800795) and -573G>C (rs1800796), have been investigated for association with type...... 2 diabetes in numerous studies but with results that have been largely equivocal. To clarify the relationship between the two IL6 variants and type 2 diabetes, we analyzed individual data on >20,000 participants from 21 published and unpublished studies. Collected data represent eight different...... countries, making this the largest association analysis for type 2 diabetes reported to date. The GC and CC genotypes of IL6 -174G>C were associated with a decreased risk of type 2 diabetes (odds ratio 0.91, P = 0.037), corresponding to a risk modification of nearly 9%. No evidence for association was found...

  20. Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

    Directory of Open Access Journals (Sweden)

    Lin-Hui Gao


    Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

  1. Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco. (United States)

    Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu


    Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

  2. Methylenetetrahy-drofolate Reductase Gene Polymorphism in Patients Receiving Hemodialysis

    Directory of Open Access Journals (Sweden)

    Ermina Kiseljaković


    Full Text Available Methylenetetrahydrofolate Reductase (MTHFR is key enzyme in metabolism of homocysteine. Homozygotes for mutation (TT genotype have hyperhomocysteinemia, risk factor for atherosclerosis development. The aim of the study was to find out distribution of genotype frequencies of C677T MTHFR among patients on maintenance hemodialysis. Possible association of alleles and genotypes of C677T polymorphism of the MTHFR gene with age of onset, duration of dialysis and cause of kidney failure was studied also. Cross-sectional study includes 80 patients from Clinic of Hemodialysis KUCS in Sarajevo. In order to perform genotyping, isolated DNA was analyzed by RFLP-PCR and gel-electrophoresis. From total of 80 patients, 42.5% (n=24 were female, 57.5% (n=46 were male, mean age 54.59±1.78 years and duration of dialysis 79.92±6.32 months. Genotype distribution was: CC 51.2% (n=41, CT 37.5% (n=30 and TT 11.2% (n=9. Patients with wild-type genotype have longer duration of dialysis in month (87.1 ± 63.93 comparing to TT genotype patients (67.06 ± 39.3, with no statistical significance. T allele frequency was significantly higher in group of vascular and congenital cause of kidney failure (Pearson X2 =6.049, P<0.05 comparing to inflammation etiology group. Genotype distribution results are within the results other studies in Europe. Obtained results indicate that C677T polymorphism is not associated with onset, duration and cause of kidney failure in our hemodialysis population. There is an association of T allele of the MTHFR gene and vascular and congenital cause kidney failure.


    Directory of Open Access Journals (Sweden)

    Zh.P. Sharnova


    Full Text Available To investigate the role of the reninangiotensin system genes polymorphisms in develop and progression of nephrotic syndrom (NS in children we determined the genotypes of angiotensin converting enzyme (ACE, angiotensinogen (AGT and angiotensin ii receptor (ATII-R of 1 type in 80 russian children with ns including and 15 children with chronic renal failure (CRF. Genotype frequencies did not differ between patients with ns and controls (n = 165. The distribution of ace, AGT and ATII-R 1 type genotypes was similar among ns sub groups, such as focal segmental glomerulosclerosis (FSGS (n = 18, steroid-sensitive nephrotic syndrome (n = 32, nephrotic syndrome with hypertension and hemoturia (n = 22 and with control group. When ns subjects with CRF (n = 15 were compared with control, the prevalence of ace DD genotype was significantly higher (47% VS 21%; χ2 = 4,44; p < 0,05. Our results indicate that the DD genotype ace may be a factor of risk for the dеvеlopment of progressive renal impairment in the children with nephrotic syndrome. The analysis of treatment's effect with inhibitor of ace in groups patients with steroid resistant NS (SRNS demonstrated decreasing of renoprotective effect of this drugs in patients with id and dd genotypes com? Pared with ii genotype: the degree of blood pressure, proteinuria and the rate of glomerular filtration decrease was significantly lower (55,46 ± 9,25 VS 92,74 ± 25; р < 0,05 in these patients.Key words: nephrotic syndrom, chronic renal failure, polymorphism of genes, renin-angiotensin system.


    Directory of Open Access Journals (Sweden)

    R. Saikhom


    Full Text Available The present study was carried out with an aim to investigate the genetic variability of growth hormone gene in Haringhata Black chicken. Blood samples were collected from 82 experimental birds and genomic DNA was extracted using the modified high salt method. Amplification of specific DNA fragment of intron 4 of growth hormone gene yielded a product size of 713 bp and was analyzed for polymorphism using PCR-SSCP technique. The banding pattern of present investigation revealed two SSCP variants AA and BB genotype in all experimental birds. In the analysed flock of Haringhata Black Chicken, the genotype frequencies were found to be 0.915 for AA and 0.085 for BB genotype. The frequencies of A and B alleles were 0.915 and 0.085 respectively which indicated A allele was predominant in the studied Haringhata Black Chicken population of the farm. The Chi Square Test revealed that studied population was not in accordance with Hardy Weinberg equilibrium with respect to intron 4 of Growth hormone gene.

  5. Cloning and Polymorphisms of Yak Lactate Dehydrogenase b Gene

    Directory of Open Access Journals (Sweden)

    Yaou Xu


    Full Text Available The main objective of this work was to study the unique polymorphisms of the lactate dehydrogenase-1 (LDH1 gene in yak (Bos grunniens. Native polyacrylamide gel electrophoresis revealed three phenotypes of LDH1 (a tetramer of H subunit in yak heart and longissimus muscle extracts. The corresponding gene, ldhb, encoding H subunits of three LDH1 phenotypes was obtained by RT-PCR. A total of six nucleotide differences were detected in yak ldhb compared with that of cattle, of which five mutations cause amino acid substitutions. Sequence analysis shows that the G896A and C689A, mutations of ldhb gene, result in alterations of differently charged amino acids, and create the three phenotypes (F, M, and S of yak LDH1. Molecular modeling of the H subunit of LDH indicates that the substituted amino acids are not located within NAD+ or substrate binding sites. PCR-RFLP examination of G896A mutation demonstrated that most LDH1-F samples are actually heterozygote at this site. These results help to elucidate the molecular basis and genetic characteristic of the three unique LDH1 phenotypes in yak.

  6. A variant of the endothelial nitric oxide synthase gene (NOS3) associated with AMS susceptibility is less common in the Quechua, a high altitude Native population. (United States)

    Wang, Pei; Ha, Alice Y N; Kidd, Kenneth K; Koehle, Michael S; Rupert, Jim L


    Endothelial nitric oxide synthase (eNOS) is a vascular enzyme that produces nitric oxide, a transient signaling molecule that by vasodilatation regulates blood flow and pressure. Nitric oxide is believed to play roles in both short-term acclimatization and long-term evolutionary adaptation to environmental hypoxia. Several laboratories, including ours, have shown that variants in NOS3 (the gene encoding eNOS) are overrepresented in individuals with altitude-related illnesses such as high altitude pulmonary edema (HAPE) and acute mountain sickness (AMS), suggesting that NOS3 genotypes contribute to altitude tolerance. To further test our hypothesis that the G allele at the G894T polymorphism in NOS3 (dbSNP number: rs1799983; protein polymorphism Glu298Asp) is beneficial in hypoxic environments, we compared frequencies of this allele in an altitude-adapted Amerindian population, Quechua of the Andean altiplano, with those in a lowland Amerindian population, Maya of the Yucatan Peninsula. While common in both populations, the G allele was significantly more frequent in the highlanders. Taken together, our data suggest that this variant in NOS3, which has been previously associated with higher levels of nitric oxide, contributes to both acclimatization and adaptation to altitude.

  7. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K


    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  8. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression. (United States)

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M


    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  9. High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

    Directory of Open Access Journals (Sweden)

    Mariela V Catone

    Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

  10. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)


    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

  11. UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

    International Nuclear Information System (INIS)

    Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko


    Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

  12. The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton. (United States)

    Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan


    Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

  13. Nitric Oxide Synthase Type III Overexpression By Gene Therapy Exerts Antitumoral Activity In Mouse Hepatocellular Carcinoma

    Directory of Open Access Journals (Sweden)

    Raúl González


    Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.

  14. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email:; Gu, Ji-Dong [The University of Hong Kong (China)], email:


    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  15. Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

    International Nuclear Information System (INIS)

    Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.


    Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

  16. Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat. (United States)

    Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi


    Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.

  17. Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

    International Nuclear Information System (INIS)

    Ge Shimei; Xie Baoen; Chen Sanfeng


    The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

  18. New polymorphisms of Xeroderma Pigmentosum DNA repair genes in myelodysplastic syndrome. (United States)

    Santiago, Sabrina Pinheiro; Junior, Howard Lopes Ribeiro; de Sousa, Juliana Cordeiro; de Paula Borges, Daniela; de Oliveira, Roberta Taiane Germano; Farias, Izabelle Rocha; Costa, Marília Braga; Maia, Allan Rodrigo Soares; da Nóbrega Ito, Mayumi; Magalhães, Silvia Maria Meira; Pinheiro, Ronald Feitosa


    The association between Xeroderma Pigmentosum DNA repair genes (XPA rs1800975, XPC rs2228000, XPD rs1799793 and XPF rs1800067) polymorphisms and myelodysplastic syndrome (MDS) have not been reported. To assess the functional role between these polymorphisms and MDS, we evaluated 189 samples stratified in two groups: 95 bone marrow samples from MDS patients and 94 from healthy elderly volunteers used as controls. Genotypes for all polymorphisms were identified in DNA samples in an allelic discrimination experiment by real-time polymerase chain reaction (qPCR). We also studied the mRNA expression of XPA and XPC genes to evaluate if its polymorphisms were functional in 53 RNAm MDS patients by qPCR methodologies. To the rs2228000 polymorphism, the CT and TT polymorphic genotype were associated with increased odds ratio (OR) of more profound cytopenia (hemoglobin and neutrophils count). To the rs1799793 polymorphism, we found that the GG homozygous wild-type genotype was associated with a decreased chance of developing MDS. We observed low expression of XPA in younger patients, in hypoplastic MDS and patients with abnormal karyotype when presented AG or AA polymorphic genotypes. We also found that there was a statistically significant interaction between the presence of micromegakaryocyte on down regulation of XPC regarding the CT heterozygous genotype of the rs1800975 polymorphism. Our results suggest that new functional polymorphisms of Xeroderma Pigmentosum DNA repair genes in MDS are related to its pathogenesis and prognosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Geographical and Ethnic Distributions of the MTHFR C677T, A1298C and MTRR A66G Gene Polymorphisms in Chinese Populations: A Meta-Analysis.

    Directory of Open Access Journals (Sweden)

    Xingmin Wang

    Full Text Available The geographical and ethnic distributions of the polymorphic methylenetetrahydrofolate reductase (MTHFR mutations (C677T and A1298C and methionine synthase reductase (MTRR mutation (A66G remain heterogeneous in China. The goal of this study was to estimate the pooled frequencies of the alleles and associated genotypes of these gene polymorphisms among healthy populations in Mainland China.We systematically reviewed published epidemiological studies on the distributions of 3 genetic variants in Chinese healthy populations living in Mainland China through a meta-analysis. The relevant electronic databases were searched. All of the raw data of the eligible citations were extracted. The frequency estimates were stratified by geography, ethnicity and sex.Sixty-six studies were identified with a total of 92277 study participants. The meta-analysis revealed that the frequencies of the MTHFR C677T, A1298C, and MTRR A66G gene polymorphisms varied significantly between different ethnic groups and along geographical gradients. The frequencies of the 677T allele and 677TT genotype increased along the southern-central-northern direction across Mainland China (all Pvalues≤0.001. The frequencies of the 1298C, 1298CC, 66G and 66GG genotypes decreased along the south-central-north direction across the country (all Pvalues≤0.001.Our meta-analysis strongly indicates significant geographical and ethnic variations in the frequencies of the C677T, A1298C, and A66G gene polymorphisms in the folate metabolism pathway among Chinese populations.

  20. Genetic Analysis of the Atrial Natriuretic Peptide Gene Polymorphisms among Essential Hypertensive Patients in Malaysia

    Directory of Open Access Journals (Sweden)

    Nooshin Ghodsian


    Full Text Available Background. Atrial natriuretic peptide (ANP considerably influences blood pressure regulation through water and sodium homoeostasis. Several of the studies have utilized anonymous genetic polymorphic markers and made inconsequent claims about the ANP relevant disorders. Thus, we screened Insertion/Deletion (ID and G191A polymorphisms of ANP to discover sequence variations with potential functional significance and to specify the linkage disequilibrium pattern between polymorphisms. The relationships of detected polymorphisms with EH with or without Type 2 Diabetes Mellitus (T2DM status were tested subsequently. Method. ANP gene polymorphisms (I/D and A191G were specified utilizing mutagenically separated Polymerase Chain Reaction (PCR in 320 subjects including 163 EH case subjects and 157 controls. Result. This case-control study discovered a significant association between I/D polymorphisms of ANP gene in EH patient without T2DM. However, the study determined no association between G191A polymorphisms of ANP in EH with or without T2DM. In addition, sociodemographic factors in the case and healthy subjects exhibited strong differences (P<0.05. Conclusion. As a risk factor, ANP gene polymorphisms may affect hypertension. Despite the small sample size in this study, it is the first research assessing the ANP gene polymorphisms in both EH and T2DM patients among Malaysian population.

  1. Screening strategies for a highly polymorphic gene: DHPLC analysis of the Fanconi anemia group A gene. (United States)

    Rischewski, J; Schneppenheim, R


    Patients with Fanconi anemia (Fanc) are at risk of developing leukemia. Mutations of the group A gene (FancA) are most common. A multitude of polymorphisms and mutations within the 43 exons of the gene are described. To examine the role of heterozygosity as a risk factor for malignancies, a partially automatized screening method to identify aberrations was needed. We report on our experience with DHPLC (WAVE (Transgenomic)). PCR amplification of all 43 exons from one individual was performed on one microtiter plate on a gradient thermocycler. DHPLC analysis conditions were established via melting curves, prediction software, and test runs with aberrant samples. PCR products were analyzed twice: native, and after adding a WT-PCR product. Retention patterns were compared with previously identified polymorphic PCR products or mutants. We have defined the mutation screening conditions for all 43 exons of FancA using DHPLC. So far, 40 different sequence variations have been detected in more than 100 individuals. The native analysis identifies heterozygous individuals, and the second run detects homozygous aberrations. Retention patterns are specific for the underlying sequence aberration, thus reducing sequencing demand and costs. DHPLC is a valuable tool for reproducible recognition of known sequence aberrations and screening for unknown mutations in the highly polymorphic FancA gene.

  2. Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lydia J R Hunter

    Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

  3. 4G/5G Variant of Plasminogen Activator Inhibitor-1 Gene and Severe Pregnancy-Induced Hypertension: Subgroup Analyses of Variants of Angiotensinogen and Endothelial Nitric Oxide Synthase (United States)

    Kobashi, Gen; Ohta, Kaori; Yamada, Hideto; Hata, Akira; Minakami, Hisanori; Sakuragi, Noriaki; Tamashiro, Hiko; Fujimoto, Seiichiro


    Background Pregnancy-induced hypertension (PIH) is a common cause of perinatal mortality. It is believed to result from the interaction of several factors, including those related to the blood coagulation system. We performed genotyping and subgroup analyses to determine if the 4G/5G genotypes of the plasminogen activator inhibitor-1 gene (PAI-1) play a role in the pathogenesis of PIH, and to evaluate possible interactions of the PAI-1 polymorphisms with those of the angiotensinogen gene (AGT) and the endothelial nitric oxide synthase gene (NOS3). Methods An association study of PAI-1 polymorphism, and subgroup analyses of common variants of AGT and NOS3, among 128 patients with PIH and 376 healthy pregnant controls. Results No significant differences were found between the cases and controls in the frequencies of allele 4G or the 4G/4G genotype. In subgroup analyses, after adjustment for multiple comparison, a significant association with the AGT TT genotype was found among women with the PAI-1 4G/4G genotype, and an association with the NOS3 GA+AA genotype was found among women with the 5G/5G or 4G/5G genotypes. Conclusions Our findings suggest that there are at least 2 pathways in the pathogenesis of severe PIH. However, with respect to early prediction and prevention of severe PIH, although the PAI-1 4G/4G genotype alone was not a risk factor for severe PIH, the fact that PAI-1 genotypes are associated with varying risks for severe PIH suggests that PAI-1 genotyping of pregnant women, in combination with other tests, may be useful in the development of individualized measures that may prevent severe PIH. PMID:19838007

  4. Association of inflammatory gene polymorphisms with ischemic stroke in a Chinese Han population


    Zhao, Nan; Liu, Xin; Wang, Yongqin; Liu, Xiaoqiu; Li, Jiana; Yu, Litian; Ma, Liyuan; Wang, Shuyu; Zhang, Hongye; Liu, Lisheng; Zhao, Jingbo; Wang, Xingyu


    Abstract Background Inflammatory mechanisms are important in stroke risk, and genetic variations in components of the inflammatory response have been implicated as risk factors for stroke. We tested the inflammatory gene polymorphisms and their association with ischemic stroke in a Chinese Han population. Methods A total of 1,124 ischemic stroke cases and 1,163 controls were genotyped with inflammatory panel strips containing 51 selected inflammatory gene polymorphisms from 35 candidate genes...

  5. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase. (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J


    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  6. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  7. Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes. (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique


    Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

  8. Blood lead levels, iron metabolism gene polymorphisms and homocysteine: a gene-environment interaction study. (United States)

    Kim, Kyoung-Nam; Lee, Mee-Ri; Lim, Youn-Hee; Hong, Yun-Chul


    Homocysteine has been causally associated with various adverse health outcomes. Evidence supporting the relationship between lead and homocysteine levels has been accumulating, but most prior studies have not focused on the interaction with genetic polymorphisms. From a community-based prospective cohort, we analysed 386 participants (aged 41-71 years) with information regarding blood lead and plasma homocysteine levels. Blood lead levels were measured between 2001 and 2003, and plasma homocysteine levels were measured in 2007. Interactions of lead levels with 42 genotyped single-nucleotide polymorphisms (SNPs) in five genes ( TF , HFE , CBS , BHMT and MTR ) were assessed via a 2-degree of freedom (df) joint test and a 1-df interaction test. In secondary analyses using imputation, we further assessed 58 imputed SNPs in the TF and MTHFR genes. Blood lead concentrations were positively associated with plasma homocysteine levels (p=0.0276). Six SNPs in the TF and MTR genes were screened using the 2-df joint test, and among them, three SNPs in the TF gene showed interactions with lead with respect to homocysteine levels through the 1-df interaction test (plead levels. Blood lead levels were positively associated with plasma homocysteine levels measured 4-6 years later, and three SNPs in the TF gene modified the association. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  9. Effect of AGTR1 and BDKRB2 gene polymorphisms on atorvastatin metabolism in a Mexican population


    Herrera-González, Sarahí; Martínez-Treviño, Denisse Aideé; Aguirre-Garza, Marcelino; Gómez-Silva, Magdalena; Barrera-Saldaña, Hugo Alberto; León-Cachón, Rafael Baltazar Reyes


    Discrepancies in the response to drugs are partially due to polymorphisms in genes involved in drug metabolism and transport. The frequency, pattern and impact of these polymorphisms vary among populations. In the present study, the pharmacokinetics and pharmacogenetics of atorvastatin (ATV) in a Mexican population were investigated. The study cohort exhibited differing ATV metabolizing phenotypes, and in subsequent allelic discrimination assays, single nucleotide polymorphisms in the angiote...

  10. The Evaluation of IL6 and ESR1 Gene Polymorphisms in Primary Dysmenorrhea. (United States)

    Ozsoy, Asker Zeki; Karakus, Nevin; Yigit, Serbulent; Cakmak, Bulent; Nacar, Mehmet Can; Yılmaz Dogru, Hatice


    Primary dysmenorrhea is the most common gynecological complaint with painful menstrual cramps in pelvis without any pathology. It affects about half of menstruating women, and it causes significant disruption in quality of life. We investigated the association between IL6 gene promoter and ESR1 gene XbaI and PvuII polymorphisms and primary dysmenorrhea. In this case-control study, 152 unrelated young women with primary dysmenorrhea and 150 unrelated healthy age-matched controls participated. Genomic DNA was isolated and IL6 and ESR1 gene polymorphisms were genotyped using PCR-based RFLP assay. The distribution of genotype and allele frequencies of IL6 gene promoter and ESR1 gene XbaI polymorphisms were not statistically different between patients and controls (p > 0.05). However, the genotype and allele frequencies of ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls (p = 0.009 and p = 0.021, respectively). Statistically significant associations were also observed between age and married status of primary dysmenorrhea patients and ESR1 gene PvuII polymorphism (p = 0.044 and p = 0.023, respectively). In combined genotype analyses, AG at ESR1 XbaI and TC at ESR1 PvuII loci encoded a p-value of 0.027. Thus, individuals who are heterozygote at both loci have a lower risk of developing primary dysmenorrhea. Our study suggests no strong association between IL6 gene promoter and ESR1 gene XbaI polymorphisms and primary dysmenorrhea in Turkish women. However, ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls. The potential association between ESR1 gene PvuII polymorphism and age and married status of dysmenorrhea patients deserves further consideration.

  11. Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance. (United States)

    Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A


    Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

  12. The effects of gene polymorphisms on glioma prognosis. (United States)

    Cui, Ying; Li, Guolin; Yan, Mengdan; Li, Jing; Jin, Tianbo; Li, Shanqu; Mu, Shijie


    Malignant gliomas are the most common primary brain tumors. Various genetic factors play important roles in the development and prognosis of glioma. The present study focuses on the impact of MPHOSPH6, TNIP1 and several other genes (ACYP2, NAF1, TERC, TERT, OBFC1, ZNF208 and RTEL1) on telomere length and how this affects the prognosis of glioma. Forty-three polymorphisms in nine genes from 605 glioma patients were selected. The association between genotype and survival outcome was analyzed using the Kaplan-Meier method, Cox regression analysis and the log-rank test. The 1-year overall survival (OS) rates of patients younger than 40 years of age was higher compared to those in patients older than 40 years of age. The 1-year OS rate of patients who underwent total resection was higher than that of patients whose gliomas were not completely resected. The 1-year OS rates of patients undergoing chemotherapy and of patients who did not undergo chemotherapy were 39.90% and 26.80%, respectively. Univariate analyses showed that ACYP2 rs12615793 and TERT rs2853676 loci affected progression-free survival in glioma patients; both ZNF208 rs8105767 and ACYP2 rs843720 affected the OS of patients with low-grade gliomas. Multivariate analyses suggested that MPHOSPH6 rs1056629 and rs1056654, and TERT rs2853676 loci were associated with good prognoses of patients with glioma or high-grade gliomas, whereas ZNF208 rs8105767 was associated with good prognosis of patients with low-grade glioma. Age, surgical resection and chemotherapy influenced the survival rates of glioma patients. TERT, MPHOSPH6, ACYP2 and ZNF208 genes were found to affect glioma prognosis. Copyright © 2017 John Wiley & Sons, Ltd.

  13. [Polymorphism of vitamin D receptor gene Fok I in Mongolian population of China]. (United States)

    Xing, Shao-ji; Zhou, Li-she; Xu, Xiu-ju


    To investigate the polymorphism distribution of vitamin D receptor (VDR) gene Fok I in Mongolian population of China. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used to analyze three genotypes FF, Ff and ff in the start codon of VDR gene (Fok I) in unrelated normal healthy Mongolian individuals of China. In the population, we obtained the allelic frequencies of 57% and 43% for (F) and (f) allele and the percentage of genotypes FF, Ff and ff to be 31%, 52%, and 17% respectively. The polymorphism frequency and distribution of this VDR gene Fok I in Mongolian population of China exhibit its own characteristics.

  14. Angiotensinogen and ACE gene polymorphisms and risk of atrial fibrillation in the general population

    DEFF Research Database (Denmark)

    Ravn, Lasse Steen; Benn, Marianne; Nordestgaard, Børge


    Objectives The renin-angiotensin system may play a role in the pathogenesis of atrial fibrillation, and renin-angiotensin system blockers reduce the risk of atrial fibrillation. We hypothesized that polymorphisms in the angiotensinogen and angiotensin-converting enzyme (ACE) genes encoding proteins...... in this system predict risk of atrial fibrillation. Methods and results We genotyped 9235 individuals from the Danish general population, The Copenhagen City Heart Study, for the a-20c, g-6a, T174M, and M235T polymorphisms in the angiotensinogen gene and the insertion/deletion (I/D) polymorphism in the ACE gene...

  15. A multilevel prediction of physiological response to challenge: Interactions among child maltreatment, neighborhood crime, endothelial nitric oxide synthase gene (eNOS), and GABA(A) receptor subunit alpha-6 gene (GABRA6). (United States)

    Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante


    Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.

  16. Gene polymorphisms as risk factors for predicting the cardiovascular manifestations in Marfan syndrome. Role of folic acid metabolism enzyme gene polymorphisms in Marfan syndrome. (United States)

    Benke, Kálmán; Ágg, Bence; Mátyás, Gábor; Szokolai, Viola; Harsányi, Gergely; Szilveszter, Bálint; Odler, Balázs; Pólos, Miklós; Maurovich-Horvat, Pál; Radovits, Tamás; Merkely, Béla; Nagy, Zsolt B; Szabolcs, Zoltán


    Folic acid metabolism enzyme polymorphisms are believed to be responsible for the elevation of homocysteine (HCY) concentration in the blood plasma, correlating with the pathogenesis of aortic aneurysms and aortic dissection. We studied 71 Marfan patients divided into groups based on the severity of cardiovascular involvement: no intervention required (n=27, Group A); mild involvement requiring intervention (n=17, Group B); severe involvement (n=27, Group C) subdivided into aortic dilatation (n=14, Group C1) and aortic dissection (n=13, Group C2), as well as 117 control subjects. We evaluated HCY, folate, vitamin B12 and the polymorphisms of methylenetetrahydrofolate reductase (MTHFR;c.665C>T and c.1286A>C), methionine synthase (MTR;c.2756A>G) and methionine synthase reductase (MTRR;c.66A>G). Multiple comparisons showed significantly higher levels of HCY in Group C2 compared to Groups A, B, C1 and control group (pMarfan patients, and especially aortic dissection, is associated with higher HCY plasma levels and prevalence of homozygous genotypes of folic acid metabolism enzymes than mild or no cardiovascular involvement. These results suggest that impaired folic acid metabolism has an important role in the development and remodelling of the extracellular matrix of the aorta.

  17. Significant association of interleukin-4 gene intron 3 VNTR polymorphism with susceptibility to knee osteoarthritis. (United States)

    Yigit, Serbulent; Inanir, Ahmet; Tekcan, Akın; Tural, Ercan; Ozturk, Gokhan Tuna; Kismali, Gorkem; Karakus, Nevin


    Interleukin-4 (IL-4) is a strong chondroprotective cytokine and polymorphisms within this gene may be a risk factor for osteoarthritis (OA). We aimed to investigate genotype and allele frequencies of IL-4 gene intron 3 variable number of tandem repeats (VNTR) polymorphism in patients with knee OA in a Turkish population. The study included 202 patients with knee OA and 180 healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers followed by restriction fragment length polymorphism (RFLP) analysis. Our result show that there was statistically significant difference between knee OA patients and control group with respect to IL-4 genotype distribution and allele frequencies (p=0.000, OR: 0.20, 95% CI: 0.10-0.41, OR: 0.22, 95% CI: 0.12-0.42, respectively). Our findings suggest that there is an association of IL-4 gene intron 3 VNTR polymorphism with susceptibility of a person for development of knee OA. As a result, IL-4 gene intron 3 VNTR polymorphism could be a genetic marker in OA in a Turkish study population. This is the first association study that evaluates the associations between IL-4 gene VNTR polymorphism and knee OA. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  18. The (CTGn polymorphism in the NOTCH4 gene is not associated with schizophrenia in Japanese individuals

    Directory of Open Access Journals (Sweden)

    Okubo Takehito


    Full Text Available Abstract Background The human NOTCH4 gene is a candidate gene for schizophrenia due to its chromosomal location and neurobiological roles. In a British linkage study, NOTCH4 gene polymorphisms were highly associated with schizophrenia. In a Japanese case-control association study, however, these polymorphisms did not show significant associations with schizophrenia. We conducted a case-control study with Japanese subjects to explore an association between the triplet repeat polymorphism in the NOTCH4 gene and schizophrenia, including subtypes of schizophrenia, longitudinal disease course characteristics, and a positive family history for psychoses. Methods We examined the (CTGn repeat polymorphism in the NOTCH4 gene among 100 healthy Japanese individuals and 102 patients with schizophrenia (22 paranoid, 38 disorganized, 29 residual, 64 episodic, 31 continuous, 42 with prominent negative symptoms, and 46 with positive family histories using a polymerase chain reaction-based, single-strand conformational polymorphism analysis. Results Five different alleles consisting of 6, 9, 10, 11, and 13 repeats of CTG (Leu in patients with schizophrenia, and 4 alleles consisting of 6, 9, 10, and 11 repeats in controls were found. No significant differences in genotype or allele frequencies of repeat numbers were found between controls and patients. In addition, there were no associations between the polymorphism and schizophrenia subtypes, longitudinal disease course characteristics, or positive family history of the patients. Conclusions Our data suggest a lack of association between the NOTCH4 gene triplet repeat polymorphism and schizophrenia in Japanese individuals.

  19. Cytokine Gene Polymorphisms across Tuberculosis Clinical Spectrum in Pakistani Patients (United States)

    Ansari, Ambreen; Talat, Najeeha; Jamil, Bushra; Hasan, Zahra; Razzaki, Tashmeem; Dawood, Ghaffar; Hussain, Rabia


    Background Pakistan ranks 7th globally in terms of tuberculosis (TB) disease burden (incidence 181/100000 pop./yr; prevalence of 329/pop./yr). Reports from different populations show variable associations of TB susceptibility and severity with cytokine gene polymorphisms. Tuberculosis clinical severity is multi-factorial and cytokines play a pivotal role in the modulation of disease severity. We have recently reported that the ratio of two key cytokines (IFNγ and IL10) show significant correlation with the severity spectrum of tuberculosis. The objective of the current study was to analyze the frequency of cytokine gene polymorphisms linked to high and low responder phenotypes (IFNγ +874 T hi→A lo and IL10 −1082 G lo→A hi) in tuberculosis patients. Methods and Findings Study groups were stratified according to disease site as well as disease severity: Pulmonary N = 111 (Minimal, PMN = 19; Moderate, PMD = 63; Advance, PAD = 29); Extra-pulmonary N = 67 (Disseminated DTB = 20, Localized LTB = 47) and compared with healthy controls (TBNA = 188). Genotype analyses were carried out using amplification refractory mutation system-PCR (ARMS-PCR) and stimulated whole blood (WB) culture assay was used for assessing cytokine profiles. Our results suggest that the IFNγ +874 TT genotype and T allele was overrepresented in PMN (p = 0.01) and PMD (p = 0.02). IFNγ +874 TT in combination with IL10 GG lo genotypes showed the highest association (χ2 = 6.66, OR = 6.06, 95% CI = 1.31–28.07, p = 0.01). IFNγ AA lo on the other hand in combination with IL10 GG lo increased the risk of PAD (OR = 5.26; p = 0.005) and DTB (OR = 3.59; p = 0.045). Conclusion These findings are consistent with the role of IL10 in reducing collateral tissue damage and the protective role of IFNγ in limiting disease in the lung. PMID:19274101

  20. RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

    Directory of Open Access Journals (Sweden)

    Smrati Mishra

    Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

  1. Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon. (United States)

    Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori


    Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Nucleotide variability in the 5-enolpyruvylshikimate-3-phosphate synthase gene from Eleusine indica (L.) Gaertn. (United States)

    Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S


    This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.

  3. Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene. (United States)

    Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E


    Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.

  4. Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes. (United States)

    González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique


    Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

  5. Relationship between IL-10 gene -819C/T polymorphism and the ...

    African Journals Online (AJOL)

    Background: The -819C/T polymorphism in interleukin 10 (IL-10) gene has been reported to be associated with inflammatory bowel disease (IBD) ,but the previous results are conflicting. Materials and methods: The present study aimed at investigating the association between this polymorphism and risk of IBD using a ...

  6. Polymorphism of glucagon-like peptide-1 receptor gene (rs1042044 ...

    African Journals Online (AJOL)



    Feb 16, 2015 ... turnover via GLP-1 receptors (GLP1Rs) in postmenopausal state. Furthermore, polymorphisms in. GLP1R gene were suggested to affect the function of GLP1Rs and be associated with many diseases. However, the relationships between GLP1R polymorphisms and osteoporosis susceptibility and bone.

  7. Polymorphisms in Dopamine System Genes Are Associated with Individual Differences in Attention in Infancy (United States)

    Holmboe, Karla; Nemoda, Zsofia; Fearon, R. M. Pasco; Csibra, Gergely; Sasvari-Szekely, Maria; Johnson, Mark H.


    Knowledge about the functional status of the frontal cortex in infancy is limited. This study investigated the effects of polymorphisms in four dopamine system genes on performance in a task developed to assess such functioning, the Freeze-Frame task, at 9 months of age. Polymorphisms in the catechol-O-methyltransferase ("COMT") and the…

  8. Polymorphisms of the prion protein gene Arabi sheep breed in Iran ...

    African Journals Online (AJOL)

    Ovine scrapie is a neurodegenerative disease caused by polymorphisms of the prion protein gene (Prnp); especially the amino acid residue alterations at codons 136, 154, and 174, in sheep have been found to be associated with susceptibility to scrapie disease. We studied Prnp polymorphisms in local sheep of ...

  9. Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J


    Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

  10. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.


    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  11. A Malus crabapple chalcone synthase gene, McCHS, regulates red petal color and flavonoid biosynthesis.

    Directory of Open Access Journals (Sweden)

    Deqiang Tai

    Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.

  12. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.


    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

  13. A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

    NARCIS (Netherlands)

    Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.


    Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

  14. Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

    Directory of Open Access Journals (Sweden)

    Xiudao Yu


    Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

  15. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  16. Influence of FCGRT gene polymorphisms on pharmacokinetics of therapeutic antibodies. (United States)

    Passot, Christophe; Azzopardi, Nicolas; Renault, Sylvaine; Baroukh, Nadine; Arnoult, Christophe; Ohresser, Marc; Boisdron-Celle, Michèle; Gamelin, Erick; Watier, Hervé; Paintaud, Gilles; Gouilleux-Gruart, Valérie


    The neonatal Fc receptor (FcRn) encoded by FCGRT is known to be involved in the pharmacokinetics (PK) of therapeutic monoclonal antibodies (mAbs). Variability in the expression of FCGRT gene and consequently in the FcRn protein level could explain differences in PK observed between patients treated with mAbs. We studied whether the previously described variable number tandem repeat (VNTR) or copy number variation (CNV) of FCGRT are associated with individual variations of PK parameters of cetuximab. VNTR and CNV were assessed on genomic DNA of 198 healthy individuals and of 94 patients treated with the therapeutic mAb. VNTR and CNV were analyzed by allele-specific PCR and duplex real-time PCR with Taqman (®) technology, respectively. The relationship between FCGRT polymorphisms (VNTR and CNV) and PK parameters of patients treated with cetuximab was studied. VNTR3 homozygote patients had a lower cetuximab distribution clearance than VNTR2/VNTR3 and VNTR3/VNTR4 patients (p = 0.021). We observed no affects of VNTR genotype on elimination clearance. One healthy person (0.5%) and 1 patient (1.1%) had 3 copies of FCGRT. The PK parameters of this patient did not differ from those of patients with 2 copies. The FCGRT promoter VNTR may influence mAbs' distribution in the body. CNV of FCGRT cannot be used as a relevant pharmacogenetic marker because of its low frequency.

  17. emm Gene Polymorphism among Streptococcus pyogenes Isolated from

    Directory of Open Access Journals (Sweden)

    Mollaii Hamid


    Full Text Available DNA sequencing is the most conclusive method for emm (M protein gene typing of Streptococcus pyogenes. This method is not a feasible approach in developing countries where streptococcal infection is widespread among adults and children. Alternatively the PCR-RFLP has the potential for rapid screening of different types of S. pyogenes. To document the emm type distribution of S. pyogenes in a group of patients suffering from pharyngitis, the restriction fragment length polymorphism (RFLP profile of 50 isolates were analyzed. By using Hae III+ HincII (double digestion and Dde I restriction enzymes and based on RFLP, the profile patterns of the isolates were compared. The analysis of data identified 15 distinct RFLP patterns for Hae III+ Hinc II and 13 patterns for Dde I. They differ from each other by at least one band. Although the number of isolates was not sufficient to make any epidemiological conclusion, but the finding demonstrated that the S. pyogenes population among pateints was heterogeneous. Regarding the PCR method, we managed to improve the results by modification of CDC protocol in three different ways. This study was conducted in normal circumstances when pharyngitis was at the peak seasonal incident. However emm amplicon restriction digest analysis is a valuable tool for rapid analysis of S. pyogenes infection in more important situation like outbreaks and in selected type of study like consideration of nosocomial infection.

  18. Association of ghrelin receptor gene polymorphism with bulimia nervosa in a Japanese population. (United States)

    Miyasaka, K; Hosoya, H; Sekime, A; Ohta, M; Amono, H; Matsushita, S; Suzuki, K; Higuchi, S; Funakoshi, A


    Eating disorders (EDs) have a highly heterogeneous etiology and multiple genetic factors might contribute to their pathogenesis. Ghrelin, a novel growth hormone-releasing peptide, enhances appetite and increases food intake, and human ghrelin plasma levels are inversely correlated with body mass index. In the present study, we examined the 171T/C polymorphism of the ghrelin receptor (growth hormone secretagogue receptor, GHSR) gene in patients diagnosed with EDs, because the subjects having ghrelin gene polymorphism (Leu72Met) was not detected in a Japanese population, previously. In addition, beta3 adrenergic receptor gene polymorphism (Try64Arg) and cholecystokinin (CCK)-A receptor (R) gene polymorphism (-81A/G, -128G/T), which are both associated with obesity, were investigated. The subjects consisted of 228 Japanese patients with EDs [96 anorexia nervosa (AN), 116 bulimia nervosa (BN) and 16 not otherwise specified (NOS)]. The age- and gender-matched control group consisted of 284 unrelated Japanese subjects. The frequency of the CC type of the GHSR gene was significantly higher in BN subjects than in control subjects (chi(2) = 4.47, p = 0.035, odds ratio = 2.05, Bonferroni correction: p = 0.070), while the frequency in AN subjects was not different from that in controls. The distribution of neither beta3 adrenergic receptor gene nor CCK-AR polymorphism differed between EDs and control subjects. Therefore, the CC type of GHSR gene polymorphism (171T/C) is a risk factor for BN, but not for AN.

  19. Association of ACE Gene I/D polymorphism with migraine in Kashmiri population. (United States)

    Wani, Irfan Yousuf; Sheikh, Saleem; Shah, Zafar Amin; Pandith, Arshid A; Wani, Mushtaq; Asimi, Ravouf; Wani, Maqbool; Sheikh, Shahnawaz; Mehraj, Iqra


    Migraine is a complex, recurrent headache disorder that is one of the most common complaints in neurology practice. The role of various genes in its pathogenesis is being studied. We did this study to see whether an association exists between ACE gene I/D polymorphism and migraine in our region. The study included 100 patients diagnosed with migraine and 121 healthy controls. The study subject were age and gender matched. The analysis was based on Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length Polymorphism (RFLP). Out of 100 cases, 69 were females and 31 were males. Fifty-seven were having migraine without aura and 43 had migraine with aura. 45 of the cases had II polymorphism, 40 had ID polymorphism and 15 had DD polymorphism in ACE gene. We were not able to find a statistically significant association between ACE gene I/D polymorphism with migraine. The reason for difference in results between our study and other studies could be because of different ethnicity in study populations. So a continuous research is needed in this regard in order to find the genes and different polymorphism that increase the susceptibility of Kashmiri population to migraine.

  20. Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production. (United States)

    Oberding, Lisa K; Gieg, Lisa M


    Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

  1. The β fibrinogen gene G-455A polymorphism in Asian subjects with ...

    African Journals Online (AJOL)

    Jonny Karunia Fajar


    Aug 10, 2016 ... Conclusions: In the Asian population, the b fibrinogen gene G-455A polymorphism was associ- ..... Kazakhstan, Kuwait, Kyrgyzstan, Laos, Lebanon, Malaysia, ... Thailand, Timor-Leste, Turkey, Turkmenistan, United Arab.

  2. Role of TLR4 gene polymorphisms in the colorectal cancer risk ...

    African Journals Online (AJOL)

    Role of TLR4 gene polymorphisms in the colorectal cancer risk modulation in ethnic Kashmiri population – A case–control study. Saniya Nissar, Aga Syed Sameer, Roohi Rasool, Qurteeba Qadri, Nissar A. Chowdri, Fouzia Rashid ...

  3. Androgen Receptor Gene Polymorphism, Aggression, and Reproduction in Tanzanian Foragers and Pastoralists (United States)

    Butovskaya, Marina L.; Lazebny, Oleg E.; Vasilyev, Vasiliy A.; Dronova, Daria A.; Karelin, Dmitri V.; Mabulla, Audax Z. P.; Shibalev, Dmitri V.; Shackelford, Todd K.; Fink, Bernhard; Ryskov, Alexey P.


    The androgen receptor (AR) gene polymorphism in humans is linked to aggression and may also be linked to reproduction. Here we report associations between AR gene polymorphism and aggression and reproduction in two small-scale societies in northern Tanzania (Africa)—the Hadza (monogamous foragers) and the Datoga (polygynous pastoralists). We secured self-reports of aggression and assessed genetic polymorphism of the number of CAG repeats for the AR gene for 210 Hadza men and 229 Datoga men (aged 17–70 years). We conducted structural equation modeling to identify links between AR gene polymorphism, aggression, and number of children born, and included age and ethnicity as covariates. Fewer AR CAG repeats predicted greater aggression, and Datoga men reported more aggression than did Hadza men. In addition, aggression mediated the identified negative relationship between CAG repeats and number of children born. PMID:26291982

  4. RAPTOR gene polymorphism is independently correlated with urothelial cancer susceptibility compared with environmental toxin exposure

    Directory of Open Access Journals (Sweden)

    Hao Lun Luo


    Conclusion: RAPTOR gene polymorphisms are important SNPs with significantly association with the risk of urothelial cancer in Taiwan. Further researches about raptor-mTOR complex interfering malignant transformation of urothelium is worthy of further investigation.

  5. An association between apo-A4 gene polymorphism (Thr347Ser ...

    African Journals Online (AJOL)

    Pramod Kumar

    Objective: We aimed at studying the relationship between apoA4 gene polymorphisms (Thr347Ser and ... showed significant association with lipid risk factors like high levels of ..... in German population showed that Ser347 allele is associated.

  6. Association of Interleukin 27 gene polymorphism and risk of Hepatitis B viral infection in Egyptian population

    Directory of Open Access Journals (Sweden)

    Yasser B.M. Ali


    Conclusion: Our data suggested that polymorphisms in the IL-27 gene may not contribute to HBV susceptibility. Further studies with large sample size should be conducted to validate these results in Egyptian population.

  7. deletion polymorphism of ACE gene and Alzheimerв€™s disease

    African Journals Online (AJOL)

    Omayma M. Hassanin


    Jun 27, 2014 ... ease, 45 males and 39 females aged 65 ± 7 years from the Geriatric Department at Ain-Shams Uni- ..... alternative therapy provided by the ACE protein. .... enzyme (ACE) gene polymorphism in relation to physical perfor-.

  8. Polymorphisms of the prion protein gene Arabi sheep breed in Iran

    African Journals Online (AJOL)



    Nov 9, 2011 ... Key words: Prion protein gene (Prnp), polymorphisms, susceptibility, scrapie. INTRODUCTION. Scrapie is an invariably fatal .... consists of a DNA denaturation step (5 min at 95°C), followed by 30 amplification cycles ...

  9. Association of MTHFR gene polymorphisms with breast cancer survival

    International Nuclear Information System (INIS)

    Martin, Damali N; Boersma, Brenda J; Howe, Tiffany M; Goodman, Julie E; Mechanic, Leah E; Chanock, Stephen J; Ambs, Stefan


    Two functional single nucleotide polymorphisms (SNPs) in the 5,10-methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, lead to decreased enzyme activity and affect chemosensitivity of tumor cells. We investigated whether these MTHFR SNPs were associated with breast cancer survival in African-American and Caucasian women. African-American (n = 143) and Caucasian (n = 105) women, who had incident breast cancer with surgery, were recruited between 1993 and 2003 from the greater Baltimore area, Maryland, USA. Kaplan-Meier survival and multivariate Cox proportional hazards regression analyses were used to examine the relationship between MTHFR SNPs and disease-specific survival. We observed opposite effects of the MTHFR polymorphisms A1298C and C677T on breast cancer survival. Carriers of the variant allele at codon 1298 (A/C or C/C) had reduced survival when compared to homozygous carriers of the common A allele [Hazard ratio (HR) = 2.05; 95% confidence interval (CI), 1.05–4.00]. In contrast, breast cancer patients with the variant allele at codon 677 (C/T or T/T) had improved survival, albeit not statistically significant, when compared to individuals with the common C/C genotype (HR = 0.65; 95% CI, 0.31–1.35). The effects were stronger in patients with estrogen receptor-negative tumors (HR = 2.70; 95% CI, 1.17–6.23 for A/C or C/C versus A/A at codon 1298; HR = 0.36; 95% CI, 0.12–1.04 for C/T or T/T versus C/C at codon 677). Interactions between the two MTHFR genotypes and race/ethnicity on breast cancer survival were also observed (A1298C, p interaction = 0.088; C677T, p interaction = 0.026). We found that the MTHFR SNPs, C677T and A1298C, were associated with breast cancer survival. The variant alleles had opposite effects on disease outcome in the study population. Race/ethnicity modified the association between the two SNPs and breast cancer survival

  10. DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...

    African Journals Online (AJOL)

    We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...

  11. Do prion protein gene polymorphisms induce apoptosis in non

    Indian Academy of Sciences (India)

    To elucidate the relationship between the SNPs and apoptosis, TUNEL assays and active caspase-3 immunodetection techniques in brain sections of the polymorphic samples were performed. The results revealed that TUNEL-positive cells and active caspase-3-positive cells in the turtles with four polymorphisms were ...

  12. Impact of genetic polymorphisms of four cytokine genes on treatment ...

    African Journals Online (AJOL)

    Background: Many factors contribute for viral clearance and response to antiviral therapy. Genetic polymorphisms of cytokines, chemokines, and their receptors can alter the immune response against Hepatitis C virus (HCV). Aim of the study: The aim of the current study is to assess single nucleotide polymorphism (SNP) in ...


    Directory of Open Access Journals (Sweden)

    O. P. Bobrova


    Full Text Available The literature review on the role of cytokine gene polymorphisms in the development of chronic pain in cancer patients was presented using MedLine, PubMed, NEB, WileyOnlineLibrary, WebofScience, OxfordUniversityPress and SAGEPremier databases for years 1995 to 2016. The role of inter-individual differences based on cytokine gene polymorphisms and their receptors for personalized anesthetic and accompanying treatment in oncology was shown.

  14. Tetranucleotide repeat polymorphism at the human prostatic acid phosphatase (ACPP) gene

    Energy Technology Data Exchange (ETDEWEB)

    Polymeropoulos, M H; Xiao, Hong; Rath, D S; Merril, C R [National Inst. of Mental Health Neuroscience Center, Washington, DC (United States)


    The polymorphic (AAAT){sub n} repeat begins at base pair 2342 of the human prostatic acid phosphatase gene on chromosome 3q21-qter. The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously. The predicted length of the amplified sequence was 275 bp. Co-dominant segregation was observed in two informative families. The human prostatic acid phosphatase gene has been assigned to chromosome 3q21-qter.

  15. AB126. Association between FOX03A gene polymorphisms and human longevity: a meta-analysis


    Zhao, Shanchao; Bao, Jiming; Song, Xianlu


    Objective Numerous studies have shown associations between the FOX03A gene, encoding the forkhead box 03 transcription factor, and human or specifically male longevity. However, the associations of specific FOX03A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. Methods A comprehensive search was conducted to identify studies of FOX03A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% c...

  16. Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis


    Bao, Ji-Ming; Song, Xian-Lu; Hong, Ying-Qia; Zhu, Hai-Li; Li, Cui; Zhang, Tao; Chen, Wei; Zhao, Shan-Chao; Chen, Qing


    Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% confidence interval...

  17. Novel SNPs polymorphism of bovine CACNA2D1 gene and their ...

    African Journals Online (AJOL)

    In this study, the bovine CACNA2D1 gene was taken as a candidate gene for mastitis resistance. The objective of this study was to identify single nucleotide polymorphisms (SNPs) in the bovine CACNA2D1 gene and evaluate the association of these SNPs with mastitis in cattle. Through DNA sequencing and PCR-RFLP ...

  18. Effects of bovine prolactin gene polymorphism within exon 4 on milk ...

    African Journals Online (AJOL)

    In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for variation and genetic trends in milk yield and composition traits. Genomic DNAs were extracted from 268 semen samples belonged to Iranian Holstein bulls. Genotyping for the prolactin gene using PCRRFLP technique and RsaI ...

  19. Effects of bovine prolactin gene polymorphism within exon 4 on milk ...

    African Journals Online (AJOL)



    Oct 5, 2009 ... In this study, polymorphism of prolactin gene was analyzed as a candidate gene responsible for ... studied. Based on important role of prolactin gene in milk related traits and their genetic trends in dairy cattle, the aims of this study were, to screen ..... isolation and selection towards high fat and protein per-.

  20. Role of tumour necrosis factor gene polymorphisms (-308 and -238) in breast cancer susceptibility and severity

    International Nuclear Information System (INIS)

    Azmy, Iman AF; Balasubramanian, Saba P; Wilson, Anthony G; Stephenson, Timothy J; Cox, Angela; Brown, Nicola J; Reed, Malcolm WR


    Genetic polymorphisms in the promoter region of the tumour necrosis factor (TNF) gene can regulate gene expression and have been associated with inflammatory and malignant conditions. We have investigated two polymorphisms in the promoter of the TNF gene (-308 G>A and -238 G>A) for their role in breast cancer susceptibility and severity by means of an allelic association study. Using a case–control study design, breast cancer patients (n = 709) and appropriate age-matched and sex-matched controls obtained from the Breast Screening Unit (n = 498) were genotyped for these TNF polymorphisms, using a high-throughput allelic discrimination method. Allele frequencies for both polymorphisms were similar in both breast cancer cases and controls. However, the -308 polymorphism was found to be associated with vascular invasion in breast tumours (P = 0.024). Comparison with other standard prognostic indices did not show any association for either genotype. We demonstrated no association between the -308G>A polymorphism and the -238G>A polymorphism in the promoter region of TNF and susceptibility to breast cancer, in a large North European population. However, the -308 G>A polymorphism was found to be associated with the presence of vascular invasion in breast tumours

  1. Citric acid production and citrate synthase genes in distinct strains of ...

    African Journals Online (AJOL)



    May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

  2. Association of HS6ST3 gene polymorphisms with obesity and triglycerides: gene x gender interaction. (United States)

    Wang, Ke-Sheng; Wang, Liang; Liu, Xuefeng; Zeng, Min


    The heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene is involved in heparan sulphate and heparin metabolism, and has been reported to be associated with diabetic retinopathy in type 2 diabetes.We hypothesized that HS6ST3 gene polymorphisms might play an important role in obesity and related phenotypes (such as triglycerides). We examined genetic associations of 117 single-nucleotide polymorphisms (SNPs) within the HS6ST3 gene with obesity and triglycerides using two Caucasian samples: the Marshfield sample (1442 obesity cases and 2122 controls), and the Health aging and body composition (Health ABC) sample (305 cases and 1336 controls). Logistic regression analysis of obesity as a binary trait and linear regression analysis of triglycerides as a continuous trait, adjusted for age and sex, were performed using PLINK. Single marker analysis showed that six SNPs in the Marshfield sample and one SNP in the Health ABC sample were associated with obesity (P triglycerides in the Marshfield sample (P triglycerides in the Marshfield sample. These findings contribute new insights into the pathogenesis of obesity and triglycerides and demonstrate the importance of gender differences in the aetiology.

  3. Association of duffy blood group gene polymorphisms with IL8 gene in chronic periodontitis.

    Directory of Open Access Journals (Sweden)

    Emília Ângela Sippert

    Full Text Available The antigens of the Duffy blood group system (DARC act as a receptor for the interleukin IL-8. IL-8 plays an important role in the pathogenesis of chronic periodontitis due to its chemotactic properties on neutrophils. The aim of this study was to investigate a possible association of Duffy blood group gene polymorphisms with the -353T>A, -845T>C and -738T>A SNPs of the IL8 gene in chronic periodontitis. One hundred and twenty-four individuals with chronic periodontitis and 187 controls were enrolled. DNA was extracted using the salting-out method. The Duffy genotypes and IL8 gene promoter polymorphisms were investigated by PCR-RFLP. Statistical analyses were conducted using the Chi square test with Yates correction or Fisher's Exact Test, and the possibility of associations were evaluated by odds ratio with a 95% confidence interval. When analyzed separately, for the Duffy blood group system, differences in the genotype and allele frequencies were not observed between all the groups analyzed; and, in nonsmokers, the -845C allele (3.6% vs. 0.4%, -845TC genotype (7.3% vs. 0.7% and the CTA haplotype (3.6% vs. 0.4% were positively associated with chronic periodontitis. For the first time to our knowledge, the polymorphisms of erythroid DARC plus IL8 -353T>A SNPs were associated with chronic periodontitis in Brazilian individuals. In Afro-Brazilians patients, the FY*02N.01 with IL8 -353A SNP was associated with protection to chronic periodontitis.

  4. Association of duffy blood group gene polymorphisms with IL8 gene in chronic periodontitis. (United States)

    Sippert, Emília Ângela; de Oliveira e Silva, Cléverson; Visentainer, Jeane Eliete Laguila; Sell, Ana Maria


    The antigens of the Duffy blood group system (DARC) act as a receptor for the interleukin IL-8. IL-8 plays an important role in the pathogenesis of chronic periodontitis due to its chemotactic properties on neutrophils. The aim of this study was to investigate a possible association of Duffy blood group gene polymorphisms with the -353T>A, -845T>C and -738T>A SNPs of the IL8 gene in chronic periodontitis. One hundred and twenty-four individuals with chronic periodontitis and 187 controls were enrolled. DNA was extracted using the salting-out method. The Duffy genotypes and IL8 gene promoter polymorphisms were investigated by PCR-RFLP. Statistical analyses were conducted using the Chi square test with Yates correction or Fisher's Exact Test, and the possibility of associations were evaluated by odds ratio with a 95% confidence interval. When analyzed separately, for the Duffy blood group system, differences in the genotype and allele frequencies were not observed between all the groups analyzed; and, in nonsmokers, the -845C allele (3.6% vs. 0.4%), -845TC genotype (7.3% vs. 0.7%) and the CTA haplotype (3.6% vs. 0.4%) were positively associated with chronic periodontitis. For the first time to our knowledge, the polymorphisms of erythroid DARC plus IL8 -353T>A SNPs were associated with chronic periodontitis in Brazilian individuals. In Afro-Brazilians patients, the FY*02N.01 with IL8 -353A SNP was associated with protection to chronic periodontitis.

  5. Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae). (United States)

    Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes


    Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

  6. Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia (United States)

    Ak, Duygu Gezen; Kahraman, Hakkí; Dursun, Erdinç; Duman, Belgin Süsleyici; Erensoy, Nevin; Alagöl, Faruk; Tanakol, Refik; Yılmazer, Selma


    Vitamin D receptor (VDR) gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD) and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08). Also no association between biochemical data and VDR gene polymorphisms was observed. PMID:16403954

  7. Polymorphisms at the Ligand Binding Site of the Vitamin D Receptor Gene and Osteomalacia

    Directory of Open Access Journals (Sweden)

    Duygu Gezen Ak


    Full Text Available Vitamin D receptor (VDR gene polymorphisms have been suggested as possible determinants of bone mineral density (BMD and calcium metabolism. In this study, our aim was to determine whether there is an association between VDR gene polymorphism and osteomalacia or not. We determined ApaI and TaqI polymorphisms in the vitamin D receptor gene in 24 patients with osteomalacia and 25 age-matched healthy controls. Serum calcium, phosphorus, ALP, PTH, 25OHD levels were also examined. We used PCR and RFLP methods to test for an association between osteomalacia and polymorphisms within, intron 8 and exon 9 of the VDR gene. When the control and patients were compared for their ApaI and TaqI genotypes there was no relationship between VDR gene allelic polymorphisms and osteomalacia. Whereas a nearly significant difference for A allele was found in the allellic distribution of the patients (p = 0.08. Also no association between biochemical data and VDR gene polymorphisms was observed.

  8. Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

    Directory of Open Access Journals (Sweden)

    Emilia Wilmowicz


    Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

  9. Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Dangler, C. A.; Sordillo, L. M.


    This study was conducted to investigate polymorphism of the coagulase gene of Staphylococcus aureus causing bovine mastitis. One hundred eighty-seven strains of S. aureus were isolated from bovine mastitic milk samples obtained from 187 different Danish dairy farms. The isolates were characterised......% of the isolates. The ease of analysing coagulase gene polymorphisms among a large number of strains, and the multiple distinct polymorphic patterns generated, supports the use of this technique in epidemiological investigations of bovine mastitis. The predominating variants may have predelection for causing...

  10. Intestinal PTGS2 mRNA Levels, PTGS2 Gene Polymorphisms, and Colorectal Carcinogenesis

    DEFF Research Database (Denmark)

    Vogel, Lotte K.; Saebo, Mona; Hoyer, Helle


    Background & Aims: Inflammation is a major risk factor for development of colorectal cancer (CRC). Prostaglandin synthase cyclooxygenase-2 (COX-2) encoded by the PTGS2 gene is the rate limiting enzyme in prostaglandin synthesis and therefore plays a distinct role as regulator of inflammation...

  11. Association of eNOS and HSP70 gene polymorphisms with glaucoma in Pakistani cohorts.

    NARCIS (Netherlands)

    Ayub, H.; Khan, M.I.; Micheal, S.; Akhtar, F.; Ajmal, M.; Shafique, S.; Ali, S.H.; Hollander, A.I. den; Ahmed, A.; Qamar, R.


    PURPOSE: To investigate the involvement of stress-regulating genes, endothelial nitric oxide synthase (eNOS) and heat shock protein 70 (HSP70) with primary open angle glaucoma (POAG) and primary closed angle glaucoma (PCAG). METHODS: POAG and PCAG patients recruited from different areas of Pakistan

  12. Interleukin-6 and tumor necrosis factor-alpha gene polymorphisms in chronic idiopathic urticaria. (United States)

    Tavakol, M; Amirzargar, A A; Movahedi, M; Aryan, Z; Bidoki, A Z; Gharagozlou, M; Aghamohammadi, A; Nabavi, M; Ahmadvand, A; Behniafard, N; Heidari, K; Soltani, S; Rezaei, N


    This study was performed to evaluate association of gene polymorphisms among proinflammatory cytokines and susceptibility to chronic idiopathic urticaria (CIU). Ninety patients with prolonged urticaria more than 6 weeks were included as case group. Single nucleotide polymorphisms (SNPs) of IL-6 (G/C -174, G/A nt565) and TNF-α (G/A -308, G/A -238) were evaluated, using polymerase chain reaction (PCR); and the results were compared to the control group. G allele was significantly higher in the patients at locus of -238 of promoter of TNF-α gene (p<0.001). Frequency of following genotypes were significantly lower in patients with CIU, compared to controls: AG at -308 and GA at -238 of TNF-α gene (p<0.05 and p<0.001, respectively), CG at -174 and GG at +565 of IL-6 gene (p<0.05). Additionally, following genotypes were more common among patients with CIU: GG at -308 and -238 of TNF-α gene (p<0.05 and p<0.001, respectively), GG at -174 and GA at +565 of IL-6 gene (p<0.05). Pro-inflammatory cytokine gene polymorphisms can affect susceptibility to CIU. TNF-α promoter polymorphisms as well as IL-6 gene polymorphisms are associated with CIU. Copyright © 2013 SEICAP. Published by Elsevier Espana. All rights reserved.

  13. Citrus nobiletin suppresses inducible nitric oxide synthase gene expression in interleukin-1β-treated hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Yoshigai, Emi [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Machida, Toru [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okuyama, Tetsuya [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Mori, Masatoshi; Murase, Hiromitsu; Yamanishi, Ryota [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan); Okumura, Tadayoshi [Research Organization of Science and Technology, Ritsumeikan University, Kusatsu, Shiga (Japan); Department of Surgery, Kansai Medical University, Hirakata, Osaka (Japan); Ikeya, Yukinobu [Department of Pharmacy, College of Pharmaceutical Sciences, Ritsumeikan University, Kusatsu, Shiga (Japan); Nishino, Hoyoku [Ritsumeikan Global Innovation Research Organization (R-GIRO), Kusatsu, Shiga (Japan); Department of Biochemistry, Kyoto Prefectural University of Medicine, Kyoto (Japan); Nishizawa, Mikio, E-mail: [Department of Biomedical Sciences, College of Life Sciences, Kusatsu, Shiga (Japan)


    Highlights: •Nobiletin is a polymethoxylated flavone that is abundant in citrus peels. •Nobiletin is a major constituent of the Citrus unshiu peel extract. •Nobiletin suppresses induction of NO and reduces iNOS expression in hepatocytes. •Nobiletin reduces the iNOS promoter activity and the DNA-binding activity of NF-κB. -- Abstract: Background: Nobiletin is a polymethoxylated flavone that is abundant in the peels of citrus fruits, such as Citrus unshiu (Satsuma mandarin) and Citrus sinensis. The dried peels of C. unshiu (chinpi) have been included in several formulae of Japanese Kampo medicines. Nobiletin may suppress the induction of inducible nitric oxide synthase (iNOS), which synthesizes the inflammatory mediator nitric oxide (NO) in hepatocytes. Methods: A C. unshiu peel (CUP) extract was prepared. Primary cultured rat hepatocytes were treated with the CUP extract or nobiletin in the presence of interleukin 1β (IL-1β), which induces iNOS expression. NO production and iNOS gene expression were analyzed. Results: High-performance liquid chromatography analyses revealed that the nobiletin content in the CUP extract was 0.14%. Nobiletin dose-dependently reduced the NO levels and decreased iNOS expression at the protein, mRNA and antisense transcript levels. Flavone, which does not contain any methoxy groups, also suppressed iNOS induction. Nobiletin reduced the transcriptional activity of iNOS promoter-luciferase constructs and the DNA-binding activity of nuclear factor κB (NF-κB) in the nuclei. Conclusions: The suppression of iNOS induction by nobiletin suggests that nobiletin may be responsible for the anti-inflammatory effects of citrus peels and have a therapeutic potential for liver diseases.

  14. The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora. (United States)

    Schindler, Daniel; Nowrousian, Minou


    Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Candidate gene analysis using imputed genotypes: cell cycle single-nucleotide polymorphisms and ovarian cancer risk

    DEFF Research Database (Denmark)

    Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A


    Polymorphisms in genes critical to cell cycle control are outstanding candidates for association with ovarian cancer risk; numerous genes have been interrogated by multiple research groups using differing tagging single-nucleotide polymorphism (SNP) sets. To maximize information gleaned from......, and rs3212891; CDK2 rs2069391, rs2069414, and rs17528736; and CCNE1 rs3218036. These results exemplify the utility of imputation in candidate gene studies and lend evidence to a role of cell cycle genes in ovarian cancer etiology, suggest a reduced set of SNPs to target in additional cases and controls....

  16. Influence of ghrelin gene polymorphisms on hypertension and atherosclerotic disease. (United States)

    Berthold, Heiner K; Giannakidou, Eleni; Krone, Wilhelm; Trégouët, David-Alexandre; Gouni-Berthold, Ioanna


    Ghrelin is involved in several metabolic and cardiovascular processes. Recent evidence suggests its involvement in blood pressure regulation and hypertension. The aim of the study was to determine associations of single-nucleotide polymorphisms (SNPs) and haplotypes of the ghrelin gene (GHRL) with hypertension and atherosclerotic disease. Six GHRL SNPs (rs27647, rs26802, rs34911341, rs696217, rs4684677 and a -473G/A (with no assigned rsID)) were investigated in a sample of 1143 hypertensive subjects and 1489 controls of Caucasian origin. Both single-locus and haplotype association analyses were performed. In single-locus analyses, only the non-synonymous rs34911341 was associated with hypertension (odds ratio (OR)=1.95 (95% confidence interval (CI): 1.26-3.02), P=0.003). Six common haplotypes with frequency >1% were inferred from the studied GHRL SNPs, and their frequency distribution was significantly different between hypertensive subjects and controls (chi(2)=12.96 with 5 d.f. (degree of freedom), P=0.024). The effect of rs26802 was found to be significantly (P=0.017) modulated by other GHRL SNPs, as its C allele conferred either an increased risk (OR=1.30 (1.08-1.57), P=0.005) or a decreased risk (OR=0.50 (0.23-1.06), P=0.07) of hypertension according to the two different haplotypes on which it can be found. No association of GHRL SNPs or haplotypes with atherosclerotic disease was observed. In conclusion, we observed statistical evidence for association between GHRL SNPs and risk of hypertension.

  17. Genetic association between polymorphism of mdm2 gene and symptoms and pathological types of NSCLC

    International Nuclear Information System (INIS)

    Liu Xiaolan; Wang Weili; Zhang Xueying; Hao Ming; Liu Linlin; Wu Zhenfeng; Jiang Hongwei


    Objective: To investigate the genetic association between polymorphism of mdm2 gene and symptoms and pathological types of non-small cell lung cancer (NSCLC). Methods: Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) was used to identify mdm2 genotypes. The Pearson Chi square test and Woolf statistic method were used to analyze the relative risk and 95% confidence interval (CI) in order to find the genetic association between polymorphism of mdm2 gene and symptoms and pathological types of NSCLC. Results: In the SNP rs1196337 (a G to A base change) AA genotype showed association with cough of NSCLC (P<0.05). Conclusion: The polymorphism of mdm2 gene may be associated with symptom as cough of NSCLC. (authors)

  18. No association between polymorphisms in the DDC gene and paranoid schizophrenia in a northern Chinese population. (United States)

    Zhang, Boyu; Jia, Yanbin; Yuan, Yanbo; Yu, Xin; Xu, Qi; Shen, Yucun; Shen, Yan


    Several lines of evidence suggest that dysfunctions of neurotransmitters are associated with schizophrenia. DOPA decarboxylase (DDC) is an enzyme involved directly in the synthesis of dopamine and serotonin, and indirectly in the synthesis of noradrenaline. Therefore, the DDC gene can be considered a candidate gene for schizophrenia. We performed an association study between three single nucleotide polymorphisms in the DDC gene and paranoid schizophrenia. However, in our study no significant differences were found in the genotype distributions and allele frequencies between 80 paranoid schizophrenics and 108 controls for any of the polymorphisms. Neither did the haplotypes of the single nucleotide polymorphisms show any association with paranoid schizophrenia. Therefore, we conclude that the polymorphisms studied do not play a major role in paranoid schizophrenia pathogenesis in the population investigated.

  19. Study of the HFE gene common polymorphisms in French patients with sporadic amyotrophic lateral sclerosis. (United States)

    Praline, Julien; Blasco, Hélène; Vourc'h, Patrick; Rat, Valérian; Gendrot, Chantal; Camu, William; Andres, Christian R


    Our objective was to investigate whether the C282Y (p.Cys 282 Tyr) and H63D (p. His 63 Asp) HFE polymorphisms were associated with sporadic amyotrophic lateral sclerosis (SALS) in the French population. We searched for a relation of HFE polymorphisms with the clinical characteristics of the disease. The HFE polymorphisms were studied in 824 patients with SALS and 583 controls. We compared the frequency of the polymorphisms between SALS and controls groups by univariate and multivariate statistics, taking into account gender, site, age-at-onset and survival. We did not observe significant difference in the frequency of H63D polymorphism between SALS and control group. We observed a significant difference for C282Y between patients and controls with a low frequency of the Y allele in patients (3.2%) compared to our control group (5.9%). Disease duration, distribution of gender, site-of-onset, age-at-onset did not differ between groups taking into account genotypes of each polymorphism. Our results in this large cohort of ALS patients indicate that H63D polymorphism is not associated with SALS in the French population. This conclusion does not exclude a weak effect of the HFE gene polymorphisms in certain ALS populations, or an effect of other rare HFE gene variants. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Prion protein gene polymorphisms in Turkish native goat breeds

    Indian Academy of Sciences (India)


    3The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of ... Eighteen single-nucleotide polymorphisms were detected in the caprine PRNP .... Sampling localities, sample size (n) and sex of Turkish native goat breeds.

  1. CD36 gene polymorphism is associated with Alzheimer's disease

    Czech Academy of Sciences Publication Activity Database

    Šerý, Omar; Janoutová, J.; Ewerlingová, Laura; Hálová, Alice; Lochman, J.; Janout, V.; Khan, N. A.; Balcar, Vladimír Josef


    Roč. 135, č. 1 (2017), s. 46-53 ISSN 0300-9084 Institutional support: RVO:67985904 Keywords : polymorphism * association * CD36 Subject RIV: FH - Neurology OBOR OECD: Neurosciences (including psychophysiology Impact factor: 3.112, year: 2016

  2. GGC and StuI polymorphism on the androgen receptor gene in endometrial cancer patients

    International Nuclear Information System (INIS)

    Sasaki, Masahiro; Karube, Akihiro; Karube, Yuko; Watari, Michiko; Sakuragi, Noriaki; Fujimoto, Seiichiro; Dahiya, Rajvir


    Androgens have an anti-proliferative effect on endometrial cells. Human androgen receptor (AR) gene contains two polymorphic short tandem repeats of GGC and CAG, and a single-nucleotide polymorphism on exon 1 that is recognized by the restriction enzyme, StuI. Prior studies have shown that the lengths of the CAG repeat are inversely and linearly related to AR activity and associated with endometrial cancer. However, little is known about the GGC repeat and the StuI polymorphism of the AR gene. Thus, we investigated whether these AR polymorphisms are risk factors for endometrial cancer. To test this hypothesis, the genetic distributions of these polymorphisms were investigated in blood samples from endometrial cancer patients and healthy controls. The allelic and genotyping profiles were analyzed by polymerase chain reaction (PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), and direct DNA sequencing, and analyzed statistically. The GGC repeat was significantly longer in endometrial cancer patients as compared to normal healthy controls. In general, an increased risk of endometrial cancer was found with increasing GGC repeat. The relative risk for the 17 GGC repeat was greater than 4, as compared to controls. However, the StuI polymorphism was not significantly different between patients and controls. The findings suggest that increased numbers of GGC repeat on the AR gene may be a risk factor for endometrial cancer

  3. Association of TAP Gene Polymorphisms and Risk of Cervical Intraepithelial Neoplasia

    Directory of Open Access Journals (Sweden)

    Camilla Natter


    Full Text Available Background. Transporter associated with antigen processing (TAP is responsible for peptide loading onto class I major histocompatibility complex (MHC-I molecules. TAP seems to facilitate the detection of HPV by MHC-I molecules and contributes to successful eradication of HPV. TAP polymorphisms could have an important impact on the course of HPV infection. Objective. The aim of this study is to evaluate the association between five TAP gene polymorphisms and the risk of CIN. Methods. This case-control study investigated five common TAP polymorphisms in TAP1 (1341 and 2254 and TAP2 (1135, 1693, and 1993 in 616 women with CIN and 206 controls. Associations between gene polymorphisms and risk of CIN were analysed by univariate and multivariable models. The combined effect of the five TAP gene polymorphisms on the risk for CIN was investigated by haplotype analysis. Results. No significant difference in genotype distribution of the five TAP polymorphisms was observed in women with CIN and controls. Haplotype analysis revealed that women with haplotype mut-wt-wt-wt-wt (TAP polymorphisms t1135-t1341-t1693-t1993-t2254 had a significantly lower risk for CIN, compared to women with the haplotype wt-wt-wt-wt-wt (; OR 0.5 []. Conclusion. Identification of this haplotype combination could be used to identify women, less susceptible for development of CIN following HPV infection.

  4. Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean. (United States)

    Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao


    Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

  5. Polymorphisms in the vitamin D receptor gene and the androgen receptor gene and the risk of benign prostatic hyperplasia

    NARCIS (Netherlands)

    Bousema, J. T.; Bussemakers, M. J.; van Houwelingen, K. P.; Debruyne, F. M.; Verbeek, A. L.; de la Rosette, J. J.; Kiemeney, L. A.


    Little is known about risk factors for the development of benign prostatic hyperplasia (BPH). Recently, associations were observed between prostate cancer (CaP) risk and polymorphisms in the vitamin D receptor (VDR) gene and the androgen receptor (AR) gene. Since both receptors are relevant for

  6. Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

    DEFF Research Database (Denmark)

    Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek


    A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

  7. Interleukin-17 Gene Polymorphisms Contribute to Cancer Risk

    Directory of Open Access Journals (Sweden)

    Yu-Ming Niu


    Full Text Available Epidemiological studies have suggested that interleukin-17 (IL-17 polymorphisms are associated with cancer risk. However, the results of these studies are inconsistent. Therefore, we performed a meta-analysis to obtain a precise conclusion. Odds ratios (ORs with 95% confidence intervals (CIs were used to assess the association of the IL-17A rs2275913G>A and IL-17F rs763780T>C polymorphisms with cancer risk. Publication bias and sensitivity analyses were performed to ensure the statistical power. Overall, 10 relevant case-control studies involving 4,516 cases and 5,645 controls were included. The pooled ORs with 95% CIs indicated that the IL-17A rs2275913G>A polymorphism was significantly associated with increased cancer risk (for A versus G: OR = 1.28, 95% CI: 1.16–1.41, PC polymorphism was also significantly associated with gastric cancer development. Overall, the present meta-analysis suggests that IL-17 polymorphisms increase the risk of developing cancer, particularly gastric cancer, in the Asian (and Chinese population.

  8. Polymorphisms within the FANCA gene associate with premature ovarian failure in Korean women. (United States)

    Pyun, Jung-A; Kim, Sunshin; Cha, Dong Hyun; Kwack, KyuBum


    This study investigated whether polymorphisms within the Fanconi anemia complementation group A (FANCA) gene contribute to the increased risk of premature ovarian failure (POF) in Korean women. Ninety-eight women with POF and 218 controls participated in this study. Genomic DNA from peripheral blood was isolated, and GoldenGate genotyping assay was used to identify single nucleotide polymorphisms (SNPs) within the FANCA gene. Two significant SNPs (rs1006547 and rs2239359; P FANCA gene may increase the risk for POF in Korean women.

  9. [CCR5, CCR2, apoe, p53, ITGB3 and HFE gene polymorphism in Western Siberia long-livers]. (United States)

    Ivanoshchuk, D E; Mikhaĭlova, S V; Kulikov, I V; Maksimov, V N; Voevoda, M I; Romashchenko, A G


    In order to estimate the distribution of some polymorphisms for the CCR5, CCR2, apoE, p53, ITGB3, and HFE genes in Russian long-livers from Western Siberia, a sample of 271 individuals (range 90-105 years) was examined. It was demonstrated that carriage of the delta32 polymorphism for the CCR5 gene, V64/polymorphism for the CCR2 gene, e2/e3/e4 for the apoE gene, L33P for the ITGB3 gene, as well as H63D and S65C polymorphisms for the HFE gene does not influence on predisposition to the longevity; carriage of the 282 Y allele for the HFE gene negatively influences on the longevity; carriage of the heterozygous genotype for the R72P polymorphism for the p53 gene correlates with the longevity of elderly people.

  10. Polymorphisms of Selected DNA Repair Genes and Lung Cancer in Chromium Exposure. (United States)

    Halasova, E; Matakova, T; Skerenova, M; Krutakova, M; Slovakova, P; Dzian, A; Javorkova, S; Pec, M; Kypusova, K; Hamzik, J


    Chromium is a well-known mutagen and carcinogen involved in lung cancer development. DNA repair genes play an important role in the elimination of genetic changes caused by chromium exposure. In the present study, we investigated the polymorphisms of the following DNA repair genes: XRCC3, participating in the homologous recombination repair, and hMLH1 and hMSH2, functioning in the mismatch repair. We focused on the risk the polymorphisms present in the development of lung cancer regarding the exposure to chromium. We analyzed 106 individuals; 45 patients exposed to chromium with diagnosed lung cancer and 61 healthy controls. Genotypes were determined by a PCR-RFLP method. We unravelled a potential for increased risk of lung cancer development in the hMLH1 (rs1800734) AA genotype in the recessive model. In conclusion, gene polymorphisms in the DNA repair genes underscores the risk of lung cancer development in chromium exposed individuals.

  11. Association of angiotensin receptor 2 gene polymorphisms with pregnancy induced hypertension risk. (United States)

    Li, Chenyang; Peng, Weijun; Zhang, Heng; Yan, Weirong


    To investigate the association of polymorphisms and haplotypes of angiotensin receptor 2 (AT2R) gene with pregnancy induced hypertension (PIH) in Chinese Han women. A case-control study was designed with 446 cases (gestational hypertension, GH: 124; pre-eclampsia, PE + eclampsia, E: 322) and 650 controls. rs5193, rs1403543 and rs12710567 of AT2R gene were genotyped. A logistic regression approach was applied to estimate the relationship between the polymorphisms and haplotypes of AT2Rgene with PIH risk. No relationship between AT2R gene polymorphisms and PIH was detected. The haplotype analysis also showed a negative result. rs5193, rs1403543 and rs12710567 of AT2R gene might have no effect on PIH risk among Chinese Han women.

  12. Reward dependence is related to norepinephrine transporter T-182C gene polymorphism in a Korean population. (United States)

    Ham, Byung-Joo; Choi, Myoung-Jin; Lee, Heon-Jeong; Kang, Rhee-Hun; Lee, Min-Soo


    It is well established that approximately 50% of the variance in personality traits is genetic. The goal of this study was to investigate a relationship between personality traits and the T-182C polymorphism in the norepinephrine transporter gene. The participants included 115 healthy adults with no history of psychiatric disorders and other physical illness during the past 6 months. All participants were tested with the Temperament and Character Inventory and genotyped norepinephrine transporter gene polymorphism. Differences on the Temperament and Character Inventory dimensions among three groups were examined with one-way analysis of variance. Our study suggests that the norepinephrine transporter T-182C gene polymorphism is associated with reward dependence in Koreans, but the small number of study participants and their sex and age heterogeneity limits generalization of our results. Further studies are necessary with a larger number of homogeneous participants to confirm whether the norepinephrine transporter gene is related to personality traits.

  13. Association of HS6ST3 gene polymorphisms with obesity and ...

    Indian Academy of Sciences (India)

    The heparan sulfate 6-O-sulfotransferase 3 (HS6ST3) gene is involved in heparan sulphate and heparin metabolism, and has been reported to be associated with diabetic retinopathy in type 2 diabetes. We hypothesized that HS6ST3 gene polymorphisms might play an important role in obesity and related phenotypes (such ...

  14. Association of HS6ST3 gene polymorphisms with obesity and ...

    Indian Academy of Sciences (India)

    Supplementary data: Association of HS6ST3 gene polymorphisms with obesity and triglycerides: gene × gender interaction. Ke-Sheng Wang, Liang Wang, Xuefeng Liu and Min Zeng. J. Genet. 92, 395–402. Table 1. Associations of 117 SNPs with obesity in the Health ABC and Marshfield samples. Minor. OR Health.

  15. Association of 308G/A TNF-α gene polymorphism and spontaneous ...

    African Journals Online (AJOL)

    Background: Single nucleotide polymorphism (SNP) within tumor necrosis factor alpha (TNF-α) gene promoter (308G/A TNFA) is associated with higher gene expression. The role of this SNP as a risk factor for spontaneous preterm birth has been assessed in some regions and the findings were significantly different ...

  16. Role of MTHFR A1298C gene polymorphism in the etiology of ...

    African Journals Online (AJOL)

    Various studies have performed to evaluate the role of MTHFR A1298C gene polymorphism to the risk of prostate cancer and the results were inconclusive and inconsistent. A meta-analysis of published case-control studies, up to December 2014, was performed to investigate the association between MTHFR A1298C gene ...

  17. Prolactin-RsaI gene polymorphism in East Anatolian Red cattle in ...

    African Journals Online (AJOL)

    The aim of the study was to determine by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method the gene and genotype frequencies of PRL gene in native East Anatolian Red (EAR) cattle, which are raised as a genetic resource in Turkey. PCR-RFLP analysis involved the use of the ...

  18. Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)


    Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.


    The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

  19. The first report of prion-related protein gene (PRNT) polymorphisms in goat. (United States)

    Kim, Yong-Chan; Jeong, Byung-Hoon


    Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

  20. Genetic polymorphisms at the leptin receptor gene in three beef cattle breeds

    Directory of Open Access Journals (Sweden)

    Sabrina E.M. Almeida


    Full Text Available The genetic diversity of a single nucleotide polymorphism (SNP at the exon 20 (T945M of the leptin receptor gene (LEPR and of three short tandem repeats (STRs BM7225, BMS694, and BMS2145 linked to LEPR was investigated in three beef cattle herds (Brangus Ibagé, Charolais, and Aberdeen Angus. A cheap and effective new method to analyze the T945M polymorphism in cattle populations was developed and the possible role of these polymorphisms in reproduction and weight gain of postpartum cows was evaluated. High levels of genetic diversity were observed with the average heterozygosity of STRs ranging from 0.71 to 0.81. No significant association was detected between LEPR markers and reproductive parameters or daily weight gain. These negative results suggest that the LEPR gene polymorphisms, at least those herein described, do not influence postpartum cows production.

  1. Functional polymorphisms in the P2X7 receptor gene are associated with osteoporosis

    DEFF Research Database (Denmark)

    Husted, L B; Harsløf, T; Stenkjær, L


    variant allele, which has been associated with increased receptor function in monocytes, was associated with increased total hip BMD in women. With the exception of His155Tyr for which we found conflicting results in men and women, our results are consistent with the phenotype of the knockout mouse......UNLABELLED: The P2X(7) receptor is an ATP-gated cation channel. We investigated the effect of both loss-of-function and gain-of-function polymorphisms in the P2X(7) receptor gene on BMD and risk of vertebral fractures and found that five polymorphisms and haplotypes containing three...... of these polymorphisms were associated with BMD and fracture risk. INTRODUCTION: The P2X(7) receptor is an ATP-gated cation channel. P2X(7) receptor knockout mice have reduced total bone mineral content, and because several functional polymorphisms have been identified in the human P2X(7) receptor gene, we wanted...

  2. Research on the relativity between gene polymorphism and children cardiac insufficiency. (United States)

    He, X-H; Li, C-L; Ling, N; Wang, Q-W; Wang, Z-Z; An, X-J


    We analyzed the relationship between Mink-S27 gene polymorphism and children with cardiac insufficiency. From April 2013 to April 2015, we enrolled 73 cases of children with cardiac insufficiency for this study, and all 73 were placed in the observation group. 76 normal cases were selected for the control group. Restriction fragment length polymorphism (RFLP) was used to make polymorphism analysis of the Mink-S27. Our results showed no significant differences in Mink-S27 genotype and allele distribution in both observation and control groups (p>0.05). In lesion samples collected from children with cardiac insufficiency, we detected significant difference in AA, CC genotype frequency and allele frequency between the observation group and the control group (prelatively high. GNAS2 gene polymorphism was associated with the prevalence of cardiac insufficiency in children. And also the patients' condition was correlated to the frequency of different genotypes and alleles.

  3. Differential effect of beetroot bread on postprandial DBP according to Glu298Asp polymorphism in the eNOS gene: a pilot study. (United States)

    Hobbs, D A; George, T W; Lovegrove, J A


    Our objective was to investigate whether the presence of Glu298Asp polymorphism in the endothelial NO synthase (eNOS) gene differentially affects the postprandial blood pressure response to dietary nitrate-rich beetroot bread. A randomised, single-blind, controlled, crossover acute pilot study was performed in 14 healthy men (mean age: 34±9 years) who were retrospectively genotyped for Glu298Asp polymorphism (7GG; T carriers 7). Volunteers were randomised to receive 200 g beetroot-enriched bread (1.1 mmol nitrate) or control bread (no beetroot; 0.01 mmol nitrate) on two separate occasions 10 days apart. Baseline and incremental area under the curve of blood pressure and NOx (nitrate/nitrite) were measured for a 6-h postprandial period. A treatment × genotype interaction was observed for diastolic blood pressure (Pconsumption of beetroot bread compared with control bread. No significant differences were observed in the GG group. The beneficial diastolic blood pressure reduction was observed only in the T carriers of the Glu298Asp polymorphism in the eNOS gene after consumption of nitrate-rich beetroot bread. These data require confirmation in a larger population group.

  4. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples. (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona


    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  5. [G894T (NOS3) and G1958A (MTHFD1) gene polymorphisms and risk of ischemic heart disease in Yucatan, Mexico]. (United States)

    García-González, Igrid; Solís-Cárdenas, Alberto de Jesús; Flores-Ocampo, Jorge A; Alejos-Mex, Ricardo; Herrera-Sánchez, Luis Fernando; González-Herrera, Lizbeth Josefina


    Cardiovascular medicine is focused on the search for genetic risk markers with predictive and/or prognostic value. Among the genetic variants of interest are G894T endothelial nitric oxide synthase and G1958A methylenetetrahydrofolate dehydrogenase1 gene polymorphisms. The aim of this study was to determine the possible association between these polymorphisms and ischemic heart disease in patients from Southern of Mexico (Yucatán). Case-control study matched by age, sex and origin was designed. We studied 98 patients with coronary disease and 101 controls. Participants were evaluated for the usual risk factors. The polymorphisms were identified using the polymerase chain reaction/restriction fragment length polymorphism analysis. Informed consent was obtained from all participants. The G894T and G1958A polymorphisms were not associated with ischemic heart disease, however, the TT genotype (G894T) was associated with the angina (OR=10.2; 95%CI, 1.51-68.8; p=0.025). The genotype GT (G894T) was the most frequent in patients with family history of coronary artery disease. Multiple logistic regression analysis identified smoking (OR=5.21; 95%CI, 2.1-12.9; p=0.000), hypertension (OR=3.54; 95%CI, 1.47-8.56; p=0.005) and obesity (OR=1.16; 95%CI, 1.1-1.27; p=0.001) as risk factors predicting the ischemic heart disease. The G894T and G1958A polymorphisms showed not association with ischemic heart disease. However, homozygosis for the 894T allele (NOS3) confers at risk to develop angina on Yucatán. Copyright © 2014 Sociedad Española de Arteriosclerosis. Published by Elsevier España. All rights reserved.

  6. Associations between interleukin-1 gene polymorphisms and coronary heart disease risk: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Liang Zhou

    Full Text Available OBJECTIVE: A great number of studies regarding the associations between IL-1B-511, IL-1B+3954 and IL-1RN VNTR polymorphisms within the IL-1gene cluster and coronary heart disease (CHD have been published. However, results have been inconsistent. In this study, a meta-analysis was performed to investigate the associations. METHODS: Published literature from PubMed and Embase databases were searched for eligible publications. Pooled odds ratios (ORs with 95% confidence intervals (CIs were calculated using random- or fixed- effect model. RESULTS: Thirteen studies (3,219 cases/2,445 controls for IL-1B-511 polymorphism, nine studies (1,828 cases/1,818 controls for IL-1B+3954 polymorphism and twelve studies (2,987 cases/ 2,208 controls for IL-1RN VNTR polymorphism were included in this meta analysis. The results indicated that both IL-1B-511 and IL-1B+3954 polymorphisms were not associated with CHD risk (IL-1B-511 T vs. C: OR = 0.98, 95%CI 0.87-1.09; IL-1B+3954 T vs. C: OR = 1.06, 95%CI 0.95-1.19. Similarly, there was no association between IL-1RN VNTR polymorphism and CHD risk (*2 vs. L: OR = 1.00, 95%CI 0.85-1.17. CONCLUSIONS: This meta-analysis suggested that there were no associations between IL-1 gene cluster polymorphisms and CHD.

  7. Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome. (United States)

    Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele


    Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  8. Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR. (United States)

    Lane, Courtney E; Benton, Michael G


    A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

    International Nuclear Information System (INIS)

    Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.


    Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

  10. Metabolite profiling of Arabidopsis thaliana (L.) plants transformed with an antisense chalcone synthase gene

    DEFF Research Database (Denmark)

    Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.


    A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...

  11. of endothelial nitric oxide synthase gene and serum level of vascular ...

    African Journals Online (AJOL)


    Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

  12. Factors influencing gene silencing of granule-bound starch synthase in potato

    NARCIS (Netherlands)

    Heilersig, H.J.B.


    In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI

  13. Investigation on the association between NLRP3 gene polymorphisms and susceptibility to primary gout. (United States)

    Wang, L F; Ding, Y J; Zhao, Q; Zhang, X L


    We conducted a case-control study to investigate the association between 3 common NALP3 polymorphisms (rs10754558, rs7512998, and rs12137901) and the susceptibility to primary gout. A total of 320 patients with primary gout and 320 controls were included in this study. The genotyping of NALP3 rs10754558, rs7512998, and rs12137901 were conducted by polymerase chain reaction-restriction fragment length polymorphism. Comparison analysis showed that primary gout patients were more likely to have higher body mass index, prevalence of hypertension, blood glucose, triglycerides, urea nitrogen, and uric acid (P gene polymorphisms and the risk of primary gout.

  14. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia


    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  15. Serum Homocysteine, Vitamin B12, Folic Acid Levels and Methylenetetrahydrofolate Reductase (MTHFR) Gene Polymorphism in Vitiligo (United States)

    Yasar, Ali; Gunduz, Kamer; Onur, Ece; Calkan, Mehmet


    The aim of this study was to determine serum vitamin B12, folic acid and homocysteine (Hcy) levels as well as MTHFR (C677, A1298C) gene polymorphisms in patients with vitiligo, and to compare the results with healthy controls. Forty patients with vitiligo and 40 age and sex matched healthy subjects were studied. Serum vitamin B12 and folate levels were determined by enzyme-linked immunosorbent assay. Plasma Hcy levels and MTHFR polymorphisms were determined by chemiluminescence and real time PCR methods, respectively. Mean serum vitamin B12 and Hcy levels were not significantly different while folic acid levels were significantly lower in the control group. There was no significant relationship between disease activity and vitamin B12, folic acid and homocystein levels. No significant difference in C677T gene polymorphism was detected. Heterozygote A1298C gene polymorphism in the patient group was statistically higher than the control group. There was no significant relationship between MTHFR gene polymorphisms and vitamin B12, folic acid and homocysteine levels. In conclusion, vitamin B12, folate and Hcy levels are not altered in vitiligo and MTHFR gene mutations (C677T and A1298C) do not seem to create susceptibility for vitiligo. PMID:22846211

  16. Serum Homocysteine, Vitamin B12, Folic Acid Levels and Methylenetetrahydrofolate Reductase (MTHFR Gene Polymorphism in Vitiligo

    Directory of Open Access Journals (Sweden)

    Ali Yasar


    Full Text Available The aim of this study was to determine serum vitamin B12, folic acid and homocysteine (Hcy levels as well as MTHFR (C677, A1298C gene polymorphisms in patients with vitiligo, and to compare the results with healthy controls. Forty patients with vitiligo and 40 age and sex matched healthy subjects were studied. Serum vitamin B12 and folate levels were determined by enzyme-linked immunosorbent assay. Plasma Hcy levels and MTHFR polymorphisms were determined by chemiluminescence and real time PCR methods, respectively. Mean serum vitamin B12 and Hcy levels were not significantly different while folic acid levels were significantly lower in the control group. There was no significant relationship between disease activity and vitamin B12, folic acid and homocystein levels. No significant difference in C677T gene polymorphism was detected. Heterozygote A1298C gene polymorphism in the patient group was statistically higher than the control group. There was no significant relationship between MTHFR gene polymorphisms and vitamin B12, folic acid and homocysteine levels. In conclusion, vitamin B12, folate and Hcy levels are not altered in vitiligo and MTHFR gene mutations (C677T and A1298C do not seem to create susceptibility for vitiligo.

  17. ALK7 Gene Polymorphism is Associated with Metabolic Syndrome Risk and Cardiovascular Remodeling

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wenchao; Wang, Hui; Zhang, Wei [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Lv, Ruijuan [Department of Emergency, Qilu Hospital of Shandong University, Jinan (China); Wang, Zhihao [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Department of Geriatrics, Qilu Hospital of Shandong University, Jinan (China); Shang, Yuanyuan; Zhang, Yun; Zhong, Ming [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Chen, Yuguo; Tang, Mengxiong, E-mail: [Key Laboratory of Cardiovascular Remodeling and Function Research Chinese Ministry of Education and Chinese Ministry of Public Health, Qilu Hospital of Shandong University, Jinan (China); Department of Emergency, Qilu Hospital of Shandong University, Jinan (China)


    Activin receptor-like kinase 7 (ALK7) is a type I receptor for the TGF-β superfamily and has recently been demonstrated to play an important role in the maintenance of metabolic homeostasis. To investigate the association of the ALK7 gene polymorphism with metabolic syndrome (MetS) and cardiovascular remodeling in MetS patients. The single nucleotide polymorphism rs13010956 in the ALK7 gene was genotyped in 351 Chinese subjects undergoing carotid and cardiac ultrasonography. The associations of the ALK7 gene polymorphism with the MetS phenotype, MetS parameters, and cardiovascular ultrasonic features were analyzed. The rs13010956 polymorphism in the ALK7 gene was found to be significantly associated with the MetS phenotype in females (p < 0.05) and was also significantly associated with blood pressure in the total (p < 0.05) and female populations (p < 0.01). Further analysis revealed that rs13010956 was associated with mean intima-media thickness of the carotid arteries in females (p < 0.05). After control for body mass index, blood pressure, fasting blood glucose, and triglycerides, rs13010956 was also found to be significantly associated with left ventricular mass index in the total (p < 0.05) and female populations (p < 0.05). Our findings suggested that the ALK7 gene polymorphism rs13010956 was significantly associated with MetS risk in females and may be involved in cardiovascular remodeling in MetS patients.

  18. DNA repair gene polymorphisms in relation to chromosome aberration frequencies in retired radiation workers

    International Nuclear Information System (INIS)

    Wilding, Craig S.; Relton, Caroline L.; Rees, Gwen S.; Tarone, Robert E.; Whitehouse, Caroline A.; Tawn, E. Janet


    Polymorphic variation in DNA repair genes was examined in a group of retired workers from the British Nuclear Fuels plc facility at Sellafield in relation to previously determined translocation frequencies in peripheral blood lymphocytes. Variation at seven polymorphisms in four genes involved in the base excision repair (XRCC1 R194W, R399Q and a [AC] n microsatellite in the 3' UTR) and double strand break repair (XRCC3 T241M and a [AC] n microsatellite in intron 3 of XRCC3, XRCC4 I134T, and a GACTAn microsatellite located 120kb 5' of XRCC5) pathways was determined for 291 retired radiation workers who had received cumulative occupational external radiation doses of between 0 and 1873mSv. When the interaction between radiation dose and each DNA repair gene polymorphism was examined in relation to translocation frequency there was no evidence for any of the polymorphisms studied influencing the response to occupational exposure. A positive interaction observed between genotype (individuals with at least one allele >=20 repeat units) at a microsatellite locus in the XRCC3 gene and smoking status should be interpreted cautiously because interactions were investigated for seven polymorphisms and two exposures. Nonetheless, further research is warranted to examine whether this DNA repair gene variant might be associated with a sub-optimal repair response to smoking-induced DNA damage and hence an increased frequency of translocations

  19. ALK7 Gene Polymorphism is Associated with Metabolic Syndrome Risk and Cardiovascular Remodeling

    International Nuclear Information System (INIS)

    Zhang, Wenchao; Wang, Hui; Zhang, Wei; Lv, Ruijuan; Wang, Zhihao; Shang, Yuanyuan; Zhang, Yun; Zhong, Ming; Chen, Yuguo; Tang, Mengxiong


    Activin receptor-like kinase 7 (ALK7) is a type I receptor for the TGF-β superfamily and has recently been demonstrated to play an important role in the maintenance of metabolic homeostasis. To investigate the association of the ALK7 gene polymorphism with metabolic syndrome (MetS) and cardiovascular remodeling in MetS patients. The single nucleotide polymorphism rs13010956 in the ALK7 gene was genotyped in 351 Chinese subjects undergoing carotid and cardiac ultrasonography. The associations of the ALK7 gene polymorphism with the MetS phenotype, MetS parameters, and cardiovascular ultrasonic features were analyzed. The rs13010956 polymorphism in the ALK7 gene was found to be significantly associated with the MetS phenotype in females (p < 0.05) and was also significantly associated with blood pressure in the total (p < 0.05) and female populations (p < 0.01). Further analysis revealed that rs13010956 was associated with mean intima-media thickness of the carotid arteries in females (p < 0.05). After control for body mass index, blood pressure, fasting blood glucose, and triglycerides, rs13010956 was also found to be significantly associated with left ventricular mass index in the total (p < 0.05) and female populations (p < 0.05). Our findings suggested that the ALK7 gene polymorphism rs13010956 was significantly associated with MetS risk in females and may be involved in cardiovascular remodeling in MetS patients

  20. Angiotensin II type 1 receptor (A1166C gene polymorphism and essential hypertension in Egyptian population

    Directory of Open Access Journals (Sweden)

    Marium M. Shamaa


    Full Text Available The pathogenesis of essential hypertension (EH is affected by genetic and environmental factors. Mutations in hypertension-related genes can affect blood pressure (BP via alteration of salt and water reabsorption by the nephron. The genes of the renin-angiotensin system (RAS have been extensively studied because of the well documented role of this system in the control of BP. It has been previously shown that Angiotensin II type 1 receptor (ATR1 gene polymorphism could be associated with increased risk of EH. So, in the current study, we evaluated the frequency of ATR1 (A1166C polymorphism in relation to EH in a group of Egyptian population. The study population included 83 hypertensive patients and 60 age and sex matched healthy control subjects. Restriction fragment length polymorphism – Polymerase chain reaction (RFLP – PCR was used for the analysis of A1166C polymorphism of ATR1 genes in peripheral blood samples of all patients and controls. The results revealed that there was a positive risk of developing EH when having the T allele whether in homozygous or heterozygous state. From this work, it was concluded that there was an association between ATR1 (A1166C gene polymorphism and the risk of developing EH.

  1. Retracted Association of STAT4 gene polymorphism with systemic lupus erythematosus / lupus nephritis risk. (United States)

    Zhou, Tian-Biao; Jiang, Zong-Pei; Qin, Yuan-Han; Zhou, Jia-Fan


    The association of STAT4 gene polymorphism with systemic lupus erythematosus (SLE) / lupus nephritis (LN) results from the published studies is still conflicting. This meta-analysis was performed to evaluate the relationship between STAT4 rs7574865, rs16833431, rs11889341, rs8179673, rs10168266, rs7582694, rs3821236, rs7601754 gene polymorphism and SLE / LN, and to explore whether STAT4 gene polymorphism could become a predictive marker for SLE / LN risk. Association studies were identified from the databases of PubMed, Embase, Cochrane Library and CBM-disc (China Biological Medicine Database) as of September 1, 2013, and eligible investigations were synthesized using meta-analysis method. 24 investigations were identified for the analysis of association between STAT4 gene polymorphism and SLE, consisting of 31190 patients with SLE and 43940 controls. In STAT4 rs7574865, there was a marked association between T allele or TT genotype and SLE susceptibility (T: OR=1.53, 95% CI: 1.30-1.79, Prs7574865 gene polymorphism was not associated with the LN risk. Our results indicate that T allele or TT homozygous is a significant risk genetic molecular marker to predict the SLE susceptibility and GG genotype is a valuable marker to against the SLE risk, but the association was not found for LN. However, more investigations are required to further clarify the association of the T allele or TT homozygous with SLE / LN susceptibility. This article is protected by copyright. All rights reserved.

  2. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase]. (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V


    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  3. Interleukin-21 gene polymorphism rs2221903 is associated with disease activity in patients with rheumatoid arthritis. (United States)

    Malinowski, Damian; Paradowska-Gorycka, Agnieszka; Safranow, Krzysztof; Pawlik, Andrzej


    Interleukin-21 (IL-21) is a cytokine which plays a significant role in the pathogenesis and disease activity of rheumatoid arthritis (RA). Genetic polymorphisms in the IL-21 gene may alter the synthesis of IL-21. The aim of this study was to examine IL-21 and IL-21R polymorphisms in patients with RA. We examined 422 patients with RA and 338 healthy controls. Single nucleotide polymorphisms (SNPs) within the IL-21 (rs6822844 G>T, rs6840978 C>T, rs2221903 T>C) and IL-21R (rs2285452 G>A) genes were genotyped using TaqMan genotyping assays. There were no statistically significant differences in the distribution of studied genotypes and alleles between RA patients and the control group. To examine whether IL-21 polymorphisms affect disease activity in RA patients, we compared the distribution of IL-21 genotypes between patients with DAS28 ≤ 2.5 (patients with remission of disease symptoms) and patients with DAS28 > 2.5 (patients with active RA). Among patients with DAS28 > 2.5, increased prevalence of rs2221903 CT and CC genotypes was observed (OR = 1.54; 95% CI: 1.04-2.28; p = 0.035). The results of this study suggest that IL-21 and IL-21R gene polymorphisms are not risk loci for RA susceptibility, whereas the IL-21 rs2221903 polymorphism is associated with disease activity.

  4. Extensive shared polymorphism at non-MHC immune genes in recently diverged North American prairie grouse (United States)

    Minias, Piotr; Bateson, Zachary W.; Whittingham, Linda A.; Johnson, Jeff A.; Oyler-McCance, Sara J.; Dunn, Peter O.


    Gene polymorphisms shared between recently diverged species are thought to be widespread and most commonly reflect introgression from hybridization or retention of ancestral polymorphism through incomplete lineage sorting. Shared genetic diversity resulting from incomplete lineage sorting is usually maintained for a relatively short period of time, but under strong balancing selection it may persist for millions of years beyond species divergence (balanced trans-species polymorphism), as in the case of the major histocompatibility complex (MHC) genes. However, balancing selection is much less likely to act on non-MHC immune genes. The aim of this study was to investigate the patterns of shared polymorphism and selection at non-MHC immune genes in five grouse species from Centrocercus and Tympanuchus genera. For this purpose, we genotyped five non-MHC immune genes that do not interact directly with pathogens, but are involved in signaling and regulate immune cell growth. In contrast to previous studies with MHC, we found no evidence for balancing selection or balanced trans-species polymorphism among the non-MHC immune genes. No haplotypes were shared between genera and in most cases more similar allelic variants sorted by genus. Between species within genera, however, we found extensive shared polymorphism, which was most likely attributable to introgression or incomplete lineage sorting following recent divergence and large ancestral effective population size (i.e., weak genetic drift). Our study suggests that North American prairie grouse may have attained relatively low degree of reciprocal monophyly at nuclear loci and reinforces the rarity of balancing selection in non-MHC immune genes.

  5. Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis. (United States)

    Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida


    Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

  6. Modification of Tamoxifen Effectiveness by Gene Polymorphisms and Other Drugs (United States)


    dopamine transporter and receptor polymorphisms. J Clin Psychopharmacol 26: 192 – 197 Jensen AR, Ewertz M, Cold S, Storm HH, Overgaard J (2003) Time...369: 23 – 37 Zourková A, Cesková E, Hadasová E, Ravcuková B (2007) Links among paroxetine-induced sexual dysfunctions, gender, and CYP2D6 activity

  7. Prevalence of thrombophilic gene polymorphisms (FVL G1691A and ...

    African Journals Online (AJOL)

    Hamdia Ezzat


    Feb 22, 2014 ... The Egyptian Journal of Medical Human Genetics ... on polymorphisms influencing some biological functions [8]. Among the candidate ...... 2005;3(2):292–9. [17] Graham I, Atar D, Borch-Johnsen K, et al.

  8. Contribution of genes polymorphism to susceptibility and outcome of ...

    African Journals Online (AJOL)

    Harapan Tumangger

    Examination of the association between genetic polymorphisms and sep- sis promises to provide ... 100. 2.10. Plasminogen activator inhibitor type 1 (PAI-1) . ... Disclosure statement. ... at position А308 were more likely to succumb to severe sepsis ..... relation to monokine secretion and insulin-dependent diabetes mellitus.

  9. Maternal MTHFR gene polymorphisms and the risk of Down ...

    African Journals Online (AJOL)

    Estimation of maternal plasma homocysteine (Hyc): methionine (Met) ratio and lymphocyte methotrexate (MTX) cytotoxicity to assess the occurrence of MTHFR 677C → T mutation. Results: The MTHFR 677C → T polymorphism is more prevalent among mothers of infant with DS compared with the controls, with an odd ratio ...

  10. Association of PPARγ gene polymorphisms with osteoarthritis in a ...

    Indian Academy of Sciences (India)

    One-hundred knee OA cases and 100 controls were studied. Statistically significant differences were detected in genotype and allele frequencies between OA and control groups in this population. For knee OA, the highest risk was associated with the variant allele T of the single-nucleotide polymorphism rs12629751 (odds ...

  11. Thrombophilic gene polymorphisms and recurrent pregnancy loss in Greek women. (United States)

    Chatzidimitriou, M; Chatzidimitriou, D; Mavridou, M; Anetakis, C; Chatzopoulou, F; Lialiaris, T; Mitka, S


    Recurrent pregnancy loss (RPL) is a multifactorial disorder. The aim of this study was the detection of various genetic polymorphisms and their correlation to RPL, in Greek women. The impact of 12 thrombophilic polymorphisms was evaluated, among 48 Greek women with a history of RPL, vs 27 healthy parous women. Multiplex PCR and in situ hybridization on nitrocellulose films were performed, to investigate 12 genetic polymorphisms previously reported as risk factors for RPL. Heterozygous FV Leiden, homozygous PAI-1 4G/4G, heterozygous MTHFR C677T, homozygous MTHFR A1298C, as much as the combined thrombophilic genotypes MTHFR 677T + ACE Ι/D, MTHFR 677T/1298C + ACE D/D, ACE I/D + b-fibrinogen -455 G/A, FV HR2 + b-fibrinogen -455 G/A showed a correlation as risk factors for RPL, whereas the rest of the investigated polymorphisms and their combinations did not render statistically significant differences between the two groups in study. The results of this study, as well as those of similar studies, concerning the detection of genetic, environmental, and physiological factors underlying RPL, will prove of critical significance in the investigation and treatment of thrombophilic predisposition, in cases of RPL. © 2017 John Wiley & Sons Ltd.

  12. Non-HLA gene polymorphisms in juvenile idiopathic arthritis

    DEFF Research Database (Denmark)

    Alberdi-Saugstrup, M.; Enevold, C.; Zak, M.


    Objective: To test the hypothesis that non-HLA single-nucleotide polymorphisms (SNPs) associated with the risk of juvenile idiopathic arthritis (JIA) are risk factors for an unfavourable disease outcome at long-term follow-up. Methods: The Nordic JIA cohort is a prospective multicentre study cohort...

  13. Analysis of polymorphisms and selective pressures on ama1 gene ...

    Indian Academy of Sciences (India)

    The apical membrane antigen-1 (AMA-1) of Plasmodium spp. is a merozoite surface antigen that is essential for the recognition and invasion of erythrocytes. Polymorphisms occurring in this surface antigen will cause major obstacles in developing effective malaria vaccines based on AMA-1. The objective of this study was ...

  14. Polymorphisms in the ALOX12 gene and osteoporosis

    DEFF Research Database (Denmark)

    Harsløf, T; Husted, Lise Bjerre; Nyegaard, Mette


    associated with osteoporosis. METHODS: We examined the effect of ALOX12 polymorphisms on BMD and the risk of fractures in two Danish cohorts: AROS, a case-control population comprising 809 individuals and DOPS, a population comprising 1,716 perimenopausal women allocated to hormone therapy or not at baseline...

  15. Yr10 gene polymorphism in bread wheat varieties | Temel | African ...

    African Journals Online (AJOL)

    Yellow rust resistance locus Yr10 located on chromosome 1B in Moro and originated from the Turkish line PI178383 was investigated in terms of polymorphism in seven winter type bread wheat cvs. (Triticum aestivum ssp. Aestivum) Altay2000, zgi2001, Sönmez2001 (yellow rust resistant), Aytýn98, ES14, Harmankaya99 ...

  16. A population frequency analysis of the FABP2 gene polymorphism

    African Journals Online (AJOL)


    DNA was extracted from blood samples for genotype analysis. A PCR-RFLP ... Thr54 genotype. The frequencies of the allele Ala54 and the allele Thr54 of the .... Table 2: Genotype percentages and allele frequencies of FABP2 polymorphism in various ethnic groups. Study Group (n). Genotype %. Allele frequency. P. (vs.

  17. Calpastatin ( CAST ) gene polymorphism in Kajli, Lohi and Thalli ...

    African Journals Online (AJOL)

    Restriction fragment length polymorphisms (RFLPs) in the amplified fragments were studied using Msp1 restriction enzyme. Frequencies of MM, MN and NN genotypes were found to be 77, 20 and 3% in Lohi breed and 68, 26 and 6% in Kajli breed respectively. In Thalli sheep, only the MM (80%) and MN (20%) genotypes ...

  18. An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles (United States)

    Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

  19. Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

    NARCIS (Netherlands)

    Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.


    The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC, in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

  20. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.


    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  1. Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...

    Indian Academy of Sciences (India)

    Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.

  2. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    African Journals Online (AJOL)

    Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier (RFC1) A80G gene polymorphisms on the maternal risk for DS. Patients: This study was conducted in the Medical Genetics Center, Ain-Shams University hospitals, on a total of 170 mothers of children, diagnosed with ...

  3. Methionine synthase A2756G and reduced folate carrier1 A80G ...

    African Journals Online (AJOL)

    Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...

  4. A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105

    Directory of Open Access Journals (Sweden)

    Hiroaki Iwasaka


    Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.

  5. Association of −330 interleukin-2 gene polymorphism with oral cancer

    Directory of Open Access Journals (Sweden)

    Prithvi Kumar Singh


    >Results: IL-2 (−330A>C gene polymorphism was significantly associated with oral cancer whereas it was neither associated with clinicopathological status nor with cancer pain. The AC heterozygous genotype was significantly associated with oral cancer patients as compared to controls [odds ratio (OR: 3.0; confidence interval (CI: 2.14-4.20; PC gene polymorphism was also associated with oral cancer in tobacco smokers and chewers. >Interpretation & conclusions: Our results showed that oral cancer patients had significantly higher frequency of AA genotype but significantly lower frequency of AC genotype and C allele compared to controls. The IL-2 AC genotype and C allele of IL-2 (−330A>C gene polymorphisms could be potential protective factors and might reduce the risk of oral cancer in Indian population.

  6. Angiotensinogen and ACE gene polymorphisms and risk of atrial fibrillation in the general population

    DEFF Research Database (Denmark)

    Ravn, Lasse S; Benn, Marianne; Nordestgaard, Børge G


    OBJECTIVES: The renin-angiotensin system may play a role in the pathogenesis of atrial fibrillation, and renin-angiotensin system blockers reduce the risk of atrial fibrillation. We hypothesized that polymorphisms in the angiotensinogen and angiotensin-converting enzyme (ACE) genes encoding...... in the ACE gene; rare allele frequencies were 0.16, 0.40, 0.12, 0.41, and 0.49, respectively. Participants had sinus rhythm at inclusion. During 26 years of follow-up, 968 individuals developed atrial fibrillation. Multifactorially adjusted hazard ratios for atrial fibrillation for a-20c ac and cc versus aa...... proteins in this system predict risk of atrial fibrillation. METHODS AND RESULTS: We genotyped 9235 individuals from the Danish general population, The Copenhagen City Heart Study, for the a-20c, g-6a, T174M, and M235T polymorphisms in the angiotensinogen gene and the insertion/deletion (I/D) polymorphism...

  7. Canine olfactory receptor gene polymorphism and its relation to odor detection performance by sniffer dogs. (United States)

    Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz


    The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.

  8. Peculiarities of bronchial asthma management in children with allelic GSTT1, GSTM1 gene polymorphism

    Directory of Open Access Journals (Sweden)

    O. K. Коloskova


    Full Text Available Content of peculiarities of basic anti-inflammatory therapy and its efficacy in children with available or absent deletion polymorphism of GSTM1  and GSTT1 genes coding II phase enzymes of GSTM1 and GSTT1 xenobiotic detoxication considering their acetylation status. It is established that in patients of a school age suffering from bronchial asthma with available deletion polymorphism of GSTT1 and GSTМ1 genes associated with slow acetylation phenotype anti-inflammatory therapy should be intensified emphasizing on much higher “step” or by means of addition of other anti-inflammatory drugs. In patients without deletion polymorphism of the examined genes in terms of quick acetylation phenotype average daily doses of iGCS have a tendency to prevailing over the similar ones in patients from the groups of comparison, and their triple administration is reliably higher

  9. Association of Gene Polymorphisms in Interleukin 6 in Infantile Bronchial Asthma. (United States)

    Babusikova, Eva; Jurecekova, Jana; Jesenak, Milos; Evinova, Andrea


    The genetic background of bronchial asthma is complex, and it is likely that multiple genes contribute to its development both directly and through gene-gene interactions. Cytokines contribute to different aspects of asthma, as they determine the type, severity and outcomes of asthma pathogenesis. Allergic asthmatics undergoing an asthmatic attack exhibit significantly higher levels of pro-inflammatory cytokines, such as interleukins and chemokines. In recent years, cytokines and their receptors have been shown to be highly polymorphic, and this prompted us to investigate interleukin 6 promoter polymorphisms at position -174G/C (rs1800795) and at -572G/C (rs1800796) in relation to asthma in children. Interleukin 6 promoter polymorphisms were analyzed in bronchial asthma patients and healthy children using polymerase chain reaction-restriction fragment length polymorphism analysis. We observed a significant association between polymorphism at -174G/C and bronchial asthma (OR=3.4, 95% CI: 2.045-5.638, P<.001). Higher associations between polymorphism at IL-6 -174G/C and bronchial asthma were observed in atopic patients (OR=4.1, 95% CI: 2.308-7.280, P<8.10 -7 ). Interleukin 6 polymorphism is associated with bronchial asthma, particularly its atopic phenotype. Expression and secretion of interleukins in asthmatic patients may be affected by genetic polymorphisms, and could have a disease-modifying effect in the asthmatic airway and modify the therapeutic response. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  10. Multidrug resistance 1 gene polymorphisms may determine Crohn's disease behavior in patients from Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Ana Teresa P. Carvalho


    Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut

  11. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.


    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  12. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    International Nuclear Information System (INIS)

    Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano


    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

  13. Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)


    Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

  14. No Association between Personality and Candidate Gene Polymorphisms in a Wild Bird Population.

    Directory of Open Access Journals (Sweden)

    Hannah A Edwards

    Full Text Available Consistency of between-individual differences in behaviour or personality is a phenomenon in populations that can have ecological consequences and evolutionary potential. One way that behaviour can evolve is to have a genetic basis. Identifying the molecular genetic basis of personality could therefore provide insight into how and why such variation is maintained, particularly in natural populations. Previously identified candidate genes for personality in birds include the dopamine receptor D4 (DRD4, and serotonin transporter (SERT. Studies of wild bird populations have shown that exploratory and bold behaviours are associated with polymorphisms in both DRD4 and SERT. Here we tested for polymorphisms in DRD4 and SERT in the Seychelles warbler (Acrocephalus sechellensis population on Cousin Island, Seychelles, and then investigated correlations between personality and polymorphisms in these genes. We found no genetic variation in DRD4, but identified four polymorphisms in SERT that clustered into five haplotypes. There was no correlation between bold or exploratory behaviours and SERT polymorphisms/haplotypes. The null result was not due to lack of power, and indicates that there was no association between these behaviours and variation in the candidate genes tested in this population. These null findings provide important data to facilitate representative future meta-analyses on candidate personality genes.

  15. DNA Repair Gene Polymorphism and the Risk of Mitral Chordae Tendineae Rupture

    Directory of Open Access Journals (Sweden)

    Aysel Kalayci Yigin


    Full Text Available Polymorphisms in Lys939Gln XPC gene may diminish DNA repair capacity, eventually increasing the risk of carcinogenesis. The aim of the present study was to evaluate the significance of polymorphism Lys939Gln in XPC gene in patients with mitral chordae tendinea rupture (MCTR. Twenty-one patients with MCTR and thirty-seven age and sex matched controls were enrolled in the study. Genotyping of XPC gene Lys939Gln polymorphism was carried out using polymerase chain reaction- (PCR- restriction fragment length polymorphism (RFLP. The frequencies of the heterozygote genotype (Lys/Gln-AC and homozygote genotype (Gln/Gln-CC were significantly different in MCTR as compared to control group, respectively (52.4% versus 43.2%, p=0.049; 38.15% versus 16.2%, p=0.018. Homozygote variant (Gln/Gln genotype was significantly associated with increased risk of MCTR (OR = 2.059; 95% CI: 1.097–3.863; p=0.018. Heterozygote variant (Lys/Gln genotype was also highly significantly associated with increased risk of MCTR (OR = 1.489; 95% CI: 1.041–2.129; p=0.049. The variant allele C was found to be significantly associated with MCTR (OR = 1.481; 95% CI: 1.101–1.992; p=0.011. This study has demonstrated the association of XPC gene Lys939Gln polymorphism with MCTR, which is significantly associated with increased risk of MCTR.

  16. Insulin gene polymorphisms in type 1 diabetes, Addison's disease and the polyglandular autoimmune syndrome type II

    Directory of Open Access Journals (Sweden)

    Hahner Stefanie


    Full Text Available Abstract Background Polymorphisms within the insulin gene can influence insulin expression in the pancreas and especially in the thymus, where self-antigens are processed, shaping the T cell repertoire into selftolerance, a process that protects from β-cell autoimmunity. Methods We investigated the role of the -2221Msp(C/T and -23HphI(A/T polymorphisms within the insulin gene in patients with a monoglandular autoimmune endocrine disease [patients with isolated type 1 diabetes (T1D, n = 317, Addison's disease (AD, n = 107 or Hashimoto's thyroiditis (HT, n = 61], those with a polyglandular autoimmune syndrome type II (combination of T1D and/or AD with HT or GD, n = 62 as well as in healthy controls (HC, n = 275. Results T1D patients carried significantly more often the homozygous genotype "CC" -2221Msp(C/T and "AA" -23HphI(A/T polymorphisms than the HC (78.5% vs. 66.2%, p = 0.0027 and 75.4% vs. 52.4%, p = 3.7 × 10-8, respectively. The distribution of insulin gene polymorphisms did not show significant differences between patients with AD, HT, or APS-II and HC. Conclusion We demonstrate that the allele "C" of the -2221Msp(C/T and "A" -23HphI(A/T insulin gene polymorphisms confer susceptibility to T1D but not to isolated AD, HT or as a part of the APS-II.

  17. Polymorphism of the p53 tumor suppressor gene is associated with susceptibility to uterine leiomyoma. (United States)

    Denschlag, Dominik; Bettendorf, Herta; Watermann, Dirk; Keck, Christoph; Tempfer, Clemens; Pietrowski, Detlef


    To evaluate the association between the presence of uterine leiomyoma and two single nuclear polymorphisms of the p53 tumor suppressor and the angiopoietin-2 (ANGPT2) genes. Prospective case control study. Academic research institution. One hundred thirty-two women with clinically and surgically diagnosed uterine leiomyomas and 280 controls. Peripheral venous puncture. Genotyping was performed by polymerase chain reaction-based amplification of the Arg and Pro variants at codon 72 of the p53 gene and by restriction fragment length polymorphism analysis of the G/G and G/A alleles in exon 4 of the ANGPT2 gene. Comparing women with uterine leiomyomas and controls, no statistically significant difference with respect to allele frequency and genotype distribution were ascertained for the ANGPT2 polymorphism (P=.2 and P=.5, respectively). However, for the p53 tumor suppressor gene polymorphism, statistically significant differences in terms of a higher Pro allele frequency and a higher prevalence of the Pro/Pro genotype among women with uterine leiomyoma (32.0% vs. 16.0%, respectively, and 21.3% vs. 4.7%, respectively) were ascertained (P=.001, OR 1.74; 95% CI 1.24-2.45, P=.001; OR 3.84, 95% CI 1.81-8.14; respectively). Carriage of the p53 polymorphism at codon 72 predicts the susceptibility to leiomyoma in a Caucasian population and may contribute to the pathogenesis of uterine leiomyoma.

  18. Interleukin gene polymorphisms and breast cancer: a case control study and systematic literature review

    International Nuclear Information System (INIS)

    Balasubramanian, SP; Azmy, IAF; Higham, SE; Wilson, AG; Cross, SS; Cox, A; Brown, NJ; Reed, MW


    Interleukins and cytokines play an important role in the pathogenesis of many solid cancers. Several single nucleotide polymorphisms (SNPs) identified in cytokine genes are thought to influence the expression or function of these proteins and many have been evaluated for their role in inflammatory disease and cancer predisposition. The aim of this study was to evaluate any role of specific SNPs in the interleukin genes IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 in predisposition to breast cancer susceptibility and severity. Candidate single nucleotide polymorphisms (SNPs) in key cytokine genes were genotyped in breast cancer patients and in appropriate healthy volunteers who were similar in age, race and sex. Genotyping was performed using a high throughput allelic discrimination method. Data on clinico-pathological details and survival were collected. A systematic review of Medline English literature was done to retrieve previous studies of these polymorphisms in breast cancer. None of the polymorphisms studied showed any overall predisposition to breast cancer susceptibility, severity or to time to death or occurrence of distant metastases. The results of the systematic review are summarised. Polymorphisms within key interleukin genes (IL1A, IL1B, IL1RN, IL4R, IL6 and IL10 do not appear to play a significant overall role in breast cancer susceptibility or severity

  19. [Association of IL-1β-511T gene rs16944 polymorphism with febrile seizures]. (United States)

    Ren, Xiao-Tun; Sun, Su-Zhen; Liu, Fang; Wang, Xiao-Ming


    Despite substantial research efforts worldwide, the role of inflammatory cytokine IL-1β in the onset of febrile seizures (FS) remains controversial. The aim of this study was to assess the relationship between rs16944 polymorphism of the IL-1β-511T gene and occurrence of simple FS in a sample of Han children in northern China. The IL-1β-511T gene rs16944 was genotyped by SNaPshot SNP technique in 141 FS children and 130 healthy control subjects. The genotypic and allelic frequencies in the two groups were comparatively analyzed. There were no significant differences in genotypic and allelic frequencies of rs16944 polymorphism of the IL-1β-511T gene between FS patients and control subjects (P>0.05).When the clinical data on A/A, A/G and G/G genotypes of the rs16944 polymorphism in FS patients, there was statistically significant difference in age of first onset (χ(2)=19.491, Prs16944 polymorphism of the IL-1β-511T gene and the incidence of FS in Han children in Northern China. However, the differences in genotypes of this polymorphism might be associated with pathogenesis and prognosis of simple FS in the population studied.

  20. Relationship between ADD1 Gly460Trp gene polymorphism and essential hypertension in Madeira Island. (United States)

    Sousa, Ana Célia; Palma Dos Reis, Roberto; Pereira, Andreia; Borges, Sofia; Freitas, Ana Isabel; Guerra, Graça; Góis, Teresa; Rodrigues, Mariana; Henriques, Eva; Freitas, Sónia; Ornelas, Ilídio; Pereira, Décio; Brehm, António; Mendonça, Maria Isabel


    Essential hypertension (EH) is a complex disease in which physiological, environmental, and genetic factors are involved in its genesis. The genetic variant of the alpha-adducin gene (ADD1) has been described as a risk factor for EH, but with controversial results.The objective of this study was to evaluate the association of ADD1 (Gly460Trp) gene polymorphism with the EH risk in a population from Madeira Island.A case-control study with 1614 individuals of Caucasian origin was performed, including 817 individuals with EH and 797 controls. Cases and controls were matched for sex and age, by frequency-matching method. All participants collected blood for biochemical and genotypic analysis for the Gly460Trp polymorphism. We further investigated which variables were independently associated to EH, and, consequently, analyzed their interactions.In our study, we found a significant association between the ADD1 gene polymorphism and EH (odds ratio 2.484, P = .01). This association remained statistically significant after the multivariate analysis (odds ratio 2.548, P = .02).The ADD1 Gly460Trp gene polymorphism is significantly and independently associated with EH risk in our population. The knowledge of genetic polymorphisms associated with EH is of paramount importance because it leads to a better understanding of the etiology and pathophysiology of this pathology.

  1. Analysis of Vitamin D Receptor (VDR Gene Polymorphisms in Alopecia Areata

    Directory of Open Access Journals (Sweden)

    Omer Ates


    Full Text Available Aim: Alopecia areata (AA is a disease characterized with hair loss on the hair skin any region of the body. This disease affects approximately 1%u20132% of the general population. The etiopathogenesis of this disease is unclear but infections, genetic, psychological and autoimmune factors is known play to role. Vitamin D is thought to be a regulator of the immune system and the action of it is dependent on the vitamin D receptor (VDR. Given the autoimmune component shared by this autoimmune diseases. In this study investigated the role of VDR gene polymorphisms in the development of AA. Material and Method: The study group included 198 patients with AA and 167 control. Genomic DNA was extracted from blood samples using DNA isolation kit. The frequency of VDR gene polymorphisms genotypes and allelic variants were analyzed by using Polymerase Chain Reaction (PCR and Restriction Fragment Length Polymorphisms (RFLP method. Results: Statistical evaluation of data results showed a not significant association for genotypic frequency distribution between the VDR gene BsmI (rs1544410 and ApaI (rs7975232, TaqI (rs731236 polymorphisms and AA (p=0.8891, 0.7309, 0.6761, respectively. Discussion: Our study reflects that VDR gene polymorphisms could not play a role in determining genetic susceptibility to AA.

  2. [The value of 5-HTT gene polymorphism for the assessment and prediction of male adolescence violence]. (United States)

    Yu, Yue; Liu, Xiang; Yang, Zhen-xing; Qiu, Chang-jian; Ma, Xiao-hong


    To establish an adolescent violence crime prediction model, and to assess the value of serotonin transporter (5-HTT) gene polymorphism for the assessment and prediction of violent crime. Investigative tools were used to analyze the difference in personality dimensions, social support, coping styles, aggressiveness, impulsivity, and family condition scale between 223 adolescents with violence behavior and 148 adolescents without violence behavior. The distribution of 5-HTT gene polymorphisms (5-HTTLPR and 5-HTTVNTR) was compared between the two groups. The role of 5-HTT gene polymorphism on adolescent personality, impulsion and aggression scale also was also analyzed. Stepwise logistic regression was used to establish a predictive model for adolescent violent crime. Significant difference was found between the violence group and the control group on multiple dimensions of psychology and environment scales. However, no statistical difference was found with regard to the 5-HTT genotypes and alleles between adolescents with violent behaviors and normal controls. The rate of prediction accuracy was not significantly improved when 5-HTT gene polymorphism was taken into the model. The violent crime of adolescents was closely related with social and environmental factors. No association was found between 5-HTT polymorphisms and adolescent violence criminal behavior.


    Directory of Open Access Journals (Sweden)

    E. Andreas


    Full Text Available Growth hormone (GH is an anabolic hormone which sintesized and secreted by somatrotop cell inpituitary anterior lobe. GH exert its effect on growth and metabolism by interacting with a specificreceptor on the surface of the target cells. Growth hormone receptor (GHR has been suggested ascandidate gene for traits related to meat production in Bovidae. The objectives of this study were toidentify polymorphism of GH and GHR genes in buffalo. The 452 DNA samples buffalo were collectedfrom five populations in Indonesia (Siborong-Borong-Medan (65, Lebak-Banten (29, Pandeglang-Banten (180, Semarang-Central Java, and Mataram-West Nusa Tenggara (103. A gene fragment of theGH|AluI gene at 432 bp located on exon 3 and GHR|AluI gene at 298 bp on exon 10 were successfullyamplified by using the techniques of a PCR (polymerase chain reaction and genotyped by PCR-RFLP(restriction fragment length polymorphism then -SSCP (single strand conformation polymorphism. Theresults showed no polymorphisms were detected in these genes. All buffaloes tested had LL genotype forlocus GH|AluI and AA genotype for locus GHR|AluI.

  4. An Investigation of the Relationship between PPP1R3 Gene Polymorphism and Type 2 Diabetes

    Directory of Open Access Journals (Sweden)

    Soyar Sari


    Full Text Available Background and Objectives: PPP1R3 is one of the genes confirmed to be associated with type 2 diabetes. This gene is located on the long arm of chromosome 7 and encodes protein phosphatase 1 (PP1, which has serine/threonine phosphatase activity. There is a polymorphic region in the 3'UTR region of this gene, which creates ARE1 and ARE2 alleles. The aim of this study was to determine the relationship between PPP1R3 gene polymorphism and type 2 diabetes. Methods: In this case-control study, 100 patients with type 2 diabetes and 100 healthy individuals, were randomly selected from the study population. PPP1R3 gene polymorphism was analyzed using PCR-RFLP method. Comparison of variables between healthy and patient groups, was performed by t-test, allele frequency by counting, and calculation of their ratio by chi-square test, and the population was confirmed to be in Hardy-Weinberg equilibrium. Distribution of genotypes and alleles was compared between healthy and patient groups. Results: In this study, there was no significant difference between the frequency of genotypes and frequency of alleles in subjects with type 2 diabetes and healthy control subjects. Conclusion: The findings of this study indicated that polymorphisms in the 3'UTR region of PPP1R3 gene is not associated with type 2 diabetes.

  5. [Aldose reductase gene polymorphism and rate of appearance of retinopathy in non insulin dependent diabetics]. (United States)

    Olmos, P; Acosta, A M; Schiaffino, R; Díaz, R; Alvarado, D; O'Brien, A; Muñoz, X; Arriagada, P; Claro, J C; Vega, R; Vollrath, V; Velasco, S; Emmerich, M; Maiz, A


    Recent studies suggest that polymorphisms associated to the aldose reductase gene could be related to early retinopathy in noninsulin dependent diabetics (NIDDM). There is also new interest on the genetic modulation of coagulation factors in relation to this complication. To look for a possible relationship between the rate of appearance of retinopathy and the genotype of (AC)n polymorphic marker associated to aldose reductase gene. A random sample of 27 NIDDM, aged 68.1 +/- 10.6 years, with a mean diabetes duration of 20.7 +/- 4.8 years and a mean glycosilated hemoglobin of 10.6 +/- 1.6%, was studied. The genotype of the (AC)n, polymorphic marker associated to the 5' end of the aldose reductase (ALR2) gene was determined by 32P-PCR plus sequenciation. Mutations of the factor XIII-A gene were studied by single stranded conformational polymorphism, sequenciation and restriction fragment length polymorphism. Four patients lacked the (AC)24 and had a higher rate of appearance of retinopathy than patients with the (AC)24 allele (0.0167 and 0.0907 score points per year respectively, p = 0.047). Both groups had similar glycosilated hemoglobin (11.7 +/- 0.2 and 10.5 +/- 1.6% respectively). Factor XIII gene mutations were not related to the rate of appearance of retinopathy. Our data suggest that the absence of the (AC)24 allele of the (AC)n polymorphic marker associated to the 5' end of the aldose reductase gene, is associated to a five fold reduction of retinopathy appearance rate.

  6. Genetic polymorphism in three glutathione s-transferase genes and breast cancer risk

    Energy Technology Data Exchange (ETDEWEB)

    Woldegiorgis, S.; Ahmed, R.C.; Zhen, Y.; Erdmann, C.A.; Russell, M.L.; Goth-Goldstein, R.


    The role of the glutathione S-transferase (GST) enzyme family is to detoxify environmental toxins and carcinogens and to protect organisms from their adverse effects, including cancer. The genes GSTM1, GSTP1, and GSTT1 code for three GSTs involved in the detoxification of carcinogens, such as polycyclic aromatic hydrocarbons (PAHs) and benzene. In humans, GSTM1 is deleted in about 50% of the population, GSTT1 is absent in about 20%, whereas the GSTP1 gene has a single base polymorphism resulting in an enzyme with reduced activity. Epidemiological studies indicate that GST polymorphisms increase the level of carcinogen-induced DNA damage and several studies have found a correlation of polymorphisms in one of the GST genes and an increased risk for certain cancers. We examined the role of polymorphisms in genes coding for these three GST enzymes in breast cancer. A breast tissue collection consisting of specimens of breast cancer patients and non-cancer controls was analyzed by polymerase chain reaction (PCR) for the presence or absence of the GSTM1 and GSTT1 genes and for GSTP1 single base polymorphism by PCR/RFLP. We found that GSTM1 and GSTT1 deletions occurred more frequently in cases than in controls, and GSTP1 polymorphism was more frequent in controls. The effective detoxifier (putative low-risk) genotype (defined as presence of both GSTM1 and GSTT1 genes and GSTP1 wild type) was less frequent in cases than controls (16% vs. 23%, respectively). The poor detoxifier (putative high-risk) genotype was more frequent in cases than controls. However, the sample size of this study was too small to provide conclusive results.

  7. Chrysanthemum expressing a linalool synthase gene 'smells good', but 'tastes bad' to western flower thrips

    DEFF Research Database (Denmark)

    Yang, Ting; Stoopen, Geert; Thoen, Manus


    Herbivore-induced plant volatiles are often involved in direct and indirect plant defence against herbivores. Linalool is a common floral scent and found to be released from leaves by many plants after herbivore attack. In this study, a linalool/nerolidol synthase, FaNES1, was overexpressed...... less preferred by WFT. Considering the common occurrence of linalool and its glycosides in plant tissues, it suggests that plants may balance attractive fragrance with 'poor taste' using the same precursor compound....

  8. Association between Single Nucleotide Polymorphisms in Vitamin D Receptor Gene Polymorphisms and Permanent Tooth Caries Susceptibility to Permanent Tooth Caries in Chinese Adolescent

    Directory of Open Access Journals (Sweden)

    Miao Yu


    Full Text Available Purpose. Dental caries is a multifactorial infectious disease. In this study, we investigated whether single nucleotide polymorphisms (SNPs in vitamin D receptor (VDR gene were associated with susceptibility to permanent tooth caries in Chinese adolescents. Method. A total of 200 dental caries patients and 200 healthy controls aged 12 years were genotyped for VDR gene polymorphisms using the PCR-restriction fragment length polymorphism (PCR-RFLP assay. All of them were examined for their oral and dental status with the WHO criteria, and clinical information such as the Decayed Missing Filled Teeth Index (DMFT was evaluated. Genomic DNA was extracted from the buccal epithelial cells. The four polymorphic SNPs (Bsm I, Taq I, Apa I, and Fok I in VDR were assessed for both genotypic and phenotypic susceptibilities. Results. Among the four examined VDR gene polymorphisms, the increased frequency of the CT and CC genotype of the Fok I VDR gene polymorphism was associated with dental caries in 12-year-old adolescent, compared with the controls (X2 = 17.813, p≤0.001. Moreover, Fok I polymorphic allele C frequency was significantly increased in the dental caries cases, compared to the controls (X2 = 14.144, p≤0.001, OR = 1.730, 95% CI = 1.299–2.303. However, the other three VDR gene polymorphisms (Bsm I, Taq I, and Apa I showed no statistically significant differences in the caries groups compared with the controls. Conclusion. VDR-Fok I gene polymorphisms may be associated with susceptibility to permanent tooth caries in Chinese adolescent.

  9. Association between polymorphism at 3 ׳UTR of urokinase gene and risk of calcium

    Directory of Open Access Journals (Sweden)

    S. Morovvati


    Full Text Available Background: Kidney stone is a common multifactorial disease in Iran. Environmental and genetic factors including single nucleotide polymorphism (SNP affect the incidence of kidney stones. Objective: The aim of this study was to determine the association of +4065 T/C polymorphism at 3′untranslated region (3'UTR of urokinase gene and calcium kidney stones. Methods: This case-control study was conducted on 70 patients with history of calcium kidney stones as case group and 70 healthy subjects as control group in the Baqiyatallah hospital in 2013. The polymorphism was assessed using the Allele Specific PCR (AS-PCR method. Allele and genotype frequencies of the two groups were compared using 2x2 contingency tables. Hardy-Weinberg equilibrium was compared between the two groups using Chi-square test. Findings: Of 70 cases, 10 (15% were heterozygous and 24 (34% were homozygous for the polymorphism. Of 70 controls, 25 (35% were heterozygous for the polymorphism. The frequency of mutant T allele was 41% in the case group and 18% in the control group. The frequency of mutant C allele was 59% in the case group and 82% in the control group. The risk of calcium kidney stones in carriers of the mutant allele was 1.7 times higher than non-carriers (OR: 1.7. Conclusion: With regards to the results, it seems that there is a significant association between the polymorphism at 3 ׳UTR of urokinase gene and formation of calcium kidney stones. Urokinase gene polymorphism may be introduced as a candidate gene involved in calcium stone formation.

  10. The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

    DEFF Research Database (Denmark)

    Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo


    identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

  11. Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

    DEFF Research Database (Denmark)

    Liepman, Aaron H; Nairn, C Joseph; Willats, William G T


    from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

  12. Codon 201Gly Polymorphic Type of the DCC Gene is Related to Disseminated Neuroblastoma

    Directory of Open Access Journals (Sweden)

    Xiao-Tang Kong


    Full Text Available The deleted in colorectal carcinoma (DCC gene is a potential tumor- suppressor gene on chromosome 18821.3. The relatively high frequency of loss of heterozygosity (LOH and loss of expression of this gene in neuroblastoma, especially in the advanced stages, imply the possibility of involvement of the DCC gene in progression of neuroblastoma. However, only few typical mutations have been identified in this gene, indicating that other possible mechanisms for the inactivation of this gene may exist. A polymorphic change (Arg to Gly at DCC codon 201 is related to advanced colorectal carcinoma and increases in the tumors with absent DCC protein expression. In order to understand whether this change is associated with the development or progression of neuroblastoma, we investigated codon 201 polymorphism of the DCC gene in 102 primary neuroblastomas by polymerase chain reaction single-strand conformation polymorphism. We found no missense or nonsense mutations, but a polymorphic change from CGA (Arg to GGA (Gly at codon 201 resulting in three types of polymorphism: codon 201Gly type, codon 201Arg/Gly type, and codon 201Arg type. The codon 201Gly type occurred more frequently in disseminated (stages IV and IVs neuroblastomas (72% than in localized (stages I, II, and III tumors (48% (P=.035, and normal controls (38% (P=.024. In addition, the codon 201Gly type was significantly more common in tumors found clinically (65% than in those found by mass screening (35% (P=.002. The results suggested that the codon 201Gly type of the DCC gene might be associated with a higher risk of disseminating neuroblastoma.

  13. Polymorphism of the ACE gene and the risk of obstructive sleep apnoea. (United States)

    Chmielewska, Izabela; Mlak, Radosław; Krawczyk, Paweł; Czukiewska, Ewa; Milanowski, Janusz


    Obstructive sleep apnoea/hypopnea syndrome (OSA) is characterized by obstruction of the upper airway during sleep, resulting in repetitive breathing pauses accompanied by oxygen desaturation and arousal from sleep. Among the candidate genes affecting the risk of OSA, genes whose polymorphisms influence the development of diseases with similar pathogenesis such as OSA could be listed: APOE, genes for leptin and leptin receptor, TNFA1, ADRB2 and ACE (gene for angiotensin-converting enzyme). Until now there has been a confirmed relationship between ACE gene polymorphism and cardiovascular diseases, but its effect on the incidence of OSA is debatable. The aim of this study was to investigate the effect of ACE gene insertion/deletion (I/D) polymorphism on the risk of OSA. Fifty-five patients with confirmed diagnose of OSA and qualified to CPAP therapy entered the study. The control group included 50 subjects who did not complain of any sleep related symptoms. Diagnose of OSA was set on the basis of full overnight polysomnography together with Epworth Sleepiness Scale according to American Academy of Sleep Medicine guidelines. DNA was isolated from peripheral blood leukocytes with Qiagen DNA mini Kit. ACE gene polymorphism was determined in genomic DNA using allele specific polymerase chain reaction. Different sizes of PCR products were observed on agarose gel electrophoresis. There were non-significant differences in the frequency of ACE genotypes. However, allele D had significantly lower prevalence in the study group than in the control group. (χ(2) = 4.25 p = 0.04). Moreover, I allele carriers had a threefold greater risk of developing OSA (HR = 2.748, 95% CI = 1.029-7.340, p gene polymorphism might be useful to determine the risk of developing OSA in clinically predisposed patients.

  14. Association of DPP4 Gene Polymorphisms with Type 2 Diabetes Mellitus in Malaysian Subjects


    Ahmed, Radwan H.; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D.; Al-absi, Boshra; Muniandy, Sekaran


    Background Genetic polymorphisms of the Dipeptidyl Peptidase 4 (DPP4) gene may play a role in the etiology of type 2 diabetes mellitus (T2DM). This study aimed to investigate the possible association of single nucleotide polymorphisms (SNPs) of the DPP4 gene in Malaysian subjects with T2DM and evaluated whether they had an effect on the serum levels of soluble dipeptidyl peptidase 4 (sDPP-IV). Method Ten DPP4 SNPs were genotyped by TaqMan genotyping assays in 314 subjects with T2DM and 235 co...

  15. Codon 129 polymorphism of prion protein gene in is not a risk factor for Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Jerusa Smid


    Full Text Available Interaction of prion protein and amyloid-b oligomers has been demonstrated recently. Homozygosity at prion protein gene (PRNP codon 129 is associated with higher risk for Creutzfeldt-Jakob disease. This polymorphism has been addressed as a possible risk factor in Alzheimer disease (AD. Objective To describe the association between codon 129 polymorphisms and AD. Methods We investigated the association of codon 129 polymorphism of PRNP in 99 AD patients and 111 controls, and the association between this polymorphism and cognitive performance. Other polymorphisms of PRNP and additive effect of apolipoprotein E gene (ApoE were evaluated. Results Codon 129 genotype distribution in AD 45.5% methionine (MM, 42.2% methionine valine (MV, 12.1% valine (VV; and 39.6% MM, 50.5% MV, 9.9% VV among controls (p>0.05. There were no differences of cognitive performance concerning codon 129. Stratification according to ApoE genotype did not reveal difference between groups. Conclusion Codon 129 polymorphism is not a risk factor for AD in Brazilian patients.

  16. Polymorphisms of interleukin-1β and MUC7 genes in burning mouth syndrome. (United States)

    Kim, Moon-Jong; Kim, Jihoon; Chang, Ji-Youn; Kim, Yoon-Young; Kho, Hong-Seop


    The objectives of the present study are to compare polymorphisms of the IL-1β and MUC7 genes between patients with burning mouth syndrome (BMS) and controls and to investigate relationships between these polymorphisms and clinical characteristics in BMS patients. Forty female BMS patients and 40 gender- and age-matched controls were included. Genomic DNA was extracted from saliva samples. Single-nucleotide polymorphisms of IL-1β -511 and +3954 and variation in number of tandem repeat (VNTR) polymorphism of MUC7 were analyzed. Relationships between genotypic polymorphism data and clinical characteristics in BMS patients were also analyzed. There were no significant differences in the genotypes of IL-1β -511 and +3954 and of MUC7 between the groups. There were no significant differences in symptom duration and intensity of BMS patients according to their IL-1β and MUC7 genotypes. The T allele of IL-1β -511 showed associations with psychometry results in BMS patients: paranoid ideation (P = 0.014), Global Severity Index (P = 0.025), and Positive Symptom Total (P = 0.008). The genotypic polymorphisms of IL-1β -511 and +3954, and of MUC7 VNTR, had no direct associations with the development of BMS. However, the T allele of IL-1β -511 may increase the risk of BMS by increasing psychological asthenia. The genotypic polymorphisms of IL-1β -511 may increase the risk for the development of BMS by increasing psychological asthenia.

  17. Uterine leiomyoma is associated with a polymorphism in the interleukin 1-beta gene. (United States)

    Pietrowski, Detlef; Thewes, Roberta; Sator, Michael; Denschlag, Dominik; Keck, Christoph; Tempfer, Clemens


    To investigate whether polymorphisms in the interleukin-1beta (IL-1beta) gene are associated with uterine leiomyoma. Case-control study in a collective of 131 patients and 280 controls. Genotyping of the IL-1beta-511 and IL-1beta-3954 polymorphism was performed by PCR amplification and subsequent RFLP analysis. A significant difference in the allele frequencies of the IL-1beta-511 Cpolymorphism was found. Allele frequencies of the IL-1beta-511 Cpolymorphism were 70.6% (C allele) in the patient group and 57.1% in the control group [P < 0.0002; odds ratio (OR) 1.81; 95% confidence interval (CI): 1.32-2.47]. The genotype distributions showed also differences using a dominant genotype model (C/C vs. C/T+T/T; P < 0.0002; OR 2.73; 95% CI: 1.77-4.2). No difference was found in the IL-1beta-3954 polymorphism. The IL-1beta-511 promoter polymorphism is related to an increased susceptibility to uterine leiomyoma, suggesting that this polymorphism does contribute to the development of this disease.

  18. Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea). (United States)

    Yang, Ji; Gu, Hongya; Yang, Ziheng


    Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

  19. Genome-Wide Identification, Evolutionary and Expression Analyses of the GALACTINOL SYNTHASE Gene Family in Rapeseed and Tobacco

    Directory of Open Access Journals (Sweden)

    Yonghai Fan


    Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.

  20. Haptoglobin gene polymorphisms in peri-implantitis and chronic periodontitis. (United States)

    Ebadian, Ahmad R; Kadkhodazadeh, Mahdi; Naghavi, Seyed Hamid Hosseini; Torshabi, Maryam; Tamizi, Mahmood


    The haptoglobin-hemoglobin (Hp-Hb) complex plays a significant role in regulating immune responses and acts as a bacteriostatic agent. Haptoglobin polymorphisms result in different Hb binding affinities. This study sought to assess whether Hp 2-2 could be a genetic determinant for increasing the risk of peri-implantitis and chronic periodontitis. Of the Iranian subjects referred to the Department of Periodontics, Shahid Beheshti University, Tehran, 203 were entered into the study, including 117 patients and 86 periodontally healthy individuals. Polymerase chain reaction (PCR) was performed for genotyping. Data were analyzed by Kruskal-Wallis test using the SPSS statistics software package. The prevalence of Hp 2-2, 2-1, and 1-1 did not differ significantly between patients and healthy subjects (P > 0.05). The highest frequencies of Hp 1-1, 2-1, and 2-2 genotypes were seen in the control (7%), peri-implantitis (51%) and periodontitis (64%) groups, respectively. Haptoglobin polymorphisms may not play a role in development of peri-implantitis or chronic periodontitis among Iranians but we strongly suggest researchers to evaluate this polymorphism in further studies on larger sample sizes, different populations, and other types of periodontitis. © 2013 Wiley Publishing Asia Pty Ltd.

  1. Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.). (United States)

    Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder


    Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

  2. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta


    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  3. Analysis of polymorphisms and selective pressures on ama1 gene ...

    Indian Academy of Sciences (India)

    Chuen Yang Chua


    Sep 5, 2017 ... The presence of purifying selection and low nucleotide diversity ... (2000) studied the gene substitution of ama1 ... in the gene coding for AMA-1 protein in Plasmodium ... Health Malaysia. ...... X. Asembo Bay Cohort Project.

  4. Polymorphism in TNP-1 gene of Murrah buffalo bulls | Panigrahi ...

    African Journals Online (AJOL)

    ... spermatids, have been reported to be important for histone displacement and chromatin ... (TNP-1) gene was analyzed using polymerase chain reaction-single strand ... Analysis of TNP-1 gene sequence of Murrah buffalo revealed 3 single ...

  5. Evaluation of ACE gene I/D polymorphism in Iranian elite athletes. (United States)

    Shahmoradi, Somayeh; Ahmadalipour, Ali; Salehi, Mansoor


    Angiotensin converting enzyme (ACE) is an important gene, which is associated with the successful physical activity. The ACE gene has a major polymorphism (I/D) in intron 16 that determines its plasma and tissue levels. In this study, we aimed to determine whether there is an association between this polymorphism and sports performance in our studied population including elite athletes of different sports disciplines. We investigated allele frequency and genotype distribution of the ACE gene in 156 Iranian elite athletes compared to 163 healthy individuals. We also investigated this allele frequency between elite athletes in three functional groups of endurance, power, and mixed sports performances. DNA was extracted from peripheral blood, and polymerase chain reaction (PCR) method was performed on intron 16 of the ACE gene. The ACE genotype was determined for each subject. Statistical analysis was performed by SPSS 15, and results were analyzed by Chi-Square test. There was a significant difference in genotype distribution and allele frequency of the ACE gene in athletes and control group (P = 0.05, P = 0.03, respectively). There was also a significant difference in allele frequency of the ACE gene in 3 groups of athletes with different sports disciplines (P = 0.045). Proportion of the ACE gene D allele was greater in elite endurance athletes (37 high-distance cyclists) than two other groups. Findings of the present study demonstrated that there is an association between the ACE gene I/D polymorphism and sports performance in Iranian elite athletes.

  6. Interleukin gene polymorphisms in Chinese Han population with breast cancer, a case-control study. (United States)

    Zuo, Xiaoxiao; Li, Miao; Yang, Ya; Liang, Tiansong; Yang, Hongyao; Zhao, Xinhan; Yang, Daoke


    Cytokines are known as important regulators of the cancer involved in inflammatory and immunological responses. This fact and plethora of gene polymorphism data prompted us to investigate IL1 gene polymorphisms in breast cancer (BC) patients. Totally, 530 patients with BC and 628 healthy control women were studied. The genetic polymorphisms for IL1 were analyzed by Massarray Sequencing method. Three single nucleotide polymorphisms (SNPs) identified in IL1B, IL1R1 gene are thought to influence breast cancer risk. The results of the association between IL-1B, IL1R1 polymorphisms and breast cancer risk have significant. We found that the variant TT genotype of rs10490571 was associated with a significantly increased breast cancer risk (TT vs. CC: OR = 2.82, 95% CI = 1.12-7.08, P = 0.047 for the codominant model). For rs16944 (AG vs. GG: OR = 0.60, 95% CI = 0.41-0.90, P = 0.034 for the codominant model) and rs1143623 (CG vs. CC: OR = 0.65, 95% CI = 0.45-0.94, P = 0.023 for the codominant model) have significant associations were found in genetic models. In conclusion, the present analysis suggests a correlation of polymorphic markers within the IL-1 gene locus with the risk in developing breast cancer. Taken together with our finding that IL1B, IL1R1 gene three SNP are also associated with the risk for the disease, we suggest that inflammation via innate and adaptive immunity contributes to multifactorial hereditary predisposition to pathogenesis of the breast cancer.

  7. Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer. (United States)

    Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling


    Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

  8. Association of polymorphisms of interleukin-18 gene promoter region with polycystic ovary syndrome in chinese population

    Directory of Open Access Journals (Sweden)

    Li Mei-zhi


    Full Text Available Abstract Background Recent research shows that polycystic ovary syndrome (PCOS may have an association with low-grade chronic inflammation, and that PCOS may induce an increase in serum interleukin-18 (IL-18 levels. Methods To investigate the polymorphisms of the IL-18 gene promoters with PCOS, two single nucleotide polymorphisms (SNPs in the promoter of the IL-18 gene (at positions -607C/A and -137G/C in 118 Chinese women with PCOS and 79 controls were evaluated using polymerase chain reaction (PCR. Results No significant differences were found in the genotype distribution, allele frequency and haplotype frequency between the PCOS and control groups. Further analysis demonstrated a relationship between IL-18 gene promoter polymorphisms and PCOS insulin resistance (IR. Regarding the -137 allele frequency, G and C allele frequencies were 93.5% and 6.5%, respectively, in the PCOS with IR patients; G and C allele frequencies were 85.4% and 14.6%, respectively, in PCOS patients without IR (chi2 = 3.601, P = 0.048. Conclusions The presence of a polymorphism in the IL-18 gene was found to have no correlation with the occurrence of PCOS. Carriage of the C allele at position -137 in the promoter of the IL-18 gene may play a protective role from the development of PCOS IR.

  9. General and Specific Genetic Polymorphism of Cytokines-Related Gene in AITD

    Directory of Open Access Journals (Sweden)

    Chen Xiaoheng


    Full Text Available Autoimmune thyroid disease (AITD shows the highest incidence among organ-specific autoimmune diseases and is the most common thyroid disease in humans, including Graves’ disease (GD and Hashimoto’s thyroiditis (HT. The susceptibility to autoimmune diseases is affected by increased autoantibody levels, susceptibility gene polymorphisms, environmental factors, and psychological factors, but the pathogenesis remains unclear. Various cytokines and related genes encoding them play important roles in the development and progression of AITD. CD152, an expression product of the CTLA-4 gene, downregulates T cell activation. The A/A genotype polymorphism in the CT60 locus may reduce the production of thyroid autoantibodies. The C1858T polymorphism of the PTNP22 gene reduces the expression of its encoded LYP, which increases the risk of GD and HT. GD is an organ-specific autoimmune disease involving increased secretion of thyroid hormone, whereas HT may be associated with the destruction of thyroid gland tissue and hypothyroidism. These two diseases exhibit similar pathogenesis but opposite trends in the clinical manifestations. In this review, we focus on the structure and function of these cytokines and related genes in AITD, as well as the association of polymorphisms with susceptibility to GD and HT, and attempt to describe their differences in pathogenesis and clinical manifestations.

  10. Are Toll-like receptor gene polymorphisms associated with prostate cancer?

    International Nuclear Information System (INIS)

    Kutikhin, Anton G; Yuzhalin, Arseniy E


    The suggestion that there is a connection between chronic intraprostatic inflammation and prostate cancer was declared some years ago. As Toll-like receptors (TLRs) are the key players in the processes of chronic intraprostatic inflammation, there is a hypothesis that TLR gene polymorphisms may be associated with prostate cancer risk. Although a number of comprehensive studies have been conducted on large samples in various countries, reliable connections between these single nucleotide polymorphisms and prostate cancer risk, stage, grade, aggressiveness, ability to metastasize, and mortality have not been detected. Results have also varied slightly in different populations. The data obtained regarding the absence of connection between the polymorphisms of the genes encoding interleukin-1 receptor-associated kinases (IRAK1 and IRAK4) and prostate cancer risk might indicate a lack of association between inherited variation in the TLR signaling pathway and prostate cancer risk. It is possible to consider that polymorphisms of genes encoding TLRs and proteins of the TLR pathway also do not play a major role in the etiology and pathogenesis of prostate cancer. Feasibly, it would be better to focus research on associations between TLR single nucleotide polymorphisms and cancer risk in other infection-related cancer types

  11. Combination of interleukin-10 gene promoter polymorphisms with HLA-DRB1*15 allele is associated with multiple sclerosis

    Directory of Open Access Journals (Sweden)

    Majid Shahbazi


    Interpretation & conclusions: The IL-10 and HLA-DRB1*15 polymorphisms were associated with the susceptibility to MS in Iranian patients. Our results suggest that gene-gene interaction of IL-10 polymorphisms and HLA-DRB1*15 alleles may be important factors in the development of MS.

  12. Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon. (United States)

    Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep


    GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase. (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M


    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  14. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua


    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  15. Association of Polymorphism in Gene of Pregnancy-Associated Plasma Protein A (PAPPA and Preeclampsia

    Directory of Open Access Journals (Sweden)

    Nasrin Moghaddam


    Full Text Available Background: Preeclampsia is a common disorder of pregnancy. Current study was conducted to determine the association of polymorphism in gene of pregnancy-associated plasma protein A (PAPPA and preeclampsia. Methods: In this prospective cohort study, 134 pregnant women were consecutively enrolled and the blood sampling was performed for genetic analysis in a single lab. Then the subjects were followed-up for preeclampsia and it was seen that 34 women developed preeclampsia and the polymorphism of PAPPA gene was compared between those with and without preeclampsia. Results: The results demonstrated that despite twice higher proportion of CC condition of PAPPA in those with preeclampsia in comparison with those with normal pregnancy, there was no significant difference between two groups (P > 0.05. Conclusions: Totally, according to the obtained results, it may be concluded that polymorphism of pregnancy-associated plasma protein A is not related to occurrence of preeclampsia in pregnant women.

  16. Human Retrotransposon Insertion Polymorphisms Are Associated with Health and Disease via Gene Regulatory Phenotypes

    Directory of Open Access Journals (Sweden)

    Lu Wang


    Full Text Available The human genome hosts several active families of transposable elements (TEs, including the Alu, LINE-1, and SVA retrotransposons that are mobilized via reverse transcription of RNA intermediates. We evaluated how insertion polymorphisms generated by human retrotransposon activity may be related to common health and disease phenotypes that have been previously interrogated through genome-wide association studies (GWAS. To address this question, we performed a genome-wide screen for retrotransposon polymorphism disease associations that are linked to TE induced gene regulatory changes. Our screen first identified polymorphic retrotransposon insertions found in linkage disequilibrium (LD with single nucleotide polymorphisms that were previously associated with common complex diseases by GWAS. We further narrowed this set of candidate disease associated retrotransposon polymorphisms by identifying insertions that are located within tissue-specific enhancer elements. We then performed expression quantitative trait loci analysis on the remaining set of candidates in order to identify polymorphic retrotransposon insertions that are associated with gene expression changes in B-cells of the human immune system. This progressive and stringent screen yielded a list of six retrotransposon insertions as the strongest candidates for TE polymorphisms that lead to disease via enhancer-mediated changes in gene regulation. For example, we found an SVA insertion within a cell-type specific enhancer located in the second intron of the B4GALT1 gene. B4GALT1 encodes a glycosyltransferase that functions in the glycosylation of the Immunoglobulin G (IgG antibody in such a way as to convert its activity from pro- to anti-inflammatory. The disruption of the B4GALT1 enhancer by the SVA insertion is associated with down-regulation of the gene in B-cells, which would serve to keep the IgG molecule in a pro-inflammatory state. Consistent with this idea, the B4GALT1 enhancer

  17. Evaluation of serum osteopontin level and gene polymorphism as biomarkers

    DEFF Research Database (Denmark)

    Prasmickaite, Lina; Berge, Gisle; Bettum, Ingrid J


    samples from 275 high-risk melanoma patients enrolled in the Nordic Adjuvant IFN Melanoma trial were analyzed for circulating OPN concentrations and OPN promoter polymorphisms in position -443. The potential relation between serum OPN levels, the genotypes and survival in non-treated patients and patients...... receiving adjuvant IFN-α was investigated. Although slightly better survival was observed in the treated patients that had high levels of OPN, the difference was not statistically significant. In conclusion, serum OPN (its level or the genotype) cannot distinguish melanoma patients with poor prognosis...

  18. Functional gene polymorphism to reveal species history: the case of the CRTISO gene in cultivated carrots.

    Directory of Open Access Journals (Sweden)

    Vanessa Soufflet-Freslon

    Full Text Available Carrot is a vegetable cultivated worldwide for the consumption of its root. Historical data indicate that root colour has been differentially selected over time and according to geographical areas. Root pigmentation depends on the relative proportion of different carotenoids for the white, yellow, orange and red types but only internally for the purple one. The genetic control for root carotenoid content might be partially associated with carotenoid biosynthetic genes. Carotenoid isomerase (CRTISO has emerged as a regulatory step in the carotenoid biosynthesis pathway and could be a good candidate to show how a metabolic pathway gene reflects a species genetic history.In this study, the nucleotide polymorphism and the linkage disequilibrium among the complete CRTISO sequence, and the deviation from neutral expectation were analysed by considering population subdivision revealed with 17 microsatellite markers. A sample of 39 accessions, which represented different geographical origins and root colours, was used. Cultivated carrot was divided into two genetic groups: one from Middle East and Asia (Eastern group, and another one mainly from Europe (Western group. The Western and Eastern genetic groups were suggested to be differentially affected by selection: a signature of balancing selection was detected within the first group whereas the second one showed no selection. A focus on orange-rooted carrots revealed that cultivars cultivated in Asia were mainly assigned to the Western group but showed CRTISO haplotypes common to Eastern carrots.The carotenoid pathway CRTISO gene data proved to be complementary to neutral markers in order to bring critical insight in the cultivated carrot history. We confirmed the occurrence of two migration events since domestication. Our results showed a European background in material from Japan and Central Asia. While confirming the introduction of European carrots in Japanese resources, the history of Central Asia

  19. Effect of deletion of chitin synthase genes on mycelial morphology and culture viscosity in Aspergillus oryzae

    DEFF Research Database (Denmark)

    Müller, Christian; Hansen, K.; Szabo, Peter


    The objective of this study was to quantify the effect of disrupting two chitin synthases, chsB and csmA, on the morphology and rheology during batch cultivation of Aspergillus oryzae. The rheological properties were characterized in batch cultivations at different biomass concentrations (from 3...... broth was significantly affected by the biomass concentration, the morphology, and also by pH. The chsB disruption strain had lower consistency index K values for all biomass concentrations investigated, which is a desirable trait for industrial Aspergillus fermentations. (C) 2003 Wiley Periodicals, Inc....

  20. Polymorphism and methylation of the MC4R gene in obese and non-obese dogs. (United States)

    Mankowska, Monika; Nowacka-Woszuk, Joanna; Graczyk, Aneta; Ciazynska, Paulina; Stachowiak, Monika; Switonski, Marek


    The dog is considered to be a useful biomedical model for human diseases and disorders, including obesity. One of the numerous genes associated with human polygenic obesity is MC4R, encoding the melanocortin 4 receptor. The aim of our study was to analyze polymorphisms and methylation of the canine MC4R in relation to adiposity. Altogether 270 dogs representing four breeds predisposed to obesity: Labrador Retriever (n = 187), Golden Retriever (n = 38), Beagle (n = 28) and Cocker Spaniel (n = 17), were studied. The dogs were classified into three groups: lean, overweight and obese, according to the 5-point Body Condition Score (BCS) scale. In the cohort of Labradors a complete phenotypic data (age, sex, neutering status, body weight and BCS) were collected for 127 dogs. The entire coding sequence as well as 5' and 3'-flanking regions of the studied gene were sequenced and six polymorphic sites were reported. Genotype frequencies differed considerably between breeds and Labrador Retrievers appeared to be the less polymorphic. Moreover, distribution of some polymorphic variants differed significantly (P C, c.868C>T and c.*33C>G) and Beagles (c.-435T>C and c.637G>T). On the contrary, in Labradors no association between the studied polymorphisms and BCS or body weight was observed. Methylation analysis, using bisulfite DNA conversion followed by Sanger sequencing, was carried out for 12 dogs with BCS = 3 and 12 dogs with BCS = 5. Two intragenic CpG islands, containing 19 cytosines, were analyzed and the methylation profile did not differ significantly between lean and obese animals. We conclude that an association of the MC4R gene polymorphism with dog obesity or body weight is unlikely, in spite of the fact that some associations were found in small cohorts of Beagles and Golden Retrievers. Also methylation level of this gene is not related with dog adiposity.

  1. Haemochromatosis HFE gene polymorphisms as potential modifiers of hereditary nonpolyposis colorectal cancer risk and onset age. (United States)

    Shi, Zumin; Johnstone, Daniel; Talseth-Palmer, Bente A; Evans, Tiffany-Jane; Spigelman, Allan D; Groombridge, Claire; Milward, Elizabeth A; Olynyk, John K; Suchy, Janina; Kurzawski, Grzegorz; Lubinski, Jan; Scott, Rodney J


    Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by germline mutations in DNA mismatch repair genes; however, variation in disease expression suggests that there are potential modifying factors. Polymorphisms of the HFE gene, which cause the iron overload disorder hereditary haemochromatosis, have been proposed as potential risk factors for the development of colorectal cancer (CRC). To understand the relationship between HNPCC disease phenotype and polymorphisms of the HFE gene, a total of 362 individuals from Australia and Poland with confirmed causative MMR gene mutations were genotyped for the HFE C282Y and H63D polymorphisms. A significantly increased risk of developing CRC was observed for H63D homozygotes when compared with combined wild-type homozygotes and heterozygotes (hazard ratio = 2.93, p = 0.007). Evidence for earlier CRC onset was also observed in H63D homozygotes with a median age of onset 6 years earlier than wild type or heterozygous participants (44 vs. 50 years of age). This effect was significant by all tests used (log-rank test p = 0.026, Wilcoxon p = 0.044, Tarone-Ware p = 0.035). No association was identified for heterozygosity of either polymorphism and limitations on power-prevented investigation of C282Y homozygosity or compound C282Y/H63D heterozygosity. In the Australian sample only, women had a significantly reduced risk of developing CRC when compared with men (hazard ratio = 0.58, p = 0.012) independent of HFE genotype for either single nucleotide polymorphisms. In conclusion, homozygosity for the HFE H63D polymorphism seems to be a genetic modifier of disease expression in HNPCC. Understanding the mechanisms by which HFE interrelates with colorectal malignancies could lead to reduction of disease risk in HNPCC.

  2. Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

    Directory of Open Access Journals (Sweden)

    Marquez Rodolfo


    Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

  3. A systematic review of meta-analyses on gene polymorphisms and gastric cancer risk

    NARCIS (Netherlands)

    F. Gianfagna (Francesco); E. de Feo (Emma); C.M. van Duijn (Cornelia); G. Ricciardi (Gualtiero); S. Boccia (Stefania)


    textabstractBackground: Individual variations in gastric cancer risk have been associated in the last decade with specific variant alleles of different genes that are present in a significant proportion of the population. Polymorphisms may modify the effects of environmental exposures, and these


    Nucleotide sequencing of polymerase chain reaction-amplified intron region of the Cryptosporidium parvum B-tubulin gene in 26 human and 15 animal isolates revealed distinct genetic polymorphism between the human and bovine genotypes. The separation of 2 genotypes of C. parvum is...

  5. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  6. Effect of CYP2C9*3 gene polymorphism on lipid-lowering efficacy of ...

    African Journals Online (AJOL)

    Purpose: To investigate the frequency of gene CYP2C9*3 in Chinese populations, and to analyze the impact of CYP2C9*3 genetic polymorphism on the cholesterol-lowering effect of fluvastatin in a Chinese hyperlipidemic population. Methods: CYP2C9 genotype was determined by polymerase chain reaction - restriction ...

  7. High-density polymorphisms analysis of 23 candidate genes for association with bone mineral density. (United States)

    Giroux, Sylvie; Elfassihi, Latifa; Clément, Valérie; Bussières, Johanne; Bureau, Alexandre; Cole, David E C; Rousseau, François


    Osteoporosis is a bone disease characterized by low bone mineral density (BMD), a highly heritable and polygenic trait. Women are more prone than men to develop osteoporosis due to a lower peak bone mass and accelerated bone loss at menopause. Peak bone mass has been convincingly shown to be due to genetic factors with heritability up to 80%. Menopausal bone loss has been shown to have around 38% to 49% heritability depending on the site studied. To have more statistical power to detect small genetic effects we focused on premenopausal women. We studied 23 candidate genes, some involved in calcium and vitamin-D regulation and others because estrogens strongly induced their gene expression in mice where it was correlated with humerus trabecular bone density. High-density polymorphisms were selected to cover the entire gene variability and 231 polymorphisms were genotyped in a first sample of 709 premenopausal women. Positive associations were retested in a second, independent, sample of 673 premenopausal women. Ten polymorphisms remained associated with BMD in the combined samples and one was further associated in a large sample of postmenopausal women (1401 women). This associated polymorphism was located in the gene CSF3R (granulocyte colony stimulating factor receptor) that had never been associated with BMD before. The results reported in this study suggest a role for CSF3R in the determination of bone density in women. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. IL-1RN gene polymorphism is associated with peri-implantitis

    NARCIS (Netherlands)

    Laine, Marja L.; Leonhardt, Asa; Roos-Jansaker, Ann-Marie; Salvador Pena, A.; van Winkelhoff, Arie Jan; Winkel, Edwin G.; Renvert, Stefan

    Objectives: Interleukin (IL)-1 alpha, IL-1 beta and their natural specific inhibitor IL-1 receptor antagonist (IL-1ra) play a key role in the regulation of the inflammatory response in periodontal tissues. Polymorphisms in the IL-1 gene cluster have been associated with severe adult periodontitis.

  9. The role of glutathione S-transferase and claudin-1 gene polymorphisms in contact sensitization

    DEFF Research Database (Denmark)

    Ross-Hansen, K; Linneberg, A; Johansen, J D


    BACKGROUND: Contact sensitization is frequent in the general population and arises from excessive or repeated skin exposure to chemicals and metals. However, little is known about its genetic susceptibility. OBJECTIVES: To determine the role of polymorphisms of glutathione S-transferase (GST) genes...

  10. JP-3 gene polymorphism in a healthy population of Serbia and ...

    Indian Academy of Sciences (India)


    sions are the cause of Huntington disease like-2 (HDL-2) phenotype. CTG repeats in ... Analyses of CTG repeat polymorphism of JP-3 gene in various healthy populations could help in estimating ... of a recently described membrane protein family exclu- .... low frequency of larger alleles in German population based on very ...

  11. Polymorphisms in the glucocorticoid receptor gene and their associations with metabolic parameters and body composition

    NARCIS (Netherlands)

    S.W.J. Lamberts (Steven); E.F.C. van Rossum (Liesbeth)


    textabstractMost actions of glucocorticoids (GCs) are mediated by the glucocorticoid receptor (GR). The interindividual response to GCs varies considerably, as demonstrated by a variable suppressive response to 0.25-mg dexamethasone (DEX). Several polymorphisms in the gene coding

  12. Surfactant protein D multimerization and gene polymorphism in COPD and asthma

    DEFF Research Database (Denmark)

    Fakih, Dalia; Akiki, Zeina; Junker, Kirsten


    BACKGROUND AND OBJECTIVE: A structural single nucleotide polymorphism rs721917 in the surfactant protein D (SP-D) gene, known as Met11Thr, was reported to influence the circulating levels and degree of multimerization of SP-D and was associated with both COPD and atopy in asthma. Moreover, diseas...

  13. Identification of prion protein gene polymorphisms in goats from Italian scrapie outbreaks

    NARCIS (Netherlands)

    Acutis, P.L.; Bossers, A.; Priem, J.; Riina, M.V.; Peletto, S.; Mazza, M.; Casalone, C.; Forloni, G.; Ru, G.; Caramelli, M.


    Susceptibility to scrapie in sheep is influenced by polymorphisms of the prion protein (PrP) gene, whereas no strong association between genetics and scrapie has yet been determined in goats due to the limited number of studies on these animals. In this case¿control study on 177 goats from six

  14. Relationship of Serum Klotho Level With ACE Gene Polymorphism in Stable Kidney Allograft Recipients. (United States)

    Zaare Nahandi, Maryam; Ardalan, Mohamad Reza; Banagozar Mohamadi, Ali; Ghorbani Haghjo, Amir; Jabbarpor Bonyadi, Morteza; Mohamadian, Tahere


    The kidney is the main source of serum Klotho production. Immunosuppressive agents could affect the kidney in this regard. The effect of the ACE gene polymorphism on Klotho production is a less studied area. This study aimed to assess serum Klotho and ACE gene in a group of stable kidney transplant recipients. In a cross-sectional study, 30 kidney transplant recipients with stable allograft function and 27 healthy young individuals were assessed for their serum Klotho levels. The ACE gene polymorphisms were studied in both groups. Klotho level was higher in kidney transplant recipients than the controls, but the difference was not significant (2.76 ± 2.41 ng/mL versus 2.01 ± 1.41 ng/mL, respectively). In both groups, serum Klotho level was higher in those with the I>I polymorphism, the men, those with higher glomerular filtration rate, and younger individuals, but the differences did not reach a significant level. Higher body mass index was significantly associated with lower serum Klotho level in both groups. Klotho level after kidney transplantation meets the range in healthy individuals, and it is not affected by the ACE gene polymorphism.

  15. Insertion/deletion polymorphism of the ACE gene and adherence to ACE inhibitors

    NARCIS (Netherlands)

    Schelleman, H; Klungel, O H; van Duijn, C M; Witteman, J C M; Hofman, A; de Boer, A; Stricker, B H Ch

    AIMS: We investigated whether the insertion/deletion (I/D) polymorphism of the ACE gene modified the adherence to ACE inhibitors as measured by the discontinuation of an ACE inhibitor, or addition of another antihypertensive drug. METHODS: This was a cohort study among 239 subjects who started ACE

  16. ACE gene polymorphism and losartan treatment in type 2 diabetic patients with nephropathy

    NARCIS (Netherlands)

    Parving, Hans-Henrik; de Zeeuw, Dick; Cooper, Mark E.; Remuzzi, Giuseppe; Liu, Nancy; Lunceford, Jared; Shahinfar, Shahnaz; Wong, Peggy H.; Lyle, Paulette A.; Rossing, Peter; Brenner, Barry M.

    Losartan treatment reduced renal outcomes in proteinuric patients with type 2 diabetes in the Reduction of Endpoints in NIDDM with the Angiotensin II Antagonist Losartan (RENAAL) study. It is unknown whether an insertion (I)/deletion (D) polymorphism in the angiotensin I-converting enzyme (ACE) gene

  17. Assessment of the relationship between ACE I/D gene polymorphism and renal allograft survival. (United States)

    Yang, Chun-Hua; Lu, Yi; Chen, Xue-Xia; Xian, Wen-Feng; Tu, Wei-Feng; Li, Hong-Yan


    The relationship between the angiotensin-converting enzyme (ACE) insertion/deletion (I/D) gene polymorphism and renal allograft survival after renal transplantation from the published reports are still debatable. This study was performed to evaluate the relationship between the ACE I/D gene polymorphism and renal allograft survival after renal transplantation using meta-analysis. Eligible studies were identified from PubMed and Cochrane Library on 1 November 2014, and eligible studies were recruited and synthesized using a meta-analysis methodology. Twelve investigations were included in this meta-analysis for the assessment of the relationship between the ACE I/D gene polymorphism and renal allograft survival. In this meta-analysis, the ACE I/D gene polymorphism was not associated with renal allograft survival after renal transplantation for overall populations, Caucasians, Brazilians and Africans. Interestingly, the ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. ACE D allele and DD genotype were associated with renal allograft survival after renal transplantation in the Asian population. However, more studies should be performed to confirm this association. © The Author(s) 2015.

  18. Insertion/deletion polymorphism of the ACE gene and adherence to ACE inhibitors

    NARCIS (Netherlands)

    H. Schelleman (Hedi); O.H. Klungel (Olaf); C.M. van Duijn (Cornelia); J.C.M. Witteman (Jacqueline); A. Hofman (Albert); A.C. de Boer (Anton); B.H.Ch. Stricker (Bruno)


    textabstractAims: We investigated whether the insertion/deletion (I/D) polymorphism of the ACE gene modified the adherence to ACE inhibitors as measured by the discontinuation of an ACE inhibitor, or addition of another antihypertensive drug. Methods: This was a cohort study among 239 subjects who

  19. Polymorphisms of the OXTR gene explain why sales professionals love to help customers

    NARCIS (Netherlands)

    W.J.M.I. Verbeke (Willem); R.P. Bagozzi (Richard); W.E. van den Berg (Wouter); A. Lemmens (Aurélie)


    textabstractPolymorphisms of the OXTR gene affect people's social interaction styles in various social encounters: carriers of the OXTR GG, compared to the OXTR AA/AG in general, are more motivated to interact socially and detect social salience. We focus on sales professionals operating in

  20. Polymorphisms of the OXTR Gene to explain why sales professionals love to help customers

    NARCIS (Netherlands)

    Verbeke, W.; Bagozzi, R.P.; van den Berg, W.E.; Lemmens, A.


    Polymorphisms of the OXTR gene affect people’s social interaction styles in various social encounters: carriers of the OXTR GG, compared to the OXTR AA/AG in general, are more motivated to interact socially and detect social salience. We focus on sales professionals operating in knowledge intensive