Directory of Open Access Journals (Sweden)
Kexiu Song
2014-01-01
Full Text Available HDL cholesterol is known to be inversely correlated with cardiovascular disease due to its diverse antiatherogenic functions. SR-BI mediates the selective uptake of HDL-C. SR-BI knockout diminishes but does not completely block the transport of HDL; other receptors may be involved. Ectopic ATP synthase β-chain in hepatocytes has been previously characterized as an apoA-I receptor, triggering HDL internalization. This study was undertaken to identify the overexpression of ectopic ATP synthase β-chain on DIL-HDL uptake in primary hepatocytes in vitro and on plasma HDL levels in SR-BI knockout mice. Human ATP synthase β-chain cDNA was delivered to the mouse liver by adenovirus and GFP adenovirus as control. The adenovirus-mediated overexpression of β-chain was identified at both mRNA and protein levels on mice liver and validated by its increasing of DiL-HDL uptake in primary hepatocytes. In response to hepatic overexpression of β-chain, plasma HDL-C levels and cholesterol were reduced in SR-BI knockout mice, compared with the control. The present data suggest that ATP synthase β-chain can serve as the endocytic receptor of HDL, and its overexpression can reduce plasma HDL-C.
RNA-seq reveals transcriptome changes in goats following myostatin gene knockout
Cai, Bei; Zhou, Shiwei; Zhu, Haijing; Qu, Lei; Wang, Xiaolong
2017-01-01
Myostatin (MSTN) is a powerful negative regulator of skeletal muscle mass in mammalian species that is primarily expressed in skeletal muscles, and mutations of its encoding gene can result in the double-muscling trait. In this study, the CRISPR/Cas9 technique was used to edit MSTN in Shaanbei Cashmere goats and generate knockout animals. RNA sequencing was used to determine and compare the transcriptome profiles of the muscles from three wild-type (WT) goats, three fibroblast growth factor 5 (FGF5) knockout goats (FGF5+/- group) and three goats with disrupted expression of both the FGF5 and MSTN genes (FM+/- group). The sequence reads were obtained using the Illumina HiSeq 2000 system and mapped to the Capra hircus reference genome using TopHat (v2.0.9). In total, 68.93, 62.04 and 66.26 million clean sequencing reads were obtained from the WT, FM+/- and FGF5+/- groups, respectively. There were 201 differentially expressed genes (DEGs) between the WT and FGF5+/- groups, with 86 down- and 115 up-regulated genes in the FGF5+/- group. Between the WT and FM+/- groups, 121 DEGs were identified, including 81 down- and 40 up-regulated genes in the FM+/- group. A total of 198 DEGs were detected between the FGF5+/- group and FM+/- group, with 128 down- and 70 up-regulated genes in the FM+/- group. At the transcriptome level, we found substantial changes in genes involved in fatty acid metabolism and the biosynthesis of unsaturated fatty acids, such as stearoyl-CoA dehydrogenase, 3-hydroxyacyl-CoA dehydratase 2, ELOVL fatty acid elongase 6 and fatty acid synthase, suggesting that the expression levels of these genes may be directly regulated by MSTN and that these genes are likely downstream targets of MSTN with potential roles in lipid metabolism in goats. Moreover, five randomly selected DEGs were further validated with qRT-PCR, and the results were consistent with the transcriptome analysis. The present study provides insight into the unique transcriptome profile of the
Sarkar, Dayanidhi; Siddiquee, Khandaker Al Zaid; Araúzo-Bravo, Marcos J; Oba, Takahiro; Shimizu, Kazuyuki
2008-11-01
To elucidate the physiological adaptation of Escherichia coli due to cra gene knockout, a total of 3,911 gene expressions were investigated by DNA microarray for continuous culture. About 50 genes were differentially regulated for the cra mutant. TCA cycle and glyoxylate shunt were down-regulated, while pentose phosphate (PP) pathway and Entner Doudoroff (ED) pathway were up-regulated in the cra mutant. The glucose uptake rate and the acetate production rate were increased with less acetate consumption for the cra mutant. To identify the genes controlled by Cra protein, the Cra recognition weight matrix from foot-printing data was developed and used to scan the whole genome. Several new Cra-binding sites were found, and some of the result was consistent with the DNA microarray data. The ED pathway was active in the cra mutant; we constructed cra.edd double genes knockout mutant to block this pathway, where the acetate overflowed due to the down-regulation of aceA,B and icd gene expressions. Then we further constructed cra.edd.iclR triple genes knockout mutant to direct the carbon flow through the glyoxylate pathway. The cra.edd.iclR mutant showed the least acetate production, resulting in the highest cell yield together with the activation of the glycolysis pathway, but the glucose consumption rate could not be improved.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
International Nuclear Information System (INIS)
Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.
2008-01-01
Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)
The Tomato Terpene Synthase Gene Family1[W][OA
Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran
2011-01-01
Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655
Knockout of Tmem70 alters biogenesis of ATP synthase and leads to embryonal lethality in mice
Czech Academy of Sciences Publication Activity Database
Vrbacký, Marek; Kovalčíková, Jana; Chawengsaksophak, Kallayanee; Beck, Inken; Mráček, Tomáš; Nůsková, Hana; Sedmera, David; Papoušek, František; Kolář, František; Sobol, Margaryta; Hozák, Pavel; Sedláček, Radislav; Houštěk, Josef
2016-01-01
Roč. 25, č. 21 (2016), s. 4674-4685 ISSN 0964-6906 R&D Projects: GA ČR(CZ) GB14-36804G; GA MŠk(CZ) LL1204; GA MŠk(CZ) ED1.1.00/02.0109; GA TA ČR(CZ) TE01020118; GA MŠk(CZ) LM2015062; GA MZd(CZ) NV16-33018A; GA MŠk(CZ) LM2015040 Institutional support: RVO:67985823 ; RVO:68378050 Keywords : mouse knockout * mitochondria * ATP synthase * TMEM70 * biogenesis * mitochondrial diseases Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.340, year: 2016
Characterisation of iunH gene knockout strain from Mycobacterium tuberculosis
Directory of Open Access Journals (Sweden)
Anne Drumond Villela
Full Text Available BACKGROUND Tuberculosis (TB is an infectious disease caused mainly by the bacillus Mycobacterium tuberculosis. The better understanding of important metabolic pathways from M. tuberculosis can contribute to the development of novel therapeutic and prophylactic strategies to combat TB. Nucleoside hydrolase (MtIAGU-NH, encoded by iunH gene (Rv3393, is an enzyme from purine salvage pathway in M. tuberculosis. MtIAGU-NH accepts inosine, adenosine, guanosine, and uridine as substrates, which may point to a pivotal metabolic role. OBJECTIVES Our aim was to construct a M. tuberculosis knockout strain for iunH gene, to evaluate in vitro growth and the effect of iunH deletion in M. tuberculosis in non-activated and activated macrophages models of infection. METHODS A M. tuberculosis knockout strain for iunH gene was obtained by allelic replacement, using pPR27xylE plasmid. The complemented strain was constructed by the transformation of the knockout strain with pNIP40::iunH. MtIAGU-NH expression was analysed by Western blot and LC-MS/MS. In vitro growth was evaluated in Sauton’s medium. Bacterial load of non-activated and interferon-γ activated RAW 264.7 cells infected with knockout strain was compared with wild-type and complemented strains. FINDINGS Western blot and LC-MS/MS validated iunH deletion at protein level. The iunH knockout led to a delay in M. tuberculosis growth kinetics in Sauton’s medium during log phase, but did not affect bases and nucleosides pool in vitro. No significant difference in bacterial load of knockout strain was observed when compared with both wild-type and complemented strains after infection of non-activated and interferon-γ activated RAW 264.7 cells. MAIN CONCLUSION The disruption of iunH gene does not influence M. tuberculosis growth in both non-activated and activated RAW 264.7 cells, which show that iunH gene is not important for macrophage invasion and virulence. Our results indicated that MtIAGU-NH is not a
Gene Knockout Identification Using an Extension of Bees Hill Flux Balance Analysis
Directory of Open Access Journals (Sweden)
Yee Wen Choon
2015-01-01
Full Text Available Microbial strain optimisation for the overproduction of a desired phenotype has been a popular topic in recent years. Gene knockout is a genetic engineering technique that can modify the metabolism of microbial cells to obtain desirable phenotypes. Optimisation algorithms have been developed to identify the effects of gene knockout. However, the complexities of metabolic networks have made the process of identifying the effects of genetic modification on desirable phenotypes challenging. Furthermore, a vast number of reactions in cellular metabolism often lead to a combinatorial problem in obtaining optimal gene knockout. The computational time increases exponentially as the size of the problem increases. This work reports an extension of Bees Hill Flux Balance Analysis (BHFBA to identify optimal gene knockouts to maximise the production yield of desired phenotypes while sustaining the growth rate. This proposed method functions by integrating OptKnock into BHFBA for validating the results automatically. The results show that the extension of BHFBA is suitable, reliable, and applicable in predicting gene knockout. Through several experiments conducted on Escherichia coli, Bacillus subtilis, and Clostridium thermocellum as model organisms, extension of BHFBA has shown better performance in terms of computational time, stability, growth rate, and production yield of desired phenotypes.
Beta-Glucan Synthase Gene Expression in Pleurotus sp
International Nuclear Information System (INIS)
Azhar Mohamad; Nie, H.J.
2016-01-01
Pleurotus sp. is a popular edible mushroom, containing various functional component, in particular, Beta-glucan. Beta-glucans is a part of glucan family of polysaccharides and supposedly contribute to medicinal and nutritional value of Pleurotus.sp. In order to understand the distribution of Beta-glucan in Pleurotus.sp, the Beta-glucan synthase gene expression was determined and compared in different part of Pleurotus, namely mycelium, stripe and cap. The Pleurotus.sp RNA was extracted using commercial kit, employing Tissuelyser ll (Qiagen, USA) to disrupt the cell walls. Then the RNA was quantified by Nano drop (Thermo Fisher, USA) and visualized using denaturing agarose gel. RNA with good OD 260.280 reading (∼2.0) was chosen and converted to cDNA. Using Laccase synthase gene as home keeping gene, Beta-glucan synthase gene expression was quantified using CFX 96 Real Time PCR detection system (Biorad, USA). Preliminary result shows that Beta-glucan synthase was relatively expressed the most in stripe, followed by mycelium and barely in cap. (author)
Sequence analysis of cereal sucrose synthase genes and isolation ...
African Journals Online (AJOL)
SERVER
2007-10-18
Oct 18, 2007 ... sequencing of sucrose synthase gene fragment from sor- ghum using primers designed at their conserved exons. MATERIALS AND METHODS. Multiple sequence alignment. Sucrose synthase gene sequences of various cereals like rice, maize, and barley were accessed from NCBI Genbank database.
Pydiura, N A; Bayer, G Ya; Galinousky, D V; Yemets, A I; Pirko, Ya V; Podvitski, T A; Anisimova, N V; Khotyleva, L V; Kilchevsky, A V; Blume, Ya B
2015-01-01
A bioinformatic search of sequences encoding cellulose synthase genes in the flax genome, and their comparison to dicots orthologs was carried out. The analysis revealed 32 cellulose synthase gene candidates, 16 of which are highly likely to encode cellulose synthases, and the remaining 16--cellulose synthase-like proteins (Csl). Phylogenetic analysis of gene products of cellulose synthase genes allowed distinguishing 6 groups of cellulose synthase genes of different classes: CesA1/10, CesA3, CesA4, CesA5/6/2/9, CesA7 and CesA8. Paralogous sequences within classes CesA1/10 and CesA5/6/2/9 which are associated with the primary cell wall formation are characterized by a greater similarity within these classes than orthologous sequences. Whereas the genes controlling the biosynthesis of secondary cell wall cellulose form distinct clades: CesA4, CesA7, and CesA8. The analysis of 16 identified flax cellulose synthase gene candidates shows the presence of at least 12 different cellulose synthase gene variants in flax genome which are represented in all six clades of cellulose synthase genes. Thus, at this point genes of all ten known cellulose synthase classes are identify in flax genome, but their correct classification requires additional research.
DEFF Research Database (Denmark)
Choi, Kyeong Rok; Cho, Jae Sung; Cho, In Jin
2018-01-01
Pseudomonas putida has gained much interest among metabolic engineers as a workhorse for producing valuable natural products. While a few gene knockout tools for P. putida have been reported, integration of heterologous genes into the chromosome of P. putida, an essential strategy to develop stable...... plasmid curing systems, generating final strains free of antibiotic markers and plasmids. This markerless recombineering system for efficient gene knockout and integration will expedite metabolic engineering of P. putida, a bacterial host strain of increasing academic and industrial interest....
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Bratt, Jennifer M.; Franzi, Lisa M.; Linderholm, Angela L.; Last, Michael S.; Kenyon, Nicholas J.; Last, Jerold A.
2009-01-01
Arginase has been suggested to compete with nitric oxide synthase (NOS) for their common substrate, L-arginine. To study the mechanisms underlying this interaction, we compared arginase expression in isolated airways and the consequences of inhibiting arginase activity in vivo with NO production, lung inflammation, and lung function in both C57BL/6 and NOS2 knockout mice undergoing ovalbumin-induced airway inflammation, a mouse model of asthma. Arginases I and II were measured by western blot in isolated airways from sensitized C57BL/6 mice exposed to ovalbumin aerosol. Physiological and biochemical responses---inflammation, lung compliance, airway hyperreactivity, exhaled NO concentration, arginine concentration--were compared with the responses of NOS2 knockout mice. NOS2 knockout mice had increased total cells in lung lavage, decreased lung compliance, and increased airway hyperreactivity. Both arginase I and arginase II were constitutively expressed in the airways of normal C57BL/6 mice. Arginase I was up-regulated approximately 8-fold in the airways of C57BL/6 mice exposed to ovalbumin. Expression of both arginase isoforms were significantly upregulated in NOS2 knockout mice exposed to ovalbumin, with about 40- and 4-fold increases in arginases I and II, respectively. Arginine concentration in isolated airways was not significantly different in any of the groups studied. Inhibition of arginase by systemic treatment of C57BL/6 mice with a competitive inhibitor, Nω-hydroxy-nor-L-arginine (nor-NOHA), significantly decreased the lung inflammatory response to ovalbumin in these animals. We conclude that NOS2 knockout mice are more sensitive to ovalbumin-induced airway inflammation and its sequelae than are C57BL/6 mice, as determined by increased total cells in lung lavage, decreased lung compliance, and increased airway hyperreactivity, and that these findings are strongly correlated with increased expression of both arginase isoforms in the airways of the NOS2
Directory of Open Access Journals (Sweden)
Shoji Suzuki
2017-01-01
Full Text Available Multiple gene knockout systems developed in the thermoacidophilic crenarchaeon Sulfolobus acidocaldarius are powerful genetic tools. However, plasmid construction typically requires several steps. Alternatively, PCR tailing for high-throughput gene disruption was also developed in S. acidocaldarius, but repeated gene knockout based on PCR tailing has been limited due to lack of a genetic marker system. In this study, we demonstrated efficient homologous recombination frequency (2.8 × 104 ± 6.9 × 103 colonies/μg DNA by optimizing the transformation conditions. This optimized protocol allowed to develop reliable gene knockout via double crossover using short homologous arms and to establish the multiple gene knockout system with one-step PCR (MONSTER. In the MONSTER, a multiple gene knockout cassette was simply and rapidly constructed by one-step PCR without plasmid construction, and the PCR product can be immediately used for target gene deletion. As an example of the applications of this strategy, we successfully made a DNA photolyase- (phr- and arginine decarboxylase- (argD- deficient strain of S. acidocaldarius. In addition, an agmatine selection system consisting of an agmatine-auxotrophic strain and argD marker was also established. The MONSTER provides an alternative strategy that enables the very simple construction of multiple gene knockout cassettes for genetic studies in S. acidocaldarius.
Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard
2011-01-01
Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 su...
Gomes, Felipe V.; Silva, Andréia L.; Uliana, Daniela L.; Camargo, Laura H. A.; Guimarães, Francisco S.; Cunha, Fernando Q.; Joca, Sâmia R. L.; Resstel, Leonardo B. M.
2015-01-01
Background: Inducible or neuronal nitric oxide synthase gene deletion increases or decreases anxiety-like behavior in mice, respectively. Since nitric oxide and endocannabinoids interact to modulate defensive behavior, the former effect could involve a compensatory increase in basal brain nitric oxide synthase activity and/or changes in the endocannabinoid system. Thus, we investigated the expression and extinction of contextual fear conditioning of inducible nitric oxide knockout mice and possible involvement of endocannabinoids in these responses. Methods: We evaluated the effects of a preferential neuronal nitric oxide synthase inhibitor, 7-nitroindazol, nitric oxide synthase activity, and mRNA changes of nitrergic and endocannabinoid systems components in the medial prefrontal cortex and hippocampus of wild-type and knockout mice. The effects of URB597, an inhibitor of the fatty acid amide hydrolase enzyme, which metabolizes the endocannabinoid anandamide, WIN55,212-2, a nonselective cannabinoid agonist, and AM281, a selective CB1 antagonist, on contextual fear conditioning were also evaluated. Results: Contextual fear conditioning expression was similar in wild-type and knockout mice, but the latter presented extinction deficits and increased basal nitric oxide synthase activity in the medial prefrontal cortex. 7-Nitroindazol decreased fear expression and facilitated extinction in wild-type and knockout mice. URB597 decreased fear expression in wild-type and facilitated extinction in knockout mice, whereas WIN55,212-2 and AM281 increased it in wild-type mice. Nonconditioned knockout mice showed changes in the mRNA expression of nitrergic and endocannabinoid system components in the medial prefrontal cortex and hippocampus that were modified by fear conditioning. Conclusion: These data reinforce the involvement of the nitric oxide and endocannabinoids (anandamide) in stress-related disorders and point to a deregulation of the endocannabinoid system in
Guo, Jian; Wang, Yuanhua; Li, Baozhong; Huang, Siyao; Chen, Yefu; Guo, Xuewu; Xiao, Dongguang
2017-06-10
Aureobasidium pullulans is an increasingly attractive host for bio-production of pullulan, heavy oil, polymalic acid, and a large spectrum of extracellular enzymes. To date, genetic manipulation of A. pullulans mainly relies on time-consuming conventional restriction enzyme digestion and ligation methods. In this study, we present a one-step homologous recombination-based method for rapid genetic manipulation in A. pullulans. Overlaps measuring >40bp length and 10μg DNA segments for homologous recombination provided maximum benefits to transformation of A. pullulans. This optimized method was successfully applied to PKSIII gene (encodes polyketide synthase) knock-out and gltP gene (encodes glycolipid transfer protein) knock-in. After disruption of PKSIII gene, secretion of melanin decreased slightly. The melanin purified from disruptant showed lower reducing capacity compared with that of the parent strain, leading to a decrease in exopolysaccharide production. Knock-in of gltP gene resulted in at least 4.68-fold increase in heavy oil production depending on the carbon source used, indicating that gltP can regulate heavy oil synthesis in A. pullulans. Copyright © 2017 Elsevier B.V. All rights reserved.
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
STORAGESEVER
2010-05-24
May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.
Directory of Open Access Journals (Sweden)
Anna Osiak
Full Text Available Gene knockout in murine embryonic stem cells (ESCs has been an invaluable tool to study gene function in vitro or to generate animal models with altered phenotypes. Gene targeting using standard techniques, however, is rather inefficient and typically does not exceed frequencies of 10(-6. In consequence, the usage of complex positive/negative selection strategies to isolate targeted clones has been necessary. Here, we present a rapid single-step approach to generate a gene knockout in mouse ESCs using engineered zinc-finger nucleases (ZFNs. Upon transient expression of ZFNs, the target gene is cleaved by the designer nucleases and then repaired by non-homologous end-joining, an error-prone DNA repair process that introduces insertions/deletions at the break site and therefore leads to functional null mutations. To explore and quantify the potential of ZFNs to generate a gene knockout in pluripotent stem cells, we generated a mouse ESC line containing an X-chromosomally integrated EGFP marker gene. Applying optimized conditions, the EGFP locus was disrupted in up to 8% of ESCs after transfection of the ZFN expression vectors, thus obviating the need of selection markers to identify targeted cells, which may impede or complicate downstream applications. Both activity and ZFN-associated cytotoxicity was dependent on vector dose and the architecture of the nuclease domain. Importantly, teratoma formation assays of selected ESC clones confirmed that ZFN-treated ESCs maintained pluripotency. In conclusion, the described ZFN-based approach represents a fast strategy for generating gene knockouts in ESCs in a selection-independent fashion that should be easily transferrable to other pluripotent stem cells.
PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila
International Nuclear Information System (INIS)
Enan, M. R.; Bashandy, S.A.
2006-01-01
Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper
2007-01-01
Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...
Directory of Open Access Journals (Sweden)
Asish K Ghosh
Full Text Available Fibrosis is defined as an abnormal matrix remodeling due to excessive synthesis and accumulation of extracellular matrix proteins in tissues during wound healing or in response to chemical, mechanical and immunological stresses. At present, there is no effective therapy for organ fibrosis. Previous studies demonstrated that aged plasminogen activator inhibitor-1 (PAI-1 knockout mice develop spontaneously cardiac-selective fibrosis without affecting any other organs. We hypothesized that differential expressions of profibrotic and antifibrotic genes in PAI-1 knockout hearts and unaffected organs lead to cardiac selective fibrosis. In order to address this prediction, we have used a genome-wide gene expression profiling of transcripts derived from aged PAI-1 knockout hearts and kidneys. The variations of global gene expression profiling were compared within four groups: wildtype heart vs. knockout heart; wildtype kidney vs. knockout kidney; knockout heart vs. knockout kidney and wildtype heart vs. wildtype kidney. Analysis of illumina-based microarray data revealed that several genes involved in different biological processes such as immune system processing, response to stress, cytokine signaling, cell proliferation, adhesion, migration, matrix organization and transcriptional regulation were affected in hearts and kidneys by the absence of PAI-1, a potent inhibitor of urokinase and tissue-type plasminogen activator. Importantly, the expressions of a number of genes, involved in profibrotic pathways including Ankrd1, Pi16, Egr1, Scx, Timp1, Timp2, Klf6, Loxl1 and Klotho, were deregulated in PAI-1 knockout hearts compared to wildtype hearts and PAI-1 knockout kidneys. While the levels of Ankrd1, Pi16 and Timp1 proteins were elevated during EndMT, the level of Timp4 protein was decreased. To our knowledge, this is the first comprehensive report on the influence of PAI-1 on global gene expression profiling in the heart and kidney and its implication
Endothelial nitric oxide synthase gene polymorphisms associated ...
African Journals Online (AJOL)
Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...
Directory of Open Access Journals (Sweden)
О. P. Kanyuka
2014-04-01
Full Text Available A pttg gene knockout affects the functional state of erythron in mice which could be associated with structural changes in the structure of erythrocyte membranes. The pttg gene knockout causes a significant modification of fatty acids composition of erythrocyte membrane lipids by reducing the content of palmitic acid and increasing of polyunsaturated fatty acids amount by 18%. Analyzing the erythrocyte surface architectonics of mice under pttg gene knockout, it was found that on the background of reduction of the functionally complete biconcave discs population one could observe an increase of the number of transformed cells at different degeneration stages. Researches have shown that in mice with a pttg gene knockout compared with a control group of animals cytoskeletal protein – β-spectrin was reduced by 17.03%. However, there is a reduction of membrane protein band 3 by 33.04%, simultaneously the content of anion transport protein band 4.5 increases by 35.2% and protein band 4.2 by 32.1%. The lectin blot analysis has helped to reveal changes in the structure of the carbohydrate determinants of erythrocyte membrane glycoproteins under conditions of directed pttg gene inactivation, accompanied by changes in the type of communication, which joins the terminal residue in carbohydrate determinant of glycoproteins. Thus, a significant redistribution of protein and fatty acids contents in erythrocyte membranes that manifested in the increase of the deformed shape of red blood cells is observed under pttg gene knockout.
Directory of Open Access Journals (Sweden)
Mirian Perez Maluf
2009-01-01
Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.
Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance
DEFF Research Database (Denmark)
Huang, Laurence; Crothers, Kristina; Atzori, Chiara
2004-01-01
in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...
Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants
Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE
2007-07-10
Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
Matsunaga, Taichi; Yamashita, Jun K
2014-02-07
Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.
Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.
Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako
2009-02-01
Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.
Directory of Open Access Journals (Sweden)
Bechard Matthew E.
2003-01-01
Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.
Efficient CRISPR/Cas9-based gene knockout in watermelon.
Tian, Shouwei; Jiang, Linjian; Gao, Qiang; Zhang, Jie; Zong, Mei; Zhang, Haiying; Ren, Yi; Guo, Shaogui; Gong, Guoyi; Liu, Fan; Xu, Yong
2017-03-01
CRISPR/Cas9 system can precisely edit genomic sequence and effectively create knockout mutations in T0 generation watermelon plants. Genome editing offers great advantage to reveal gene function and generate agronomically important mutations to crops. Recently, RNA-guided genome editing system using the type II clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein 9 (Cas9) has been applied to several plant species, achieving successful targeted mutagenesis. Here, we report the genome of watermelon, an important fruit crop, can also be precisely edited by CRISPR/Cas9 system. ClPDS, phytoene desaturase in watermelon, was selected as the target gene because its mutant bears evident albino phenotype. CRISPR/Cas9 system performed genome editing, such as insertions or deletions at the expected position, in transfected watermelon protoplast cells. More importantly, all transgenic watermelon plants harbored ClPDS mutations and showed clear or mosaic albino phenotype, indicating that CRISPR/Cas9 system has technically 100% of genome editing efficiency in transgenic watermelon lines. Furthermore, there were very likely no off-target mutations, indicated by examining regions that were highly homologous to sgRNA sequences. Our results show that CRISPR/Cas9 system is a powerful tool to effectively create knockout mutations in watermelon.
Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.
Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica
2017-10-01
Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T
2017-01-01
Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.
Nowrousian, Minou
2009-04-01
During fungal fruiting body development, hyphae aggregate to form multicellular structures that protect and disperse the sexual spores. Analysis of microarray data revealed a gene cluster strongly upregulated during fruiting body development in the ascomycete Sordaria macrospora. Real time PCR analysis showed that the genes from the orthologous cluster in Neurospora crassa are also upregulated during development. The cluster encodes putative polyketide biosynthesis enzymes, including a reducing polyketide synthase. Analysis of knockout strains of a predicted dehydrogenase gene from the cluster showed that mutants in N. crassa and S. macrospora are delayed in fruiting body formation. In addition to the upregulated cluster, the N. crassa genome comprises another cluster containing a polyketide synthase gene, and five additional reducing polyketide synthase (rpks) genes that are not part of clusters. To study the role of these genes in sexual development, expression of the predicted rpks genes in S. macrospora (five genes) and N. crassa (six genes) was analyzed; all but one are upregulated during sexual development. Analysis of knockout strains for the N. crassa rpks genes showed that one of them is essential for fruiting body formation. These data indicate that polyketides produced by RPKSs are involved in sexual development in filamentous ascomycetes.
Directory of Open Access Journals (Sweden)
Yan Yang
2017-04-01
Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.
Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.
Directory of Open Access Journals (Sweden)
Kattina Zavala
Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.
Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model
Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.
Lymphocyte signaling: beyond knockouts.
Saveliev, Alexander; Tybulewicz, Victor L J
2009-04-01
The analysis of lymphocyte signaling was greatly enhanced by the advent of gene targeting, which allows the selective inactivation of a single gene. Although this gene 'knockout' approach is often informative, in many cases, the phenotype resulting from gene ablation might not provide a complete picture of the function of the corresponding protein. If a protein has multiple functions within a single or several signaling pathways, or stabilizes other proteins in a complex, the phenotypic consequences of a gene knockout may manifest as a combination of several different perturbations. In these cases, gene targeting to 'knock in' subtle point mutations might provide more accurate insight into protein function. However, to be informative, such mutations must be carefully based on structural and biophysical data.
Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants
Energy Technology Data Exchange (ETDEWEB)
Somerville, Chris R.; Scieble, Wolf
2000-10-11
Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Li, Hong-Wei; Yang, Xiang-Min; Tang, Juan; Wang, Shi-Jie; Chen, Zhi-Nan; Jiang, Jian-Li
2015-03-01
HAb18G/CD147 belongs to the immunoglobulin superfamily and predominantly functions as an inducer of matrix metalloproteinase secretion for tumor invasion and metastasis. This study was designed to investigate the effects of HAb18G/CD147 knockout on hepatocellular carcinoma cells using zinc-finger nuclease (ZFNs)-targeted gene knockout approach. The HCC cell line SMMC-7721 was used for ZFNs-targeted cleavage of the HAb18G/CD147 gene. RT-PCR and Western blot assays were used to detect HAb18G/CD147 expression. HAb18G phenotypic changes following HAb18G/CD147 knockout in SMMC-K7721 cells were assessed using tumor cell adhesion, invasion, migration and colony formation and flow cytometric assays. These data demonstrated that tumor cell adhesion, invasion, migration, and colony formation capabilities of SMMC-K7721 were significantly reduced compared to parental cells or SMMC-7721 with re-expression of HAb18G/CD147 protein transfected with HAb18G/CD147 cDNA. Moreover, knockout of HAb18G/CD147 expression also induced SMMC-K7721 cells to undergo apoptosis compared to SMMC-7721 and SMMC-R7721 (P CD147 reduced p53 levels in SMMC-R7721 cells, possibly through inhibition of the PI3K-Akt-MDM2 signaling pathway. The findings provide a novel insight into the mechanisms underlying HAb18G/CD147-induced progression of HCC cells.
Nitric oxide synthase gene G298 allele
International Nuclear Information System (INIS)
Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar
2004-01-01
Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant
Improving the efficiency of CHO cell line generation using glutamine synthetase gene knockout cells.
Fan, Lianchun; Kadura, Ibrahim; Krebs, Lara E; Hatfield, Christopher C; Shaw, Margaret M; Frye, Christopher C
2012-04-01
Although Chinese hamster ovary (CHO) cells, with their unique characteristics, have become a major workhorse for the manufacture of therapeutic recombinant proteins, one of the major challenges in CHO cell line generation (CLG) is how to efficiently identify those rare, high-producing clones among a large population of low- and non-productive clones. It is not unusual that several hundred individual clones need to be screened for the identification of a commercial clonal cell line with acceptable productivity and growth profile making the cell line appropriate for commercial application. This inefficiency makes the process of CLG both time consuming and laborious. Currently, there are two main CHO expression systems, dihydrofolate reductase (DHFR)-based methotrexate (MTX) selection and glutamine synthetase (GS)-based methionine sulfoximine (MSX) selection, that have been in wide industrial use. Since selection of recombinant cell lines in the GS-CHO system is based on the balance between the expression of the GS gene introduced by the expression plasmid and the addition of the GS inhibitor, L-MSX, the expression of GS from the endogenous GS gene in parental CHOK1SV cells will likely interfere with the selection process. To study endogenous GS expression's potential impact on selection efficiency, GS-knockout CHOK1SV cell lines were generated using the zinc finger nuclease (ZFN) technology designed to specifically target the endogenous CHO GS gene. The high efficiency (∼2%) of bi-allelic modification on the CHO GS gene supports the unique advantages of the ZFN technology, especially in CHO cells. GS enzyme function disruption was confirmed by the observation of glutamine-dependent growth of all GS-knockout cell lines. Full evaluation of the GS-knockout cell lines in a standard industrial cell culture process was performed. Bulk culture productivity improved two- to three-fold through the use of GS-knockout cells as parent cells. The selection stringency was
Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay
2012-12-01
Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
The Eucalyptus terpene synthase gene family.
Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J
2015-06-11
Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.
von Wettstein-Knowles, Penny
2017-07-10
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.
Knockout of exogenous EGFP gene in porcine somatic cells using zinc-finger nucleases
International Nuclear Information System (INIS)
Watanabe, Masahito; Umeyama, Kazuhiro; Matsunari, Hitomi; Takayanagi, Shuko; Haruyama, Erika; Nakano, Kazuaki; Fujiwara, Tsukasa; Ikezawa, Yuka; Nakauchi, Hiromitsu
2010-01-01
Research highlights: → EGFP gene integrated in porcine somatic cells could be knocked out using the ZFN-KO system. → ZFNs induced targeted mutations in porcine primary cultured cells. → Complete absence of EGFP fluorescence was confirmed in ZFN-treated cells. -- Abstract: Zinc-finger nucleases (ZFNs) are expected as a powerful tool for generating gene knockouts in laboratory and domestic animals. Currently, it is unclear whether this technology can be utilized for knocking-out genes in pigs. Here, we investigated whether knockout (KO) events in which ZFNs recognize and cleave a target sequence occur in porcine primary cultured somatic cells that harbor the exogenous enhanced green fluorescent protein (EGFP) gene. ZFN-encoding mRNA designed to target the EGFP gene was introduced by electroporation into the cell. Using the Surveyor nuclease assay and flow cytometric analysis, we confirmed ZFN-induced cleavage of the target sequence and the disappearance of EGFP fluorescence expression in ZFN-treated cells. In addition, sequence analysis revealed that ZFN-induced mutations such as base substitution, deletion, or insertion were generated in the ZFN cleavage site of EGFP-expression negative cells that were cloned from ZFN-treated cells, thereby showing it was possible to disrupt (i.e., knock out) the function of the EGFP gene in porcine somatic cells. To our knowledge, this study provides the first evidence that the ZFN-KO system can be applied to pigs. These findings may open a new avenue to the creation of gene KO pigs using ZFN-treated cells and somatic cell nuclear transfer.
Directory of Open Access Journals (Sweden)
Qisheng Zuo
2016-06-01
Full Text Available The present study established an efficient genome editing approach for the construction of stable transgenic cell lines of the domestic chicken (Gallus gallus domesticus. Our objectives were to facilitate the breeding of high-yield, high-quality chicken strains, and to investigate gene function in chicken stem cells. Three guide RNA (gRNAs were designed to knockout the C2EIP gene, and knockout efficiency was evaluated in DF-1 chicken fibroblasts and chicken ESCs using the luciferase single-strand annealing (SSA recombination assay, T7 endonuclease I (T7EI assay, and TA clone sequencing. In addition, the polyethylenimine-encapsulated Cas9/gRNA plasmid was injected into fresh fertilized eggs. At 4.5 d later, frozen sections of the embryos were prepared, and knockout efficiency was evaluated by the T7EI assay. SSA assay results showed that luciferase activity of the vector expressing gRNA-3 was double that of the control. Results of the T7EI assay and TA clone sequencing indicated that Cas9/gRNA vector-mediated gene knockdown efficiency was approximately 27% in both DF-1 cells and ESCs. The CRISPR/Cas9 vector was also expressed in chicken embryos, resulting in gene knockdown in three of the 20 embryos (gene knockdown efficiency 15%. Taken together, our results indicate that the CRISPR/Cas9 system can mediate stable gene knockdown at the cell and embryo levels in domestic chickens.
Liu, Bo; Sun, Li-Hua; Huang, Yan-Fei; Guo, Li-Jun; Luo, Li-Shu
2018-02-01
Protein phosphatase 2ACα (PP2ACα), a vital member of the protein phosphatase family, has been studied primarily as a regulator for the development, growth and protein synthesis of a lot of cell types. Dysfunction of PP2ACα protein results in neurodegenerative disease; however, this finding has not been directly confirmed in the mouse model with PP2ACα gene knock-out. Therefore, in this study presented here, we generated the PP2ACα gene knock-out mouse model by the Cre-loxP targeting gene system, with the purpose to directly observe the regulatory role of PP2ACα gene in the development of mouse's cerebral cortex. We observe that knocking-out PP2ACα gene in the central nervous system (CNS) results in cortical neuronal shrinkage, synaptic plasticity impairments, and learning/memory deficits. Further study reveals that PP2ACα gene knock-out initiates Hippo cascade in cortical neuroprogenitor cells (NPCs), which blocks YAP translocation into the nuclei of NPCs. Notably, p73, directly targeted by Hippo cascade, can bind to the promoter of glutaminase2 (GLS2) that plays a dominant role in the enzymatic regulation of glutamate/glutamine cycle. Finally, we find that PP2ACα gene knock-out inhibits the glutamine synthesis through up-regulating the activity of phosphorylated-p73 in cortical NPCs. Taken together, it concludes that PP2ACα critically supports cortical neuronal growth and cognitive function via regulating the signaling transduction of Hippo-p73 cascade. And PP2ACα indirectly modulates the glutamine synthesis of cortical NPCs through targeting p73 that plays a direct transcriptional regulatory role in the gene expression of GLS2. Copyright © 2017 Elsevier Ltd. All rights reserved.
Isolation and expression of the Pneumocystis carinii thymidylate synthase gene
DEFF Research Database (Denmark)
Edman, U; Edman, J C; Lundgren, B
1989-01-01
The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...
Yu, Da Young; Lee, Sang Yoon; Lee, Gyun Min
2018-05-01
Previously, it was inferred that a high glutamine synthetase (GS) activity in human embryonic kidney (HEK) 293E cells results in elevated resistance to methionine sulfoximine (MSX) and consequently hampers GS-mediated gene amplification and selection by MSX. To overcome this MSX resistance in HEK293E cells, a GS-knockout HEK293E cell line was generated using the CRISPR/Cas9 system to target the endogenous human GS gene. The GS-knockout in the HEK293E cell line (RK8) was confirmed by Western blot analysis of GS and by observation of glutamine-dependent growth. Unlike the wild type HEK293E cells, the RK8 cells were successfully used as host cells to generate a recombinant HEK293E cell line (rHEK293E) producing a monoclonal antibody (mAb). When the RK8 cells were transfected with the GS expression vector containing the mAb gene, rHEK293E cells producing the mAb could be selected in the absence as well as in the presence of MSX. The gene copies and mRNA expression levels of the mAb in rHEK293E cells were also quantified using qRT-PCR. Taken together, the GS-knockout HEK293E cell line can be used as host cells to generate stable rHEK293E cells producing a mAb through GS-mediated gene selection in the absence as well as in the presence of MSX. © 2018 Wiley Periodicals, Inc.
CRISPR/Cas9 mediated chicken Stra8 gene knockout and inhibition of male germ cell differentiation.
Directory of Open Access Journals (Sweden)
Yani Zhang
Full Text Available An efficient genome editing approach had been established to construct the stable transgenic cell lines in the domestic chicken (Gallus gallus domesticus at present. Our objectives were to investigate gene function in the differentiation process of chicken embryonic stem cells (ESCs into spermatogonial stem cells(SSCs. Three guides RNA (gRNAs were designed to knockout the Stra8 gene, and knockout efficiency was evaluated in domestic chicken cells using cleavage activity of in vitro transcription of gRNA, Luciferase-SSA assay, T7 endonuclease I assay(T7E1 and TA clone sequence. In addition, the Cas9/gRNA plasmid was transfected into ESCs to confirm the function of Stra8. SSA assay results showed that luciferase activity of the vector expressing gRNA-1 and gRNA- 2 was higher than that of gRNA-3. TA clone sequencing showed that the knockdown efficiency was 25% (10/40 in DF-1 cells, the knockdown efficiency was 23% (9/40 in chicken ESCs. T7E1 assay indicated that there were cleavage activity for three individuals, and the knockdown efficiency was 12% (3/25. Cell morphology, qRT-PCR, immunostaining and FCS indicated that Cas9/gRNA not only resulted in the knockout of Stra8 gene, but also suggested that the generation of SSCs was blocked by the Stra8 gene knockdown in vitro. Taken together, our results indicate that the CRISPR/Cas9 system could mediate stable Stra8 gene knockdown in domestic chicken's cells and inhibit ECSs differentiation into SSCs.
Adeno-associated virus LPL(S447X) gene therapy in LDL receptor knockout mice
Rip, Jaap; Sierts, Jeroen A.; Vaessen, Stefan F. C.; Kastelein, John J. P.; Twisk, Jaap; Kuivenhoven, Jan Albert
2007-01-01
BACKGROUND: Overexpression of lipoprotein lipase (LPL) protects against atherosclerosis in genetically engineered mice. We tested whether a gene therapy vector that delivers human (h) LPL(S447X) cDNA to skeletal muscle could induce similar effects. METHODS: LDL receptor knockout (LDLr-/-) mice were
Directory of Open Access Journals (Sweden)
Tilman Jobst-Schwan
Full Text Available Until recently, morpholino oligonucleotides have been widely employed in zebrafish as an acute and efficient loss-of-function assay. However, off-target effects and reproducibility issues when compared to stable knockout lines have compromised their further use. Here we employed an acute CRISPR/Cas approach using multiple single guide RNAs targeting simultaneously different positions in two exemplar genes (osgep or tprkb to increase the likelihood of generating mutations on both alleles in the injected F0 generation and to achieve a similar effect as morpholinos but with the reproducibility of stable lines. This multi single guide RNA approach resulted in median likelihoods for at least one mutation on each allele of >99% and sgRNA specific insertion/deletion profiles as revealed by deep-sequencing. Immunoblot showed a significant reduction for Osgep and Tprkb proteins. For both genes, the acute multi-sgRNA knockout recapitulated the microcephaly phenotype and reduction in survival that we observed previously in stable knockout lines, though milder in the acute multi-sgRNA knockout. Finally, we quantify the degree of mutagenesis by deep sequencing, and provide a mathematical model to quantitate the chance for a biallelic loss-of-function mutation. Our findings can be generalized to acute and stable CRISPR/Cas targeting for any zebrafish gene of interest.
Energy Technology Data Exchange (ETDEWEB)
Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)
2014-03-07
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.
International Nuclear Information System (INIS)
Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko
2014-01-01
Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes
Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un
2016-12-01
Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.
Chen, Jiang; Du, Yinan; He, Xueyan; Huang, Xingxu; Shi, Yun S
2017-03-31
The most powerful way to probe protein function is to characterize the consequence of its deletion. Compared to conventional gene knockout (KO), conditional knockout (cKO) provides an advanced gene targeting strategy with which gene deletion can be performed in a spatially and temporally restricted manner. However, for most species that are amphiploid, the widely used Cre-flox conditional KO (cKO) system would need targeting loci in both alleles to be loxP flanked, which in practice, requires time and labor consuming breeding. This is considerably significant when one is dealing with multiple genes. CRISPR/Cas9 genome modulation system is advantaged in its capability in targeting multiple sites simultaneously. Here we propose a strategy that could achieve conditional KO of multiple genes in mouse with Cre recombinase dependent Cas9 expression. By transgenic construction of loxP-stop-loxP (LSL) controlled Cas9 (LSL-Cas9) together with sgRNAs targeting EGFP, we showed that the fluorescence molecule could be eliminated in a Cre-dependent manner. We further verified the efficacy of this novel strategy to target multiple sites by deleting c-Maf and MafB simultaneously in macrophages specifically. Compared to the traditional Cre-flox cKO strategy, this sgRNAs-LSL-Cas9 cKO system is simpler and faster, and would make conditional manipulation of multiple genes feasible.
Myostatin gene knockout mediated by Cas9-D10A nickase in chicken DF1 cells without off-target effect
Directory of Open Access Journals (Sweden)
Jeong Hyo Lee
2017-05-01
Full Text Available Objective Based on rapid advancement of genetic modification techniques, genomic editing is expected to become the most efficient tool for improvement of economic traits in livestock as well as poultry. In this study, we examined and verified the nickase of mutated CRISPR-associated protein 9 (Cas9 to modulate the specific target gene in chicken DF1 cells. Methods Chicken myostatin which inhibits muscle cell growth and differentiation during myogenesis was targeted to be deleted and mutated by the Cas9-D10A nickase. After co-transfection of the nickase expression vector with green fluorescent gene (GFP gene and targeted multiplex guide RNAs (gRNAs, the GFP-positive cells were sorted out by fluorescence-activated cell sorting procedure. Results Through the genotyping analysis of the knockout cells, the mutant induction efficiency was 100% in the targeted site. Number of the deleted nucleotides ranged from 2 to 39 nucleotide deletion. There was no phenotypic difference between regular cells and knockout cells. However, myostatin protein was not apparently detected in the knockout cells by Western blotting. Additionally, six off-target sites were predicted and analyzed but any non-specific mutation in the off-target sites was not observed. Conclusion The knockout technical platform with the nickase and multiplex gRNAs can be efficiently and stablely applied to functional genomics study in poultry and finally adapted to generate the knockout poultry for agribio industry.
Effects of alpha-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle
DEFF Research Database (Denmark)
Jørgensen, Sebastian Beck; Wojtaszewski, Jørgen; Viollet, Benoit
2005-01-01
We tested the hypothesis that 5'AMP-activated protein kinase (AMPK) plays an important role in regulating the acute, exercise-induced activation of metabolic genes in skeletal muscle, which were dissected from whole-body a2- and a1-AMPK knockout (KO) and wild-type (WT) mice at rest, after treadmi...
Graham, John H; Robb, Daniel T; Poe, Amy R
2012-01-01
Distributed robustness is thought to influence the buffering of random phenotypic variation through the scale-free topology of gene regulatory, metabolic, and protein-protein interaction networks. If this hypothesis is true, then the phenotypic response to the perturbation of particular nodes in such a network should be proportional to the number of links those nodes make with neighboring nodes. This suggests a probability distribution approximating an inverse power-law of random phenotypic variation. Zero phenotypic variation, however, is impossible, because random molecular and cellular processes are essential to normal development. Consequently, a more realistic distribution should have a y-intercept close to zero in the lower tail, a mode greater than zero, and a long (fat) upper tail. The double Pareto-lognormal (DPLN) distribution is an ideal candidate distribution. It consists of a mixture of a lognormal body and upper and lower power-law tails. If our assumptions are true, the DPLN distribution should provide a better fit to random phenotypic variation in a large series of single-gene knockout lines than other skewed or symmetrical distributions. We fit a large published data set of single-gene knockout lines in Saccharomyces cerevisiae to seven different probability distributions: DPLN, right Pareto-lognormal (RPLN), left Pareto-lognormal (LPLN), normal, lognormal, exponential, and Pareto. The best model was judged by the Akaike Information Criterion (AIC). Phenotypic variation among gene knockouts in S. cerevisiae fits a double Pareto-lognormal (DPLN) distribution better than any of the alternative distributions, including the right Pareto-lognormal and lognormal distributions. A DPLN distribution is consistent with the hypothesis that developmental stability is mediated, in part, by distributed robustness, the resilience of gene regulatory, metabolic, and protein-protein interaction networks. Alternatively, multiplicative cell growth, and the mixing of
Brooks, Andrew I; Chattopadhyay, Subrata; Mitchison, Hannah M; Nussbaum, Robert L; Pearce, David A
2003-01-01
Juvenile neuronal ceroid lipofuscinosis (JNCL or Batten Disease) is the most common progressive neurodegenerative disorder of childhood. The disease is inherited in an autosomal recessive manner and is the result of mutations in the CLN3 gene. One brain region severely affected in Batten disease is the cerebellum. Using a mouse model for Batten disease which shares pathological similarities to the disease in humans we have used oligonucleotide arrays to profile approximately 19000 mRNAs in the cerebellum. We have identified reproducible changes of twofold or more in the expression of 756 gene products in the cerebellum of 10-week-old Cln3-knockout mice as compared to wild-type controls. We have subsequently divided these genes with altered expression into 14 functional categories. We report a significant alteration in expression of genes associated with neurotransmission, neuronal cell structure and development, immune response and inflammation, and lipid metabolism. An apparent shift in metabolism toward gluconeogenesis is also evident in Cln3-knockout mice. Further experimentation will be necessary to understand the contribution of these changes in expression to a disease state. Detailed analysis of the functional consequences of altered expression of genes in the cerebellum of the Cln3-knockout mice may provide valuable clues in understanding the molecular basis of the pathological mechanisms underlying Batten disease.
Energy Technology Data Exchange (ETDEWEB)
Nicholas C Carpita
2009-04-20
Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Cloning and characterization of ATP synthase CF1 α gene from ...
African Journals Online (AJOL)
ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...
Understanding the direction of information flow is essential for characterizing how genetic networks affect phenotypes. However, methods to find genetic interactions largely fail to reveal directional dependencies. We combine two orthogonal Cas9 proteins from Streptococcus pyogenes and Staphylococcus aureus to carry out a dual screen in which one gene is activated while a second gene is deleted in the same cell. We analyze the quantitative effects of activation and knockout to calculate genetic interaction and directionality scores for each gene pair.
Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.
2003-01-01
Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...
Directory of Open Access Journals (Sweden)
Xiao-Yang Pang
Full Text Available Autolysis of lactic acid bacteria (LAB plays a vital role in dairy processing. During cheese making, autolysis of LAB affects cheese flavor development through release of intracellular enzymes and restricts the proliferation of cells in yogurt fermentation and probiotics production. In order to explore the mechanism of autolysis, the gene for the autolytic enzymes of L. bulgaricus, N-acetylmuramidase (mur, was cloned and sequenced (GenBank accession number: KF157911. Mur gene overexpression and gene knockout vectors were constructed based on pMG76e and pUC19 vectors. Recombinant plasmids were transformed into L. bulgaricus ljj-6 by electroporation, then three engineered strains with pMG76e-mur vector and fifteen engineered strains with pUC19-mur::EryBII were screened. The autolysis of the mur knockout strain was significantly lower and autolysis of the mur overexpressed strain was significantly higher compared with that of the wild type strain ljj-6. This result suggested that the mur gene played an important role in autolysis of L. bulgaricus. On the other hand, autolytic activity in a low degree was still observed in the mur knockout strain, which implied that other enzymes but autolysin encoded by mur were also involved in autolysis of L. bulgaricus.
Pang, Xiao-Yang; Cui, Wen-Ming; Liu, Lu; Zhang, Shu-Wen; Lv, Jia-Ping
2014-01-01
Autolysis of lactic acid bacteria (LAB) plays a vital role in dairy processing. During cheese making, autolysis of LAB affects cheese flavor development through release of intracellular enzymes and restricts the proliferation of cells in yogurt fermentation and probiotics production. In order to explore the mechanism of autolysis, the gene for the autolytic enzymes of L. bulgaricus, N-acetylmuramidase (mur), was cloned and sequenced (GenBank accession number: KF157911). Mur gene overexpression and gene knockout vectors were constructed based on pMG76e and pUC19 vectors. Recombinant plasmids were transformed into L. bulgaricus ljj-6 by electroporation, then three engineered strains with pMG76e-mur vector and fifteen engineered strains with pUC19-mur::EryBII were screened. The autolysis of the mur knockout strain was significantly lower and autolysis of the mur overexpressed strain was significantly higher compared with that of the wild type strain ljj-6. This result suggested that the mur gene played an important role in autolysis of L. bulgaricus. On the other hand, autolytic activity in a low degree was still observed in the mur knockout strain, which implied that other enzymes but autolysin encoded by mur were also involved in autolysis of L. bulgaricus.
International Nuclear Information System (INIS)
Rothenberg, M.; Hanson, M.R.
1988-01-01
A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts
Cascini, Fidelia; Passerotti, Stella; Martello, Simona
2012-04-10
In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw
Directory of Open Access Journals (Sweden)
Yanjing Su
2012-06-01
Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.
The serotonin transporter knockout rat : A review
Olivier, Jocelien; Cools, Alexander; Ellenbroek, Bart A.; Cuppen, E.; Homberg, Judith; Kalueff, Allan V.; LaPorte, Justin L.
2010-01-01
This chapter dicusses the most recent data on the serotonin transporter knock-out rat, a unique rat model that has been generated by target-selected N-ethyl-N-nitrosourea (ENU) driven mutagenesis. The knock-out rat is the result of a premature stopcodon in the serotonin transporter gene, and the
Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP
Sakudo, Akikazu; Onodera, Takashi
2015-01-01
Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp−/−) mice. So far, six types of Prnp−/− mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not fully reveal PrP functions. Recently, varieties of Prnp−/− cell lines established from Prnp−/− mice have contributed to the analysis of PrP functions. In this mini-review, we focus on Prnp−/− cell lines and summarize currently available Prnp−/− cell lines and their characterizations. In addition, we introduce the recent advances in the methodology of cell line generation with knockout or knockdown of the PrP gene. We also discuss how these cell lines have provided valuable insights into PrP functions and show future perspectives. PMID:25642423
Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).
Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq
2017-08-01
Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.
Xie, Yifang; Wang, Daqi; Lan, Feng; Wei, Gang; Ni, Ting; Chai, Renjie; Liu, Dong; Hu, Shijun; Li, Mingqing; Li, Dajin; Wang, Hongyan; Wang, Yongming
2017-05-24
Human pluripotent stem cells (hPSCs) represent a unique opportunity for understanding the molecular mechanisms underlying complex traits and diseases. CRISPR/Cas9 is a powerful tool to introduce genetic mutations into the hPSCs for loss-of-function studies. Here, we developed an episomal vector-based CRISPR/Cas9 system, which we called epiCRISPR, for highly efficient gene knockout in hPSCs. The epiCRISPR system enables generation of up to 100% Insertion/Deletion (indel) rates. In addition, the epiCRISPR system enables efficient double-gene knockout and genomic deletion. To minimize off-target cleavage, we combined the episomal vector technology with double-nicking strategy and recent developed high fidelity Cas9. Thus the epiCRISPR system offers a highly efficient platform for genetic analysis in hPSCs.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...
Directory of Open Access Journals (Sweden)
Tanda Koichi
2009-06-01
Full Text Available Abstract Background Neuronal nitric oxide synthase (nNOS is involved in the regulation of a diverse population of intracellular messenger systems in the brain. In humans, abnormal NOS/nitric oxide metabolism is suggested to contribute to the pathogenesis and pathophysiology of some neuropsychiatric disorders, such as schizophrenia and bipolar disorder. Mice with targeted disruption of the nNOS gene exhibit abnormal behaviors. Here, we subjected nNOS knockout (KO mice to a battery of behavioral tests to further investigate the role of nNOS in neuropsychiatric functions. We also examined the role of nNOS in dopamine/DARPP-32 signaling in striatal slices from nNOS KO mice and the effects of the administration of a dopamine D1 receptor agonist on behavior in nNOS KO mice. Results nNOS KO mice showed hyperlocomotor activity in a novel environment, increased social interaction in their home cage, decreased depression-related behavior, and impaired spatial memory retention. In striatal slices from nNOS KO mice, the effects of a dopamine D1 receptor agonist, SKF81297, on the phosphorylation of DARPP-32 and AMPA receptor subunit GluR1 at protein kinase A sites were enhanced. Consistent with the biochemical results, intraperitoneal injection of a low dose of SKF81297 significantly decreased prepulse inhibition in nNOS KO mice, but not in wild-type mice. Conclusion These findings indicate that nNOS KO upregulates dopamine D1 receptor signaling, and induces abnormal social behavior, hyperactivity and impaired remote spatial memory. nNOS KO mice may serve as a unique animal model of psychiatric disorders.
Flynn, Christopher M; Schmidt-Dannert, Claudia
2018-06-01
The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide
Directory of Open Access Journals (Sweden)
Kathryn M Munro
Full Text Available Mice lacking the axon guidance molecule EphA4 have been shown to exhibit extensive axonal regeneration and functional recovery following spinal cord injury. To assess mechanisms by which EphA4 may modify the response to neural injury a microarray was performed on spinal cord tissue from mice with spinal cord injury and sham injured controls. RNA was purified from spinal cords of adult EphA4 knockout and wild-type mice four days following lumbar spinal cord hemisection or laminectomy only and was hybridised to Affymetrix All-Exon Array 1.0 GeneChips™. While subsequent analyses indicated that several pathways were altered in EphA4 knockout mice, of particular interest was the attenuated expression of a number of inflammatory genes, including Arginase 1, expression of which was lower in injured EphA4 knockout compared to wild-type mice. Immunohistological analyses of different cellular components of the immune response were then performed in injured EphA4 knockout and wildtype spinal cords. While numbers of infiltrating CD3+ T cells were low in the hemisection model, a robust CD11b+ macrophage/microglial response was observed post-injury. There was no difference in the overall number or spread of macrophages/activated microglia in injured EphA4 knockout compared to wild-type spinal cords at 2, 4 or 14 days post-injury, however a lower proportion of Arginase-1 immunoreactive macrophages/activated microglia was observed in EphA4 knockout spinal cords at 4 days post-injury. Subtle alterations in the neuroinflammatory response in injured EphA4 knockout spinal cords may contribute to the regeneration and recovery observed in these mice following injury.
Conditional ablation of glycogen synthase kinase 3β in postnatal mouse kidney.
Ge, Yan; Si, Jin; Tian, Li; Zhuang, Shougang; Dworkin, Lance D; Gong, Rujun
2011-01-01
Glycogen synthase kinase (GSK)3 is a ubiquitously expressed serine/threonine kinase existing in two isoforms, namely GSK3α and GSK3β. Aside from the long-recognized role in insulin signal transduction and glycogen biosynthesis, GSK3β has been recently coined as a master control molecule in nuclear factor-κB activation and inflammatory kidney injury. Nevertheless, previous studies are less conclusive because they relied greatly on small molecule inhibitors, which lack selectivity and barely distinguish between the GSK3 isoforms. In addition, early embryonic lethality after global knockout of GSK3β precludes interrogation of the biological role of GSK3β in the adult kidney. To circumvent these issues, the Cre/loxP system was used to generate a conditional knockout mouse model in which the GSK3β gene was specifically deleted in kidney cortical tubules at postnatal mature stage. Kidney-specific ablation of GSK3β resulted in a phenotype no different from control littermates. Knockout mice (KO) were viable and exhibited normal development and normal kidney physiology in terms of kidney function, urine albumin excretion, and urine-concentrating ability. It is noteworthy that apart from normal glomerular and tubulointerstitial morphology, the kidneys from KO demonstrated more glycogen accumulation in the renal cortical tubules as assessed by both periodic acid-Schiff staining for light microscopy and direct biochemical assay, consistent with an elevated glycogen synthetic activity as evidenced by diminished inhibitory phosphorylation of glycogen synthase that occurred subsequent to GSK3β ablation. This finding was further validated by electron microscopic observations of increased deposition of glycogen particles in the renal tubules of KO, suggesting that GSK3α could not fully compensate for the loss of GSK3β in regulating glycogen metabolism in the kidney. Collectively, our study suggests that kidney-specific ablation of GSK3β barely affects kidney function
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Bjørbaek, C
1995-01-01
We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard
2011-01-01
Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of -786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT) and intima-media thickness of carotid arteries were significantly higher in -786CC homozygotes, in comparison with -786TC and -786TT patients. Regarding current smoking status, -786C allele was associated with higher CHOLT than -786T allele. Conclusion. Our study indicates the putative role of -786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking.
Directory of Open Access Journals (Sweden)
R. Vasudevan
2014-06-01
Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.
Directory of Open Access Journals (Sweden)
Xiudao Yu
2013-10-01
Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.
Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine
2013-03-01
Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT
Directory of Open Access Journals (Sweden)
Mariateresa eVolpicella
2016-03-01
Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.
[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].
Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V
2014-01-01
Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.
Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne
2004-01-01
The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...
Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W
2012-06-01
Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.
Directory of Open Access Journals (Sweden)
Piotr Szymczyk
2016-09-01
Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.
Directory of Open Access Journals (Sweden)
Shinsaku Tokuda
Full Text Available Tight junctions (TJs regulate the movements of substances through the paracellular pathway, and claudins are major determinants of TJ permeability. Claudin-2 forms high conductive cation pores in TJs. The suppression of claudin-2 expression by RNA interference in Madin-Darby canine kidney (MDCK II cells (a low-resistance strain of MDCK cells was shown to induce a three-fold increase in transepithelial electrical resistance (TER, which, however, was still lower than in high-resistance strains of MDCK cells. Because RNA interference-mediated knockdown is not complete and only reduces gene function, we considered the possibility that the remaining claudin-2 expression in the knockdown study caused the lower TER in claudin-2 knockdown cells. Therefore, we investigated the effects of claudin-2 knockout in MDCK II cells by establishing claudin-2 knockout clones using transcription activator-like effector nucleases (TALENs, a recently developed genome editing method for gene knockout. Surprisingly, claudin-2 knockout increased TER by more than 50-fold in MDCK II cells, and TER values in these cells (3000-4000 Ω·cm2 were comparable to those in the high-resistance strains of MDCK cells. Claudin-2 re-expression restored the TER of claudin-2 knockout cells dependent upon claudin-2 protein levels. In addition, we investigated the localization of claudin-1, -2, -3, -4, and -7 at TJs between control MDCK cells and their respective knockout cells using their TALENs. Claudin-2 and -7 were less efficiently localized at TJs between control and their knockout cells. Our results indicate that claudin-2 independently determines the 'leaky' property of TJs in MDCK II cells and suggest the importance of knockout analysis in cultured cells.
DEFF Research Database (Denmark)
Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek
2008-01-01
A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...
DEFF Research Database (Denmark)
Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo
2016-01-01
identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...
Global analysis of gene expression in the developing brain of Gtf2ird1 knockout mice.
Directory of Open Access Journals (Sweden)
Jennifer O'Leary
Full Text Available Williams-Beuren Syndrome (WBS is a neurodevelopmental disorder caused by a hemizygous deletion of a 1.5 Mb region on chromosome 7q11.23 encompassing 26 genes. One of these genes, GTF2IRD1, codes for a putative transcription factor that is expressed throughout the brain during development. Genotype-phenotype studies in patients with atypical deletions of 7q11.23 implicate this gene in the neurological features of WBS, and Gtf2ird1 knockout mice show reduced innate fear and increased sociability, consistent with features of WBS. Multiple studies have identified in vitro target genes of GTF2IRD1, but we sought to identify in vivo targets in the mouse brain.We performed the first in vivo microarray screen for transcriptional targets of Gtf2ird1 in brain tissue from Gtf2ird1 knockout and wildtype mice at embryonic day 15.5 and at birth. Changes in gene expression in the mutant mice were moderate (0.5 to 2.5 fold and of candidate genes with altered expression verified using real-time PCR, most were located on chromosome 5, within 10 Mb of Gtf2ird1. siRNA knock-down of Gtf2ird1 in two mouse neuronal cell lines failed to identify changes in expression of any of the genes identified from the microarray and subsequent analysis showed that differences in expression of genes on chromosome 5 were the result of retention of that chromosome region from the targeted embryonic stem cell line, and so were dependent upon strain rather than Gtf2ird1 genotype. In addition, specific analysis of genes previously identified as direct in vitro targets of GTF2IRD1 failed to show altered expression.We have been unable to identify any in vivo neuronal targets of GTF2IRD1 through genome-wide expression analysis, despite widespread and robust expression of this protein in the developing rodent brain.
Disease Model Discovery from 3,328 Gene Knockouts by The International Mouse Phenotyping Consortium
Meehan, Terrence F.; Conte, Nathalie; West, David B.; Jacobsen, Julius O.; Mason, Jeremy; Warren, Jonathan; Chen, Chao-Kung; Tudose, Ilinca; Relac, Mike; Matthews, Peter; Karp, Natasha; Santos, Luis; Fiegel, Tanja; Ring, Natalie; Westerberg, Henrik; Greenaway, Simon; Sneddon, Duncan; Morgan, Hugh; Codner, Gemma F; Stewart, Michelle E; Brown, James; Horner, Neil; Haendel, Melissa; Washington, Nicole; Mungall, Christopher J.; Reynolds, Corey L; Gallegos, Juan; Gailus-Durner, Valerie; Sorg, Tania; Pavlovic, Guillaume; Bower, Lynette R; Moore, Mark; Morse, Iva; Gao, Xiang; Tocchini-Valentini, Glauco P; Obata, Yuichi; Cho, Soo Young; Seong, Je Kyung; Seavitt, John; Beaudet, Arthur L.; Dickinson, Mary E.; Herault, Yann; Wurst, Wolfgang; de Angelis, Martin Hrabe; Lloyd, K.C. Kent; Flenniken, Ann M; Nutter, Lauryl MJ; Newbigging, Susan; McKerlie, Colin; Justice, Monica J.; Murray, Stephen A.; Svenson, Karen L.; Braun, Robert E.; White, Jacqueline K.; Bradley, Allan; Flicek, Paul; Wells, Sara; Skarnes, William C.; Adams, David J.; Parkinson, Helen; Mallon, Ann-Marie; Brown, Steve D.M.; Smedley, Damian
2017-01-01
Although next generation sequencing has revolutionised the ability to associate variants with human diseases, diagnostic rates and development of new therapies are still limited by our lack of knowledge of function and pathobiological mechanism for most genes. To address this challenge, the International Mouse Phenotyping Consortium (IMPC) is creating a genome- and phenome-wide catalogue of gene function by characterizing new knockout mouse strains across diverse biological systems through a broad set of standardised phenotyping tests, with all mice made readily available to the biomedical community. Analysing the first 3328 genes reveals models for 360 diseases including the first for type C Bernard-Soulier, Bardet-Biedl-5 and Gordon Holmes syndromes. 90% of our phenotype annotations are novel, providing the first functional evidence for 1092 genes and candidates in unsolved diseases such as Arrhythmogenic Right Ventricular Dysplasia 3. Finally, we describe our role in variant functional validation with the 100,000 Genomes and other projects. PMID:28650483
Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong
2016-02-10
In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.
Sun, Lichang; He, Tao; Zhang, Lili; Pang, Maoda; Zhang, Qiaoyan; Zhou, Yan; Bao, Hongduo; Wang, Ran
2017-07-28
The mcr-1 gene is a new "superbug" gene discoverd in China in 2016 that makes bacteria highly resistant to the last-resort class of antibiotics. The mcr-1 gene raised serious concern about its possible global dissemination and spread. Here, we report a potential anti-resistant strategy using the CRISPR/Cas9-mediated approach that can efficiently induce mcr-1 gene knockout in Escherichia coli . Our findings suggested that using the CRISPR/Cas9 system to knock out the resistance gene mcr-1 might be a potential anti-resistant strategy. Bovine myeloid antimicrobial peptide-27 could help deliver plasmid pCas::mcr targeting specific DNA sequences of the mcr-1 gene into microbial populations.
Directory of Open Access Journals (Sweden)
Mariela V Catone
Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.
Yuen, Garmen; Khan, Fehad J; Gao, Shaojian; Stommel, Jayne M; Batchelor, Eric; Wu, Xiaolin; Luo, Ji
2017-11-16
CRISPR/Cas9 is a powerful gene editing tool for gene knockout studies and functional genomic screens. Successful implementation of CRISPR often requires Cas9 to elicit efficient target knockout in a population of cells. In this study, we investigated the role of several key factors, including variation in target copy number, inherent potency of sgRNA guides, and expression level of Cas9 and sgRNA, in determining CRISPR knockout efficiency. Using isogenic, clonal cell lines with variable copy numbers of an EGFP transgene, we discovered that CRISPR knockout is relatively insensitive to target copy number, but is highly dependent on the potency of the sgRNA guide sequence. Kinetic analysis revealed that most target mutation occurs between 5 and 10 days following Cas9/sgRNA transduction, while sgRNAs with different potencies differ by their knockout time course and by their terminal-phase knockout efficiency. We showed that prolonged, low level expression of Cas9 and sgRNA often fails to elicit target mutation, particularly if the potency of the sgRNA is also low. Our findings provide new insights into the behavior of CRISPR/Cas9 in mammalian cells that could be used for future improvement of this platform. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing
2016-03-01
Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.
Marvel, Miranda; Spicer, Olivia Smith; Wong, Ten-Tsao; Zmora, Nilli; Zohar, Yonathan
2018-04-04
Gonadotropin-releasing hormone (GnRH) is known as a pivotal upstream regulator of reproduction in vertebrates. However, reproduction is not compromised in the hypophysiotropic Gnrh3 knockout line in zebrafish (gnrh3-/-). In order to determine if Gnrh2, the only other Gnrh isoform in zebrafish brains, is compensating for the loss of Gnrh3, we generated a double Gnrh knockout zebrafish line. Surprisingly, the loss of both Gnrh isoforms resulted in no major impact on reproduction, indicating that a compensatory response, outside of the Gnrh system, was evoked. A plethora of factors acting along the reproductive hypothalamus-pituitary axis were evaluated as possible compensators based on neuroanatomical and differential gene expression studies. In addition, we also examined the involvement of feeding factors in the brain as potential compensators for Gnrh2, which has known anorexigenic effects. We found that the double knockout fish exhibited upregulation of several genes in the brain, specifically gonadotropin-inhibitory hormone (gnih), secretogranin 2 (scg2), tachykinin 3a (tac3a), and pituitary adenylate cyclase-activating peptide 1 (pacap1), and downregulation of agouti-related peptide 1 (agrp1), indicating the compensation occurs outside of Gnrh cells and therefore is a non-cell autonomous response to the loss of Gnrh. While the differential expression of gnih and agrp1 in the double knockout line was confined to the periventricular nucleus and hypothalamus, respectively, the upregulation of scg2 corresponded with a broader neuronal redistribution in the lateral hypothalamus and hindbrain. In conclusion, our results demonstrate the existence of a redundant reproductive regulatory system that comes into play when Gnrh2 and Gnrh3 are lost.
Directory of Open Access Journals (Sweden)
Bua-In Saowaluck
2014-01-01
Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.
Hosomi, Koji; Kuwana, Ritsuko; Takamatsu, Hiromu; Kohda, Tomoko; Kozaki, Shunji; Mukamoto, Masafumi
2015-06-01
Clostridium botulinum is a heat-resistant spore-forming bacterium that causes the serious paralytic illness botulism. Heat-resistant spores may cause food sanitation hazards and sporulation plays a central role in the survival of C. botulinum. We observed morphological changes and investigated the role of the transcriptional regulator SpoIIID in the sporulation of C. botulinum type B strain 111 in order to elucidate the molecular mechanism in C. botulinum. C. botulinum type B formed heat-resistant spores through successive morphological changes corresponding to those of Bacillus subtilis, a spore-forming model organism. An analysis of the spoIIID gene knockout mutant revealed that the transcriptional regulator SpoIIID contributed to heat-resistant spore formation by C. botulinum type B and activated the transcription of the sigK gene later during sporulation. Transcription of the spoIIID gene, which differed from that in B. subtilis and Clostridium difficile, was observed in the sigE gene knockout mutant of C. botulinum type B. An analysis of the sigF gene knockout mutant showed that the sporulation-specific sigma factor SigF was essential for transcription of the spoIIID gene in C. botulinum type B. These results suggest that the regulation of sporulation in C. botulinum is not similar to that in B. subtilis and other clostridia. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Leila ePazouki
2015-03-01
Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.
Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav
2017-08-09
Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.
Directory of Open Access Journals (Sweden)
Nor ‘Aini, A. R.
2006-01-01
Full Text Available An integrated analysis of the cell growth characteristics, enzyme activities, intracellular metabolite concentrations was made to investigate the metabolic regulation of pgi gene knockout Escherichia coli based on batch culture and continuous culture which was performed at the dilution rate of 0.2h-1. The enzymatic study identified that pathways of pentose phosphate, ED pathway and glyoxylate shunt were all active in pgi mutant. The glycolysis enzymes i.e glyceraldehyde-3-phosphate dehydrogenase, fructose diphosphatase, pyruvate kinase, triose phosphate isomerase were down regulated implying that the inactivation of pgi gene reduced the carbon flux through glycolytic pathway. Meanwhile, the pentose phosphate pathway was active as a major route for intermediary carbohydrate metabolism instead of glycolysis. The pentose phosphate pathway generates most of the major reducing co-factor NADPH as shown by the increased of NADPH/NADP+ ratio in the mutant when compared with the parent strain. The fermentative enzymes such as acetate kinase and lactate dehydrogenase were down regulated in the mutant. Knockout of pgi gene results in the significant increase in the intracellular concentration of glucose-6-phosphate and decrease in the concentration of oxaloacetate. The slow growth rate of the mutant was assumed to be affected by the accumulation of glucose-6-phosphate and imbalance of NADPH reoxidation.
DEFF Research Database (Denmark)
Schmieder, Valerie; Bydlinski, Nina; Strasser, Richard
2017-01-01
(sgRNAs) for full gene deletions. This strategy also enables the targeting of regulatory regions, which would not respond to the conventional frameshift mutations, as shown by deleting the α-1,6-Fucosyltransferase 8 (FUT8) promoter resulting in a functional knock-out. Fut8 also served as model...
Prion protein (PrP) gene-knockout cell lines: insight into functions of the PrP
Sakudo, Akikazu; Onodera, Takashi
2015-01-01
Elucidation of prion protein (PrP) functions is crucial to fully understand prion diseases. A major approach to studying PrP functions is the use of PrP gene-knockout (Prnp ?/?) mice. So far, six types of Prnp ?/? mice have been generated, demonstrating the promiscuous functions of PrP. Recently, other PrP family members, such as Doppel and Shadoo, have been found. However, information obtained from comparative studies of structural and functional analyses of these PrP family proteins do not ...
Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao
2011-10-01
Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.
Gene Expression Profiles of Main Olfactory Epithelium in Adenylyl Cyclase 3 Knockout Mice
Directory of Open Access Journals (Sweden)
Zhenshan Wang
2015-11-01
Full Text Available Adenylyl Cyclase 3 (AC3 plays an important role in the olfactory sensation-signaling pathway in mice. AC3 deficiency leads to defects in olfaction. However, it is still unknown whether AC3 deficiency affects gene expression or olfactory signal transduction pathways within the main olfactory epithelium (MOE. In this study, gene microarrays were used to screen differentially expressed genes in MOE from AC3 knockout (AC3−/− and wild-type (AC3+/+ mice. The differentially expressed genes identified were subjected to bioinformatic analysis and verified by qRT-PCR. Gene expression in the MOE from AC3−/− mice was significantly altered, compared to AC3+/+ mice. Of the 41266 gene probes, 3379 had greater than 2-fold fold change in expression levels between AC3−/− and AC3+/+ mice, accounting for 8% of the total gene probes. Of these genes, 1391 were up regulated, and 1988 were down regulated, including 425 olfactory receptor genes, 99 genes that are specifically expressed in the immature olfactory neurons, 305 genes that are specifically expressed in the mature olfactory neurons, and 155 genes that are involved in epigenetic regulation. Quantitative RT-PCR verification of the differentially expressed epigenetic regulation related genes, olfactory receptors, ion transporter related genes, neuron development and differentiation related genes, lipid metabolism and membrane protein transport etc. related genes showed that P75NTR, Hinfp, Gadd45b, and Tet3 were significantly up-regulated, while Olfr370, Olfr1414, Olfr1208, Golf, Faim2, Tsg101, Mapk10, Actl6b, H2BE, ATF5, Kirrrel2, OMP, Drd2 etc. were significantly down-regulated. In summary, AC3 may play a role in proximal olfactory signaling and play a role in the regulation of differentially expressed genes in mouse MOE.
Kane, Garvan C; Lam, Chen-Fuh; O'Cochlain, Fearghas; Hodgson, Denice M; Reyes, Santiago; Liu, Xiao-Ke; Miki, Takashi; Seino, Susumu; Katusic, Zvonimir S; Terzic, Andre
2006-11-01
Sepsis, the systemic inflammatory response to infection, imposes a high demand for bodily adaptation, with the cardiovascular response a key determinant of outcome. The homeostatic elements that secure cardiac tolerance in the setting of the sepsis syndrome are poorly understood. Here, in a model of acute septic shock induced by endotoxin challenge with Escherichia coli lipopolysaccharide (LPS), knockout of the KCNJ8 gene encoding the vascular Kir6.1 K(ATP) channel pore predisposed to an early and profound survival disadvantage. The exaggerated susceptibility provoked by disruption of this stress-responsive sensor of cellular metabolism was linked to progressive deterioration in cardiac activity, ischemic myocardial damage, and contractile dysfunction. Deletion of KCNJ8 blunted the responsiveness of coronary vessels to cytokine- or metabolic-mediated vasodilation necessary to support myocardial perfusion in the wild-type (WT), creating a deficit in adaptive response in the Kir6.1 knockout. Application of a K(ATP) channel opener drug improved survival in the endotoxic WT but had no effect in the Kir6.1 knockout. Restoration of the dilatory capacity of coronary vessels was required to rescue the Kir6.1 knockout phenotype and reverse survival disadvantage in lethal endotoxemia. Thus, the Kir6.1-containing K(ATP) channel, by coupling vasoreactivity with metabolic demand, provides a vital feedback element for cardiovascular tolerance in endotoxic shock.
Directory of Open Access Journals (Sweden)
Blazej Misiak
2011-01-01
Full Text Available Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS. Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT and intima-media thickness of carotid arteries were significantly higher in −786CC homozygotes, in comparison with −786TC and −786TT patients. Regarding current smoking status, −786C allele was associated with higher CHOLT than −786T allele. Conclusion. Our study indicates the putative role of −786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking.
Misiak, Blazej; Krolik, Marta; Kukowka, Anna; Lewera, Anna; Leszczynski, Przemyslaw; Stankiewicz-Olczyk, Joanna; Slezak, Ryszard
2011-01-01
Background. Extensive evidence, arising from models of endothelial nitric oxide synthase gene (NOS3)-knockout mice supports the role of endothelial malfunction in the pathogenesis of the metabolic syndrome (MS). Aims. The aim of this study was to evaluate the role of −786T/C polymorphism in the etiology of MS and assess previously reported interaction with cigarette smoking. Methods. Based on International Diabetes Federation 2005 criteria, we recruited randomly 152 subjects with MS and 75 subjects without MS. Results. Allelic and genotype frequencies did not differ significantly between both groups. Total cholesterol level (CHOLT) and intima-media thickness of carotid arteries were significantly higher in −786CC homozygotes, in comparison with −786TC and −786TT patients. Regarding current smoking status, −786C allele was associated with higher CHOLT than −786T allele. Conclusion. Our study indicates the putative role of −786T/C polymorphism in the development of hypercholesterolemia, in patients with MS, which might be enhanced by cigarette smoking. PMID:22164159
DEFF Research Database (Denmark)
Liepman, Aaron H; Nairn, C Joseph; Willats, William G T
2007-01-01
from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...
Directory of Open Access Journals (Sweden)
Gnanasambandan Ramanathan
2017-01-01
Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.
Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh
2016-06-01
Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori
2016-11-18
Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Chen, Yanyan; Xu, Yuanyuan; Zheng, Hongzhi; Fu, Jingqi; Hou, Yongyong; Wang, Huihui; Zhang, Qiang; Yamamoto, Masayuki; Pi, Jingbo
2016-01-01
Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.
Energy Technology Data Exchange (ETDEWEB)
Chen, Yanyan [The First Affiliated Hospital, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States); Xu, Yuanyuan, E-mail: yyxu@cmu.edu.cn [School of Public Health, China Medical University, Shenyang, Liaoning (China); Zheng, Hongzhi [The First Affiliated Hospital, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States); Fu, Jingqi; Hou, Yongyong; Wang, Huihui [School of Public Health, China Medical University, Shenyang, Liaoning (China); Zhang, Qiang [Rollins School of Public Health, Emory University, Atlanta, GA (United States); Yamamoto, Masayuki [Graduate School of Medicine, Tohoku University, Sendai (Japan); Pi, Jingbo, E-mail: jbpi@cmu.edu.cn [School of Public Health, China Medical University, Shenyang, Liaoning (China); The Hamner Institutes for Health Sciences, Research Triangle Park, NC (United States)
2016-09-09
Nuclear factor E2-related factor 2 (NRF2) and uncoupling protein 2 (UCP2) are indicated to protect from oxidative stress. They also play roles in the homeostasis of glutathione. However, the detailed mechanisms are not well understood. In the present study, we found Nrf2-knockout (Nrf2-KO) mice exhibited altered glutathione homeostasis and reduced expression of various genes involved in GSH biosynthesis, regeneration, utilization and transport in the liver. Ucp2-knockout (Ucp2-KO) mice exhibited altered glutathione homeostasis in the liver, spleen and blood, as well as increased transcript of cystic fibrosis transmembrane conductance regulator in the liver, a protein capable of mediating glutathione efflux. Nrf2-Ucp2-double knockout (DKO) mice showed characteristics of both Nrf2-KO and Ucp2-KO mice. But no significant difference was observed in DKO mice when compared with Nrf2-KO or Ucp2-KO mice, except in blood glutathione levels. These data suggest that ablation of Nrf2 and Ucp2 leads to disrupted GSH balance, which could result from altered expression of genes involved in GSH metabolism. DKO may not evoke more severe oxidative stress than the single gene knockout. - Highlights: • Nrf2/Ucp2 deficiency leads to alteration of glutathione homeostasis. • Nrf2 regulates expression of genes in glutathione generation and utilization. • Ucp2 affects glutathione metabolism by regulating hepatic efflux of glutathione. • Nrf2 deficiency may not aggravate oxidative stress in Ucp2-deficient mice.
Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui
2015-09-01
In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.
Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.
2012-01-01
The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...
DEFF Research Database (Denmark)
Costa, M C; Helweg-Larsen, J; Lundgren, Bettina
2003-01-01
The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...
Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes
Directory of Open Access Journals (Sweden)
Bin Wang
2010-07-01
Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.
Efficient gene knock-out and knock-in with transgenic Cas9 in Drosophila.
Xue, Zhaoyu; Ren, Mengda; Wu, Menghua; Dai, Junbiao; Rong, Yikang S; Gao, Guanjun
2014-03-21
Bacterial Cas9 nuclease induces site-specific DNA breaks using small gRNA as guides. Cas9 has been successfully introduced into Drosophila for genome editing. Here, we improve the versatility of this method by developing a transgenic system that expresses Cas9 in the Drosophila germline. Using this system, we induced inheritable knock-out mutations by injecting only the gRNA into embryos, achieved highly efficient mutagenesis by expressing gRNA from the promoter of a novel non-coding RNA gene, and recovered homologous recombination-based knock-in of a fluorescent marker at a rate of 4.5% by co-injecting gRNA with a circular DNA donor. Copyright © 2014 Xue et al.
Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S
2013-03-01
Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.
Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)
Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru
2018-04-01
Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.
Directory of Open Access Journals (Sweden)
So-Jung Kim
2017-03-01
Full Text Available Kelch-like ECH-associated protein 1 (keap1 is a cysteine-rich protein that interacts with transcription factor Nrf2 in a redox-sensitive manner, leading to the degradation of Nrf2 (Kim et al., 2014a. Disruption of Keap1 results in the induction of Nrf2-related signaling pathways involving the expression of a set of anti-oxidant and anti-inflammatory genes. We generated biallelic mutants of the Keap1 gene using a CRISPR-Cas9 genome editing method in the H9 human embryonic stem cell (hESC. The Keap1 homozygous-knockout H9 cell line retained normal morphology, gene expression, and in vivo differentiation potential.
Directory of Open Access Journals (Sweden)
Meng eWang
2013-05-01
Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.
Progressive hearing loss and degeneration of hair cell stereocilia in taperin gene knockout mice
International Nuclear Information System (INIS)
Chen, Mo; Wang, Qin; Zhu, Gang-Hua; Hu, Peng; Zhou, Yuan; Wang, Tian; Lai, Ruo-Sha; Xiao, Zi-An; Xie, Ding-Hua
2016-01-01
The TPRN gene encodes taperin, which is prominently present at the taper region of hair cell stereocilia. Mutations in TPRN have been reported to cause autosomal recessive nonsyndromic deafness 79(DFNB 79). To investigate the role of taperin in pathogenesis of hearing loss, we generated TPRN knockout mice using TALEN technique. Sanger sequencing confirmed an 11 bp deletion at nucleotide 177–187 in exon 1 of TPRN, which results in a truncated form of taperin protein. Heterozygous TPRN +/− mice showed apparently normal auditory phenotypes to their wide-type (WT) littermates. Homozygous TPRN −/− mice exhibited progressive sensorineural hearing loss as reflected by auditory brainstem response to both click and tone burst stimuli at postnatal days 15 (P15), 30 (P30), and 60 (P60). Alex Fluor-594 phalloidin labeling showed no obvious difference in hair cell numbers in the cochlea between TPRN −/− mice and WT mice under light microscope. However, scanning electronic microscopy revealed progressive degeneration of inner hair cell stereocilia, from apparently normal at postnatal days 3 (P3) to scattered absence at P15 and further to substantial loss at P30. The outer hair cell stereocilia also showed progressive degeneration, though much less severe, Collectively, we conclude that taperin plays an important role in maintenance of hair cell stereocilia. Establishment of TPRN knockout mice enables further investigation into the function of this gene. - Highlights: • TPRN −/− mice were generated using TALEN technique. • TPRN −/− mice presented progressive hearing loss. • WT and TPRN −/− mice showed no difference in hair cell numbers. • TPRN −/− mice showed progressive degeneration of hair cell stereocilia.
Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey
2015-12-01
Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Here we report a new species, Sarcocystis pantherophisi with the Eastern rat snake (Pantherophis alleghaniensis) as natural definitive host and the interferon gamma gene knockout (KO) mouse as the experimental intermediate host. Sporocysts (n=15) from intestinal contents of the snake were 17.3 x 10....
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Noar, Roslyn D; Daub, Margaret E
2016-01-01
Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode
Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.
Directory of Open Access Journals (Sweden)
Roslyn D Noar
Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that
Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng
2018-03-06
Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.
2015-01-01
Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891
Directory of Open Access Journals (Sweden)
Sofia Sisay
Full Text Available Endocannabinoids and some phytocannabinoids bind to CB1 and CB2 cannabinoid receptors, transient receptor potential vanilloid one (TRPV1 receptor and the orphan G protein receptor fifty-five (GPR55. Studies using C57BL/10 and C57BL/6 (Cnr2 (tm1Zim CB2 cannabinoid receptor knockout mice have demonstrated an immune-augmenting effect in experimental autoimmune encephalomyelitis (EAE models of multiple sclerosis. However, other EAE studies in Biozzi ABH mice often failed to show any treatment effect of either CB2 receptor agonism or antagonism on inhibition of T cell autoimmunity. The influence of genetic background on the induction of EAE in endocannabinoid system-related gene knockout mice was examined. It was found that C57BL/6.GPR55 knockout mice developed less severe disease, notably in female mice, following active induction with myelin oligodendrocyte glycoprotein 35-55 peptide. In contrast C57BL/6.CB2 (Cnr2 (Dgen receptor knockout mice developed augmented severity of disease consistent with the genetically and pharmacologically-distinct, Cnr2 (tm1Zim mice. However, when the knockout gene was bred into the ABH mouse background and EAE induced with spinal cord autoantigens the immune-enhancing effect of CB2 receptor deletion was lost. Likewise CB1 receptor and transient receptor potential vanilloid one knockout mice on the ABH background demonstrated no alteration in immune-susceptibility, in terms of disease incidence and severity of EAE, in contrast to that reported in some C57BL/6 mouse studies. Furthermore the immune-modulating influence of GPR55 was marginal on the ABH mouse background. Whilst sedative doses of tetrahydrocannabinol could induce immunosuppression, this was associated with a CB1 receptor rather than a CB2 receptor-mediated effect. These data support the fact that non-psychoactive doses of medicinal cannabis have a marginal influence on the immune response in MS. Importantly, it adds a note of caution for the translational
Deconstructing mammalian reproduction: using knockouts to define fertility pathways.
Roy, Angshumoy; Matzuk, Martin M
2006-02-01
Reproduction is the sine qua non for the propagation of species and continuation of life. It is a complex biological process that is regulated by multiple factors during the reproductive life of an organism. Over the past decade, the molecular mechanisms regulating reproduction in mammals have been rapidly unraveled by the study of a vast number of mouse gene knockouts with impaired fertility. The use of reverse genetics to generate null mutants in mice through targeted disruption of specific genes has enabled researchers to identify essential regulators of spermatogenesis and oogenesis in vivo and model human disorders affecting reproduction. This review focuses on the merits, utility, and the variations of the knockout technology in studies of reproduction in mammals.
Directory of Open Access Journals (Sweden)
Resnanti Utami Handayani
2014-07-01
Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.
Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi
2014-10-01
Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.
CD44 and Bak expression in IL-6 or TNF-alpha gene knockout mice after whole lung irradiation
International Nuclear Information System (INIS)
Sakai, Minako; Iwakawa, Mayumi; Ohta, Toshie; Tsujii, Hirohiko; Imai, Takashi; Iwakura, Yoichiro
2008-01-01
To understand the molecular mechanisms that underlie radiation pneumonitis, we examined whether knockout of the tumor necrosis factor (TNF) or the interleukin (IL)-6 gene could give mice an inherent resistance to radiation in the acute phase of alveolar damage after thoracic irradiation. The temporal expression of inflammation (CD44) and apoptosis (Bak) markers in lung after thoracic irradiation was measured to determine the degree of alveolar damage. At 4 weeks post-irradiation (10 Gy), small inflammatory foci were observed in all mice, but there were no obvious histological differences between control (C57BL/6JSlc), TNF-alpha knockout (TNF KO), and IL-6 knockout (IL-6 KO) mice. However, immunohistochemical analysis of CD44 and Bak expression over a time course of 2 weeks highlighted significant differences between the three groups. C57BL/6JSlc and TNF KO mice had increased numbers of both CD44-positive and Bak-positive cells after irradiation, while the IL-6 KO mice showed stable levels of CD44 and Bak. In conclusion, the radioresistant status of IL-6 KO mice in the acute phase of alveolar damage after irradiation suggested an important role for IL-6 in radiation pneumonitis. (author)
Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika
2017-12-01
An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.
Liu, Zhongliang; Hui, Yi; Shi, Lei; Chen, Zhenyu; Xu, Xiangjie; Chi, Liankai; Fan, Beibei; Fang, Yujiang; Liu, Yang; Ma, Lin; Wang, Yiran; Xiao, Lei; Zhang, Quanbin; Jin, Guohua; Liu, Ling; Zhang, Xiaoqing
2016-09-13
Loss-of-function studies in human pluripotent stem cells (hPSCs) require efficient methodologies for lesion of genes of interest. Here, we introduce a donor-free paired gRNA-guided CRISPR/Cas9 knockout strategy (paired-KO) for efficient and rapid gene ablation in hPSCs. Through paired-KO, we succeeded in targeting all genes of interest with high biallelic targeting efficiencies. More importantly, during paired-KO, the cleaved DNA was repaired mostly through direct end joining without insertions/deletions (precise ligation), and thus makes the lesion product predictable. The paired-KO remained highly efficient for one-step targeting of multiple genes and was also efficient for targeting of microRNA, while for long non-coding RNA over 8 kb, cleavage of a short fragment of the core promoter region was sufficient to eradicate downstream gene transcription. This work suggests that the paired-KO strategy is a simple and robust system for loss-of-function studies for both coding and non-coding genes in hPSCs. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jun Song
2018-03-01
Full Text Available Using the CRISPR/Cas9 gene-editing technology, we recently produced a number of rabbits with mutations in immune function genes, including FOXN1, PRKDC, RAG1, RAG2, and IL2RG. Seven founder knockout rabbits (F0 and three male IL2RG null (−/y F1 animals demonstrated severe combined immunodeficiency (SCID, characterized by absence or pronounced hypoplasia of the thymus and splenic white pulp, and absence of immature and mature T and B-lymphocytes in peripheral blood. Complete blood count analysis showed severe leukopenia and lymphocytopenia accompanied by severe neutrophilia. Without prophylactic antibiotics, the SCID rabbits universally succumbed to lung infections following weaning. Pathology examination revealed severe heterophilic bronchopneumonia caused by Bordetella bronchiseptica in several animals, but a consistent feature of lung lesions in all animals was a severe interstitial pneumonia caused by Pneumocystis oryctolagi, as confirmed by histological examination and PCR analysis of Pneumocystis genes. The results of this study suggest that these SCID rabbits could serve as a useful model for human SCID to investigate the disease pathogenesis and the development of gene and drug therapies.
Song, Jun; Wang, Guoshun; Hoenerhoff, Mark J.; Ruan, Jinxue; Yang, Dongshan; Zhang, Jifeng; Yang, Jibing; Lester, Patrick A.; Sigler, Robert; Bradley, Michael; Eckley, Samantha; Cornelius, Kelsey; Chen, Kong; Kolls, Jay K.; Peng, Li; Ma, Liang; Chen, Yuqing Eugene; Sun, Fei; Xu, Jie
2018-01-01
Using the CRISPR/Cas9 gene-editing technology, we recently produced a number of rabbits with mutations in immune function genes, including FOXN1, PRKDC, RAG1, RAG2, and IL2RG. Seven founder knockout rabbits (F0) and three male IL2RG null (−/y) F1 animals demonstrated severe combined immunodeficiency (SCID), characterized by absence or pronounced hypoplasia of the thymus and splenic white pulp, and absence of immature and mature T and B-lymphocytes in peripheral blood. Complete blood count analysis showed severe leukopenia and lymphocytopenia accompanied by severe neutrophilia. Without prophylactic antibiotics, the SCID rabbits universally succumbed to lung infections following weaning. Pathology examination revealed severe heterophilic bronchopneumonia caused by Bordetella bronchiseptica in several animals, but a consistent feature of lung lesions in all animals was a severe interstitial pneumonia caused by Pneumocystis oryctolagi, as confirmed by histological examination and PCR analysis of Pneumocystis genes. The results of this study suggest that these SCID rabbits could serve as a useful model for human SCID to investigate the disease pathogenesis and the development of gene and drug therapies. PMID:29593714
Cyclic GMP-AMP Synthase Is an Innate Immune DNA Sensor for Mycobacterium tuberculosis.
Collins, Angela C; Cai, Haocheng; Li, Tuo; Franco, Luis H; Li, Xiao-Dong; Nair, Vidhya R; Scharn, Caitlyn R; Stamm, Chelsea E; Levine, Beth; Chen, Zhijian J; Shiloh, Michael U
2015-06-10
Activation of the DNA-dependent cytosolic surveillance pathway in response to Mycobacterium tuberculosis infection stimulates ubiquitin-dependent autophagy and inflammatory cytokine production, and plays an important role in host defense against M. tuberculosis. However, the identity of the host sensor for M. tuberculosis DNA is unknown. Here we show that M. tuberculosis activated cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) synthase (cGAS) in macrophages to produce cGAMP, a second messenger that activates the adaptor protein stimulator of interferon genes (STING) to induce type I interferons and other cytokines. cGAS localized with M. tuberculosis in mouse and human cells and in human tuberculosis lesions. Knockdown or knockout of cGAS in human or mouse macrophages blocked cytokine production and induction of autophagy. Mice deficient in cGAS were more susceptible to lethality caused by infection with M. tuberculosis. These results demonstrate that cGAS is a vital innate immune sensor of M. tuberculosis infection. Copyright © 2015 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Dullat Harpreet K
2011-03-01
Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.
Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.
2000-01-01
The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were
Li, Xiaoli; Li, Yaqing; Han, Gaoyang; Li, Xiaoran; Ji, Yasai; Fan, Zhirui; Zhong, Yali; Cao, Jing; Zhao, Jing; Mariusz, Goscinski; Zhang, Mingzhi; Wen, Jianguo; Nesland, Jahn M.; Suo, Zhenhe
2016-01-01
Pyruvate plays a critical role in the mitochondrial tricarboxylic acid (TCA) cycle, and it is the center product for the synthesis of amino acids, carbohydrates and fatty acids. Pyruvate transported across the inner mitochondrial membrane appears to be essential in anabolic and catabolic intermediary metabolism. The mitochondrial pyruvate carrier (MPC) mounted in the inner membrane of mitochondria serves as the channel to facilitate pyruvate permeating. In mammals, the MPC is formed by two paralogous subunits, MPC1 and MPC2. It is known that complete ablation of MPC2 in mice causes death on the 11th or 12th day of the embryonic period. However, MPC1 deletion and the knowledge of gene function in vivo are lacking. Using the new technology of gene manipulation known as Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR-associated 9 (CRISPR/Cas9) systems, we gained stable MPC1 gene heterozygous mutation mice models, and the heterozygous mutations could be stably maintained in their offsprings. Only one line with homozygous 27 bases deletion in the first exon was established, but no offsprings could be obtained after four months of mating experiments, indicating infertility of the mice with such homozygous deletion. The other line of MPC1 knockout (KO) mice was only heterozygous, which mutated in the first exon with a terminator shortly afterwards. These two lines of MPC1 KO mice showed lower fertility and significantly higher bodyweight in the females. We concluded that heterozygous MPC1 KO weakens fertility and influences the metabolism of glucose and fatty acid and bodyweight in mice. PMID:27835892
Directory of Open Access Journals (Sweden)
Ben Stocks
2017-12-01
Full Text Available Tumour protein 53 (p53 has been implicated in the regulation of mitochondrial biogenesis in skeletal muscle, with whole-body p53 knockout mice displaying impairments in basal mitochondrial content, respiratory capacity, and enzyme activity. This study aimed to determine the effect of skeletal muscle-specific loss of p53 on mitochondrial content and enzyme activity. Mitochondrial protein content, enzyme activity and mRNA profiles were assessed in skeletal muscle of 8-week-old male muscle fibre-specific p53 knockout mice (p53 mKO and floxed littermate controls (WT under basal conditions. p53 mKO and WT mice displayed similar content of electron transport chain proteins I-V and citrate synthase enzyme activity in skeletal muscle. In addition, the content of proteins regulating mitochondrial morphology (MFN2, mitofillin, OPA1, DRP1, FIS1, fatty acid metabolism (β-HAD, ACADM, ACADL, ACADVL, carbohydrate metabolism (HKII, PDH, energy sensing (AMPKα2, AMPKβ2, and gene transcription (NRF1, PGC-1α, and TFAM were comparable in p53 mKO and WT mice (p > 0.05. Furthermore, p53 mKO mice exhibited normal mRNA profiles of targeted mitochondrial, metabolic and transcriptional proteins (p > 0.05. Thus, it appears that p53 expression in skeletal muscle fibres is not required to develop or maintain mitochondrial protein content or enzyme function in skeletal muscle under basal conditions.
Hepatic changes in metabolic gene expression in old ghrelin and ghrelin receptor knockout mice
Ghrelin knockout (GKO) and ghrelin receptor (growth hormone secretagogue receptor) knockout (GHSRKO) mice exhibit enhanced insulin sensitivity, but the mechanism is unclear. Insulin sensitivity declines with age and is inversely associated with accumulation of lipid in liver, a key glucoregulatory ...
Zuo, Y-Y; Huang, J-L; Wang, J; Feng, Y; Han, T-T; Wu, Y-D; Yang, Y-H
2018-02-01
P-glycoprotein [P-gp or the ATP-binding cassette transporter B1 (ABCB1)] is an important participant in multidrug resistance of cancer cells, yet the precise function of this arthropod transporter is unknown. The aim of this study was to determine the importance of P-gp for susceptibility to insecticides in the beet armyworm (Spodoptera exigua) using clustered regularly interspaced short palindromic repeats/CRISPR-associated 9 (CRISPR/Cas9) gene-editing technology. We cloned an open reading frame (ORF) encoding the S. exigua P-gp protein (SeP-gp) predicted to display structural characteristics common to P-gp and other insect ABCB1 transporters. A knockout line with a frame shift deletion of four nucleotides in the SeP-gp ORF was established using the CRISPR/Cas9 gene-editing system to test its potential role in determining susceptibility to chemical insecticides or insecticidal proteins from the bacterium Bacillus thuringiensis (Bt). Results from comparative bioassays demonstrate that knockout of SeP-gp significantly increases susceptibility of S. exigua by around threefold to abamectin and emamectin benzoate (EB), but not to spinosad, chlorfenapyr, beta-cypermethrin, carbosulfan indoxacarb, chlorpyrifos, phoxim, diafenthiuron, chlorfluazuron, chlorantraniliprole or two Bt toxins (Cry1Ca and Cry1Fa). Our data support an important role for SeP-gp in susceptibility of S. exigua to abamectin and EB and imply that overexpression of SeP-gp may contribute to abamectin and EB resistance in S. exigua. © 2017 The Royal Entomological Society.
Su, Shengan; Lu, Yunbi; Zhang, Weiping
2013-05-01
To investigate the effects of aquaporin-4 (AQP4) gene knockout on the behavior changes and cerebral morphology during aging in mice,and to compare that of young and aged mice between AQP4 knockout mice (AQP4(-/-)) and wild type mice (AQP4(+/+)). Fifty-eight CD-1 mice were divided into four groups: young (2-3 months old) AQP4(-/-), aged (17-19 months old) AQP4(-/-), young AQP4(+/+) and aged AQP4(+/+). The activity levels and exploring behavior of mice were tested in open field. The neurons were stained with toluidine blue and NeuN, the astrocytes and microglia were stained with GFAP and Iba-1, respectively. The morphological changes of neuron, astrocyte and microglia were then analyzed. Compared with young mice, the total walking distance in open field of aged AQP4(+/+) mice and aged AQP4(-/-) mice decreased 41.2% and 44.1%, respectively (Ptime in the central area of open field. The density of neuron in cortex of aged AQP4(+/+) mice and aged AQP4(-/-) mice decreased 19.6% and 15.8%, respectively (P<0.05), while there was no difference in the thickness of neuron cell body in hippocampus CA1 region. The density of astrocyte in hippocampus CA3 region of aged AQP4(+/+) mice and aged AQP4(-/-) mice increased 57.7% and 64.3%, respectively (P<0.001), while there was no difference in the area of astrocyte. The area of microglia in hippocampus CA3 region of aged AQP4(+/+) mice and aged AQP4(-/-) mice increased 46.9% and 52.0%, respectively (P<0.01), while there was no difference in the density of microglia. Compared with AQP4(+/+) mice, the young and aged AQP4(-/-) mice showed smaller area of astrocyte in hippocampus CA3 region, reduced 18.0% in young mice and 23.6% in aged mice. There was no difference between AQP4(+/+) mice and AQP4(-/-) mice for other observed indexes. AQP4 may be involved in change of astrocyte and astrocyte-related behaviors during aging. AQP4 gene knockout may have limited effects on the change of neuron, microglia and most neuronal behaviors in aging
Lane, Courtney E; Benton, Michael G
2015-12-01
A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ober, Dietrich; Hartmann, Thomas
1999-01-01
Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289
Miyamoto, Kei; Suzuki, Ken-Ichi T; Suzuki, Miyuki; Sakane, Yuto; Sakuma, Tetsushi; Herberg, Sarah; Simeone, Angela; Simpson, David; Jullien, Jerome; Yamamoto, Takashi; Gurdon, J B
2015-01-01
Recent advances in genome editing using programmable nucleases have revolutionized gene targeting in various organisms. Successful gene knock-out has been shown in Xenopus, a widely used model organism, although a system enabling less mosaic knock-out in founder embryos (F0) needs to be explored in order to judge phenotypes in the F0 generation. Here, we injected modified highly active transcription activator-like effector nuclease (TALEN) mRNA to oocytes at the germinal vesicle (GV) stage, followed by in vitro maturation and intracytoplasmic sperm injection, to achieve a full knock-out in F0 embryos. Unlike conventional injection methods to fertilized embryos, the injection of TALEN mRNA into GV oocytes allows expression of nucleases before fertilization, enabling them to work from an earlier stage. Using this procedure, most of developed embryos showed full knock-out phenotypes of the pigmentation gene tyrosinase and/or embryonic lethal gene pax6 in the founder generation. In addition, our method permitted a large 1 kb deletion. Thus, we describe nearly complete gene knock-out phenotypes in Xenopus laevis F0 embryos. The presented method will help to accelerate the production of knock-out frogs since we can bypass an extra generation of about 1 year in Xenopus laevis. Meantime, our method provides a unique opportunity to rapidly test the developmental effects of disrupting those genes that do not permit growth to an adult able to reproduce. In addition, the protocol shown here is considerably less invasive than the previously used host transfer since our protocol does not require surgery. The experimental scheme presented is potentially applicable to other organisms such as mammals and fish to resolve common issues of mosaicism in founders.
Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying
2016-12-28
The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.
International Nuclear Information System (INIS)
Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.
2006-01-01
The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)
Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T
2016-12-01
Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger
Energy Technology Data Exchange (ETDEWEB)
Rinker, Torri E.; Baker, Scott E.
2007-01-29
Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.
FMR1 Knockout mice: A model to study fragile X mental retardation
Energy Technology Data Exchange (ETDEWEB)
Oostra, B.A.; Bakker, C.E.; Reyniers, E. [Erasmus Univ., Rotterdam (Netherlands)] [and others
1994-09-01
The fragile X syndrome is the most frequent form of inherited mental retardation in humans with an incidence of 1 in 1250 males and 1 in 2500 females. The clinical syndrome includes moderate to severe mental retardation, autistic behavior, macroorchidism, and facial features, such as long face with mandibular prognathism and large, everted ears. The molecular basis for this disease is a large expansion of a triplet repeat (CGG){sub n} in the 5{prime} untranslated region of the FMR1 gene. Due to this large expansion of the CGG repeat, the promoter region becomes methylated and the FMR1 gene is subsequently silenced. Hardly anything is known about the physiologic function of FMR1 and the pathologic mechanisms leading to these symptoms. Since the FMR1 gene is highly conserved in the mouse, we used the mouse to design a knockout model for the fragile X syndrome. These knockout mice lacking Fmrp have normal litter size suggesting that FMR1 is not essential in human gametogenesis and embryonic development. The knockout mice show the abnormalities also seen in the affected organs of human patients. Mutant mice show a gradual development through time of macroorchidism. In the knockout mice we observed cognitive defects in the form of deficits in learning (as shown by the hidden platform Morris water maze task) and behavioral abnormalities such as increased exploratory behavior and hyperactivity. Therefore this knockout mouse may serve as a valuable tool in studying the role of FMR1 in the fragile X syndrome and may serve as a model to elucidate the mechanisms involved in macroorchidism, abnormal behavior, and mental retardation.
Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians
DEFF Research Database (Denmark)
Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh
2008-01-01
of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...
Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei
2013-01-01
Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...
Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei
2017-02-01
Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P
2013-05-01
We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.
Mohamed Salleh, Faridah Hani; Arif, Shereena Mohd; Zainudin, Suhaila; Firdaus-Raih, Mohd
2015-12-01
A gene regulatory network (GRN) is a large and complex network consisting of interacting elements that, over time, affect each other's state. The dynamics of complex gene regulatory processes are difficult to understand using intuitive approaches alone. To overcome this problem, we propose an algorithm for inferring the regulatory interactions from knock-out data using a Gaussian model combines with Pearson Correlation Coefficient (PCC). There are several problems relating to GRN construction that have been outlined in this paper. We demonstrated the ability of our proposed method to (1) predict the presence of regulatory interactions between genes, (2) their directionality and (3) their states (activation or suppression). The algorithm was applied to network sizes of 10 and 50 genes from DREAM3 datasets and network sizes of 10 from DREAM4 datasets. The predicted networks were evaluated based on AUROC and AUPR. We discovered that high false positive values were generated by our GRN prediction methods because the indirect regulations have been wrongly predicted as true relationships. We achieved satisfactory results as the majority of sub-networks achieved AUROC values above 0.5. Copyright © 2015 Elsevier Ltd. All rights reserved.
Sato, Shigeto; Koike, Masato; Funayama, Manabu; Ezaki, Junji; Fukuda, Takahiro; Ueno, Takashi; Uchiyama, Yasuo; Hattori, Nobutaka
2016-12-01
Kufor-Rakeb syndrome (KRS) is an autosomal recessive form of early-onset parkinsonism linked to the PARK9 locus. The causative gene for KRS is Atp13a2, which encodes a lysosomal type 5 P-type ATPase. We recently showed that KRS/PARK9-linked mutations lead to several lysosomal alterations, including reduced proteolytic processing of cathepsin D in vitro. However, it remains unknown how deficiency of Atp13a2 is connected to lysosomal impairments. To address this issue, we analyzed brain tissues of Atp13a2 conditional-knockout mice, which exhibited characteristic features of neuronal ceroid lipofuscinosis, including accumulation of lipofuscin positive for subunit c of mitochondrial ATP synthase, suggesting that a common pathogenic mechanism underlies both neuronal ceroid lipofuscinosis and Parkinson disease. Copyright © 2016 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Generation of knockout rabbits using transcription activator-like effector nucleases.
Wang, Yu; Fan, Nana; Song, Jun; Zhong, Juan; Guo, Xiaogang; Tian, Weihua; Zhang, Quanjun; Cui, Fenggong; Li, Li; Newsome, Philip N; Frampton, Jon; Esteban, Miguel A; Lai, Liangxue
2014-01-01
Zinc-finger nucleases and transcription activator-like effector nucleases are novel gene-editing platforms contributing to redefine the boundaries of modern biological research. They are composed of a non-specific cleavage domain and a tailor made DNA-binding module, which enables a broad range of genetic modifications by inducing efficient DNA double-strand breaks at desired loci. Among other remarkable uses, these nucleases have been employed to produce gene knockouts in mid-size and large animals, such as rabbits and pigs, respectively. This approach is cost effective, relatively quick, and can produce invaluable models for human disease studies, biotechnology or agricultural purposes. Here we describe a protocol for the efficient generation of knockout rabbits using transcription activator-like effector nucleases, and a perspective of the field.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-10-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.
DEFF Research Database (Denmark)
Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri
2014-01-01
BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Directory of Open Access Journals (Sweden)
Michelle Wehling-Henricks
Full Text Available Survival of dystrophin/utrophin double-knockout (dko mice was increased by muscle-specific expression of a neuronal nitric oxide synthase (nNOS transgene. Dko mice expressing the transgene (nNOS TG+/dko experienced delayed onset of mortality and increased life-span. The nNOS TG+/dko mice demonstrated a significant decrease in the concentration of CD163+, M2c macrophages that can express arginase and promote fibrosis. The decrease in M2c macrophages was associated with a significant reduction in fibrosis of heart, diaphragm and hindlimb muscles of nNOS TG+/dko mice. The nNOS transgene had no effect on the concentration of cytolytic, CD68+, M1 macrophages. Accordingly, we did not observe any change in the extent of muscle fiber lysis in the nNOS TG+/dko mice. These findings show that nNOS/NO (nitric oxide-mediated decreases in M2c macrophages lead to a reduction in the muscle fibrosis that is associated with increased mortality in mice lacking dystrophin and utrophin. Interestingly, the dramatic and beneficial effects of the nNOS transgene were not attributable to localization of nNOS protein at the cell membrane. We did not detect any nNOS protein at the sarcolemma in nNOS TG+/dko muscles. This important observation shows that sarcolemmal localization is not necessary for nNOS to have beneficial effects in dystrophic tissue and the presence of nNOS in the cytosol of dystrophic muscle fibers can ameliorate the pathology and most importantly, significantly increase life-span.
Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny
2016-03-09
Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Cross-species complementation of bacterial- and eukaryotic-type cardiolipin synthases
Directory of Open Access Journals (Sweden)
Petra Gottier
2017-11-01
Full Text Available The glycerophospholipid cardiolipin is a unique constituent of bacterial and mitochondrial membranes. It is involved in forming and stabilizing high molecular mass membrane protein complexes and in maintaining membrane architecture. Absence of cardiolipin leads to reduced efficiency of the electron transport chain, decreased membrane potential, and, ultimately, impaired respiratory metabolism. For the protozoan parasite Trypanosoma brucei cardiolipin synthesis is essential for survival, indicating that the enzymes involved in cardiolipin production represent potential drug targets. T. brucei cardiolipin synthase (TbCLS is unique as it belongs to the family of phospholipases D (PLD, harboring a prokaryotic-type cardiolipin synthase (CLS active site domain. In contrast, most other eukaryotic CLS, including the yeast ortholog ScCrd1, are members of the CDP-alcohol phosphatidyl transferase family. To study if these mechanistically distinct CLS enzymes are able to catalyze cardiolipin production in a cell that normally expresses a different type of CLS, we expressed TbCLS and ScCrd1 in CLS-deficient yeast and trypanosome strains, respectively. Our results show that TbCLS complemented cardiolipin production in CRD1 knockout yeast and partly restored wild-type colony forming capability under stress conditions. Remarkably, CL remodeling appeared to be impaired in the transgenic construct, suggesting that CL production and remodeling are tightly coupled processes that may require a clustering of the involved proteins into specific CL-synthesizing domains. In contrast, no complementation was observed by heterologous expression of ScCrd1 in conditional TbCLS knockout trypanosomes, despite proper mitochondrial targeting of the protein.
Generation of knockout rabbits using transcription activator-like effector nucleases
Directory of Open Access Journals (Sweden)
Yu Wang
2014-01-01
Full Text Available Zinc-finger nucleases and transcription activator-like effector nucleases are novel gene-editing platforms contributing to redefine the boundaries of modern biological research. They are composed of a non-specific cleavage domain and a tailor made DNA-binding module, which enables a broad range of genetic modifications by inducing efficient DNA double-strand breaks at desired loci. Among other remarkable uses, these nucleases have been employed to produce gene knockouts in mid-size and large animals, such as rabbits and pigs, respectively. This approach is cost effective, relatively quick, and can produce invaluable models for human disease studies, biotechnology or agricultural purposes. Here we describe a protocol for the efficient generation of knockout rabbits using transcription activator-like effector nucleases, and a perspective of the field.
Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).
Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes
2012-03-01
Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.
Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W
2015-03-31
Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.
Xiang, Lin; Zhao, Kaige; Chen, Longqing
2010-01-01
Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043
Schindler, Daniel; Nowrousian, Minou
2014-07-01
Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
J H Duncan Bassett
Full Text Available Osteoporosis is a common polygenic disease and global healthcare priority but its genetic basis remains largely unknown. We report a high-throughput multi-parameter phenotype screen to identify functionally significant skeletal phenotypes in mice generated by the Wellcome Trust Sanger Institute Mouse Genetics Project and discover novel genes that may be involved in the pathogenesis of osteoporosis. The integrated use of primary phenotype data with quantitative x-ray microradiography, micro-computed tomography, statistical approaches and biomechanical testing in 100 unselected knockout mouse strains identified nine new genetic determinants of bone mass and strength. These nine new genes include five whose deletion results in low bone mass and four whose deletion results in high bone mass. None of the nine genes have been implicated previously in skeletal disorders and detailed analysis of the biomechanical consequences of their deletion revealed a novel functional classification of bone structure and strength. The organ-specific and disease-focused strategy described in this study can be applied to any biological system or tractable polygenic disease, thus providing a general basis to define gene function in a system-specific manner. Application of the approach to diseases affecting other physiological systems will help to realize the full potential of the International Mouse Phenotyping Consortium.
Watanabe, Kazuki; Sakai, Takaomi
2016-01-01
In the fruitfly Drosophila melanogaster, females take the initiative to mate successfully because they decide whether to mate or not. However, little is known about the molecular and neuronal mechanisms regulating sexual receptivity in virgin females. Genetic tools available in Drosophila are useful for identifying molecules and neural circuits involved in the regulation of sexual receptivity. We previously demonstrated that insulin-producing cells (IPCs) in the female brain are critical to the regulation of female sexual receptivity. Ablation and inactivation of IPCs enhance female sexual receptivity, suggesting that neurosecretion from IPCs inhibits female sexual receptivity. IPCs produce and release insulin-like peptides (Ilps) that modulate various biological processes such as metabolism, growth, lifespan and behaviors. Here, we report a novel role of the Ilps in sexual behavior in Drosophila virgin females. Compared with wild-type females, females with knockout mutations of Ilps showed a high mating success rate toward wild-type males, whereas wild-type males courted wild-type and Ilp-knockout females to the same extent. Wild-type receptive females retard their movement during male courtship and this reduced female mobility allows males to copulate. Thus, it was anticipated that knockout mutations of Ilps would reduce general locomotion. However, the locomotor activity in Ilp-knockout females was significantly higher than that in wild-type females. Thus, our findings indicate that the high mating success rate in Ilp-knockout females is caused by their enhanced sexual receptivity, but not by improvement of their sex appeal or by general sluggishness.
Directory of Open Access Journals (Sweden)
Benjamin A. Diner
2016-11-01
Full Text Available The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS. Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1 and human cytomegalovirus (HCMV infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses.
Directory of Open Access Journals (Sweden)
Ro Dae-Kyun
2009-07-01
Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes
Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean
Good, Laura Lee
2001-01-01
The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...
Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....
Single-Step Generation of Conditional Knockout Mouse Embryonic Stem Cells
Directory of Open Access Journals (Sweden)
Matyas Flemr
2015-07-01
Full Text Available Induction of double-strand DNA breaks (DSBs by engineered nucleases, such as CRISPR/Cas9 or transcription activator-like effector nucleases (TALENs, stimulates knockin of exogenous DNA fragments via homologous recombination (HR. However, the knockin efficiencies reported so far have not allowed more complex in vitro genome modifications such as, for instance, simultaneous integration of a DNA fragment at two distinct genomic sites. We developed a reporter system to enrich for cells with engineered nuclease-assisted HR events. Using this system in mouse embryonic stem cells (mESCs, we achieve single-step biallelic and seamless integration of two loxP sites for Cre recombinase-mediated inducible gene knockout, as well as biallelic endogenous gene tagging with high efficiency. Our approach reduces the time and resources required for conditional knockout mESC generation dramatically.
Hou, Shasha; Tan, Jian; Yang, Bing; He, Lu; Zhu, Yu
2018-05-01
Thyroid cancer is a common primary tumor in China. Therefore, it is important to investigate the underlying molecular mechanism of thyroid cancer in order to achieve effective individualized treatments. In our previous study, a positive correlation between the expression of alkylglycerone phosphate synthase (AGPS) and the malignant phenotype of thyroid cancer cell lines was identified. The inactivation of AGPS was able to decrease the malignancy of cancer, and inhibit tumor growth and invasion. However, the function of AGPS on thyroid cancer was unclear. In the present study, it was revealed that AGPS was able to regulate the expression of circular RNAs (circRNAs), which may be the mechanism of its anticancer activity. Therefore, the effects of AGPS silencing and knockout on circRNA expression in the thyroid cancer cell line FRO were investigated using circRNAs microarray, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed in order to investigate the underlying molecular mechanism of AGPS for the regulation of thyroid cancer through circRNAs.
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J
1999-01-01
Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....
International Nuclear Information System (INIS)
Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano
2014-01-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal
Energy Technology Data Exchange (ETDEWEB)
Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)
2014-07-01
Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.
Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.
Directory of Open Access Journals (Sweden)
Praveen Balabaskaran Nina
2010-07-01
Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a
Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.
Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M
2008-07-01
Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.
Glycogen synthase kinase 3α regulates urine concentrating mechanism in mice
Nørregaard, Rikke; Tao, Shixin; Nilsson, Line; Woodgett, James R.; Kakade, Vijayakumar; Yu, Alan S. L.; Howard, Christiana; Rao, Reena
2015-01-01
In mammals, glycogen synthase kinase (GSK)3 comprises GSK3α and GSK3β isoforms. GSK3β has been shown to play a role in the ability of kidneys to concentrate urine by regulating vasopressin-mediated water permeability of collecting ducts, whereas the role of GSK3α has yet to be discerned. To investigate the role of GSK3α in urine concentration, we compared GSK3α knockout (GSK3αKO) mice with wild-type (WT) littermates. Under normal conditions, GSK3αKO mice had higher water intake and urine outp...
Directory of Open Access Journals (Sweden)
Emilia Wilmowicz
2016-03-01
Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.
Liu, Hongxia; Qu, Xiaoxu; Gao, Ling; Zhao, Shengming; Lu, Zhaoxin; Zhang, Chong; Bie, Xiaomei
2016-11-10
Gene knockout is an important approach to improve the production of antimicrobial compounds. B. subtilis PB2-LS10, derived from B. subtilis PB2-L by a surfactin synthetase (srf) genes knockout, exhibits stronger inhibitory action than its parental strain against all tested pathogenic bacteria and fungi. The antimicrobial extracts produced by B. subtilis PB2-L and B. subtilis PB2-LS10 respectively were characterized by the high-resolution LC-ESI-MS. To provide further insight into the distinct antimicrobial activities, we investigated the impact of the srf genes deletion on the growth and gene transcriptional profile of the strains. The mutant strain grew quickly and reached stationary phase 2h earlier than the wild-type. Prominent expression changes in the modified strain involved genes that were essential to metabolic pathways and processes. Genes related to amino acid transport, ATP-binding cassette (ABC) transporters and protein export were up-regulated in strain PB2-LS10. However, amino acid metabolism, carbohydrate metabolism and fatty acid metabolism were repressed. Because of its excellent antimicrobial activity, strain PB2-LS10 has potential for use in food preservation. Copyright © 2016 Elsevier B.V. All rights reserved.
Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.
2013-01-01
The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112
Ghosh, Subhabrata; Mandi, Swati Sen
2015-07-25
Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Leick, Lotte; Wojtaszewski, Jørgen F P; Johansen, Sune T.
2008-01-01
The aim of the present study was to test the hypothesis that peroxisome proliferator activated receptor-gamma coactivator (PGC) 1alpha is required for exercise-induced adaptive gene responses in skeletal muscle. Whole body PGC-1alpha knockout (KO) and littermate wild-type (WT) mice performed....... Resting muscles of the PGC-1alpha KO mice had lower ( approximately 20%) cytochrome c (cyt c), cytochrome oxidase (COX) I, and aminolevulinate synthase (ALAS) 1 mRNA and protein levels than WT, but similar levels of AMP-activated protein kinase (AMPK) alpha1, AMPKalpha2, and hexokinase (HK) II compared...
Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K
1999-03-01
The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.
Zimmermann-Peruzatto, Josi Maria; Lazzari, Virgínia Meneghini; Agnes, Grasiela; Becker, Roberta Oriques; de Moura, Ana Carolina; Guedes, Renata Padilha; Lucion, Aldo Bolten; Almeida, Silvana; Giovenardi, Márcia
2017-07-01
Social relations are built and maintained from the interaction among individuals. The oxytocin (OT), vasopressin (VP), estrogen, dopamine, and their receptors are involved in the modulation of sexual behavior in females. This study aimed to analyze the impact of OT gene knockout (OTKO) on sexual behavior and the gene expression of oxytocin (OTR), estrogen alpha (ERα), estrogen beta (ERβ), vasopressin (V 1a R), and dopamine (D 2 R) receptors in the olfactory bulb (OB), prefrontal cortex (PFC), hippocampus (HPC), and hypothalamus (HPT), as well as in the synthesis of VP in the HPT of female mice. Wild-type (WT) littermates were used for comparisons. The C DNAs were synthesized by polymerase chain reaction and the gene expression was calculated with the 2 -ΔΔCt formula. Our results showed that the absence of OT caused an increase in the frequency and duration of non-receptive postures and a decrease in receptive postures in the OTKO. OTKO females showed a significant decrease in the gene expression of OTR in the HPC, V 1a R in the HPT, and ERα and ERβ in the PFC. There was no significant difference in the gene expression of D 2 R of OTKO. However, OTKO showed an increased gene expression of V 1a R in the HPC. There is no significant difference in VP mRNA synthesis in the HPT between OTKO and WT. Our findings demonstrate that the absence of OT leads to significant changes in the expression of the studied genes (OTR, ERα, ERβ, V 1a R), and these changes may contribute to the decreased sexual behavior observed in OTKO females.
Directory of Open Access Journals (Sweden)
Lin-Hui Gao
2018-01-01
Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.
Sdhd and SDHD/H19 knockout mice do not develop paraganglioma or pheochromocytoma.
Directory of Open Access Journals (Sweden)
Jean-Pierre Bayley
Full Text Available BACKGROUND: Mitochondrial succinate dehydrogenase (SDH is a component of both the tricarboxylic acid cycle and the electron transport chain. Mutations of SDHD, the first protein of intermediary metabolism shown to be involved in tumorigenesis, lead to the human tumors paraganglioma (PGL and pheochromocytoma (PC. SDHD is remarkable in showing an 'imprinted' tumor suppressor phenotype. Mutations of SDHD show a very high penetrance in man and we postulated that knockout of Sdhd would lead to the development of PGL/PC, probably in aged mice. METHODOLOGY/PRINCIPAL FINDINGS: We generated a conventional knockout of Sdhd in the mouse, removing the entire third exon. We also crossed this mouse with a knockout of H19, a postulated imprinted modifier gene of Sdhd tumorigenesis, to evaluate if loss of these genes together would lead to the initiation or enhancement of tumor development. Homozygous knockout of Sdhd results in embryonic lethality. No paraganglioma or other tumor development was seen in Sdhd KO mice followed for their entire lifespan, in sharp contrast to the highly penetrant phenotype in humans. Heterozygous Sdhd KO mice did not show hyperplasia of paraganglioma-related tissues such as the carotid body or of the adrenal medulla, or any genotype-related pathology, with similar body and organ weights to wildtype mice. A cohort of Sdhd/H19 KO mice developed several cases of profound cardiac hypertrophy, but showed no evidence of PGL/PC. CONCLUSIONS: Knockout of Sdhd in the mouse does not result in a disease phenotype. H19 may not be an initiator of PGL/PC tumorigenesis.
Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major
Lazzari, Virginia Meneghini; Zimmermann-Peruzatto, Josi Maria; Agnes, Grasiela; Becker, Roberta Oriques; de Moura, Ana Carolina; Almeida, Silvana; Guedes, Renata Padilha; Giovenardi, Marcia
2017-11-02
Social interaction between animals is crucial for the survival and life in groups. It is well demonstrated that oxytocin (OT) and vasopressin (AVP) play critical roles in the regulation of social behaviors in mammals, however, other neurotransmitters and hormones are involved in the brain circuitry related to these behaviors. The present study aimed to investigate the gene expression of neurotransmitter receptors in the brain of OT knockout (OTKO) male mice. In this study, we evaluated the expression levels of the OT receptor (Oxtr), AVP receptors 1a and 1b (Avpr1a; Avpr1b), dopamine receptor 2 (Drd2), and the estrogen receptors alpha and beta (Esr1; Esr2) genes in the hippocampus (HPC), olfactory bulb (OB), hypothalamus (HPT) and prefrontal cortex (PFC). AVP gene (Avp) expression was analyzed in the HPT. Gene expression results were discussed regarding to social interaction and sexual behavior findings. Additionally, we analyzed the influence of OT absence on the Avp mRNA expression levels in the HPT. RNA extraction and cDNAs synthesis followed by quantitative polymerase chain reaction were performed for gene expression determination. Results were calculated with the 2 -ΔΔCt method. Our main finding was that HPC is more susceptible to gene expression changes due to the lack of OT. OTKOs exhibited decreased expression of Drd2 and Avpr1b, but increased expression of Oxtr in the HPC. In the PFC, Esr2 was increased. In the HPT, there was a reduced Avp expression in the OTKO group. No differences were detected in the OB and HPT. Despite these changes in gene expression, sexual behavior was not affected. However, OTKO showed higher social investigation and lower aggressive performance than wild-type mice. Our data highlight the importance of OT for proper gene expression of neurotransmitter receptors related to the regulation of social interaction in male mice. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Andreas Holmgaard
2017-12-01
Full Text Available Virus-based gene therapy by CRISPR/Cas9-mediated genome editing and knockout may provide a new option for treatment of inherited and acquired ocular diseases of the retina. In support of this notion, we show that Streptococcus pyogenes (Sp Cas9, delivered by lentiviral vectors (LVs, can be used in vivo to selectively ablate the vascular endothelial growth factor A (Vegfa gene in mice. By generating LVs encoding SpCas9 targeted to Vegfa, and in parallel the fluorescent eGFP marker protein, we demonstrate robust knockout of Vegfa that leads to a significant reduction of VEGFA protein in transduced cells. Three of the designed single-guide RNAs (sgRNAs induce in vitro indel formation at high frequencies (44%–93%. A single unilateral subretinal injection facilitates RPE-specific localization of the vector and disruption of Vegfa in isolated eGFP+ RPE cells obtained from mice five weeks after LV administration. Notably, sgRNA delivery results in the disruption of Vegfa with an in vivo indel formation efficacy of up to 84%. Sequencing of Vegfa-specific amplicons reveals formation of indels, including 4-bp deletions and 2-bp insertions. Taken together, our data demonstrate the capacity of lentivirus-delivered SpCas9 and sgRNAs as a developing therapeutic path in the treatment of ocular diseases, including age-related macular degeneration.
Directory of Open Access Journals (Sweden)
Smrati Mishra
Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.
Directory of Open Access Journals (Sweden)
T. Angeline
2011-01-01
Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.
Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.
2001-01-01
Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major
Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling
2016-01-01
Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Generation of knockout rabbits using transcription activator-like effector nucleases
Wang, Yu; Fan, Nana; Song, Jun; Zhong, Juan; Guo, Xiaogang; Tian, Weihua; Zhang, Quanjun; Cui, Fenggong; Li, Li; Newsome, Philip N; Frampton, Jon; Esteban, Miguel A; Lai, Liangxue
2014-01-01
Zinc-finger nucleases and transcription activator-like effector nucleases are novel gene-editing platforms contributing to redefine the boundaries of modern biological research. They are composed of a non-specific cleavage domain and a tailor made DNA-binding module, which enables a broad range of genetic modifications by inducing efficient DNA double-strand breaks at desired loci. Among other remarkable uses, these nucleases have been employed to produce gene knockouts in mid-size and large ...
Cloning and sequence analysis of putative type II fatty acid synthase ...
Indian Academy of Sciences (India)
Prakash
Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.
Directory of Open Access Journals (Sweden)
Patrick C Y Woo
Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid
Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution
International Nuclear Information System (INIS)
Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi
2010-01-01
The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.
Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk
2014-02-01
Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq
2015-01-01
Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Functional Characterization of Sesquiterpene Synthase from Polygonum minus
Directory of Open Access Journals (Sweden)
Su-Fang Ee
2014-01-01
Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.
Directory of Open Access Journals (Sweden)
Christina Spilker
2016-03-01
Full Text Available Jacob, the protein encoded by the Nsmf gene, is involved in synapto-nuclear signaling and docks an N-Methyl-D-Aspartate receptor (NMDAR-derived signalosome to nuclear target sites like the transcription factor cAMP-response-element-binding protein (CREB. Several reports indicate that mutations in NSMF are related to Kallmann syndrome (KS, a neurodevelopmental disorder characterized by idiopathic hypogonadotropic hypogonadism (IHH associated with anosmia or hyposmia. It has also been reported that a protein knockdown results in migration deficits of Gonadotropin-releasing hormone (GnRH positive neurons from the olfactory bulb to the hypothalamus during early neuronal development. Here we show that mice that are constitutively deficient for the Nsmf gene do not present phenotypic characteristics related to KS. Instead, these mice exhibit hippocampal dysplasia with a reduced number of synapses and simplification of dendrites, reduced hippocampal long-term potentiation (LTP at CA1 synapses and deficits in hippocampus-dependent learning. Brain-derived neurotrophic factor (BDNF activation of CREB-activated gene expression plays a documented role in hippocampal CA1 synapse and dendrite formation. We found that BDNF induces the nuclear translocation of Jacob in an NMDAR-dependent manner in early development, which results in increased phosphorylation of CREB and enhanced CREB-dependent Bdnf gene transcription. Nsmf knockout (ko mice show reduced hippocampal Bdnf mRNA and protein levels as well as reduced pCREB levels during dendritogenesis. Moreover, BDNF application can rescue the morphological deficits in hippocampal pyramidal neurons devoid of Jacob. Taken together, the data suggest that the absence of Jacob in early development interrupts a positive feedback loop between BDNF signaling, subsequent nuclear import of Jacob, activation of CREB and enhanced Bdnf gene transcription, ultimately leading to hippocampal dysplasia.
Modrzynska, Katarzyna; Pfander, Claudia; Chappell, Lia; Yu, Lu; Suarez, Catherine; Dundas, Kirsten; Gomes, Ana Rita; Goulding, David; Rayner, Julian C; Choudhary, Jyoti; Billker, Oliver
2017-01-11
A family of apicomplexa-specific proteins containing AP2 DNA-binding domains (ApiAP2s) was identified in malaria parasites. This family includes sequence-specific transcription factors that are key regulators of development. However, functions for the majority of ApiAP2 genes remain unknown. Here, a systematic knockout screen in Plasmodium berghei identified ten ApiAP2 genes that were essential for mosquito transmission: four were critical for the formation of infectious ookinetes, and three were required for sporogony. We describe non-essential functions for AP2-O and AP2-SP proteins in blood stages, and identify AP2-G2 as a repressor active in both asexual and sexual stages. Comparative transcriptomics across mutants and developmental stages revealed clusters of co-regulated genes with shared cis promoter elements, whose expression can be controlled positively or negatively by different ApiAP2 factors. We propose that stage-specific interactions between ApiAP2 proteins on partly overlapping sets of target genes generate the complex transcriptional network that controls the Plasmodium life cycle. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Keisuke Nakajima
2015-01-01
Full Text Available Zinc-finger nucleases, transcription activator-like effector nucleases (TALENs and the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins system are potentially powerful tools for producing tailor-made knockout animals. However, their mutagenic activity is not high enough to induce mutations at all loci of a target gene throughout an entire tadpole. In this study, we present a highly efficient method for introducing gene modifications at almost all target sequences in randomly selected embryos. The gene modification activity of TALEN is enhanced by adopting the host-transfer technique. In our method, the efficiency is further improved by injecting TALEN mRNAs fused to the 3′UTR of the Xenopus DEADSouth gene into oocytes, which are then transferred into a host female frog, where they are ovulated and fertilized. The addition of the 3′UTR of the DEADSouth gene promotes mRNA translation in the oocytes and increases the expression of TALEN proteins to near-maximal levels three hours post fertilization (hpf. In contrast, TALEN mRNAs without this 3′UTR are translated infrequently in oocytes. Our data suggest that genomic DNA is more sensitive to TALEN proteins from fertilization to the midblastula (MBT stage. Our method works by increasing the levels of TALEN proteins during the pre-MBT stages.
Survey of quasi-free cluster knockout
International Nuclear Information System (INIS)
Roos, P.G.; Chant, N.S.
1975-01-01
The investigation of quasi-free knockout reactions has been proceeding for many years now, since the first experiments studying (p,2p) reactions on light nuclei. These experiments clearly showed the dominance of quasi-free proton knockout, and have provided information on the proton holes states in nuclei. From very early in the game people extended these studies to the knock-out of clusters, in an attempt to obtain nuclear structure information about clustering in nuclei. These cluster knockout reactions, excluding the nucleon knockout work, are examined. 20 figures, 16 references
Cloning and expression of pineapple sucrose- phosphate synthase ...
African Journals Online (AJOL)
hope&shola
2010-12-06
Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.
Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei
Directory of Open Access Journals (Sweden)
Yue Ming
2009-06-01
Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.
Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V
2010-01-01
Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.
Less is More: unveiling the functional core of hematopoietic stem cells through knockout mice
Rossi, Lara; Lin, Kuanyin K.; Boles, Nathan C.; Yang, Liubin; King, Katherine Y.; Jeong, Mira; Mayle, Allison; Goodell, Margaret A.
2012-01-01
Summary Hematopoietic stem cells (HSCs) represent one of the first recognized somatic stem cells. As such, nearly 200 genes have been examined for roles in HSC function in knockout mice. In this review, we compile the majority of these reports to provide a broad overview of the functional modules revealed by these genetic analyses and highlight some key regulatory pathways involved, including cell cycle control, TGF-β signaling, Pten/AKT signaling, Wnt signaling, and cytokine signaling. Finally, we propose recommendations for characterization of HSC function in knockout mice to facilitate cross-study comparisons that would generate a more cohesive picture of HSC biology. In the field of design, the minimalist movement stripped down buildings and objects to their most basic features, a sentiment that architect Ludwig Mies van der Rohe summarized in his motto “less is more”. By depleting HSCs of specific genes, knockout studies transpose the minimalist approach into research biology, providing insights into the essential core of genetic features that is indispensable for a well-functioning hematopoietic system. PMID:22958929
Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud
2007-10-01
Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.
Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.
2013-01-01
Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150
Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng
2017-02-01
Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.
Directory of Open Access Journals (Sweden)
YIN Fang
2013-08-01
Full Text Available The major metabolites of Streptomyces parvus HCCB10043 is lipopeptide compounds A21978C,its genome sequence includes the non ribosomal peptide synthetase(NRPS,polyketide synthases(PKS and hybrid NRPS-PKS multi-enzyme system gene clusters,they do have a their common feature in the metabolite biosynthetic cluster,which is called TE domain as well.Thioesterase can synthesized the synthesis of compounds of the chain termination,and with functions to release mature lipopeptide hydrolysis and cyclized peptide chain aliphatic linear.This study,we knockout the TE domain of a gene cluster,which guide the biosynthesis of bipyridine,to obtain engineered bacteria.The fermentation results demonstrates reduced yields for metabolites 2,2′-Bipyridine (2,2′-BP.
Longo, M; Jain, [No Value; Langenveld, J; Vedernikov, YP; Garfield, RE; Hankins, GDV; Anderson, GD; Saade, GR
2004-01-01
Objective: Transgenic mice that lack endothelial nitric oxide synthase have offspring with growth deficiency and abnormal vascular reactivity in later life. Our objective was to evaluate the role of parity in the modulation of the fetal programming of growth and vascular responses in these
Analysis of genetic variation of inducible nitric oxide synthase and ...
African Journals Online (AJOL)
The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...
Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.
Jain, Parul; Tar'an, Bunyamin
2014-11-01
Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.
Energy Technology Data Exchange (ETDEWEB)
Zhao, Hongxin; Ma, Kun; Lu, Yuan; Zhang, Chong; Wang, Liyan; Xing, Xin-Hui [Institute of Biochemical Engineering, Department of Chemical Engineering, Tsinghua University, Tsinghua Yuan, Beijing 100084 (China)
2009-01-15
A 5431-bp DNA fragment partially encoding the formate hydrogen lyase (FHL) gene cluster hycABCDE was isolated and identified from Enterobacter aerogenes IAM1183 chromosomal DNA. All the five putative gene products showed a high degree of homology to the reported bacterial FHL proteins. The gene hycA, encoding the FHL repressor protein, and hybO, encoding the small subunit of the uptake hydrogenase, were targeted for genetic knockout for improving the hydrogen production. The pYM-Red recombination system was adopted to form insertional mutations in the E. aerogenes genome, thereby creating mutant strains of IAM1183-A ({delta} hycA), IAM1183-O ({delta} hybO), and IAM1183-AO ({delta} hycA/ {delta} hybO double knockout). The hydrogen production experiments with these mutants showed that the maximum specific hydrogen productivities of IAM1183-A, IAM1183-O, and IAM1183-AO were 2879.466 {+-} 38.59, 2747.203 {+-} 13.25 and 3372.019 {+-} 4.39 (ml h{sup -1} g{sup -1}dry cell weight), respectively, higher than that of the wild strain (2321.861 {+-} 15.34 ml h{sup -1} g{sup -1}dry cell weight). The total H{sub 2} yields by the three mutants IAM1183-A, IAM1183-O and IAM1183-AO were 0.73, 0.78, and 0.83 mol-H{sub 2}/mol glucose, respectively, while the wild-type IAM1183 was only 0.65 mol-H{sub 2}/mol glucose. The metabolites of the mutants including acetate, ethanol, 2,3-butanediol and succinate were all increased compared with that of the wild type, implying the changed metabolic flux by the mutation. In the fermentor cultivation with IAM1183 {delta} hycA/ {delta} hybO, the total hydrogen volume after 16 h cultivation reached 4.4 L, while that for the wild type was only 2.9 L. (author)
Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2
Directory of Open Access Journals (Sweden)
Bhubalan, K.
2010-01-01
Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.
Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling
2014-01-13
Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.
Energy Technology Data Exchange (ETDEWEB)
Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)
1995-08-28
Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.
Directory of Open Access Journals (Sweden)
Louise Thorlacius-Ussing
Full Text Available A barrier in a pig-to-man xenotransplantation is that the Galα1-3Galβ1-4GlcNAc-R carbohydrate (α-Gal epitope expressed on pig endothelial cells reacts with naturally occurring antibodies in the recipient's blood leading to rejection. Deletion of the α1,3-galactosyltransferase gene prevents the synthesis of the α-Gal epitope. Therefore, knockout models of the α1,3-galactosyltransferase gene are widely used to study xenotransplantation. We have performed proteomic studies on liver and pancreas tissues from wild type and α1,3-galactosyltransferase gene knockout mice. The tissues were analyzed by two-dimensional polyacrylamide gel electrophoresis and liquid chromatography-tandem mass spectrometry. The analyses revealed that a wide variety of proteins and protein fragments are differentially expressed suggesting that knockout of the α1,3-galactosyltransferase gene affects the expression of several other genes.
Isolation of developing secondary xylem specific cellulose synthase ...
Indian Academy of Sciences (India)
The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.
International Nuclear Information System (INIS)
Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.
2017-01-01
Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)
International Nuclear Information System (INIS)
de Forest, T. Jr.
1977-01-01
It is pointed out that the primary motivation for performing high energy single nucleon knock-out reactions is based on the concept of quasi-elastic scattering. The validity of and corrections to the partial wave impulse approximation and kinematical invariance of knock-out reactions and tests of the reaction mechanism are treated. The effect of distortions on the momentum distribution in the effective momentum approximation for given parameters are plotted. 12 references
Characterization of Bombyx mori nucleopolyhedrovirus with a knockout of Bm17
Shen, Hongxing; Zhou, Yang; Zhang, Wen; Nin, Bin; Wang, Hua; Wang, Xiaochun; Shao, Shihe; Chen, Huiqing; Guo, Zhongjian; Liu, Xiaoyong; Yao, Qin; Chen, Keping
2012-01-01
Open reading frame 17 (Bm17) gene of Bombyx mori nucleopolyhedrovirus is a highly conserved gene in lepidopteran nucleopolyhedroviruses, but its function remains unknown. In this report, transient-expression and superinfection assays indicated that BM17 localized in the nucleus and cytoplasm of infected BmN cells. To determine the role of Bm17 in baculovirus life cycle, we constructed a Bm17 knockout virus and characterized its properties in cells. Analysis of the production and infection of ...
Directory of Open Access Journals (Sweden)
Bin Tang
2018-01-01
Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele
2015-08-01
Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Yang, Ji; Gu, Hongya; Yang, Ziheng
2004-01-01
Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.
Human Genetic Disorders and Knockout Mice Deficient in Glycosaminoglycan
Directory of Open Access Journals (Sweden)
Shuji Mizumoto
2014-01-01
Full Text Available Glycosaminoglycans (GAGs are constructed through the stepwise addition of respective monosaccharides by various glycosyltransferases and maturated by epimerases and sulfotransferases. The structural diversity of GAG polysaccharides, including their sulfation patterns and sequential arrangements, is essential for a wide range of biological activities such as cell signaling, cell proliferation, tissue morphogenesis, and interactions with various growth factors. Studies using knockout mice of enzymes responsible for the biosynthesis of the GAG side chains of proteoglycans have revealed their physiological functions. Furthermore, mutations in the human genes encoding glycosyltransferases, sulfotransferases, and related enzymes responsible for the biosynthesis of GAGs cause a number of genetic disorders including chondrodysplasia, spondyloepiphyseal dysplasia, and Ehlers-Danlos syndromes. This review focused on the increasing number of glycobiological studies on knockout mice and genetic diseases caused by disturbances in the biosynthetic enzymes for GAGs.
Directory of Open Access Journals (Sweden)
Berta Alquézar
2017-08-01
Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.
International Nuclear Information System (INIS)
Ge Shimei; Xie Baoen; Chen Sanfeng
2006-01-01
The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis
Prohormone convertase 2 activity is increased in the hippocampus of Wfs1 knockout mice
Directory of Open Access Journals (Sweden)
Karin eTein
2015-08-01
Full Text Available BackgroundMutations in WFS1 gene cause Wolfram syndrome, which is a rare autosomal recessive disorder, characterized by diabetes insipidus, diabetes mellitus, optic nerve atrophy and deafness (DIDMOAD. The WFS1 gene product wolframin is located in the endoplasmic reticulum. Mice lacking this gene exhibit disturbances in the processing and secretion of peptides, such as vasopressin and insulin. In the brain, high levels of the wolframin protein have been observed in the hippocampus, amygdala and limbic structures. The aim of this study was to investigate the effect of Wfs1 knockout on peptide processing in mouse hippocampus. A peptidomic approach was used to characterize individual peptides in the hippocampus of wild-type and Wfs1 knockout mice. ResultsWe identified 126 peptides in hippocampal extracts and the levels of 10 peptides differed between Wfs1 KO and wild-type mice at P<0.05. The peptide with the largest alteration was little-LEN, which level was 25 times higher in the hippocampus of Wfs1 KO mice compared to wild-type mice. Processing (cleavage of little-LEN from the Pcsk1n gene product proSAAS involves prohormone convertase 2 (PC2. Thus, PC2 activity was measured in extracts prepared from the hippocampus of Wfs1 knockout mice. The activity of PC2 in Wfs1 mutant mice was significantly higher (149.9±2.3%, p<0.0001, n=8 than in wild-type mice (100.0±7.0%, n=8. However, Western blot analysis showed that protein levels of 7B2, proPC2 and PC2 were same in both groups, and so were gene expression levels.ConclusionsProcessing of proSAAS is altered in the hippocampus of Wfs1-KO mice, which is caused by increased activity of PC2. Increased activity of PC2 in Wfs1 knockout mice is not caused by alteration in the levels of PC2 protein. Our results suggest a functional link between Wfs1 and PC2. Thus, the detailed molecular mechanism of the role of Wfs1 in the regulation of PC2 activity needs further investigation.
Ran, Yidong; Patron, Nicola; Kay, Pippa; Wong, Debbie; Buchanan, Margaret; Cao, Ying-Ying; Sawbridge, Tim; Davies, John P; Mason, John; Webb, Steven R; Spangenberg, German; Ainley, William M; Walsh, Terence A; Hayden, Matthew J
2018-05-07
Sequence-specific nucleases have been used to engineer targeted genome modifications in various plants. While targeted gene knockouts resulting in loss of function have been reported with relatively high rates of success, targeted gene editing using an exogenously supplied DNA repair template and site-specific transgene integration has been more challenging. Here, we report the first application of zinc finger nuclease (ZFN)-mediated, nonhomologous end-joining (NHEJ)-directed editing of a native gene in allohexaploid bread wheat to introduce, via a supplied DNA repair template, a specific single amino acid change into the coding sequence of acetohydroxyacid synthase (AHAS) to confer resistance to imidazolinone herbicides. We recovered edited wheat plants having the targeted amino acid modification in one or more AHAS homoalleles via direct selection for resistance to imazamox, an AHAS-inhibiting imidazolinone herbicide. Using a cotransformation strategy based on chemical selection for an exogenous marker, we achieved a 1.2% recovery rate of edited plants having the desired amino acid change and a 2.9% recovery of plants with targeted mutations at the AHAS locus resulting in a loss-of-function gene knockout. The latter results demonstrate a broadly applicable approach to introduce targeted modifications into native genes for nonselectable traits. All ZFN-mediated changes were faithfully transmitted to the next generation. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Chen, Yong; Boettger, Michael K; Reif, Andreas; Schmitt, Angelika; Uçeyler, Nurcan; Sommer, Claudia
2010-03-02
Although it has been largely demonstrated that nitric oxide synthase (NOS), a key enzyme for nitric oxide (NO) production, modulates inflammatory pain, the molecular mechanisms underlying these effects remain to be clarified. Here we asked whether cytokines, which have well-described roles in inflammatory pain, are downstream targets of NO in inflammatory pain and which of the isoforms of NOS are involved in this process. Intraperitoneal (i.p.) pretreatment with 7-nitroindazole sodium salt (7-NINA, a selective neuronal NOS inhibitor), aminoguanidine hydrochloride (AG, a selective inducible NOS inhibitor), L-N(G)-nitroarginine methyl ester (L-NAME, a non-selective NOS inhibitor), but not L-N(5)-(1-iminoethyl)-ornithine (L-NIO, a selective endothelial NOS inhibitor), significantly attenuated thermal hyperalgesia induced by intraplantar (i.pl.) injection of complete Freund's adjuvant (CFA). Real-time reverse transcription-polymerase chain reaction (RT-PCR) revealed a significant increase of nNOS, iNOS, and eNOS gene expression, as well as tumor necrosis factor-alpha (TNF), interleukin-1 beta (IL-1beta), and interleukin-10 (IL-10) gene expression in plantar skin, following CFA. Pretreatment with the NOS inhibitors prevented the CFA-induced increase of the pro-inflammatory cytokines TNF and IL-1beta. The increase of the anti-inflammatory cytokine IL-10 was augmented in mice pretreated with 7-NINA or L-NAME, but reduced in mice receiving AG or L-NIO. NNOS-, iNOS- or eNOS-knockout (KO) mice had lower gene expression of TNF, IL-1beta, and IL-10 following CFA, overall corroborating the inhibitor data. These findings lead us to propose that inhibition of NOS modulates inflammatory thermal hyperalgesia by regulating cytokine expression.
Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep
2015-10-01
GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cdh13 and AdipoQ gene knockout alter instrumental and Pavlovian drug conditioning.
King, C P; Militello, L; Hart, A; St Pierre, C L; Leung, E; Versaggi, C L; Roberson, N; Catlin, J; Palmer, A A; Richards, J B; Meyer, P J
2017-09-01
Genome-wide association studies in humans have suggested that variants of the cadherin-13 (CDH13) gene are associated with substance use disorder, subjective response to amphetamine, and attention deficit hyperactivity disorder. To examine the role of the Cdh13 and its peptide ligand adiponectin (AdipoQ) in addiction-related behaviors, we assessed Cdh13 knockout (KO) rats and AdipoQ KO mice using intravenous cocaine self-administration and conditioned place preference (CPP) paradigms. During intravenous cocaine self-administration, male Cdh13 heterozygous (+/-) and KO (-/-) rats showed increased cue-induced reinstatement compared with wild-type (WT) rats when presented with a cocaine-paired stimulus, whereas female Cdh13 rats showed no differences across genotype. Cdh13 -/- rats showed higher responding for a saccharin reinforcer and learned the choice reaction time (RT) task more slowly than WTs. However, we found no differences between Cdh13 -/- and +/+ rats in responding for sensory reinforcement, number of premature responses in the RT task, tendency to approach a Pavlovian food cue, CPP and locomotor activation to cocaine (10 or 20 mg/kg). In AdipoQ -/- mice, there was a significant increase in CPP to methamphetamine (1 mg/kg) but not to a range of d-amphetamine doses (0.5, 1, 2 and 4 mg/kg). Taken together, these data suggest that Cdh13 and AdipoQ regulate sensitivity to psychomotor stimulants and palatable rewards without producing major changes in other behaviors. In humans, these two genes may regulate sensitivity to natural and drug rewards, thus influencing susceptibility to the conditioned drug effects and relapse. © 2017 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.
Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H
2004-01-01
The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed
Directory of Open Access Journals (Sweden)
Hiroaki Iwasaka
2018-04-01
Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.
Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji
2014-11-01
We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar
2016-04-01
Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak
2015-01-01
Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.
Theodorakis, Nicholas G; Wang, Yining N; Korshunov, Vyacheslav A; Maluccio, Mary A; Skill, Nicholas J
2015-04-14
Portal hypertension is a common complication of liver cirrhosis and significantly increases mortality and morbidity. Previous reports have suggested that the compound thalidomide attenuates portal hypertension (PHT). However, the mechanism for this action is not fully elucidated. One hypothesis is that thalidomide destabilizes tumor necrosis factor α (TNFα) mRNA and therefore diminishes TNFα induction of nitric oxide synthase (NOS) and the production of nitric oxide (NO). To examine this hypothesis, we utilized the murine partial portal vein ligation (PVL) PHT model in combination with endothelial or inducible NOS isoform gene knockout mice. Wild type, inducible nitric oxide synthase (iNOS)(-/-) and endothelial nitric oxide synthase (eNOS)(-/-) mice received either PVL or sham surgery and were given either thalidomide or vehicle. Serum nitrate (total nitrate, NOx) was measured daily for 7 d as a surrogate of NO synthesis. Serum TNFα level was quantified by enzyme-linked immunosorbent assay. TNFα mRNA was quantified in liver and aorta tissue by reverse transcription-polymerase chain reaction. PHT was determined by recording splenic pulp pressure (SPP) and abdominal aortic flow after 0-7 d. Response to thalidomide was determined by measurement of SPP and mean arterial pressure (MAP). SPP, abdominal aortic flow (Qao) and plasma NOx were increased in wild type and iNOS(-/-) PVL mice when compared to sham operated control mice. In contrast, SPP, Qao and plasma NOx were not increased in eNOS(-/-) PVL mice when compared to sham controls. Serum TNFα level in both sham and PVL mice was below the detection limit of the commercial ELISA used. Therefore, the effect of thalidomide on serum TNFα levels was undetermined in wild type, eNOS(-/-) or iNOS(-/-) mice. Thalidomide acutely increased plasma NOx in wild type and eNOS(-/-) mice but not iNOS(-/-) mice. Moreover, thalidomide temporarily (0-90 min) decreased mean arterial pressure, SPP and Qao in wild type, e
DEFF Research Database (Denmark)
Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny
2007-01-01
Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...
A norm knockout method on indirect reciprocity to reveal indispensable norms
Yamamoto, Hitoshi; Okada, Isamu; Uchida, Satoshi; Sasaki, Tatsuya
2017-03-01
Although various norms for reciprocity-based cooperation have been suggested that are evolutionarily stable against invasion from free riders, the process of alternation of norms and the role of diversified norms remain unclear in the evolution of cooperation. We clarify the co-evolutionary dynamics of norms and cooperation in indirect reciprocity and also identify the indispensable norms for the evolution of cooperation. Inspired by the gene knockout method, a genetic engineering technique, we developed the norm knockout method and clarified the norms necessary for the establishment of cooperation. The results of numerical investigations revealed that the majority of norms gradually transitioned to tolerant norms after defectors are eliminated by strict norms. Furthermore, no cooperation emerges when specific norms that are intolerant to defectors are knocked out.
Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).
Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian
2013-12-01
Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.
Valles-Ortega, Jordi; Duran, Jordi; Garcia-Rocha, Mar; Bosch, Carles; Saez, Isabel; Pujadas, Lluís; Serafin, Anna; Cañas, Xavier; Soriano, Eduardo; Delgado-García, José M; Gruart, Agnès; Guinovart, Joan J
2011-11-01
Lafora disease (LD) is caused by mutations in either the laforin or malin gene. The hallmark of the disease is the accumulation of polyglucosan inclusions called Lafora Bodies (LBs). Malin knockout (KO) mice present polyglucosan accumulations in several brain areas, as do patients of LD. These structures are abundant in the cerebellum and hippocampus. Here, we report a large increase in glycogen synthase (GS) in these mice, in which the enzyme accumulates in LBs. Our study focused on the hippocampus where, under physiological conditions, astrocytes and parvalbumin-positive (PV(+)) interneurons expressed GS and malin. Although LBs have been described only in neurons, we found this polyglucosan accumulation in the astrocytes of the KO mice. They also had LBs in the soma and some processes of PV(+) interneurons. This phenomenon was accompanied by the progressive loss of these neuronal cells and, importantly, neurophysiological alterations potentially related to impairment of hippocampal function. Our results emphasize the relevance of the laforin-malin complex in the control of glycogen metabolism and highlight altered glycogen accumulation as a key contributor to neurodegeneration in LD. Copyright © 2011 EMBO Molecular Medicine.
Directory of Open Access Journals (Sweden)
Yonghai Fan
2017-12-01
Full Text Available Galactinol synthase (GolS is a key enzyme in raffinose family oligosaccharide (RFO biosynthesis. The finding that GolS accumulates in plants exposed to abiotic stresses indicates RFOs function in environmental adaptation. However, the evolutionary relationships and biological functions of GolS family in rapeseed (Brassica napus and tobacco (Nicotiana tabacum remain unclear. In this study, we identified 20 BnGolS and 9 NtGolS genes. Subcellular localization predictions showed that most of the proteins are localized to the cytoplasm. Phylogenetic analysis identified a lost event of an ancient GolS copy in the Solanaceae and an ancient duplication event leading to evolution of GolS4/7 in the Brassicaceae. The three-dimensional structures of two GolS proteins were conserved, with an important DxD motif for binding to UDP-galactose (uridine diphosphate-galactose and inositol. Expression profile analysis indicated that BnGolS and NtGolS genes were expressed in most tissues and highly expressed in one or two specific tissues. Hormone treatments strongly induced the expression of most BnGolS genes and homologous genes in the same subfamilies exhibited divergent-induced expression. Our study provides a comprehensive evolutionary analysis of GolS genes among the Brassicaceae and Solanaceae as well as an insight into the biological function of GolS genes in hormone response in plants.
Directory of Open Access Journals (Sweden)
Jianrong Wang
2014-12-01
Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.
Institute of Scientific and Technical Information of China (English)
Shengqiang Chen; Xuegang Luo; Quan Yang; Weiwen Sun; Kaiyi Cao; Xi Chen; Yueling Huang; Lijun Dai; Yonghong Yi
2011-01-01
In the present study, Fmr1 knockout mice (KO mice) were used as the model for fragile X syndrome. The results of step-through and step-down tests demonstrated that Fmr1 KO mice had shorter latencies and more error counts, indicating a learning and memory disorder. After treatment with 30, 60, 90, 120, or 200 mg/kg lithium chloride, the learning and memory abilities of the Fmr1 KO mice were significantly ameliorated, in particular, the 200 mg/kg lithium chloride treatment had the most significant effect. Western blot analysis showed that lithium chloride significantly enhanced the expression of phosphorylated glycogen synthase kinase 3 beta, an inactive form of glycogen synthase kinase 3 beta, in the cerebral cortex and hippocampus of the Fmr1 KO mice. These results indicated that lithium chloride improved learning and memory in the Fmr1 KO mice, possibly by inhibiting glycogen synthase kinase 3 beta activity.
Energy Technology Data Exchange (ETDEWEB)
Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk
2011-07-01
Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
DEFF Research Database (Denmark)
Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P
1994-01-01
To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...
Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert
2014-01-01
The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2017-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Use of octaketide synthases to produce kermesic acid and flavokermesic acid
DEFF Research Database (Denmark)
2016-01-01
A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....
Directory of Open Access Journals (Sweden)
Xingsheng Hou
Full Text Available FlcA is a response regulator controlling flocculation and the morphological transformation of Azospirillum cells from vegetative to cyst-like forms. To understand the cellular responses of Azospirillum to conditions that cause morphological transformation, proteins differentially expressed under flocculation conditions in A. brasilense Sp7 and its flcA knockout mutant were investigated. Comparison of 2-DE protein profiles of wild-type (Sp7 and a flcA deletion mutant (Sp7-flcAΔ revealed a total of 33 differentially expressed 2-DE gel spots, with 22 of these spots confidently separated to allow protein identification. Analysis of these spots by liquid chromatography-tandem mass spectrometry (LC-MS/MS and MASCOT database searching identified 48 proteins (≥10% emPAI in each spot. The functional characteristics of these proteins included carbon metabolism (beta-ketothiolase and citrate synthase, nitrogen metabolism (Glutamine synthetase and nitric oxide synthase, stress tolerance (superoxide dismutase, Alkyl hydroperoxidase and ATP-dependent Clp protease proteolytic subunit and morphological transformation (transducer coupling protein. The observed differences between Sp7 wild-type and flcA- strains enhance our understanding of the morphological transformation process and help to explain previous phenotypical observations. This work is a step forward in connecting the Azospirillum phenome and genome.
Hou, Xingsheng; McMillan, Mary; Coumans, Joëlle V F; Poljak, Anne; Raftery, Mark J; Pereg, Lily
2014-01-01
FlcA is a response regulator controlling flocculation and the morphological transformation of Azospirillum cells from vegetative to cyst-like forms. To understand the cellular responses of Azospirillum to conditions that cause morphological transformation, proteins differentially expressed under flocculation conditions in A. brasilense Sp7 and its flcA knockout mutant were investigated. Comparison of 2-DE protein profiles of wild-type (Sp7) and a flcA deletion mutant (Sp7-flcAΔ) revealed a total of 33 differentially expressed 2-DE gel spots, with 22 of these spots confidently separated to allow protein identification. Analysis of these spots by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and MASCOT database searching identified 48 proteins (≥10% emPAI in each spot). The functional characteristics of these proteins included carbon metabolism (beta-ketothiolase and citrate synthase), nitrogen metabolism (Glutamine synthetase and nitric oxide synthase), stress tolerance (superoxide dismutase, Alkyl hydroperoxidase and ATP-dependent Clp protease proteolytic subunit) and morphological transformation (transducer coupling protein). The observed differences between Sp7 wild-type and flcA- strains enhance our understanding of the morphological transformation process and help to explain previous phenotypical observations. This work is a step forward in connecting the Azospirillum phenome and genome.
Effects and mechanism of acid rain on plant chloroplast ATP synthase.
Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua
2016-09-01
Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.
Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle
DEFF Research Database (Denmark)
Højlund, Kurt; Beck-Nielsen, Henning
2006-01-01
Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...
Directory of Open Access Journals (Sweden)
Tao Zhou
2015-01-01
Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.
Yu, Fei; Zeng, Hui; Lei, Ming; Xiao, De-Ming; Li, Wei; Yuan, Hao; Lin, Jian-Jing
2016-10-01
This study investigated the effects of SIRT1 gene knock-out on osteoarthritis in mice, and the possible roles of SREBP2 protein and the PI3K/AKT signaling pathway in the effects. Mice were randomly divided into a normal group and a SIRT1 gene knock-out group (6 mice in each group). In these groups, one side of the knee anterior cruciate ligament was traversed, and the ipsilateral medial meniscus was cut to establish an osteoarthritis model of knee joint. The countralateral synovial bursa was cut out, serving as controls. The knee joint specimens were then divided into four groups: SIRT1 +/+ control group (group A, n=6); SIRT1 +/+ osteoarthritis group (group B, n=6); SIRT1 -/- control group (group C, n=6); SIRT1 -/- osteoarthritis group (group D, n=6). HE staining, Masson staining, Safranin O-Fast Green staining and Van Gieson staining were used to observe the morphological changes in the articular cartilage of the knee. Immunohistochemical staining was employed to detect the expression of SIRT1, SREBP2, VEGF, AKT, HMGCR and type II collagen proteins. SA-β-gal staining was utilized to evaluate chondrocyte aging. The results showed clear knee joint cartilage destruction and degeneration in the SIRT1 -/- osteoarthritis group. The tidal line was twisted and displaced anteriorly. Type II collagen was destroyed and distributed unevenly. Compared with the SIRT1 +/+ osteoarthritis group and SIRT1 -/- control group, SIRT1 protein expression was not obviously changed in the SIRT1 -/- osteoarthritis group (P>0.05), while the expression levels of the SREBP2, VEGF and HMGCR proteins were significantly increased (Pknock-out may aggravate cartilage degeneration in osteoarthritis by activating the SREBP2 protein-mediated PI3K/AKT signalling pathway, suggesting that SIRT1 gene may play a protective role against osteoarthritis.
Institute of Scientific and Technical Information of China (English)
Ping Yang; Guoqiang Cai; Youqing Cai; Jian Fei; Guoxiang Liu
2013-01-01
Attention deficit/hyperactivity disorder (ADHD) is characterized by hyperactivity,impaired sustained attention,impulsivity,and is usually accompanied by varying degrees of learning difficulties and lack of motor coordination.However,the pathophysiology and etiology of ADHD remain inconclusive so far.Our previous studies have demonstrated that the gamma aminobutyric acid transporter subtype 1 (GAT1) gene knockout (ko) mouse (gat1-/-)is hyperactive and exhibited impaired memory performance in the Morris water maze.In the current study,we found that the gat1-/-mice showed low levels of attentional focusing and increased impulsivity.In addition,the gat1-/-mice displayed ataxia characterized by defects in motor coordination and balance skills.The hyperactivity in the ko mice was reduced by both methylphenidate and amphetamine.Collectively,these results suggest that GAT1 ko mouse is a new animal model for ADHD studying and GAT1 may be a new target to treat ADHD.
DEFF Research Database (Denmark)
Müller, Christian; Hjort, C.M.; Hansen, K.
2002-01-01
In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...
Directory of Open Access Journals (Sweden)
Lydia J R Hunter
Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus
Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek
2014-01-01
Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...
International Nuclear Information System (INIS)
Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua
2013-01-01
1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.
Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae
2017-11-15
Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd
Directory of Open Access Journals (Sweden)
Mei Lan Jin
2017-11-01
Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.
Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi
DEFF Research Database (Denmark)
Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi
2018-01-01
Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...
Zhou, Haoming; Wang, Han; Ni, Ming; Yue, Shi; Xia, Yongxiang; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Lu, Ling; Wang, Xuehao; Zhai, Yuan
2018-02-13
Glycogen synthase kinase 3β (Gsk3β [Gsk3b]) is a ubiquitously expressed kinase with distinctive functions in different types of cells. Although its roles in regulating innate immune activation and ischaemia and reperfusion injuries (IRIs) have been well documented, the underlying mechanisms remain ambiguous, in part because of the lack of cell-specific tools in vivo. We created a myeloid-specific Gsk3b knockout (KO) strain to study the function of Gsk3β in macrophages in a murine liver partial warm ischaemia model. Compared with controls, myeloid Gsk3b KO mice were protected from IRI, with diminished proinflammatory but enhanced anti-inflammatory immune responses in livers. In bone marrow-derived macrophages, Gsk3β deficiency resulted in an early reduction of Tnf gene transcription but sustained increase of Il10 gene transcription on Toll-like receptor 4 stimulation in vitro. These effects were associated with enhanced AMP-activated protein kinase (AMPK) activation, which led to an accelerated and higher level of induction of the novel innate immune negative regulator small heterodimer partner (SHP [Nr0b2]). The regulatory function of Gsk3β on AMPK activation and SHP induction was confirmed in wild-type bone marrow-derived macrophages with a Gsk3 inhibitor. Furthermore, we found that this immune regulatory mechanism was independent of Gsk3β Ser9 phosphorylation and the phosphoinositide 3-kinase-Akt signalling pathway. In vivo, myeloid Gsk3β deficiency facilitated SHP upregulation by ischaemia-reperfusion in liver macrophages. Treatment of Gsk3b KO mice with either AMPK inhibitor or SHP small interfering RNA before the onset of liver ischaemia restored liver proinflammatory immune activation and IRI in these otherwise protected hosts. Additionally, pharmacological activation of AMPK protected wild-type mice from liver IRI, with reduced proinflammatory immune activation. Inhibition of the AMPK-SHP pathway by liver ischaemia was demonstrated in tumour resection
Directory of Open Access Journals (Sweden)
Kawamukai Makoto
2004-11-01
Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors.
Miura, Hiromi; Quadros, Rolen M; Gurumurthy, Channabasavaiah B; Ohtsuka, Masato
2018-01-01
CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement of genomic segments is very poor. The majority of mouse models used in research involve knock-in (reporters or recombinases) or gene replacement (e.g., conditional knockout alleles containing exons flanked by LoxP sites). A few methods for creating such models have been reported that use double-stranded DNA as donors, but their efficiency is typically 1-10% and therefore not suitable for routine use. We recently demonstrated that long single-stranded DNAs (ssDNAs) serve as very efficient donors, both for insertion and for gene replacement. We call this method efficient additions with ssDNA inserts-CRISPR (Easi-CRISPR) because it is a highly efficient technology (efficiency is typically 30-60% and reaches as high as 100% in some cases). The protocol takes ∼2 months to generate the founder mice.
Nitric oxide synthase modulates CFA-induced thermal hyperalgesia through cytokine regulation in mice
Directory of Open Access Journals (Sweden)
Üçeyler Nurcan
2010-03-01
Full Text Available Abstract Background Although it has been largely demonstrated that nitric oxide synthase (NOS, a key enzyme for nitric oxide (NO production, modulates inflammatory pain, the molecular mechanisms underlying these effects remain to be clarified. Here we asked whether cytokines, which have well-described roles in inflammatory pain, are downstream targets of NO in inflammatory pain and which of the isoforms of NOS are involved in this process. Results Intraperitoneal (i.p. pretreatment with 7-nitroindazole sodium salt (7-NINA, a selective neuronal NOS inhibitor, aminoguanidine hydrochloride (AG, a selective inducible NOS inhibitor, L-N(G-nitroarginine methyl ester (L-NAME, a non-selective NOS inhibitor, but not L-N(5-(1-iminoethyl-ornithine (L-NIO, a selective endothelial NOS inhibitor, significantly attenuated thermal hyperalgesia induced by intraplantar (i.pl. injection of complete Freund's adjuvant (CFA. Real-time reverse transcription-polymerase chain reaction (RT-PCR revealed a significant increase of nNOS, iNOS, and eNOS gene expression, as well as tumor necrosis factor-alpha (TNF, interleukin-1 beta (IL-1β, and interleukin-10 (IL-10 gene expression in plantar skin, following CFA. Pretreatment with the NOS inhibitors prevented the CFA-induced increase of the pro-inflammatory cytokines TNF and IL-1β. The increase of the anti-inflammatory cytokine IL-10 was augmented in mice pretreated with 7-NINA or L-NAME, but reduced in mice receiving AG or L-NIO. NNOS-, iNOS- or eNOS-knockout (KO mice had lower gene expression of TNF, IL-1β, and IL-10 following CFA, overall corroborating the inhibitor data. Conclusion These findings lead us to propose that inhibition of NOS modulates inflammatory thermal hyperalgesia by regulating cytokine expression.
Itzhak, Yossef; Anderson, Karen L; Ali, Syed F
2004-10-01
It has been shown that mice deficient in neuronal nitric oxide synthase (nNOS) gene are resistant to cocaine-induced psychomotor sensitization and methamphetamine (METH)-induced dopaminergic neurotoxicity. The present study was undertaken to investigate the hypothesis that nNOS has a major role in dopamine (DA)- but not serotonin (5-hydroxytryptamine; 5-HT)-mediated effects of psychostimulants. The response of nNOS knockout (KO) and wild-type (WT) mice to the psychomotor-stimulating and neurotoxic effects of 3,4-methylenedioxymethamphetamine (MDMA; "Ecstasy") and METH were investigated. Repeated administration of MDMA for 5 days resulted in psychomotor sensitization in both WT and nNOS KO mice, while repeated administration of METH caused psychomotor sensitization in WT but not in KO mice. Sensitization to both MDMA and METH was persistent for 40 days in WT mice, but not in nNOS KO mice. These findings suggest that the induction of psychomotor sensitization to MDMA and METH is NO independent and NO dependent, respectively, while the persistence of sensitization to both drugs is NO dependent. For the neurochemical studies, a high dose of MDMA caused marked depletion of 5-HT in several brain regions of both WT and KO mice, suggesting that the absence of the nNOS gene did not afford protection against MDMA-induced depletion of 5-HT. Striatal dopaminergic neurotoxicity caused by high doses of MDMA and METH in WT mice was partially prevented in KO mice administered with MDMA, but it was fully precluded in KO mice administered with METH. The differential response of nNOS KO mice to the behavioral and neurotoxic effects of MDMA and METH suggests that the nNOS gene is required for the expression and persistence of DA-mediated effects of METH and MDMA, while 5-HT-mediated effects of MDMA (induction of sensitization and 5-HT depletion) are not dependent on nNOS.
Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.
2017-01-01
Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...
Brief Report: Altered Social Behavior in Isolation-Reared "Fmr1" Knockout Mice
Heitzer, Andrew M.; Roth, Alexandra K.; Nawrocki, Lauren; Wrenn, Craige C.; Valdovinos, Maria G.
2013-01-01
Social behavior abnormalities in Fragile X syndrome (FXS) are characterized by social withdrawal, anxiety, and deficits in social cognition. To assess these deficits, a model of FXS, the "Fmr1" knockout mouse ("Fmr1" KO), has been utilized. This mouse model has a null mutation in the fragile X mental retardation 1 gene ("Fmr1") and displays…
Generation of a Nrf2 homozygous knockout human embryonic stem cell line using CRISPR/Cas9
Directory of Open Access Journals (Sweden)
So-Jung Kim
2017-03-01
Full Text Available Nuclear factor erythroid 2-related factor 2 (NFE2L2 or Nrf2 is a well-known transcription factor that regulates the expression of a large number of anti-oxidant genes in mammalian cells (J.H. Kim et al., 2014. Here, we generated a homozygous Nrf2 knockout human embryonic stem cell (hESC line, H9Nrf2KO-A13, using the CRISPR/Cas9 genome editing method. The Nrf2 homozygous knockout H9 cell line maintains pluripotency, differentiation potential into three germ layers, and a normal karyotype.
Almadanim, M. Cecília
2017-01-19
Calcium-dependent protein kinases (CDPKs) are involved in plant tolerance mechanisms to abiotic stresses. Although CDPKs are recognized as key messengers in signal transduction, the specific role of most members of this family remains unknown. Here we test the hypothesis that OsCPK17 plays a role in rice cold stress response by analyzing OsCPK17 knockout, silencing, and overexpressing rice lines under low temperature. Altered OsCPK17 gene expression compromises cold tolerance performance, without affecting the expression of key cold stress-inducible genes. A comparative phosphoproteomic approach led to the identification of six potential in vivo OsCPK17 targets, which are associated with sugar and nitrogen metabolism, and with osmotic regulation. To test direct interaction, in vitro kinase assays were performed, showing that the sucrose phosphate synthase OsSPS4, and the aquaporin OsPIP2;1/OsPIP2;6 are phosphorylated by OsCPK17 in a calcium-dependent manner. Altogether, our data indicates that OsCPK17 is required for a proper cold stress response in rice, likely affecting the activity of membrane channels and sugar metabolism.
HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.
PORRA, R J; ROSS, B D
1965-03-01
1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.
Zheng, Desen; Burr, Thomas J
2016-02-01
Agrobacterium vitis nontumorigenic strain F2/5 is able to inhibit crown gall disease on grapevines. The mechanism of grape tumor inhibition (GTI) by F2/5 has not been fully determined. In this study, we demonstrate that two nonribosomal peptide synthetase (NRPS) genes (F-avi3342 and F-avi5730) and one polyketide synthase gene (F-avi4330) are required for GTI. Knockout of any one of them resulted in F/25 losing GTI capacity. We previously reported that F-avi3342 and F-avi4330 but not F-avi5730 are required for induction of grape tissue necrosis and tobacco hypersensitive response. F-avi5730 is predicted to encode a single modular NRPS. It is located in a cluster that is homologous to the siderophore vicibactin biosynthesis locus in Rhizobium species. Individual disruption of F-avi5730 and two immediate downstream genes, F-avi5731 and F-avi5732, all resulted in reduced siderophore production; however, only F-avi5730 was found to be required for GTI. Complemented F-avi5730 mutant (ΔF-avi5730(+)) restored a wild-type level of GTI activity. It was determined that, over time, populations of ΔF-avi4330, ΔF-avi3342, and ΔF-avi5730 at inoculated wound sites on grapevine did not differ from those of ΔF-avi5730(+) indicating that loss of GTI was not due to reduced colonization of wound sites by mutants.
Citric acid production and citrate synthase genes in distinct strains of ...
African Journals Online (AJOL)
SAM
2014-05-28
May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...
Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.
Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin
2017-10-01
Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.
Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor
2018-04-01
Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.
1991-01-01
Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate
Denecke, Shane; Fusetto, Roberto; Batterham, Philip
2017-12-01
ABC transporters have a well-established role in drug resistance, effluxing xenobiotics from cells and tissues within the organism. More recently, research has been dedicated to understanding the role insect ABC transporters play in insecticide toxicity, but progress in understanding the contribution of specific transporters has been hampered by the lack of functional genetic tools. Here, we report knockouts of three Drosophila melanogaster ABC transporter genes, Mdr49, Mdr50, and Mdr65, that are homologous to the well-studied mammalian ABCB1 (P-glycoprotein). Each knockout mutant was created in the same wild type background and tested against a panel of insecticides representing different chemical classes. Mdr65 knockouts were more susceptible to all neuroactive insecticides tested, but Mdr49 and Mdr50 knockouts showed increased susceptibility or resistance depending on the insecticide used. Mdr65 was chosen for further analysis. Calculation of LC 50 values for the Mdr65 knockout allowed the substrate specificity of this transporter to be examined. No obvious distinguishing structural features were shared among MDR65 substrates. A role for Mdr65 in insecticide transport was confirmed by testing the capacity of the knockout to synergize with the ABC inhibitor verapamil and by measuring the levels of insecticide retained in the body of knockout flies. These data unambiguously establish the influence of ABC transporters on the capacity of wild type D. melanogaster to tolerate insecticide exposure and suggest that both tissue and substrate specificity underpin this capacity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan
2018-05-11
Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem
The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type
Miller, G W; Wang, Y M; Gainetdinov, R R; Caron, M G
2001-01-01
One of the most valuable methods for understanding the function of a particular protein is the generation of animals that have had the gene encoding for the protein of interest disrupted, commonly known as a "quo;knockout"quo; or null mutant. By incorporating a sequence of DNA (typically encoding antibiotic resistance to aid in the selection of the mutant gene) into embryonic stem cells by homologous recombination, the normal transcription of the gene is effectively blocked (Fig. 1). Since a particular protein is encoded by two copies of a gene, it is necessary to have the gene on both alleles "quo;knocked out."quo; This is performed by cross-breeding animals with one affected allele (heterozygote) to generate offspring that have inherited two mutant alleles (homozygote). This procedure has been used to generate animals lacking either the plasma membrane dopamine transporter (DAT; Fig. 2) or the vesicular monoamine transporter (VMAT2; Fig. 3). Both DAT and VMAT2 are essential for dopamine homeostasis and are thought to participate in the pathogenesis of Parkinson's disease (1-5). Fig. 1. Maps of the targeting vector and the mock construct. The mouse genomic fragment (clone 11) was isolated from a Stratagene 129 SvJ library by standard colony hybridization using a PCR probe from the 5' end of rat cDNA. The restriction site abbreviations are as follows: H, HindIII; N, NotI; Sc, SacI; Sn, SnaI; X, XbaI; and Xh, XhoI. The region between HindIII and SnaI on clone 11 containing the coding sequence from transmembrane domains 3 and 4 of VMAT2 was deleted and replaced with PGK-neo. The 3' fragment of clone 11 was reserved as an external probe for Southern analysis. To facilitate PCR screening of embryonic stem cell clones, a mock construct containing the SnaI/XbaI fragment and part of the Neo cassette was generated as a positive control. pPNT and pGEM4Z were used to construct knockout and mock vectors, respectively. (Reproduced with permission from ref. 1). Fig. 2. DAT and
Knockout and transgenic mice of Trp53: what have we learned about p53 in breast cancer?
International Nuclear Information System (INIS)
Blackburn, Anneke C; Jerry, D Joseph
2002-01-01
The human p53 tumor suppressor gene TP53 is mutated at a high frequency in sporadic breast cancer, and Li-Fraumeni syndrome patients who carry germline mutations in one TP53 allele have a high incidence of breast cancer. In the 10 years since the first knockout of the mouse p53 tumor suppressor gene (designated Trp53) was published, much has been learned about the contribution of p53 to biology and tumor suppression in the breast through the use of p53 transgenic and knockout mice. The original mice deficient in p53 showed no mammary gland phenotype. However, studies using BALB/c-Trp53-deficient mice have demonstrated a delayed involution phenotype and a mammary tumor phenotype. Together with other studies of mutant p53 transgenes and p53 bitransgenics, a greater understanding has been gained of the role of p53 in involution, of the regulation of p53 activity by hormones, of the effect of mouse strain and modifier genes on tumor phenotype, and of the cooperation between p53 and other oncogenic pathways, chemical carcinogens and hormonal stimulation in mammary tumorigenesis. Both p53 transgenic and knockout mice are important in vivo tools for understanding breast cancer, and are yet to be exploited for developing therapeutic strategies in breast cancer
Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder
2017-11-03
Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.
Directory of Open Access Journals (Sweden)
Linjie Wang
Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.
Generation of ERα-floxed and knockout mice using the Cre/LoxP system
International Nuclear Information System (INIS)
Antonson, P.; Omoto, Y.; Humire, P.; Gustafsson, J.-Å.
2012-01-01
Highlights: ► ERα floxed and knockout mice were generated. ► Disruption of the ERα gene results in sterility in both male and female mice. ► ERα −/− mice have ovaries with hemorrhagic follicles and hypoplastic uterus. ► Female ERα −/− mice develop obesity. -- Abstract: Estrogen receptor alpha (ERα) is a nuclear receptor that regulates a range of physiological processes in response to estrogens. In order to study its biological role, we generated a floxed ERα mouse line that can be used to knock out ERα in selected tissues by using the Cre/LoxP system. In this study, we established a new ERα knockout mouse line by crossing the floxed ERα mice with Cre deleter mice. Here we show that genetic disruption of the ERα gene in all tissues results in sterility in both male and female mice. Histological examination of uterus and ovaries revealed a dramatically atrophic uterus and hemorrhagic cysts in the ovary. These results suggest that infertility in female mice is the result of functional defects of the reproductive tract. Moreover, female knockout mice are hyperglycemic, develop obesity and at the age of 4 months the body weight of these mice was more than 20% higher compared to wild type littermates and this difference increased over time. Our results demonstrate that ERα is necessary for reproductive tract development and has important functions as a regulator of metabolism in females.
Directory of Open Access Journals (Sweden)
Youfeng Shen
2017-11-01
Full Text Available Abstract Background Pigs have many features that make them attractive as biomedical models for various diseases, including cancer. P53 is an important tumor suppressor gene that exerts a central role in protecting cells from oncogenic transformation and is mutated in a large number of human cancers. P53 mutations occur in almost every type of tumor and in over 50% of all tumors. In a recent publication, pigs with a mutated P53 gene were generated that resulted in lymphoma and renal and osteogenic tumors. However, approximately 80% of human tumors have dysfunctional P53. A P53-deficient pig model is still required to elucidate. Methods Transcription activator-like effector nucleases (TALENs were designed to target porcine P53 exon 4. The targeting activity was evaluated using a luciferase SSA recombination assay. P53 biallelic knockout (KO cell lines were established from single-cell colonies of fetal fibroblasts derived from Diannan miniature pigs followed by electroporation with TALENs plasmids. One cell line was selected as the donor cell line for somatic cell nuclear transfer (SCNT for the generation of P53 KO pigs. P53 KO stillborn fetuses and living piglets were obtained. Gene typing of the collected cloned individuals was performed by T7EI assay and sequencing. Fibroblast cells from Diannan miniature piglets with a P53 biallelic knockout or wild type were analyzed for the P53 response to doxorubicin treatment by confocal microscopy and western blotting. Results The luciferase SSA recombination assay revealed that the targeting activities of the designed TALENs were 55.35-fold higher than those of the control. Eight cell lines (8/19 were mutated for P53, and five of them were biallelic knockouts. One of the biallelic knockout cell lines was selected as nuclear donor cells for SCNT. The cloned embryos were transferred into five recipient gilts, three of them becoming pregnant. Five live fetuses were obtained from one surrogate by caesarean
The subcellular localization of yeast glycogen synthase is dependent upon glycogen content
Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.
2010-01-01
The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...
Knockout reactions: experimental aspects
Energy Technology Data Exchange (ETDEWEB)
Cortina Gil, D. [Santiago de Compostela Univ. (Spain)
2007-07-01
The availability of radioactive beams has given rise to intense activity in the field of direct reactions. The removal of one(two)-nucleon (referred to as nucleon knockout in this text) from a fast exotic projectile has been extensively investigated. This lecture provides a general overview of the experimental results achieved using this technique. The sensitivity of the method to different experimental aspects is illustrated with a few examples. Special attention is given to the application of nucleon-knockout reactions as a general purpose spectroscopic tool. (author)
Knockout reactions: experimental aspects
International Nuclear Information System (INIS)
Cortina Gil, D.
2007-01-01
The availability of radioactive beams has given rise to intense activity in the field of direct reactions. The removal of one(two)-nucleon (referred to as nucleon knockout in this text) from a fast exotic projectile has been extensively investigated. This lecture provides a general overview of the experimental results achieved using this technique. The sensitivity of the method to different experimental aspects is illustrated with a few examples. Special attention is given to the application of nucleon-knockout reactions as a general purpose spectroscopic tool. (author)
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
International Nuclear Information System (INIS)
Dotson, G.D.; Woodard, R.W.
1994-01-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O
Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase
Energy Technology Data Exchange (ETDEWEB)
Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)
1994-12-01
The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.
El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia
2016-11-01
Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan
2016-01-01
The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
of endothelial nitric oxide synthase gene and serum level of vascular ...
African Journals Online (AJOL)
uwerhiavwe
Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...
Factors influencing gene silencing of granule-bound starch synthase in potato
Heilersig, H.J.B.
2005-01-01
In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI
Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng
2017-10-01
RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.
Trezise, A E; Ratcliff, R; Hawkins, T E; Evans, M J; Freeman, T C; Romano, P R; Higgins, C F; Colledge, W H
1997-04-01
The cystic fibrosis (Cftr and multidrug resistance (Mdr1) genes encode structurally similar proteins which are members of the ABC transporter superfamily. These genes exhibit complementary patterns of expression in vivo, suggesting that the regulation of their expression may be co-ordinated. We have tested this hypothesis in vivo by examining Cftr and Mdr1 expression in cystic fibrosis knockout transgenic mice (Cftr(tm1CAM)). Cftr mRNA expression in Cftr(tm1CAM)/Cftr(tm1CAM) mice was 4-fold reduced in the intestine, as compared with littermate wild-type mice. All other Cftr(tm1CAM)/Cftr(tm1CAM) mouse tissues examined showed similar reductions in Cftr expression. In contrast, we observed a 4-fold increase in Mdr1 mRNA expression in the intestines of neonatal and 3- to 4-week-old Cftr(tm1CAM)/Cftr(tm1CAM) mice, as compared with age-matched +/+ mice, and an intermediate level of Mdr1 mRNA in heterozygous Cftr(tm1CAM) mice. In 10-week-old, Cftr(tm1CAM)/Cftr(tm1CAM) mice and in contrast to the younger mice, Mdr1 mRNA expression was reduced, by 3-fold. The expression of two control genes, Pgk-1 and Mdr2, was similar in all genotypes, suggesting that the changes in Mdr1 mRNA levels observed in the Cftr(tm1CAM)/Cftr(tm1CAM) mice are specific to the loss of Cftr expression and/or function. These data provide further evidence supporting the hypothesis that the regulation Cftr and Mdr1 expression is co-ordinated in vivo, and that this co-ordinate regulation is influenced by temporal factors.
Directory of Open Access Journals (Sweden)
Maiko Furubayashi
Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2016-02-01
Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.
Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D
2001-09-01
The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by
International Nuclear Information System (INIS)
Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra
2008-01-01
The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative
Directory of Open Access Journals (Sweden)
Roman eGangl
2015-09-01
Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.
Physiological roles of CNS muscarinic receptors gained from knockout mice
DEFF Research Database (Denmark)
Thomsen, Morgane; Sørensen, Gunnar; Dencker, Ditte
2017-01-01
receptors modulating neuronal activity and neurotransmitter release in many brain regions, shaping neuronal plasticity, and affecting functions ranging from motor and sensory function to cognitive processes. As gene targeting technology evolves including the use of conditional, cell type specific strains......, knockout mice are likely to continue to provide valuable insights into brain physiology and pathophysiology, and advance the development of new medications for a range of conditions such as Alzheimer's disease, Parkinson's disease, schizophrenia, and addictions, as well as non-opioid analgesics...
Glycogen synthase kinase-3β promotes cyst expansion in polycystic kidney disease.
Tao, Shixin; Kakade, Vijayakumar R; Woodgett, James R; Pandey, Pankaj; Suderman, Erin D; Rajagopal, Madhumitha; Rao, Reena
2015-06-01
Polycystic kidney diseases (PKDs) are inherited disorders characterized by the formation of fluid filled renal cysts. Elevated cAMP levels in PKDs stimulate progressive cyst enlargement involving cell proliferation and transepithelial fluid secretion often leading to end-stage renal disease. The glycogen synthase kinase-3 (GSK3) family of protein kinases consists of GSK3α and GSK3β isoforms and has a crucial role in multiple cellular signaling pathways. We previously found that GSK3β, a regulator of cell proliferation, is also crucial for cAMP generation and vasopressin-mediated urine concentration by the kidneys. However, the role of GSK3β in the pathogenesis of PKDs is not known. Here we found that GSK3β expression and activity were markedly upregulated and associated with cyst-lining epithelia in the kidneys of mice and humans with PKD. Renal collecting duct-specific gene knockout of GSK3β or pharmacological inhibition of GSK3 effectively slowed down the progression of PKD in mouse models of autosomal recessive or autosomal dominant PKD. GSK3 inactivation inhibited cAMP generation and cell proliferation resulting in reduced cyst expansion, improved renal function, and extended life span. GSK3β inhibition also reduced pERK, c-Myc, and cyclin-D1, known mitogens in proliferation of cystic epithelial cells. Thus, GSK3β has a novel functional role in PKD pathophysiology, and its inhibition may be therapeutically useful to slow down cyst expansion and progression of PKD.
Monoterpene synthases from common sage (Salvia officinalis)
Energy Technology Data Exchange (ETDEWEB)
Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)
1999-01-01
cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.
Directory of Open Access Journals (Sweden)
Marquez Rodolfo
2004-09-01
Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.
Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai
2017-02-01
Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Zhang, Li; Chung, Sookja Kim; Chow, Billy Kwok Chong
2014-01-01
Secretin (SCT) was first considered to be a gut hormone regulating gastrointestinal functions when discovered. Recently, however, central actions of SCT have drawn intense research interest and are supported by the broad distribution of SCT in specific neuronal populations and by in vivo physiological studies regarding its role in water homeostasis and food intake. The direct action of SCT on a central neuron was first discovered in cerebellar Purkinje cells in which SCT from cerebellar Purkinje cells was found to potentiate GABAergic inhibitory transmission from presynaptic basket cells. Because Purkinje neurons have a major role in motor coordination and learning functions, we hypothesize a behavioral modulatory function for SCT. In this study, we successfully generated a mouse model in which the SCT gene was deleted specifically in Purkinje cells. This mouse line was tested together with SCT knockout and SCT receptor knockout mice in a full battery of behavioral tasks. We found that the knockout of SCT in Purkinje neurons did not affect general motor ability or the anxiety level in open field tests. However, knockout mice did exhibit impairments in neuromuscular strength, motor coordination, and motor learning abilities, as shown by wire hanging, vertical climbing, and rotarod tests. In addition, SCT knockout in Purkinje cells possibly led to the delayed development of motor neurons, as supported by the later occurrence of key neural reflexes. In summary, our data suggest a role in motor coordination and motor learning for SCT expressed in cerebellar Purkinje cells. PMID:24356714
Directory of Open Access Journals (Sweden)
Thomas J Lampert
Full Text Available Although G-protein coupled receptors (GPCRs are a common element in many chemosensory transduction pathways in eukaryotic cells, no GPCR or regulated G-protein activity has yet been shown in any ciliate. To study the possible role for a GPCR in the chemoresponses of the ciliate Tetrahymena, we have generated a number of macronuclear gene knockouts of putative GPCRs found in the Tetrahymena Genome database. One of these knockout mutants, called G6, is a complete knockout of a gene that we call GPCR6 (TTHERM_00925490. Based on sequence comparisons, the Gpcr6p protein belongs to the Rhodopsin Family of GPCRs. Notably, Gpcr6p shares highest amino acid sequence homologies to GPCRs from Paramecium and several plants. One of the phenotypes of the G6 mutant is a decreased responsiveness to the depolarizing ions Ba²⁺ and K⁺, suggesting a decrease in basal excitability (decrease in Ca²⁺ channel activity. The other major phenotype of G6 is a loss of chemoattraction to lysophosphatidic acid (LPA and proteose peptone (PP, two known chemoattractants in Tetrahymena. Using microsomal [³⁵S]GTPγS binding assays, we found that wild-type (CU427 have a prominent basal G-protein activity. This activity is decreased to the same level by pertussis toxin (a G-protein inhibitor, addition of chemoattractants, or the G6 mutant. Since the basal G-protein activity is decreased by the GPCR6 knockout, it is likely that this gene codes for a constitutively active GPCR in Tetrahymena. We propose that chemoattractants like LPA and PP cause attraction in Tetrahymena by decreasing the basal G-protein stimulating activity of Gpcr6p. This leads to decreased excitability in wild-type and longer runs of smooth forward swimming (less interrupted by direction changes towards the attractant. Therefore, these attractants may work as inverse agonists through the constitutively active Gpcr6p coupled to a pertussis-sensitive G-protein.
Xu, Meiyu; Li, Lina; Ohtsu, Hiroshi; Pittenger, Christopher
2015-05-19
Tics, such as are seen in Tourette syndrome (TS), are common and can cause profound morbidity, but they are poorly understood. Tics are potentiated by psychostimulants, stress, and sleep deprivation. Mutations in the gene histidine decarboxylase (Hdc) have been implicated as a rare genetic cause of TS, and Hdc knockout mice have been validated as a genetic model that recapitulates phenomenological and pathophysiological aspects of the disorder. Tic-like stereotypies in this model have not been observed at baseline but emerge after acute challenge with the psychostimulant d-amphetamine. We tested the ability of an acute stressor to stimulate stereotypies in this model, using tone fear conditioning. Hdc knockout mice acquired conditioned fear normally, as manifested by freezing during the presentation of a tone 48h after it had been paired with a shock. During the 30min following tone presentation, knockout mice showed increased grooming. Heterozygotes exhibited normal freezing and intermediate grooming. These data validate a new paradigm for the examination of tic-like stereotypies in animals without pharmacological challenge and enhance the face validity of the Hdc knockout mouse as a pathophysiologically grounded model of tic disorders. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Impaired Healing of a Cutaneous Wound in an Inducible Nitric Oxide Synthase-Knockout Mouse
Directory of Open Access Journals (Sweden)
Takashi Kitano
2017-01-01
Full Text Available Background. We investigated the effects of loss of inducible nitric oxide synthase (iNOS on the healing process of cutaneous excisional injury by using iNOS-null (KO mice. Population of granulation tissue-related cell types, that is, myofibroblasts and macrophages, growth factor expression, and reepithelialization were evaluated. Methods. KO and wild type (WT mice of C57BL/6 background were used. Under general anesthesia two round full-thickness excision wounds of 5.0 mm in diameter were produced in dorsal skin. After specific intervals of healing, macroscopic observation, histology, immunohistochemistry, and real-time reverse transcription-polymerase chain reaction (RT-PCR were employed to evaluate the healing process. Results. The loss of iNOS retards granulation tissue formation and reepithelialization in excision wound model in mice. Detailed analyses showed that myofibroblast appearance, macrophage infiltration, and mRNA expression of transforming growth factor b and of collagen 1α2 were all suppressed by lacking iNOS. Conclusions. iNOS is required in the process of cutaneous wound healing. Lacking iNOS retards macrophage invasion and its expression of fibrogenic components that might further impair fibrogenic behaviors of fibroblasts.
ANTXR2 Knock-Out Does Not Result in the Development of Hypertension in Rats.
Liu, Xiaoyan; Yuan, Wen; Li, Jing; Yang, Lei; Cai, Jun
2017-02-01
Our recent genetic study as well as robust evidences reported by previous genome-wide association studies (GWASs) have indicated that the single nucleotide polymorphism rs16998073, located near gene anthrax toxin receptor 2 (ANTXR2), was significantly associated with hypertension in Asians and Europeans. The aim of the present study was to determine whether ANTXR2 is the causal gene of hypertension at the 4q21 locus using an ANTXR2 knock-out model. Relative expression of ANTXR2 in Wistar-Kyoto rats (WKYs) and spontaneously hypertensive rats (SHRs) were determined by real-time quantitative polymerase chain reaction and western blot analysis. ANTXR2 knock-out rats were created using CRISPR/Cas9-mediated genome editing and blood pressure values were measured in ANTXR2 -/- and wild type (WT) rats by tail-cuff method and carotid arterial catheterization method. Neither the mRNA nor protein levels of ANTXR2 were significantly different between tissues from SHRs and WKYs. To create ANTXR2 -/- rats, 67 base pairs were deleted in exon 1 of ANTXR2 using CRISPR/Cas9-mediated genome editing. ANTXR2 protein decreased significantly in aortas of ANTXR2 -/- rats, suggesting sufficient efficiency of ANTXR2 knock-out in this model. However, ANTXR2 -/- rats exhibited nearly the same blood pressure as WT rats at baseline conditions as well as during Angiotensin II (400ng/kg/min) infusion or high-salt diet treatment. These findings suggest that ANTXR2 might not be associated with hypertension and thus further functional analysis is warranted to identify the causal gene at this locus. © American Journal of Hypertension, Ltd 2016. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand
2008-01-01
Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses
Molteni, R.; Calabrese, F.; Maj, P.F.; Olivier, J.D.A.; Racagni, G.; Ellenbroek, A.A.; Riva, M.A.
2009-01-01
A gene variant in the human serotonin transporter (SERT) can increase the vulnerability to mood disorders. SERT knockout animals show similarities to the human condition and represent an important tool to investigate the mechanisms underlying the pathologic condition in humans. Along this line of
Cyclic GMP-AMP synthase is an innate immune sensor of HIV and other retroviruses.
Gao, Daxing; Wu, Jiaxi; Wu, You-Tong; Du, Fenghe; Aroh, Chukwuemika; Yan, Nan; Sun, Lijun; Chen, Zhijian J
2013-08-23
Retroviruses, including HIV, can activate innate immune responses, but the host sensors for retroviruses are largely unknown. Here we show that HIV infection activates cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) synthase (cGAS) to produce cGAMP, which binds to and activates the adaptor protein STING to induce type I interferons and other cytokines. Inhibitors of HIV reverse transcriptase, but not integrase, abrogated interferon-β induction by the virus, suggesting that the reverse-transcribed HIV DNA triggers the innate immune response. Knockout or knockdown of cGAS in mouse or human cell lines blocked cytokine induction by HIV, murine leukemia virus, and simian immunodeficiency virus. These results indicate that cGAS is an innate immune sensor of HIV and other retroviruses.
Andrade, Paola; Caudepón, Daniel; Arró, Montserrat
2016-01-01
Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. PMID
Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R
1994-01-01
We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...
Li, Yaqing; Li, Xiaoran; Li, Xiaoli; Zhong, Yali; Ji, Yasai; Yu, Dandan; Zhang, Mingzhi; Wen, Jian-Guo; Zhang, Hongquan; Goscinski, Mariusz Adam; Nesland, Jahn M.; Suo, Zhenhe
2016-01-01
Alternative pathways of metabolism endowed cancer cells with metabolic stress. Inhibiting the related compensatory pathways might achieve synergistic anticancer results. This study demonstrated that pyruvate dehydrogenase E1α gene knockout (PDHA1 KO) resulted in alterations in tumor cell metabolism by rendering the cells with increased expression of glutaminase1 (GLS1) and glutamate dehydrogenase1 (GLUD1), leading to an increase in glutamine-dependent cell survival. Deprivation of glutamine induced cell growth inhibition, increased reactive oxygen species and decreased ATP production. Pharmacological blockade of the glutaminolysis pathway resulted in massive tumor cells apoptosis and dysfunction of ROS scavenge in the LNCaP PDHA1 KO cells. Further examination of the key glutaminolysis enzymes in human prostate cancer samples also revealed that higher levels of GLS1 and GLUD1 expression were significantly associated with aggressive clinicopathological features and poor clinical outcome. These insights supply evidence that glutaminolysis plays a compensatory role for cell survival upon alternative energy metabolism and targeting the glutamine anaplerosis of energy metabolism via GLS1 and GLUD1 in cancer cells may offer a potential novel therapeutic strategy. PMID:27462778
DEFF Research Database (Denmark)
Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva
2005-01-01
The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...
Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante
2015-11-01
Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.
Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M
2005-06-01
Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.
Bone phenotypes of P2 receptor knockout mice
DEFF Research Database (Denmark)
Orriss, Isabel; Syberg, Susanne; Wang, Ning
2011-01-01
The action of extracellular nucleotides is mediated by ionotropic P2X receptors and G-protein coupled P2Y receptors. The human genome contains 7 P2X and 8 P2Y receptor genes. Knockout mice strains are available for most of them. As their phenotypic analysis is progressing, bone abnormalities have...... been observed in an impressive number of these mice: distinct abnormalities in P2X7-/- mice, depending on the gene targeting construct and the genetic background, decreased bone mass in P2Y1-/- mice, increased bone mass in P2Y2-/- mice, decreased bone resorption in P2Y6-/- mice, decreased bone...... formation and bone resorption in P2Y13-/- mice. These findings demonstrate the unexpected importance of extracellular nucleotide signalling in the regulation of bone metabolism via multiple P2 receptors and distinct mechanisms involving both osteoblasts and osteoclasts....
Manzano, David; Andrade, Paola; Caudepón, Daniel; Altabella, Teresa; Arró, Montserrat; Ferrer, Albert
2016-09-01
Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. © 2016
Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes
2010-07-01
Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta
Contribution of granule bound starch synthase in kernel modification ...
African Journals Online (AJOL)
The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...
Shuai, Yi; Guo, Jun; Dong, Yansheng; Zhong, Weijian; Xiao, Ping; Zhou, Tong; Zhang, Lishi; Peng, Shuangqing
2011-01-15
Increasing evidence from in vivo and in vitro studies has indicated that MT exerts protective effects against DOX-induced cardiotoxicity; however the underlying precise mechanisms still remain an enigma. Therefore, the present study was designed using MT knockout mice in concert with genomic approaches to explore the possible molecular and cellular mechanisms in terms of the genetic network changes. MT-I/II null (MT⁻/⁻) mice and corresponding wild-type mice (MT+/+) were administrated with a single dose of DOX (15 mg/kg, i.p.) or equal volume of saline. Animals were sacrificed on the 4th day after DOX administration and samples were collected for further analyses. Global gene expression profiles of cardiac mRNA from two genotype mice revealed that 381 characteristically MT-responsive genes were identified between MT+/+ mice and MT⁻/⁻ mice in response to DOX, including fos, ucp3, car3, atf3, map3k6, etc. Functional analysis implied MAPK signaling pathway, p53 signaling pathway, Jak-STAT signaling pathway, PPAR signaling pathway, Wnt signaling pathway, etc. might be involved to mediate the protection of DOX cardiomyopathy by MT. Results from the present study not only validated the previously reported possible mechanisms of MT protection against DOX toxicity, but also provided new clues into the molecular mechanisms involved in this process. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Oberding, Lisa K; Gieg, Lisa M
2018-01-01
Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important
Polyketide synthases from poison hemlock (Conium maculatum L.).
Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko
2015-11-01
Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.
Directory of Open Access Journals (Sweden)
M. A. Slugina
2016-01-01
Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.
Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg
2004-05-01
The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.
Energy Technology Data Exchange (ETDEWEB)
Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx
2007-08-01
To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.
Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.
2006-01-01
Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870
Chen, Xi; Sun, Weiwen; Pan, Ying; Yang, Quan; Cao, Kaiyi; Zhang, Jin; Zhang, Yizhi; Chen, Mincong; Chen, Feidi; Huang, Yueling; Dai, Lijun; Chen, Shengqiang
2013-10-01
To investigate whether lithium modifies open-field and elevated plus maze behavior, and brain phospho-glycogen synthase kinase 3 (P-GSK3beta) expression in Fmr1 knockout mice. One hundred and eighty FVB mice, including knockout and wild type, with an age of 30 days were used. An open-field and elevated plus maze was utilized to test behavior, while western blot was used to measure the P-GSK3beta expression. Six groups were formed: control (saline), lithium chloride 30, 60, 90, 120, and 200 mg/kg. The experiments were carried out in the Institute of Neuroscience, Second Affiliated Hospital of Guangzhou Medical University, Guangzhou, China between January and June 2012. Lithium significantly decreased total distance, crossing, central area time, and center entry in the open-field test (popen-arm tracking, open-arm entry, and open-arm time in the elevated plus maze (popen-field and elevated plus maze behaviors of Fmr1 knockout mice. This effect may be related to its enhancement of P-GSK3beta expression. Our findings suggest that lithium might have a therapeutic effect in fragile X syndrome.
Directory of Open Access Journals (Sweden)
Susan Richter
Full Text Available Zinc finger nucleases (ZFN are powerful tools for editing genes in cells. Here we use ZFNs to interrogate the biological function of ADPGK, which encodes an ADP-dependent glucokinase (ADPGK, in human tumour cell lines. The hypothesis we tested is that ADPGK utilises ADP to phosphorylate glucose under conditions where ATP becomes limiting, such as hypoxia. We characterised two ZFN knockout clones in each of two lines (H460 and HCT116. All four clones had frameshift mutations in all alleles at the target site in exon 1 of ADPGK, and were ADPGK-null by immunoblotting. ADPGK knockout had little or no effect on cell proliferation, but compromised the ability of H460 cells to survive siRNA silencing of hexokinase-2 under oxic conditions, with clonogenic survival falling from 21±3% for the parental line to 6.4±0.8% (p = 0.002 and 4.3±0.8% (p = 0.001 for the two knockouts. A similar increased sensitivity to clonogenic cell killing was observed under anoxia. No such changes were found when ADPGK was knocked out in HCT116 cells, for which the parental line was less sensitive than H460 to anoxia and to hexokinase-2 silencing. While knockout of ADPGK in HCT116 cells caused few changes in global gene expression, knockout of ADPGK in H460 cells caused notable up-regulation of mRNAs encoding cell adhesion proteins. Surprisingly, we could discern no consistent effect on glycolysis as measured by glucose consumption or lactate formation under anoxia, or extracellular acidification rate (Seahorse XF analyser under oxic conditions in a variety of media. However, oxygen consumption rates were generally lower in the ADPGK knockouts, in some cases markedly so. Collectively, the results demonstrate that ADPGK can contribute to tumour cell survival under conditions of high glycolytic dependence, but the phenotype resulting from knockout of ADPGK is cell line dependent and appears to be unrelated to priming of glycolysis in these lines.
Richter, Susan; Morrison, Shona; Connor, Tim; Su, Jiechuang; Print, Cristin G; Ronimus, Ron S; McGee, Sean L; Wilson, William R
2013-01-01
Zinc finger nucleases (ZFN) are powerful tools for editing genes in cells. Here we use ZFNs to interrogate the biological function of ADPGK, which encodes an ADP-dependent glucokinase (ADPGK), in human tumour cell lines. The hypothesis we tested is that ADPGK utilises ADP to phosphorylate glucose under conditions where ATP becomes limiting, such as hypoxia. We characterised two ZFN knockout clones in each of two lines (H460 and HCT116). All four clones had frameshift mutations in all alleles at the target site in exon 1 of ADPGK, and were ADPGK-null by immunoblotting. ADPGK knockout had little or no effect on cell proliferation, but compromised the ability of H460 cells to survive siRNA silencing of hexokinase-2 under oxic conditions, with clonogenic survival falling from 21±3% for the parental line to 6.4±0.8% (p = 0.002) and 4.3±0.8% (p = 0.001) for the two knockouts. A similar increased sensitivity to clonogenic cell killing was observed under anoxia. No such changes were found when ADPGK was knocked out in HCT116 cells, for which the parental line was less sensitive than H460 to anoxia and to hexokinase-2 silencing. While knockout of ADPGK in HCT116 cells caused few changes in global gene expression, knockout of ADPGK in H460 cells caused notable up-regulation of mRNAs encoding cell adhesion proteins. Surprisingly, we could discern no consistent effect on glycolysis as measured by glucose consumption or lactate formation under anoxia, or extracellular acidification rate (Seahorse XF analyser) under oxic conditions in a variety of media. However, oxygen consumption rates were generally lower in the ADPGK knockouts, in some cases markedly so. Collectively, the results demonstrate that ADPGK can contribute to tumour cell survival under conditions of high glycolytic dependence, but the phenotype resulting from knockout of ADPGK is cell line dependent and appears to be unrelated to priming of glycolysis in these lines.
Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer
International Nuclear Information System (INIS)
Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.
2003-01-01
Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement
Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.
2017-01-01
Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be considered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...
Robust and sensitive analysis of mouse knockout phenotypes.
Directory of Open Access Journals (Sweden)
Natasha A Karp
Full Text Available A significant challenge of in-vivo studies is the identification of phenotypes with a method that is robust and reliable. The challenge arises from practical issues that lead to experimental designs which are not ideal. Breeding issues, particularly in the presence of fertility or fecundity problems, frequently lead to data being collected in multiple batches. This problem is acute in high throughput phenotyping programs. In addition, in a high throughput environment operational issues lead to controls not being measured on the same day as knockouts. We highlight how application of traditional methods, such as a Student's t-Test or a 2-way ANOVA, in these situations give flawed results and should not be used. We explore the use of mixed models using worked examples from Sanger Mouse Genome Project focusing on Dual-Energy X-Ray Absorptiometry data for the analysis of mouse knockout data and compare to a reference range approach. We show that mixed model analysis is more sensitive and less prone to artefacts allowing the discovery of subtle quantitative phenotypes essential for correlating a gene's function to human disease. We demonstrate how a mixed model approach has the additional advantage of being able to include covariates, such as body weight, to separate effect of genotype from these covariates. This is a particular issue in knockout studies, where body weight is a common phenotype and will enhance the precision of assigning phenotypes and the subsequent selection of lines for secondary phenotyping. The use of mixed models with in-vivo studies has value not only in improving the quality and sensitivity of the data analysis but also ethically as a method suitable for small batches which reduces the breeding burden of a colony. This will reduce the use of animals, increase throughput, and decrease cost whilst improving the quality and depth of knowledge gained.
Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee
2017-03-01
This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.
Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu
2008-08-01
Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.
DEFF Research Database (Denmark)
Poulsen, Christian Bjørn; Penkowa, Milena; Borup, Rehannah
2005-01-01
Traumatic injury to the brain is one of the leading causes of injury-related death or disability. Brain response to injury is orchestrated by cytokines, such as interleukin (IL)-6, but the full repertoire of responses involved is not well known. We here report the results obtained with microarrays...... in wild-type and IL-6 knockout mice subjected to a cryolesion of the somatosensorial cortex and killed at 0, 1, 4, 8 and 16 days post-lesion. Overall gene expression was analyzed by using Affymetrix genechips/oligonucleotide arrays with approximately 12,400 probe sets corresponding to approximately 10...... in the initial tissue injury and later regeneration of the parenchyma. IL-6 deficiency showed a dramatic effect in the expression of many genes, especially in the 1 day post-lesion timing, which presumably underlies the poor capacity of IL-6 knockout mice to cope with brain damage. The results highlight...
Generation of ER{alpha}-floxed and knockout mice using the Cre/LoxP system
Energy Technology Data Exchange (ETDEWEB)
Antonson, P., E-mail: per.antonson@ki.se [Department of Biosciences and Nutrition, Karolinska Institutet, Novum, SE-141 83 Huddinge (Sweden); Omoto, Y.; Humire, P. [Department of Biosciences and Nutrition, Karolinska Institutet, Novum, SE-141 83 Huddinge (Sweden); Gustafsson, J.-A. [Department of Biosciences and Nutrition, Karolinska Institutet, Novum, SE-141 83 Huddinge (Sweden); Center for Nuclear Receptors and Cell Signaling, Department of Biology and Biochemistry, University of Houston, Houston, TX 77204 (United States)
2012-08-10
Highlights: Black-Right-Pointing-Pointer ER{alpha} floxed and knockout mice were generated. Black-Right-Pointing-Pointer Disruption of the ER{alpha} gene results in sterility in both male and female mice. Black-Right-Pointing-Pointer ER{alpha}{sup -/-} mice have ovaries with hemorrhagic follicles and hypoplastic uterus. Black-Right-Pointing-Pointer Female ER{alpha}{sup -/-} mice develop obesity. -- Abstract: Estrogen receptor alpha (ER{alpha}) is a nuclear receptor that regulates a range of physiological processes in response to estrogens. In order to study its biological role, we generated a floxed ER{alpha} mouse line that can be used to knock out ER{alpha} in selected tissues by using the Cre/LoxP system. In this study, we established a new ER{alpha} knockout mouse line by crossing the floxed ER{alpha} mice with Cre deleter mice. Here we show that genetic disruption of the ER{alpha} gene in all tissues results in sterility in both male and female mice. Histological examination of uterus and ovaries revealed a dramatically atrophic uterus and hemorrhagic cysts in the ovary. These results suggest that infertility in female mice is the result of functional defects of the reproductive tract. Moreover, female knockout mice are hyperglycemic, develop obesity and at the age of 4 months the body weight of these mice was more than 20% higher compared to wild type littermates and this difference increased over time. Our results demonstrate that ER{alpha} is necessary for reproductive tract development and has important functions as a regulator of metabolism in females.
Cheng, Jiujun; Charles, Trevor C
2016-09-01
Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.
Directory of Open Access Journals (Sweden)
Linda Koshy
2008-01-01
Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.
Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang
2017-07-01
The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.
Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi
2016-12-01
To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.
Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun
2017-09-01
Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.
Effects of starch synthase IIa gene dosage on grain, protein and starch in endosperm of wheat.
Konik-Rose, Christine; Thistleton, Jenny; Chanvrier, Helene; Tan, Ihwa; Halley, Peter; Gidley, Michael; Kosar-Hashemi, Behjat; Wang, Hong; Larroque, Oscar; Ikea, Joseph; McMaugh, Steve; Regina, Ahmed; Rahman, Sadequr; Morell, Matthew; Li, Zhongyi
2007-11-01
Starch synthases (SS) are responsible for elongating the alpha-1,4 glucan chains of starch. A doubled haploid population was generated by crossing a line of wheat, which lacks functional ssIIa genes on each genome (abd), and an Australian wheat cultivar, Sunco, with wild type ssIIa alleles on each genome (ABD). Evidence has been presented previously indicating that the SGP-1 (starch granule protein-1) proteins present in the starch granule in wheat are products of the ssIIa genes. Analysis of 100 progeny lines demonstrated co-segregation of the ssIIa alleles from the three genomes with the SGP-1 proteins, providing further evidence that the SGP-1 proteins are the products of the ssIIa genes. From the progeny lines, 40 doubled haploid lines representing the eight possible genotypes for SSIIa (ABD, aBD, AbD, ABd, abD, aBd, Abd, abd) were characterized for their grain weight, protein content, total starch content and starch properties. For some properties (chain length distribution, pasting properties, swelling power, and gelatinization properties), a progressive change was observed across the four classes of genotypes (wild type, single nulls, double nulls and triple nulls). However, for other grain properties (seed weight and protein content) and starch properties (total starch content, granule morphology and crystallinity, granule size distribution, amylose content, amylose-lipid dissociation properties), a statistically significant change only occurred for the triple nulls, indicating that all three genes had to be missing or inactive for a change to occur. These results illustrate the importance of SSIIa in controlling grain and starch properties and the importance of amylopectin fine structure in controlling starch granule properties in wheat.
Effects of Eaf2 gene knockout on cataract induced by ultraviolet irradiation in mice
Directory of Open Access Journals (Sweden)
Yan-Hua Jiang
2016-02-01
Full Text Available AIM:To evaluate the effects of Eaf2 gene knockout on cataract in mice induced by ultraviolet irradiation.METHODS:Fifteen wild type mice were used as the control group, and 10 Eaf2 KO mice were used as the experimental group. The 14-week mice were taken as the research objects in the two groups. So the subgroups were: WT -nonUV, WT -UV, Eaf2 KO-nonUV and Eaf2 KO-UV, a total of 4 groups. Observe the lens of mice in vivo with slit lamp microscope, grade the lens opacity with Lens Opacities Classification System II(LOCSII. Then the mice were sacrificed by breaking the neck, the lens were removed and were observed by dark field microscopy. According to the captured images, the proportion of cataract region was analyzed using Image J software. The data of the two groups were statistically analyzed.RESULTS: The results detected by the two methods were similar. In WT-UV group and Eaf2 KO-UV group, the degree of lens opacity was significantly higher than those of WT-nonUV group and Eaf2 KO-nonUV group. The lens opacity of WT-UV group was significantly higher than that in Eaf2 KO-UV group, and the difference was statistically significant(PCONCLUSION: Ultraviolet radiation can lead to the formation of cataract in mice. Eaf2 protein can promote the formation of cataract in mice caused by ultraviolet.
Directory of Open Access Journals (Sweden)
G. V. Matyushin
2017-01-01
Full Text Available Background. The discovery of new genetic predictors of cardiovascular diseases can be used in predicting and diagnosing latent forms of the disease. Wolff-Parkinson-White syndrome (WPW occurs in all age groups and detected in 1-30 people per 10000, it manifests mainly in young age (on average 20 years, and the risk of sudden cardiac death is higher than in general population.Aim. To study the relationship of WPW syndrome with the polymorphism of endothelial nitric synthase gene (NOS3, and to identify genetic predictors of this syndrome.Material and methods. The study included 51 people with ECG proven WPW syndrome and 153 people with no cardiovascular disease. The patients were divided into subgroups according to sex: 21 women, 30 men. All patients underwent a standard cardiac examination (anamnesis, electrocardiography, echocardiography, bicycle ergometry, transesophageal electrical stimulation of the atria, Holter monitoring and blood was taken for molecular genetic testing of DNA.Results. The results showed a statistically significant prevalence of rare genotype 4b\\4b NOS3 gene in the control group of women (16.3%; р<0.05 compared with women from the main group, who did not have this genotype, while there was significant prevalence of genotype 4a\\4a in the main group of women (81.0%; р<0.05 compared with women from the control group. In men this prevalence was not found.Conclusion. The presence of genotype 4b\\4b NOS3 gene reduces the likelihood of WPW syndrome and its symptoms in females. In men, this prevalence is not found, presumably, in connection with some mechanisms of hormonal regulation. The results can be used in the genetic prediction of the course of the disease.
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
The effect of insulin deficiency on tau and neurofilament in the insulin knockout mouse
International Nuclear Information System (INIS)
Schechter, Ruben; Beju, Delia; Miller, Kenneth E.
2005-01-01
Complications of diabetes mellitus within the nervous system are peripheral and central neuropathy. In peripheral neuropathy, defects in neurofilament and microtubules have been demonstrated. In this study, we examined the effects of insulin deficiency within the brain in insulin knockout mice (I(-/-)). The I(-/-) exhibited hyperphosphorylation of tau, at threonine 231, and neurofilament. In addition, we showed hyperphosphorylation of c-Jun N-terminal kinase (JNK) and glycogen synthase kinase 3 β (GSK-3 β) at serine 9. Extracellular signal-regulated kinase 1 (ERK 1) showed decrease in phosphorylation, whereas ERK 2 showed no changes. Ultrastructural examination demonstrated swollen mitochondria, endoplasmic reticulum, and Golgi apparatus, and dispersion of the nuclear chromatin. Microtubules showed decrease in the number of intermicrotubule bridges and neurofilament presented as bunches. Thus, lack of insulin brain stimulation induces JNK hyperphosphorylation followed by hyperphosphorylation of tau and neurofilament, and ultrastructural cellular damage, that over time may induce decrease in cognition and learning disabilities
The effect of insulin deficiency on tau and neurofilament in the insulin knockout mouse
Energy Technology Data Exchange (ETDEWEB)
Schechter, Ruben [William K. Warren Medical Research Institute, University of Oklahoma Medical Health Science Center, Tulsa, OK 74107 (United States); Department of Anatomy and Cell Biology, Oklahoma State University Center for Health Science, Tulsa, OK 74107 (United States); schechter@okstate edu, E-mail: ruben; Beju, Delia [William K. Warren Medical Research Institute, University of Oklahoma Medical Health Science Center, Tulsa, OK 74107 (United States); Department of Anatomy and Cell Biology, Oklahoma State University Center for Health Science, Tulsa, OK 74107 (United States); Miller, Kenneth E [Department of Anatomy and Cell Biology, Oklahoma State University Center for Health Science, Tulsa, OK 74107 (United States)
2005-09-09
Complications of diabetes mellitus within the nervous system are peripheral and central neuropathy. In peripheral neuropathy, defects in neurofilament and microtubules have been demonstrated. In this study, we examined the effects of insulin deficiency within the brain in insulin knockout mice (I(-/-)). The I(-/-) exhibited hyperphosphorylation of tau, at threonine 231, and neurofilament. In addition, we showed hyperphosphorylation of c-Jun N-terminal kinase (JNK) and glycogen synthase kinase 3 {beta} (GSK-3 {beta}) at serine 9. Extracellular signal-regulated kinase 1 (ERK 1) showed decrease in phosphorylation, whereas ERK 2 showed no changes. Ultrastructural examination demonstrated swollen mitochondria, endoplasmic reticulum, and Golgi apparatus, and dispersion of the nuclear chromatin. Microtubules showed decrease in the number of intermicrotubule bridges and neurofilament presented as bunches. Thus, lack of insulin brain stimulation induces JNK hyperphosphorylation followed by hyperphosphorylation of tau and neurofilament, and ultrastructural cellular damage, that over time may induce decrease in cognition and learning disabilities.
Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.
2015-01-01
Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the
O.I. Kadykova; P.P. Kravchun
2016-01-01
The article reviewed the links between polymorphism of endothelial nitric oxide synthase gene (Glu298Asp) and the development and progression of chronic heart failure in patients with ischemic heart disease and obesity. There has been a comprehensive survey of 222 patients with ischemic heart disease. Comparison group consisted of 115 patients with ischemic heart disease with normal body weight. The control group included 35 healthy individuals. G allele and genotype G/G polymorphism of the g...
Erratum Aldosterone synthase C-344T, angiotensin II type 1 receptor ...
Indian Academy of Sciences (India)
Aldosterone synthase C-344T, angiotensin II type 1 receptor A1166C and 11-β hydroxysteroid dehydrogenase G534A gene polymorphisms and essential hypertension in the population of Odisha, India. Manisha Patnaik, Pallabi Pati, Surendra N. Swain, Manoj K. Mohapatra, Bhagirathi Dwibedi, Shantanu K. Kar.
DEFF Research Database (Denmark)
Gojkovic, Zoran; Sandrini, Michael; Piskur, Jure
2001-01-01
no pyrimidine catabolic pathway, it enabled growth on N-carbamyl- beta -alanine as the sole nitrogen source. The D. discoideum and D. melanogaster PYD3 gene products are similar to mammalian beta -alanine synthases. In contrast, the S. kluyveri protein is quite different from these and more similar to bacterial......beta -Alanine synthase (EC 3.5.1.6), which catalyzes the final step of pyrimidine catabolism, has only been characterized in mammals. A Saccharomyces kluyveri pyd3 mutant that is unable to grow on N-carbamy-beta -alanine as the sole nitrogen source and exhibits diminished beta -alanine synthase...... N- carbamyl amidohydrolases. All three beta -alanine synthases are to some degree related to various aspartate transcarbamylases, which catalyze the second step of the de novo pyrimidine biosynthetic pathway. PYD3 expression in yeast seems to be inducible by dihydrouracil and N...
Sitthithaworn, W; Kojima, N; Viroonchatapan, E; Suh, D Y; Iwanami, N; Hayashi, T; Noji, M; Saito, K; Niwa, Y; Sankawa, U
2001-02-01
cDNAs encoding geranylgeranyl diphosphate synthase (GGPPS) of two diterpene-producing plants, Scoparia dulcis and Croton sublyratus, have been isolated using the homology-based polymerase chain reaction (PCR) method. Both clones contained highly conserved aspartate-rich motifs (DDXX(XX)D) and their N-terminal residues exhibited the characteristics of chloroplast targeting sequence. When expressed in Escherichia coli, both the full-length and truncated proteins in which the putative targeting sequence was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to produce geranylgeranyl diphosphate (GGPP). The structural factors determining the product length in plant GGPPSs were investigated by constructing S. dulcis GGPPS mutants on the basis of sequence comparison with the first aspartate-rich motif (FARM) of plant farnesyl diphosphate synthase. The result indicated that in plant GGPPSs small amino acids, Met and Ser, at the fourth and fifth positions before FARM and Pro and Cys insertion in FARM play essential roles in determination of product length. Further, when a chimeric gene comprised of the putative transit peptide of the S. dulcis GGPPS gene and a green fluorescent protein was introduced into Arabidopsis leaves by particle gun bombardment, the chimeric protein was localized in chloroplasts, indicating that the cloned S. dulcis GGPPS is a chloroplast protein.
Polyketide synthases of Diaporthe helianthi and involvement of DhPKS1 in virulence on sunflower.
Ruocco, Michelina; Baroncelli, Riccardo; Cacciola, Santa Olga; Pane, Catello; Monti, Maurilia Maria; Firrao, Giuseppe; Vergara, Mariarosaria; Magnano di San Lio, Gaetano; Vannacci, Giovanni; Scala, Felice
2018-01-06
The early phases of Diaporthe helianthi pathogenesis on sunflower are characterized by the production of phytotoxins that may play a role in host colonisation. In previous studies, phytotoxins of a polyketidic nature were isolated and purified from culture filtrates of virulent strains of D. helianthi isolated from sunflower. A highly aggressive isolate (7/96) from France contained a gene fragment of a putative nonaketide synthase (lovB) which was conserved in a virulent D. helianthi population. In order to investigate the role of polyketide synthases in D. helianthi 7/96, a draft genome of this isolate was examined. We were able to find and phylogenetically analyse 40 genes putatively coding for polyketide synthases (PKSs). Analysis of their domains revealed that most PKS genes of D. helianthi are reducing PKSs, whereas only eight lacked reducing domains. Most of the identified PKSs have orthologs shown to be virulence factors or genetic determinants for toxin production in other pathogenic fungi. One of the genes (DhPKS1) corresponded to the previously cloned D. helianthi lovB gene fragment and clustered with a nonribosomal peptide synthetase (NRPS) -PKS hybrid/lovastatin nonaketide like A. nidulans LovB. We used DhPKS1 as a case study and carried out its disruption through Agrobacterium-mediated transformation in the isolate 7/96. D. helianthi DhPKS1 deleted mutants were less virulent to sunflower compared to the wild type, indicating a role for this gene in the pathogenesis of the fungus. The PKS sequences analysed and reported here constitute a new genomic resource that will be useful for further research on the biology, ecology and evolution of D. helianthi and generally of fungal plant pathogens.
Gene knockout of tau expression does not contribute to the pathogenesis of prion disease.
Lawson, Victoria A; Klemm, Helen M; Welton, Jeremy M; Masters, Colin L; Crouch, Peter; Cappai, Roberto; Ciccotosto, Giuseppe D
2011-11-01
Prion diseases or transmissible spongiform encephalopathies are a group of fatal and transmissible disorders affecting the central nervous system of humans and animals. The principal agent of prion disease transmission and pathogenesis is proposed to be an abnormal protease-resistant isoform of the normal cellular prion protein. The microtubule-associated protein tau is elevated in patients with Creutzfeldt-Jakob disease. To determine whether tau expression contributes to prion disease pathogenesis, tau knockout and control wild-type mice were infected with the M1000 strain of mouse-adapted human prions. Immunohistochemical analysis for total tau expression in prion-infected wild-type mice indicated tau aggregation in the cytoplasm of a subpopulation of neurons in regions associated with spongiform change. Western immunoblot analysis of brain homogenates revealed a decrease in total tau immunoreactivity and epitope-specific changes in tau phosphorylation. No significant difference in incubation period or other disease features were observed between tau knockout and wild-type mice with clinical prion disease. These results demonstrate that, in this model of prion disease, tau does not contribute to the pathogenesis of prion disease and that changes in the tau protein profile observed in mice with clinical prion disease occurs as a consequence of the prion-induced pathogenesis.
Energy Technology Data Exchange (ETDEWEB)
Hughes, Sam [School of Biosciences, Cardiff University, Main Building, Park Place, Cardiff CF10 3TL (United Kingdom); School of Biomedical and Health Sciences, Pharmaceutical Sciences Research Division, King' s College London, 150 Stamford Street, London SE1 9NH (United Kingdom); Stuerzenbaum, Stephen R. [School of Biosciences, Cardiff University, Main Building, Park Place, Cardiff CF10 3TL (United Kingdom) and School of Biomedical and Health Sciences, Pharmaceutical Sciences Research Division, King' s College London, 150 Stamford Street, London SE1 9NH (United Kingdom)]. E-mail: stephen.sturzenbaum@kcl.ac.uk
2007-01-15
The genome of the nematode Caenorhabditis elegans contains two metallothionein genes, both involved in metal homeostasis and/or detoxification. Single metallothionein knockout mutants have been created and now, for the first time, a double mutant has been isolated. Life history studies in the presence or absence of cadmium showed that all metallothionein mutants are viable. Although cadmium did not influence longevity, a dose dependent reduction in total brood size and volumetric growth was observed in wild type animals, which was magnified in single knockouts and further exacerbated in the double knockout. However, the metallothionein deletion caused two effects that are independent of cadmium exposure, namely all knockout strains displayed a reduced total brood size and the deletion of both metallothionein loci caused a significant reduction in volumetric growth. In summary, metallothionein is undoubtedly an important player in cadmium detoxification, but evidently also an important factor in cadmium independent pathways. - Metallothionein is a modifier of life-history parameters.
International Nuclear Information System (INIS)
Hughes, Sam; Stuerzenbaum, Stephen R.
2007-01-01
The genome of the nematode Caenorhabditis elegans contains two metallothionein genes, both involved in metal homeostasis and/or detoxification. Single metallothionein knockout mutants have been created and now, for the first time, a double mutant has been isolated. Life history studies in the presence or absence of cadmium showed that all metallothionein mutants are viable. Although cadmium did not influence longevity, a dose dependent reduction in total brood size and volumetric growth was observed in wild type animals, which was magnified in single knockouts and further exacerbated in the double knockout. However, the metallothionein deletion caused two effects that are independent of cadmium exposure, namely all knockout strains displayed a reduced total brood size and the deletion of both metallothionein loci caused a significant reduction in volumetric growth. In summary, metallothionein is undoubtedly an important player in cadmium detoxification, but evidently also an important factor in cadmium independent pathways. - Metallothionein is a modifier of life-history parameters
Shu, Cheng-Cheng; Wang, Dong; Guo, Jing; Song, Jia-Ming; Chen, Shou-Wen; Chen, Ling-Ling; Gao, Jun-Xiang
2018-01-01
As an industrial bacterium, Bacillus licheniformis DW2 produces bacitracin which is an important antibiotic for many pathogenic microorganisms. Our previous study showed AbrB-knockout could significantly increase the production of bacitracin. Accordingly, it was meaningful to understand its genome features, expression differences between wild and AbrB-knockout (ΔAbrB) strains, and the regulation of bacitracin biosynthesis. Here, we sequenced, de novo assembled and annotated its genome, and also sequenced the transcriptomes in three growth phases. The genome of DW2 contained a DNA molecule of 4,468,952 bp with 45.93% GC content and 4,717 protein coding genes. The transcriptome reads were mapped to the assembled genome, and obtained 4,102∼4,536 expressed genes from different samples. We investigated transcription changes in B. licheniformis DW2 and showed that ΔAbrB caused hundreds of genes up-regulation and down-regulation in different growth phases. We identified a complete bacitracin synthetase gene cluster, including the location and length of bacABC, bcrABC, and bacT, as well as their arrangement. The gene cluster bcrABC were significantly up-regulated in ΔAbrB strain, which supported the hypothesis in previous study of bcrABC transporting bacitracin out of the cell to avoid self-intoxication, and was consistent with the previous experimental result that ΔAbrB could yield more bacitracin. This study provided a high quality reference genome for B. licheniformis DW2, and the transcriptome data depicted global alterations across two strains and three phases offered an understanding of AbrB regulation and bacitracin biosynthesis through gene expression. PMID:29599755
Characterization of Bombyx mori nucleopolyhedrovirus with a knockout of Bm17.
Shen, Hongxing; Zhou, Yang; Zhang, Wen; Nin, Bin; Wang, Hua; Wang, Xiaochun; Shao, Shihe; Chen, Huiqing; Guo, Zhongjian; Liu, Xiaoyong; Yao, Qin; Chen, Keping
2012-12-01
Open reading frame 17 (Bm17) gene of Bombyx mori nucleopolyhedrovirus is a highly conserved gene in lepidopteran nucleopolyhedroviruses, but its function remains unknown. In this report, transient-expression and superinfection assays indicated that BM17 localized in the nucleus and cytoplasm of infected BmN cells. To determine the role of Bm17 in baculovirus life cycle, we constructed a Bm17 knockout virus and characterized its properties in cells. Analysis of the production and infection of budded virions, the level of viral DNA replication revealed showed that there was no significant difference among the mutant, the control, and the Bm17 repaired virus strains. These results suggest that BM17 is not essential for virus replication in cultured cells.
Cong, Ling; Wang, Cheng; Chen, Ling; Liu, Huijuan; Yang, Guangxiao; He, Guangyuan
2009-09-23
Dietary micronutrient deficiencies, such as the lack of vitamin A, are a major source of morbidity and mortality worldwide. Carotenoids in food can function as provitamin A in humans, while grains of Chinese elite wheat cultivars generally have low carotenoid contents. To increase the carotenoid contents in common wheat endosperm, transgenic wheat has been generated by expressing the maize y1 gene encoding phytoene synthase driven by a endosperm-specific 1Dx5 promoter in the elite wheat (Triticum aestivum L.) variety EM12, together with the bacterial phytoene desaturase crtI gene from Erwinia uredovora under the constitutive CaMV 35S promoter control. A clear increase of the carotenoid content was detected in the endosperms of transgenic wheat that visually showed a light yellow color. The total carotenoids content was increased up to 10.8-fold as compared with the nontransgenic EM12 cultivar. To test whether the variability of total carotenoid content in different transgenic lines was due to differences in the transgene copy number or expression pattern, Southern hybridization and semiquantitative reverse transcriptase polymerase chain reaction analyses were curried out. The results showed that transgene copy numbers and transcript levels did not associate well with carotenoid contents. The expression patterns of endogenous carotenoid genes, such as the phytoene synthases and carotene desaturases, were also investigated in wild-type and transgenic wheat lines. No significant changes in expression levels of these genes were detected in the transgenic endosperms, indicating that the increase in carotenoid transgenic wheat endosperms resulted from the expression of transgenes.
Tomatidine Is a Lead Antibiotic Molecule That Targets Staphylococcus aureus ATP Synthase Subunit C.
Lamontagne Boulet, Maxime; Isabelle, Charles; Guay, Isabelle; Brouillette, Eric; Langlois, Jean-Philippe; Jacques, Pierre-Étienne; Rodrigue, Sébastien; Brzezinski, Ryszard; Beauregard, Pascale B; Bouarab, Kamal; Boyapelly, Kumaraswamy; Boudreault, Pierre-Luc; Marsault, Éric; Malouin, François
2018-06-01
Methicillin-resistant Staphylococcus aureus (MRSA) is a leading cause of deadly hospital-acquired infections. The discovery of anti- Staphylococcus antibiotics and new classes of drugs not susceptible to the mechanisms of resistance shared among bacteria is imperative. We recently showed that tomatidine (TO), a steroidal alkaloid from solanaceous plants, possesses potent antibacterial activity against S. aureus small-colony variants (SCVs), the notoriously persistent form of this bacterium that has been associated with recurrence of infections. Here, using genomic analysis of in vitro -generated TO-resistant S. aureus strains to identify mutations in genes involved in resistance, we identified the bacterial ATP synthase as the cellular target. Sequence alignments were performed to highlight the modified sequences, and the structural consequences of the mutations were evaluated in structural models. Overexpression of the atpE gene in S. aureus SCVs or introducing the mutation found in the atpE gene of one of the high-level TO-resistant S. aureus mutants into the Bacillus subtilis atpE gene provided resistance to TO and further validated the identity of the cellular target. FC04-100, a TO derivative which also possesses activity against non-SCV strains, prevents high-level resistance development in prototypic strains and limits the level of resistance observed in SCVs. An ATP synthesis assay allowed the observation of a correlation between antibiotic potency and ATP synthase inhibition. The selectivity index (inhibition of ATP production by mitochondria versus that of bacterial ATP synthase) is estimated to be >10 5 -fold for FC04-100. Copyright © 2018 American Society for Microbiology.
Ancient horizontal gene transfer from bacteria enhances biosynthetic capabilities of fungi.
Directory of Open Access Journals (Sweden)
Imke Schmitt
Full Text Available Polyketides are natural products with a wide range of biological functions and pharmaceutical applications. Discovery and utilization of polyketides can be facilitated by understanding the evolutionary processes that gave rise to the biosynthetic machinery and the natural product potential of extant organisms. Gene duplication and subfunctionalization, as well as horizontal gene transfer are proposed mechanisms in the evolution of biosynthetic gene clusters. To explain the amount of homology in some polyketide synthases in unrelated organisms such as bacteria and fungi, interkingdom horizontal gene transfer has been evoked as the most likely evolutionary scenario. However, the origin of the genes and the direction of the transfer remained elusive.We used comparative phylogenetics to infer the ancestor of a group of polyketide synthase genes involved in antibiotic and mycotoxin production. We aligned keto synthase domain sequences of all available fungal 6-methylsalicylic acid (6-MSA-type PKSs and their closest bacterial relatives. To assess the role of symbiotic fungi in the evolution of this gene we generated 24 6-MSA synthase sequence tags from lichen-forming fungi. Our results support an ancient horizontal gene transfer event from an actinobacterial source into ascomycete fungi, followed by gene duplication.Given that actinobacteria are unrivaled producers of biologically active compounds, such as antibiotics, it appears particularly promising to study biosynthetic genes of actinobacterial origin in fungi. The large number of 6-MSA-type PKS sequences found in lichen-forming fungi leads us hypothesize that the evolution of typical lichen compounds, such as orsellinic acid derivatives, was facilitated by the gain of this bacterial polyketide synthase.
Multi-substrate terpene synthases: their occurrence and physiological significance
Directory of Open Access Journals (Sweden)
Leila Pazouki
2016-07-01
Full Text Available Terpene synthases are responsible for synthesis of a large number of terpenes in plants using substrates provided by two distinct metabolic pathways, the mevalonate-dependent pathway that is located in cytosol and has been suggested to be responsible for synthesis of sesquiterpenes (C15, and 2-C-methyl-D-erythritol-4-phosphate pathway located in plastids and suggested to be responsible for the synthesis of hemi- (C5, mono- (C10 and diterpenes (C20. Recent advances in characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have demonstrated existence of a number of multi-substrate terpene synthases. This review summarizes the progress in the characterization of such multi-substrate terpene synthases and suggests that the presence of multi-substrate use might have been significantly underestimated. Multi-substrate use could lead to important changes in terpene product profiles upon substrate profile changes under perturbation of metabolism in stressed plants as well as under certain developmental stages. We therefore argue that multi-substrate use can be significant under physiological conditions and can result in complicate modifications in terpene profiles.
2013-01-01
Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205
Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg
2013-05-16
The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.
Keim, Verónica; Manzano, David; Fernández, Francisco J; Closa, Marta; Andrade, Paola; Caudepón, Daniel; Bortolotti, Cristina; Vega, M Cristina; Arró, Montserrat; Ferrer, Albert
2012-01-01
Arabidopsis thaliana contains two genes encoding farnesyl diphosphate (FPP) synthase (FPS), the prenyl diphoshate synthase that catalyzes the synthesis of FPP from isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). In this study, we provide evidence that the two Arabidopsis short FPS isozymes FPS1S and FPS2 localize to the cytosol. Both enzymes were expressed in E. coli, purified and biochemically characterized. Despite FPS1S and FPS2 share more than 90% amino acid sequence identity, FPS2 was found to be more efficient as a catalyst, more sensitive to the inhibitory effect of NaCl, and more resistant to thermal inactivation than FPS1S. Homology modelling for FPS1S and FPS2 and analysis of the amino acid differences between the two enzymes revealed an increase in surface polarity and a greater capacity to form surface salt bridges of FPS2 compared to FPS1S. These factors most likely account for the enhanced thermostability of FPS2. Expression analysis of FPS::GUS genes in seeds showed that FPS1 and FPS2 display complementary patterns of expression particularly at late stages of seed development, which suggests that Arabidopsis seeds have two spatially segregated sources of FPP. Functional complementation studies of the Arabidopsis fps2 knockout mutant seed phenotypes demonstrated that under normal conditions FPS1S and FPS2 are functionally interchangeable. A putative role for FPS2 in maintaining seed germination capacity under adverse environmental conditions is discussed.
Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing
2009-05-13
One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.
Kanda, Naho; Ichikawa, Machiko; Ono, Ayaka; Toyoda, Atsushi; Fujiyama, Asao; Abe, Jun; Tsuchikane, Yuki; Nishiyama, Tomoaki; Sekimoto, Hiroyuki
2017-12-19
Heterothallic strains of the Closterium peracerosum-strigosum-littorale (C. psl.) complex have two sexes, mating-type plus (mt + ) and mating-type minus (mt - ). Conjugation between these two sexes is regulated by two sex pheromones, protoplast-release-inducing protein (PR-IP) and PR-IP Inducer, which are produced by mt + and mt - cells, respectively. PR-IP mediates the release of protoplasts from mt - cells during mating. In this study, we examined the mechanism of action of CpRLP1 (receptor-like protein 1), which was previously identified in a cDNA microarray analysis as one of the PR-IP-inducible genes. Using CRISPR/Cas9 technology, we generated CpRLP1 knockout mutants in mt - cells of the C. psl. complex. When the knockout mt - cells were mixed with wild-type mt + cells, conjugation was severely reduced. Many cells released protoplasts without pairing, suggesting a loss of synchronization between the two mating partners. Furthermore, the knockout mutants were hypersensitive to PR-IP. We conclude that CpRLP1 is a negative regulator of PR-IP that regulates the timing of protoplast release in conjugating C. psl. cells. As the first report of successful gene knockout in the class Charophyceae, this study provides a basis for research aimed at understanding the ancestral roles of genes that are indispensable for the development of land plants.
Isolation and Characterization of Three New Monoterpene Synthases from Artemisia annua
Ruan, Ju-Xin; Li, Jian-Xu; Fang, Xin; Wang, Ling-Jian; Hu, Wen-Li; Chen, Xiao-Ya; Yang, Chang-Qing
2016-01-01
Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5, and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography–mass spectrometry detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate, salicylic acid, and gibberellin, suggesting a role of these monoterpene synthases in plant–environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant. PMID:27242840
Isolation and characterization of three new monoterpene synthases from Artemisia annua
Directory of Open Access Journals (Sweden)
Ju-Xin eRuan
2016-05-01
Full Text Available Artemisia annua, an annual herb used in traditional Chinese medicine, produces a wealth of monoterpenes and sesquiterpenes, including the well-known sesquiterpene lactone artemisinin, an active ingredient in the treatment for malaria. Here we report three new monoterpene synthases of A. annua. From a glandular trichome cDNA library, monoterpene synthases of AaTPS2, AaTPS5 and AaTPS6, were isolated and characterized. The recombinant proteins of AaTPS5 and AaTPS6 produced multiple products with camphene and 1,8-cineole as major products, respectively, and AaTPS2 produced a single product, β-myrcene. Although both Mg2+ and Mn2+ were able to support their catalytic activities, altered product spectrum was observed in the presence of Mn2+ for AaTPS2 and AaTPS5. Analysis of extracts of aerial tissues and root of A. annua with gas chromatography-mass spectrometry (GC-MS detected more than 20 monoterpenes, of which the three enzymes constituted more than 1/3 of the total. Mechanical wounding induced the expression of all three monoterpene synthase genes, and transcript levels of AaTPS5 and AaTPS6 were also elevated after treatments with phytohormones of methyl jasmonate (MeJA, salicylic acid (SA and gibberellin (GA, suggesting a role of these monoterpene synthases in plant-environment interactions. The three new monoterpene synthases reported here further our understanding of molecular basis of monoterpene biosynthesis and regulation in plant.
Kracht, Octavia Natascha; Ammann, Ann-Christin; Stockmann, Julia; Wibberg, Daniel; Kalinowski, Jörn; Piotrowski, Markus; Kerr, Russell; Brück, Thomas; Kourist, Robert
2017-04-01
Plant terpenoids are a large and highly diverse class of metabolites with an important role in the immune defense. They find wide industrial application as active pharmaceutical ingredients, aroma and fragrance compounds. Several Eremophila sp. derived terpenoids have been documented. To elucidate the terpenoid metabolism, the transcriptome of juvenile and mature Eremophila serrulata (A.DC.) Druce (Scrophulariaceae) leaves was sequenced and a transcript library was generated. We report on the first transcriptomic dataset of an Eremophila plant. IlluminaMiSeq sequencing (2 × 300 bp) revealed 7,093,266 paired reads, which could be assembled to 34,505 isogroups. To enable detection of terpene biosynthetic genes, leaves were separately treated with methyl jasmonate, a well-documented inducer of plant secondary metabolites. In total, 21 putative terpene synthase genes were detected in the transcriptome data. Two terpene synthase isoenzymatic genes, termed ES01 and ES02, were successfully expressed in E. coli. The resulting proteins catalyzed the conversion of geranyl pyrophosphate, the universal substrate of monoterpene synthases to myrcene and Z-(b)-ocimene, respectively. The transcriptomic data and the discovery of the first terpene synthases from Eremophila serrulata are the initial step for the understanding of the terpene metabolism in this medicinally important plant genus. Copyright © 2017 Elsevier Ltd. All rights reserved.
SAITO, Mikako; KANEDA, Asako; SUGIYAMA, Tae; IIDA, Ryousuke; OTOKUNI, Keiko; KABURAGI, Misako; MATSUOKA, Hideaki
2015-01-01
Exon II of glucokinase (Gk) was deleted to produce a systemic heterozygous Gk knockout (Gk+/−) mouse. The relative expression levels of Gk in the heart, lung, liver, stomach, and pancreas in Gk+/− mice ranged from 0.41–0.68 versus that in wild (Gk+/+) mice. On the other hand, its expression levels in the brain, adipose tissue, and muscle ranged from 0.95–1.03, and its expression levels in the spleen and kidney were nearly zero. Gk knockout caused no remarkable off-target effect on the expression of 7 diabetes causing genes (Shp, Hnf1a, Hnf1b, Irs1, Irs2, Kir6.2, and Pdx1) in 10 organs. The glucose tolerance test was conducted to determine the blood glucose concentrations just after fasting for 24 h (FBG) and at 2 h after high-glucose application (GTT2h). The FBG-GTT2h plots obtained with the wild strain fed the control diet (CD), Gk+/− strain fed the CD, and Gk+/− strain fed the HFD were distributed in separate areas in the FBG-GTT2h diagram. The respective areas could be defined as the normal state, prediabetes state, and diabetes state, respectively. Based on the results, the criteria for prediabetes could be defined for the Gk+/− strain developed in this study. PMID:25765873
Directory of Open Access Journals (Sweden)
Lutsyk A. D.
2012-04-01
Full Text Available Aim. To investigate the influence of pituitary tumor transforming gene (pttg-1 knockout on glycome of parenchimal organs by means of lectin histochemistry. Methods. DGalNAc, DGlcNAc, NeuNAc carbohydrate determinants were labelled with soybean agglutinin (SBA and wheat germ agglutinin (WGA, conjugated to peroxidase, with subsequent visualization of the lectin-binding sites with diaminobenzidine. The testes and kidneys of murine strain BL6/C57 with the pttg-1 gene knockout (PTTG-KO were compared to the wild type (PTTG-WT animals, both groups 1 month of age. Results. Knockout of the pttg-1 gene was accompanied by enhanced exposure of the DGalNAc sugar residues within the Golgi complex of secondary spermatocytes, in a brush border of renal tubules and on the lumenal surface of collecting ducts. Conclusions. This study suggests that knockout of the pttg-1 gene may lead to the changes in carbohydrate processing in mammalian organism.
Russo, Carlo
2015-01-01
If you are a JavaScript developer and already know the basics of KnockoutJS and you want to get the most out of it, then this book is for you. This book will help in your transition from a small site to a large web application that is easily maintainable.
Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook
2008-01-01
FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402
Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina
2002-11-01
In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.
Directory of Open Access Journals (Sweden)
Ingkasuwan Papapit
2012-08-01
Full Text Available Abstract Background Starch serves as a temporal storage of carbohydrates in plant leaves during day/night cycles. To study transcriptional regulatory modules of this dynamic metabolic process, we conducted gene regulation network analysis based on small-sample inference of graphical Gaussian model (GGM. Results Time-series significant analysis was applied for Arabidopsis leaf transcriptome data to obtain a set of genes that are highly regulated under a diurnal cycle. A total of 1,480 diurnally regulated genes included 21 starch metabolic enzymes, 6 clock-associated genes, and 106 transcription factors (TF. A starch-clock-TF gene regulation network comprising 117 nodes and 266 edges was constructed by GGM from these 133 significant genes that are potentially related to the diurnal control of starch metabolism. From this network, we found that β-amylase 3 (b-amy3: At4g17090, which participates in starch degradation in chloroplast, is the most frequently connected gene (a hub gene. The robustness of gene-to-gene regulatory network was further analyzed by TF binding site prediction and by evaluating global co-expression of TFs and target starch metabolic enzymes. As a result, two TFs, indeterminate domain 5 (AtIDD5: At2g02070 and constans-like (COL: At2g21320, were identified as positive regulators of starch synthase 4 (SS4: At4g18240. The inference model of AtIDD5-dependent positive regulation of SS4 gene expression was experimentally supported by decreased SS4 mRNA accumulation in Atidd5 mutant plants during the light period of both short and long day conditions. COL was also shown to positively control SS4 mRNA accumulation. Furthermore, the knockout of AtIDD5 and COL led to deformation of chloroplast and its contained starch granules. This deformity also affected the number of starch granules per chloroplast, which increased significantly in both knockout mutant lines. Conclusions In this study, we utilized a systematic approach of microarray
L-arginine prevents xanthoma development and inhibits atherosclerosis in LDL receptor knockout mice.
Aji, W; Ravalli, S; Szabolcs, M; Jiang, X C; Sciacca, R R; Michler, R E; Cannon, P J
1997-01-21
The potential antiatherosclerotic actions of NO were investigated in four groups of mice (n = 10 per group) lacking functional LDL receptor genes, an animal model of familial hypercholesterolemia. Group 1 was fed a regular chow diet. Groups 2 through 4 were fed a 1.25% high-cholesterol diet. In addition, group 3 received supplemental L-arginine and group 4 received L-arginine and N omega-nitro-L-arginine (L-NA), an inhibitor of NO synthase (NOS). Animals were killed at 6 months; aortas were stained with oil red O for planimetry and with antibodies against constitutive and inducible NOSs. Plasma cholesterol was markedly increased in the animals receiving the high-cholesterol diet. Xanthomas appeared in all mice fed the high-cholesterol diet alone but not in those receiving L-arginine. Aortic atherosclerosis was present in all mice on the high-cholesterol diet. The mean atherosclerotic lesion area was reduced significantly (P < .01) in the cholesterol-fed mice given L-arginine compared with those receiving the high-cholesterol diet alone. The mean atherosclerotic lesion area was significantly larger (P < .01) in cholesterol-fed mice receiving L-arginine + L-NA than in those on the high-cholesterol diet alone. Within the atherosclerotic plaques, endothelial cells immunoreacted for endothelial cell NOS; macrophages, foam cells, and smooth muscle cells immunostained strongly for inducible NOS and nitrotyrosine residues. The data indicate that L-arginine prevents xanthoma formation and reduces atherosclerosis in LDL receptor knockout mice fed a high-cholesterol diet. The abrogation of the beneficial effects of L-arginine by L-NA suggests that the antiatherosclerotic actions of L-arginine are mediated by NOS. The data suggest that L-arginine may be beneficial in familial hypercholesterolemia.
Directory of Open Access Journals (Sweden)
Ikuro eAbe
2012-03-01
Full Text Available Benzalacetone synthase, from the medicinal plant Rheum palmatum (Polygonaceae (RpBAS, is a plant-specific chalcone synthase (CHS superfamily of type III polyketide synthase (PKS. RpBAS catalyzes the one-step, decarboxylative condensation of 4-coumaroyl-CoA with malonyl-CoA to produce the C6-C4 benzalacetone scaffold. The X-ray crystal structures of RpBAS confirmed that the diketide-forming activity is attributable to the characteristic substitution of the conserved active-site "gatekeeper" Phe with Leu. Furthermore, the crystal structures suggested that RpBAS employs novel catalytic machinery for the thioester bond cleavage of the enzyme-bound diketide intermediate and the final decarboxylation reaction to produce benzalacetone. Finally, by exploiting the remarkable substrate tolerance and catalytic versatility of RpBAS, precursor-directed biosynthesis efficiently generated chemically and structurally divergent, unnatural novel polyketide scaffolds. These findings provided a structural basis for the functional diversity of the type III PKS enzymes.
Chee, Marcus Jenn Yang; Lycett, Grantley W; Khoo, Teng-Jin; Chin, Chiew Foan
2017-01-01
Production of vanillin by bioengineering has gained popularity due to consumer demand toward vanillin produced by biological systems. Natural vanillin from vanilla beans is very expensive to produce compared to its synthetic counterpart. Current bioengineering works mainly involve microbial biotechnology. Therefore, alternative means to the current approaches are constantly being explored. This work describes the use of vanillin synthase (VpVAN), to bioconvert ferulic acid to vanillin in a plant system. The VpVAN enzyme had been shown to directly convert ferulic acid and its glucoside into vanillin and its glucoside, respectively. As the ferulic acid precursor and vanillin were found to be the intermediates in the phenylpropanoid biosynthetic pathway of Capsicum species, this work serves as a proof-of-concept for vanillin production using Capsicum frutescens (C. frutescens or hot chili pepper). The cells of C. frutescens were genetically transformed with a codon optimized VpVAN gene via biolistics. Transformed explants were selected and regenerated into callus. Successful integration of the gene cassette into the plant genome was confirmed by polymerase chain reaction. High-performance liquid chromatography was used to quantify the phenolic compounds detected in the callus tissues. The vanillin content of transformed calli was 0.057% compared to 0.0003% in untransformed calli.
Bohus, B; de Wied, David; Urban, I.J.A.; Burbach, J.P.H.; De Wied, D.
1999-01-01
Behavioral neuroscience is using mon and more gene knockout techniques to produce animals with a specific deletion. These studies have their precedent in nature. A mutation may result in a limited genetic defect, as seen in the vasopressin (VP) deficiency in the Brattleboro rat. The mutation is in a
Energy Technology Data Exchange (ETDEWEB)
Richard L. Blanton
2004-02-19
OAK-B135 The major accomplishments of this project were: (1) the initial characterization of dcsA, the gene for the putative catalytic subunit of cellulose synthase in the cellular slime mold Dictyostelium discoideum; (2) the detection of a developmentally regulated event (unidentified, but perhaps a protein modification or association with a protein partner) that is required for cellulose synthase activity (i.e., the dcsA product is necessary, but not sufficient for cellulose synthesis); (3) the continued exploration of the developmental context of cellulose synthesis and DcsA; (4) the isolation of a GFP-DcsA-expressing strain (work in progress); and (5) the identification of Dictyostelium homologues for plant genes whose products play roles in cellulose biosynthesis. Although our progress was slow and many of our results negative, we did develop a number of promising avenues of investigation that can serve as the foundation for future projects.
Sauge-Merle, Sandrine; Cuiné, Stéphan; Carrier, Patrick; Lecomte-Pradines, Catherine; Luu, Doan-Trung; Peltier, Gilles
2003-01-01
Phytochelatins (PCs) are metal-binding cysteine-rich peptides, enzymatically synthesized in plants and yeasts from glutathione in response to heavy metal stress by PC synthase (EC 2.3.2.15). In an attempt to increase the ability of bacterial cells to accumulate heavy metals, the Arabidopsis thaliana gene encoding PC synthase (AtPCS) was expressed in Escherichia coli. A marked accumulation of PCs was observed in vivo together with a decrease in the glutathione cellular content. When bacterial cells expressing AtPCS were placed in the presence of heavy metals such as cadmium or the metalloid arsenic, cellular metal contents were increased 20- and 50-fold, respectively. We discuss the possibility of using genes of the PC biosynthetic pathway to design bacterial strains or higher plants with increased abilities to accumulate toxic metals, and also arsenic, for use in bioremediation and/or phytoremediation processes. PMID:12514032
Generation of beta-lactoglobulin knock-out goats using CRISPR/Cas9.
Directory of Open Access Journals (Sweden)
Wenjun Zhou
Full Text Available Goat's milk, considered a substitute for cow's milk, has a high nutritional value. However, goat's milk contains various allergens, predominantly β-lactoglobulin (BLG. In this study, we employed the CRISPR/Cas9 system to target the BLG locus in goat fibroblasts for sgRNA optimization and generate BLG knock-out goats through co-injection of Cas9 mRNA and small guide RNAs (sgRNAs into goat embryos at the one-cell stage. We firstly tested sgRNA editing efficiencies in goat fibroblast cells, and approximately 8.00%-9.09% of the cells were modified in single sgRNA-guided targeting experiment. Among the kids, the genome-targeting efficiencies of single sgRNA were 12.5% (10 ng/μL sg1 and 0% (10 ng/μL sg2 and efficiencies of dual sgRNAs were 25.0% (25 ng/μL sg2+sg3 group and 28.6% (50 ng/μL sg2+sg3 group. Relative expression of BLG in BLG knock-out goat mammary glands significantly (p < 0.01 decreased as well as other milk protein coding genes, such as CSN1S1, CSN1S2, CSN2, CSN3 and LALBA (p < 0.05. As expected, BLG protein had been abolished in the milk of the BLG knock-out goat. In addition, most of the targeted kids were chimeric (3/4, and their various body tissues were edited simultaneously. Our study thus provides a basis for optimizing the quality of goat milk, which can be applied to biomedical and agricultural research.
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1999-01-01
Four cDNAs encoding phosphoribosyl diphosphate (PRPP) synthase were isolated from a spinach (Spinacia oleracea) cDNA library by complementation of an Escherichia coli Δprs mutation. The four gene products produced PRPP in vitro from ATP and ribose-5-phosphate. Two of the enzymes (isozymes 1 and 2...
International Nuclear Information System (INIS)
Páez, David; Salazar, Juliana; Paré, Laia; Pertriz, Lourdes; Targarona, Eduardo; Rio, Elisabeth del; Barnadas, Agusti; Marcuello, Eugenio; Baiget, Montserrat
2011-01-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5′UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The ∗3/∗3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in ∗3/∗3 vs. 35% in ∗2/∗2 and ∗2/∗3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the ∗3/∗3 patients and 84 months for the ∗2/∗2 and ∗2/∗3 patients (p = .039). For XRCC1 Arg399Gln SNP, the median progression-free survival was 101 months for the G/G, 78 months for the G/A, and 31 months for the A/A patients (p = .048). Conclusions: The thymidylate
Energy Technology Data Exchange (ETDEWEB)
Paez, David, E-mail: dpaez@santpau.cat [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Salazar, Juliana; Pare, Laia [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Pertriz, Lourdes [Department of Radiotherapy, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Targarona, Eduardo [Department of Surgery, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Rio, Elisabeth del [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Barnadas, Agusti; Marcuello, Eugenio [Department of Medical Oncology, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain); Baiget, Montserrat [Centre for Biomedical Network Research on Rare Diseases, Barcelona (Spain); Department of Genetics, Hospital de la Santa Creu i Sant Pau, Universitat Autonoma de Barcelona, Barcelona (Spain)
2011-12-01
Purpose: Several studies have been performed to evaluate the usefulness of neoadjuvant treatment using oxaliplatin and fluoropyrimidines for locally advanced rectal cancer. However, preoperative biomarkers of outcome are lacking. We studied the polymorphisms in thymidylate synthase, epidermal growth factor receptor, glutathione S-transferase pi 1 (GSTP1), and several DNA repair genes to evaluate their usefulness as pharmacogenetic markers in a cohort of 128 rectal cancer patients treated with preoperative chemoradiotherapy. Methods and Materials: Blood samples were obtained from 128 patients with Stage II-III rectal cancer. DNA was extracted from the peripheral blood nucleated cells, and the genotypes were analyzed by polymerase chain reaction amplification and automated sequencing techniques or using a 48.48 dynamic array on the BioMark system. The germline polymorphisms studied were thymidylate synthase, (VNTR/5 Prime UTR, 2R G>C single nucleotide polymorphism [SNP], 3R G>C SNP), epidermal growth factor receptor (Arg497Lys), GSTP1 (Ile105val), excision repair cross-complementing 1 (Asn118Asn, 8092C>A, 19716G>C), X-ray repair cross-complementing group 1 (XRCC1) (Arg194Trp, Arg280His, Arg399Gln), and xeroderma pigmentosum group D (Lys751Gln). The pathologic response, pathologic regression, progression-free survival, and overall survival were evaluated according to each genotype. Results: The Asterisk-Operator 3/ Asterisk-Operator 3 thymidylate synthase genotype was associated with a greater response rate (pathologic complete remission and microfoci residual tumor, 59% in Asterisk-Operator 3/ Asterisk-Operator 3 vs. 35% in Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk-Operator 3; p = .013). For the thymidylate synthase genotype, the median progression-free survival was 103 months for the Asterisk-Operator 3/ Asterisk-Operator 3 patients and 84 months for the Asterisk-Operator 2/ Asterisk-Operator 2 and Asterisk-Operator 2/ Asterisk
Farrar, John
2015-01-01
This book is for web developers and designers who work with HTML and JavaScript to help them manage data and interactivity with data using KnockoutJS. Knowledge about jQuery will be useful but is not necessary.
International Nuclear Information System (INIS)
Mason, M.M.; Morris, J.S.; Derenzy, B.A.; Spate, V.L.; Horsman, T.L.; Baskett, C.K.; Nichols, T.A.; Colbert, J.W.; Clarke, L.L.; Gawenis, L.R.; Hillman, L.S.
1998-01-01
A genetically engineered 'knockout gene' mouse model for human cystic fibrosis (CF) has been utilized to study bone mineralization. In CF, the so-called cystic fibrosis transmembrane conductance regulator (CFTR) protein, a chloride ion channel, is either absent or defective. To produce the animal model the murine CFTR gene has been inactivated producing CF symptoms in the homozygotic progeny. CF results in abnormal intestinal absorption of minerals and nutrients which presumably results in substandard bone mineralization. The objective of this study was to determine the feasibility of using whole-body thermal and fast neutron activation analysis to determine mineral and trace-element differences between homozygote controls (+/+) and CF (-/-), murine siblings. Gender-matched juvenile +/+ and -/- litter mates were lyophilized and placed in a BN capsule to reduce thermal-neutron activation and irradiated for 10 seconds at φ fast ∼ 1 x 10 13 n x cm -2 x s -1 using the MURR pneumatic-tube facility. Phosphorus was measured via the 31 P 15 (n,α) 28 Al 13 reaction. After several days decay, the whole-body specimens were re-irradiated in the same facility, but without thermal-neutron shielding, for 5 seconds and the gamma-ray spectrum was recorded at two different decay periods allowing measurement of 77m Se, 24 Na, 27m g, 38 Cl, 42k , 49 Ca, 56 Mn, 66 Cu and 80 Br from the corresponding radiative-capture reactions. (author)
Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby
2013-09-06
Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular
Theoretical analysis of knock-out release of fission products from nuclear fuels
International Nuclear Information System (INIS)
Yamagishi, S.
1975-01-01
The knock-out release of fission products is studied theoretically. The general equations of knock-out release are derived, assuming that a fission fragment passing through the surface of nuclear fuels knocks out a local region of the surface with an effective thickness and an effective cross-sectional area. Using these equations, the knock-out release of fission gases is calculated for various cases. The conditions under which the knock-out coefficients (the average number of uranium atoms knocked out by one fission fragment) is obtainable are clarified by experiments on the knock-out release of fission gases. A method of determining the effective thickness and the effective cross-sectional area of a knock-out region is proposed. (Auth.)
One-neutron knockout from Ne24-28 isotopes
Rodriguez-Tajes, C; Caamano, M; Faestermann, T; Cortina-Gil, D; Zhukov, M; Simon, H; Nilsson, T; Borge, M J G; Alvarez-Pol, H; Winkler, M; Prochazka, A; Nociforo, C; Weick, H; Kanungo, R; Perez-Loureiro, D; Kurtukian, T; Suemmerer, K; Eppinger, K; Perea, A; Chatillon, A; Maierbeck, P; Benlliure, J; Pascual-Izarra, C; Gernhaeuser, R; Geissel, H; Aumann, T; Kruecken, R; Larsson, K; Tengblad, O; Benjamim, E; Jonson, B; Casarejos, E
2010-01-01
One-neutron knockout reactions of Ne24-28 in a beryllium target have been studied in the Fragment Separator (FRS), at GSI. The results include inclusive one-neutron knockout cross-sections as well as longitudinal-momentum distributions of the knockout fragments. The ground-state structure of the neutron-rich neon isotopes was obtained from an analysis of the measured momentum distributions. The results indicate that the two heaviest isotopes, Ne-27 and Ne-28, are dominated by a configuration in which a s(1/2) neutron is coupled to an excited state of the Ne-26 and Ne-27 core, respectively. (C) 2010 Elsevier B.V. All rights reserved.
Krill, Christian; Barrow, Russell A.; Chen, Shasha; Trengove, Robert; Oliver, Richard P.; Solomon, Peter S.
2014-01-01
Parastagonospora nodorum is a pathogen of wheat that affects yields globally. Previous transcriptional analysis identified a partially reducing polyketide synthase (PR-PKS) gene, SNOG_00477 (SN477), in P. nodorum that is highly upregulated during infection of wheat leaves. Disruption of the corresponding SN477 gene resulted in the loss of production of two compounds, which we identified as (R)-mellein and (R)-O-methylmellein. Using a Saccharomyces cerevisiae yeast heterologous expression system, we successfully demonstrated that SN477 is the only enzyme required for the production of (R)-mellein. This is the first identification of a fungal PKS that is responsible for the synthesis of (R)-mellein. The P. nodorum ΔSN477 mutant did not show any significant difference from the wild-type strain in its virulence against wheat. However, (R)-mellein at 200 μg/ml inhibited the germination of wheat (Triticum aestivum) and barrel medic (Medicago truncatula) seeds. Comparative sequence analysis identified the presence of mellein synthase (MLNS) homologues in several Dothideomycetes and two sodariomycete genera. Phylogenetic analysis suggests that the MLNSs in fungi and bacteria evolved convergently from fungal and bacterial 6-methylsalicylic acid synthases. PMID:25326302
International Nuclear Information System (INIS)
Jager, K. de
2003-01-01
Proton knock-out is studied in a broad program in Hall A at Jefferson Lab. The first experiment performed in Hall A studied the 16 O(e,e'p) reaction. Since then proton knock-out experiments have studied a variety of aspects of that reaction, from single-nucleon properties to its mechanism, such as final-state interactions and two-body currents, in nuclei from 2 H to 16 O. In this review the accomplishments of this program will be summarized and an outlook given of expected future results. (orig.)
Diner, Benjamin A; Lum, Krystal K; Toettcher, Jared E; Cristea, Ileana M
2016-11-15
The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS). Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV) infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses. How mammalian cells detect and respond to DNA viruses that replicate in the nucleus is poorly understood. Here, we decipher the distinct functions of two viral DNA sensors, IFI16 and cGAS, during active immune signaling upon infection with two herpesviruses, herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV). We show that IFI16
Effect of Duplicate Genes on Mouse Genetic Robustness: An Update
Directory of Open Access Journals (Sweden)
Zhixi Su
2014-01-01
Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.
International Nuclear Information System (INIS)
Sakamoto, Hideaki; Yoshida, Tetsuya; Sanaki, Takao; Shigaki, Shuhei; Morita, Hirotoshi; Oyama, Miki; Mitsui, Masaru; Tanaka, Yoshikazu; Nakano, Toru; Mitsutake, Susumu; Igarashi, Yasuyuki; Takemoto, Hiroshi
2017-01-01
To evaluate the precise role of sphingomyelin synthase 2 (SMS2) in sphingomyelin (SM) metabolism and their anti-inflammatory properties, we analyzed species of major SM and ceramide (Cer) (18:1, 18:0 sphingoid backbone, C14 - C26 N-acyl part) in SMS2 knockout and wild-type mouse plasma and liver using HPLC-MS. SMS2 deficiency significantly decreased very long chain SM (SM (d18:1/22:0) and SM (d18:1/24:0 or d18:0/24:1)) and increased very long chain Cer (Cer (d18:1/24:0 or d18:0/24:1) and Cer (d18:1/24:1)), but not long chain SM (SM (d18:1/16:0), SM (d18:1/18:0 or d18:0/18:1) and SM (d18:1/18:1)) in plasma. To examine the effects of SM on inflammation, we studied the role of very long chain SM in macrophage activation. Addition of SM (d18:1/24:0) strongly upregulated several macrophage activation markers, SM (d18:1/6:0) and Cer (d18:1/24:0) however, did not. It was suggested that very long chain SM but not long chain SM were decreased in SMS2-deficient mice liver and plasma. And the exogenously added very long chain SM (d18:1/24:0) could activate macrophages directly, suggesting a novel role of plasma very long chain SM in modulating macrophage activation and resulting inflammation. - Highlights: • Very long-chain SM species were decreased in SMS2 knockout mouse plasma and liver. • Very long-chain ceramide species were increased in SMS2 knockout mouse plasma. • SMS2 deficiency diminished the inflammatory response of macrophages. • Very long-chain SM enhanced ICAM1 and iNOS expression in peritoneal macrophages.
A Knockout Experiment: Disciplinary Divides and Experimental Skill in Animal Behaviour Genetics.
Nelson, Nicole C
2015-07-01
In the early 1990s, a set of new techniques for manipulating mouse DNA allowed researchers to 'knock out' specific genes and observe the effects of removing them on a live mouse. In animal behaviour genetics, questions about how to deploy these techniques to study the molecular basis of behaviour became quite controversial, with a number of key methodological issues dissecting the interdisciplinary research field along disciplinary lines. This paper examines debates that took place during the 1990s between a predominately North American group of molecular biologists and animal behaviourists around how to design, conduct, and interpret behavioural knockout experiments. Drawing from and extending Harry Collins's work on how research communities negotiate what counts as a 'well-done experiment,' I argue that the positions practitioners took on questions of experimental skill reflected not only the experimental traditions they were trained in but also their differing ontological and epistemological commitments. Different assumptions about the nature of gene action, eg., were tied to different positions in the knockout mouse debates on how to implement experimental controls. I conclude by showing that examining representations of skill in the context of a community's knowledge commitments sheds light on some of the contradictory ways in which contemporary animal behaviour geneticists talk about their own laboratory work as a highly skilled endeavour that also could be mechanised, as easy to perform and yet difficult to perform well.
Directory of Open Access Journals (Sweden)
Mu eLi
2016-02-01
Full Text Available Chitin synthases (CHSs are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene
Lunkenbein, S.; Coiner, H.; Vos, de C.H.; Schaart, J.G.; Boone, M.J.; Krens, F.A.; Schwab, W.; Salentijn, E.M.J.
2006-01-01
An octaploid (Fragaria × ananassa cv. Calypso) genotype of strawberry was transformed with an antisense chalcone synthase (CHS) gene construct using a ripening related CHS cDNA from Fragaria × ananassa cv. Elsanta under the control of the constitutive CaMV 35S promoter via Agrobacterium tumefaciens.
Zhu, J J; Luo, J; Sun, Y T; Shi, H B; Li, J; Wu, M; Yu, K; Haile, A B; Loor, J J
2015-05-01
The role of fatty acid synthase (FASN) on de novo fatty acid synthesis has been well established. In monogastrics, unlike acetyl-coenzyme A carboxylase, FASN is primarily controlled at the transcriptional level. However, no data exist on ruminant mammary cells evaluating effects of FASN knockdown on mRNA expression of lipogenic genes. Inhibition of FASN in mammary cells by C75-mediated interference, a synthetic inhibitor of FASN activity, and short hairpin RNA-mediated interference markedly reduced cellular triglyceride content at least in part by decreasing the expression of genes related to triglyceride synthesis (GPAT, AGPAT6, and DGAT2) and enhancing the expression of lipolysis-related genes (ATGL and HSL). Consistent with the markedly lower expression of genes related to lipid droplet formation and secretion (TIP47, ADFP, BTN1A1, and XDH), cellular lipid droplets also were reduced sharply after incubation with C75 or adenovirus-short-hairpin-RNA. The results underscored the essential role of FASN in the overall process of milk-fat formation in goat mammary epithelial cells. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Zhong, Weiqiang; Zhou, Tian-Biao; Jiang, Zongpei
2015-04-01
Association between endothelial nitric oxide synthase (eNOS) gene polymorphism and Henoch-Schönlein purpura (HSP)/Henoch-Schönlein purpura nephritis (HSPN) risk is still controversial. A meta-analysis was performed to evaluate the association between eNOS gene polymorphism and HSP/HSPN susceptibility. A predefined literature search and selection of eligible relevant studies were performed to collect data from electronic database. Three articles were identified for the analysis of association between eNOS gene polymorphism and HSPN/HSP risk. eNOS G894T gene polymorphism was not associated with HSPN susceptibility and the risk of patients with HSP developing into HSPN. Interestingly, eNOS G894T T allele and GG genotype were associated with HSP susceptibility, but not the TT genotype. eNOS T786C TT genotype was associated with HSPN susceptibility, but not C allele and CC genotype. Furthermore, eNOS T786C gene polymorphism was not associated with HSP risk and the risk of patients with HSP developing into HSPN. In conclusion, eNOS T786C TT genotype was associated with and eNOS G894T T allele and GG genotype were associated with HSP susceptibility. However, more studies should be performed in the future.
Directory of Open Access Journals (Sweden)
Anne K. Braczynski
2015-01-01
Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.
Directory of Open Access Journals (Sweden)
Deqiang Tai
Full Text Available Chalcone synthase is a key and often rate-limiting enzyme in the biosynthesis of anthocyanin pigments that accumulate in plant organs such as flowers and fruits, but the relationship between CHS expression and the petal coloration level in different cultivars is still unclear. In this study, three typical crabapple cultivars were chosen based on different petal colors and coloration patterns. The two extreme color cultivars, 'Royalty' and 'Flame', have dark red and white petals respectively, while the intermediate cultivar 'Radiant' has pink petals. We detected the flavoniods accumulation and the expression levels of McCHS during petals expansion process in different cultivars. The results showed McCHS have their special expression patterns in each tested cultivars, and is responsible for the red coloration and color variation in crabapple petals, especially for color fade process in 'Radiant'. Furthermore, tobacco plants constitutively expressing McCHS displayed a higher anthocyanins accumulation and a deeper red petal color compared with control untransformed lines. Moreover, the expression levels of several anthocyanin biosynthetic genes were higher in the transgenic McCHS overexpressing tobacco lines than in the control plants. A close relationship was observed between the expression of McCHS and the transcription factors McMYB4 and McMYB5 during petals development in different crabapple cultivars, suggesting that the expression of McCHS was regulated by these transcription factors. We conclude that the endogenous McCHS gene is a critical factor in the regulation of anthocyanin biosynthesis during petal coloration in Malus crabapple.
Dubey, Amit; Biswas, Sanjay Kumar; Sinha, Ekata; Chakma, Joy Kumar; Kamal, Raj; Arora, Mamta; Sagar, Harish; Natarajan, Mohan; Bhagyawant, Sameer S; Mohanty, Keshar Kunja
2017-07-01
The pathogen Mycobacterium leprae causes leprosy that affects mainly skin and nerves. Polymorphisms of certain genes are substantiated to be associated with the susceptibility/resistance to leprosy. The present investigation addressed the association of Nitric Oxide Synthase2 gene polymorphisms and leprosy in a population from northern part of India. A total of 323 leprosy cases and 288 healthy controls were genotyped for four NOS2 promoter variants (rs1800482, rs2779249, rs8078340 and rs2301369) using FRET technology in Real Time PCR. None of these SNPs in promoter sites was associated with susceptibility/resistance to leprosy. NOS2 rs1800482 was found to be monomorphic with GG genotype. However, NOS2-1026T allele was observed to be in higher frequency with leprosy cases (BL and LL) who were not suffering from any reactional episodes compared to cases with ENL reaction {OR=0.30, 95% CI (0.10-0.86), p=0.024}. NOS2-1026GT genotype was more prevalent in cases without reaction (BT, BB and BL) compared to RR reactional patients {OR=0.38, 95% CI (0.17-0.86), p=0.02}. Although haplotype analysis revealed that no haplotype was associated with leprosy susceptibility/resistance with statistical significance, GTG haplotype was noted to be more frequent in healthy controls. These SNPs are observed to be in linkage disequilibrium. Although, these SNPs are not likely to influence leprosy vulnerability, -1026G>T SNP was indicated to have noteworthy role in leprosy reactions. Copyright © 2017 Elsevier B.V. All rights reserved.
Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C
2015-07-28
Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.
Systematic screening for skin, hair, and nail abnormalities in a large-scale knockout mouse program.
Directory of Open Access Journals (Sweden)
John P Sundberg
Full Text Available The International Knockout Mouse Consortium was formed in 2007 to inactivate ("knockout" all protein-coding genes in the mouse genome in embryonic stem cells. Production and characterization of these mice, now underway, has generated and phenotyped 3,100 strains with knockout alleles. Skin and adnexa diseases are best defined at the gross clinical level and by histopathology. Representative retired breeders had skin collected from the back, abdomen, eyelids, muzzle, ears, tail, and lower limbs including the nails. To date, 169 novel mutant lines were reviewed and of these, only one was found to have a relatively minor sebaceous gland abnormality associated with follicular dystrophy. The B6N(Cg-Far2tm2b(KOMPWtsi/2J strain, had lesions affecting sebaceous glands with what appeared to be a secondary follicular dystrophy. A second line, B6N(Cg-Ppp1r9btm1.1(KOMPVlcg/J, had follicular dystrophy limited to many but not all mystacial vibrissae in heterozygous but not homozygous mutant mice, suggesting that this was a nonspecific background lesion. We discuss potential reasons for the low frequency of skin and adnexal phenotypes in mice from this project in comparison to those seen in human Mendelian diseases, and suggest alternative approaches to identification of human disease-relevant models.
International Nuclear Information System (INIS)
Christie, J.M.; Jenkins, G.I.
1996-01-01
UV and blue light control the expression of flavonoid biosynthesis genes in a range of higher plants. To investigate the signal transduction processes involved in the induction of chalcone synthase (CHS) gene expression by UV-B and UV-A/blue light, we examined the, effects of specific agonists and inhibitors of known signaling components in mammalian systems in a photomixotrophic Arabidopsis cell suspension culture. CHS expression is induced specifically by these wavelengths in the cell culture, in a manner similar to that in mature Arabidopsis leaf tissue. Both the UV-B and UV-A/blue phototransduction processes involve calcium, although the elevation of cytosolic calcium is insufficient on its own to stimulate CHS expression. The UV-A/blue light induction of CHS expression does not appear to involve calmodulin, whereas the UV-B response does; this difference indicates that the signal transduction pathways are, at least in part, distinct. We provide evidence that both pathways involve reversible protein phosphorylation and require protein synthesis. The UV-B and UV-A/blue light signaling pathways are therefore different from the phytochrome signal transduction pathway regulating CHS expression in other species
Kudo, Fumitaka; Matsuura, Yasunori; Hayashi, Takaaki; Fukushima, Masayuki; Eguchi, Tadashi
2016-07-01
Sordarin is a glycoside antibiotic with a unique tetracyclic diterpene aglycone structure called sordaricin. To understand its intriguing biosynthetic pathway that may include a Diels-Alder-type [4+2]cycloaddition, genome mining of the gene cluster from the draft genome sequence of the producer strain, Sordaria araneosa Cain ATCC 36386, was carried out. A contiguous 67 kb gene cluster consisting of 20 open reading frames encoding a putative diterpene cyclase, a glycosyltransferase, a type I polyketide synthase, and six cytochrome P450 monooxygenases were identified. In vitro enzymatic analysis of the putative diterpene cyclase SdnA showed that it catalyzes the transformation of geranylgeranyl diphosphate to cycloaraneosene, a known biosynthetic intermediate of sordarin. Furthermore, a putative glycosyltransferase SdnJ was found to catalyze the glycosylation of sordaricin in the presence of GDP-6-deoxy-d-altrose to give 4'-O-demethylsordarin. These results suggest that the identified sdn gene cluster is responsible for the biosynthesis of sordarin. Based on the isolated potential biosynthetic intermediates and bioinformatics analysis, a plausible biosynthetic pathway for sordarin is proposed.
Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru
2012-11-01
5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.
Methionine synthase A2756G and reduced folate carrier1 A80G ...
African Journals Online (AJOL)
Background: Polymorphisms of genes encoding enzymes involved in folate metabolism have long been hypothesized to be maternal risk factors for Down syndrome, however, results are conflicting and inconclusive. Aim of the study: To analyze the effect of methionine synthase (MTR) A2756G, and reduced folate carrier ...
Welle, Stephen; Cardillo, Andrew; Zanche, Michelle; Tawil, Rabi
2009-01-01
There is much interest in developing anti-myostatin agents to reverse or prevent muscle atrophy in adults, so it is important to characterize the effects of reducing myostatin activity after normal muscle development. For assessment of the effect of loss of myostatin signaling on gene expression in muscle, RNA from mice with postdevelopmental myostatin knockout was analyzed with oligonucleotide microarrays. Myostatin was undetectable in muscle within 2 wk after Cre recombinase activation in 4...
Directory of Open Access Journals (Sweden)
Raúl González
2015-08-01
Full Text Available Hepatocellular carcinoma develops in cirrhotic liver. The nitric oxide (NO synthase type III (NOS-3 overexpression induces cell death in hepatoma cells. The study developed gene therapy designed to specifically overexpress NOS-3 in cultured hepatoma cells, and in tumors derived from orthotopically implanted tumor cells in fibrotic livers. Liver fibrosis was induced by CCl4 administration in mice. Hepa 1-6 cells were used for in vitro and in vivo experiments. The first generation adenovirus was designed to overexpress NOS-3 (or GFP and luciferase cDNA under the regulation of murine alpha-fetoprotein (AFP and Rous Sarcoma Virus (RSV promoters, respectively. Both adenoviruses were administered through the tail vein two weeks after orthotopic tumor cell implantation. AFP-NOS-3/RSV-Luciferase increased oxidative-related DNA damage, p53, CD95/CD95L expression and caspase-8 activity in cultured Hepa 1-6 cells. The increased expression of CD95/CD95L and caspase-8 activity was abolished by l-NAME or p53 siRNA. The tail vein infusion of AFP-NOS- 3/RSV-Luciferase adenovirus increased cell death markers, and reduced cell proliferation of established tumors in fibrotic livers. The increase of oxidative/nitrosative stress induced by NOS-3 overexpression induced DNA damage, p53, CD95/CD95L expression and cell death in hepatocellular carcinoma cells. The effectiveness of the gene therapy has been demonstrated in vitro and in vivo.
Energy Technology Data Exchange (ETDEWEB)
Pejcha, Robert; Ludwig, Martha L. (Michigan)
2010-03-08
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
International Nuclear Information System (INIS)
Pejcha, Robert; Ludwig, Martha L.
2005-01-01
Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Directory of Open Access Journals (Sweden)
Robert Pejchal
2005-02-01
Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.
Directory of Open Access Journals (Sweden)
Aarón Barraza
2016-11-01
Full Text Available Legumes form symbioses with rhizobia, producing nitrogen-fixing nodules on the roots of the plant host. The network of plant signaling pathways affecting carbon metabolism may determine the final number of nodules. The trehalose biosynthetic pathway regulates carbon metabolism and plays a fundamental role in plant growth and development, as well as in plant-microbe interactions. The expression of genes for trehalose synthesis during nodule development suggests that this metabolite may play a role in legume-rhizobia symbiosis. In this work, PvTPS9, which encodes a Class II trehalose-6-phosphate synthase (TPS of common bean (Phaseolus vulgaris, was silenced by RNA interference in transgenic nodules. The silencing of PvTPS9 in root nodules resulted in a reduction of 85% (± 1% of its transcript, which correlated with a 30% decrease in trehalose contents of transgenic nodules and in untransformed leaves. Composite transgenic plants with PvTPS9 silenced in the roots showed no changes in nodule number and nitrogen fixation, but a severe reduction in plant biomass and altered transcript profiles of all Class II TPS genes. Our data suggest that PvTPS9 plays a key role in modulating trehalose metabolism in the symbiotic nodule and, therefore, in the whole plant.
Liu, Dong; Zhang, Lu; Xue, Wen; Wang, Yaping; Ju, Jiansong; Zhao, Baohua
2015-07-01
This study focused on the alanine racemase gene (alr-2), which is involved in the synthesis of d-alanine that forms the backbone of the cell wall. A stable alr-2 knockout mutant of Aeromonas hydrophila HBNUAh01 was constructed. When the mutant was supplemented with d-alanine, growth was unaffected; deprivation of d-alanine caused the growth arrest of the starved mutant cells, but not cell lysis. No alanine racemase activity was detected in the culture of the mutant. Additionally, a membrane permeability assay showed increasing damage to the cell wall during d-alanine starvation. No such damage was observed in the wild type during culture. Scanning and transmission electron microscopy analyses revealed deficiencies of the cell envelope and perforation of the cell wall. Leakage of UV-absorbing substances from the mutants was also observed. Thus, the partial viability of the mutants and their independence of d-alanine for growth indicated that inactivation of alr-2 does not impose an auxotrophic requirement for d-alanine. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Ferrando, Jorge
2015-01-01
If you are a JavaScript developer who has been using DOM manipulation libraries such as Mootools or Scriptaculous, and you want go further in modern JavaScript development with a simple and well-documented library, then this book is for you. Learning how to use Knockout will be perfect as your next step towards building JavaScript applications that respond to user interaction.
Yamamura, Y; Mizuguchi, Y; Taura, F; Kurosaki, F
2014-10-01
A cDNA clone, designated SdGGPPS2, was isolated from young seedlings of Scoparia dulcis. The putative amino acid sequence of the translate of the gene showed high homology with geranylgeranyl diphosphate synthase (GGPPS) from various plant sources, and the N-terminal residues exhibited the characteristics of chloroplast targeting sequence. An appreciable increase in the transcriptional level of SdGGPPS2 was observed by exposure of the leaf tissues of S. dulcis to methyl jasmonate, yeast extract or Ca(2+) ionophore A23187. In contrast, SdGGPPS1, a homologous GGPPS gene of the plant, showed no or only negligible change in the expression level upon treatment with these stimuli. The truncated protein heterologously expressed in Escherichia coli in which the putative targeting domain was deleted catalyzed the condensation of farnesyl diphosphate and isopentenyl diphosphate to liberate geranylgeranyl diphosphate. These results suggested that SdGGPPS2 plays physiological roles in methyl jasmonate and yeast extract-induced metabolism in the chloroplast of S. dulcis cells.
Haloperidol inhibits the development of atherosclerotic lesions in LDL receptor knockout mice.
van der Sluis, Ronald J; Nahon, Joya E; Reuwer, Anne Q; Van Eck, Miranda; Hoekstra, Menno
2015-05-01
Antipsychotic drugs have been shown to modulate the expression of ATP-binding cassette transporter A1 (ABCA1), a key factor in the anti-atherogenic reverse cholesterol transport process, in vitro. Here we evaluated the potential of the typical antipsychotic drug haloperidol to modulate the cholesterol efflux function of macrophages in vitro and their susceptibility to atherosclerosis in vivo. Thioglycollate-elicited peritoneal macrophages were used for in vitro studies. Hyperlipidaemic low-density lipoprotein (LDL) receptor knockout mice were implanted with a haloperidol-containing pellet and subsequently fed a Western-type diet for 5 weeks to induce the development of atherosclerotic lesions in vivo. Haloperidol induced a 54% decrease in the mRNA expression of ABCA1 in peritoneal macrophages. This coincided with a 30% decrease in the capacity of macrophages to efflux cholesterol to apolipoprotein A1. Haloperidol treatment stimulated the expression of ABCA1 (+51%) and other genes involved in reverse cholesterol transport, that is, CYP7A1 (+98%) in livers of LDL receptor knockout mice. No change in splenic ABCA1 expression was noted. However, the average size of the atherosclerotic size was significantly smaller (-31%) in the context of a mildly more atherogenic metabolic phenotype upon haloperidol treatment. More importantly, haloperidol markedly lowered MCP-1 expression (-70%) and secretion (-28%) by peritoneal macrophages. Haloperidol treatment lowered the susceptibility of hyperlipidaemic LDL receptor knockout mice to develop atherosclerotic lesions. Our findings suggest that the beneficial effect of haloperidol on atherosclerosis susceptibility can be attributed to its ability to inhibit macrophage chemotaxis. © 2015 The British Pharmacological Society.
Directory of Open Access Journals (Sweden)
Verónica Keim
Full Text Available Arabidopsis thaliana contains two genes encoding farnesyl diphosphate (FPP synthase (FPS, the prenyl diphoshate synthase that catalyzes the synthesis of FPP from isopentenyl diphosphate (IPP and dimethylallyl diphosphate (DMAPP. In this study, we provide evidence that the two Arabidopsis short FPS isozymes FPS1S and FPS2 localize to the cytosol. Both enzymes were expressed in E. coli, purified and biochemically characterized. Despite FPS1S and FPS2 share more than 90% amino acid sequence identity, FPS2 was found to be more efficient as a catalyst, more sensitive to the inhibitory effect of NaCl, and more resistant to thermal inactivation than FPS1S. Homology modelling for FPS1S and FPS2 and analysis of the amino acid differences between the two enzymes revealed an increase in surface polarity and a greater capacity to form surface salt bridges of FPS2 compared to FPS1S. These factors most likely account for the enhanced thermostability of FPS2. Expression analysis of FPS::GUS genes in seeds showed that FPS1 and FPS2 display complementary patterns of expression particularly at late stages of seed development, which suggests that Arabidopsis seeds have two spatially segregated sources of FPP. Functional complementation studies of the Arabidopsis fps2 knockout mutant seed phenotypes demonstrated that under normal conditions FPS1S and FPS2 are functionally interchangeable. A putative role for FPS2 in maintaining seed germination capacity under adverse environmental conditions is discussed.
DEFF Research Database (Denmark)
Heo, Min-Ji; Jung, Hwi-Min; Um, Jaeyong
2017-01-01
Genome editing using CRISPR/Cas9 was successfully demonstrated in Esherichia coli to effectively produce n-butanol in a defined medium under microaerobic condition. The butanol synthetic pathway genes including those encoding oxygen-tolerant alcohol dehydrogenase were overexpressed in metabolically...... prediction program, UTR designer, and modified using the CRISPR/Cas9 genome editing method to reduce its expression level. E. coli strains with decreased citrate synthase expression produced more butanol and the citrate synthase activity was correlated with butanol production. These results demonstrate...
Souza-Moreira, Tatiana M.; Alves, Thaís B.; Pinheiro, Karina A.; Felippe, Lidiane G.; de Lima, Gustavo M. A.; Watanabe, Tatiana F.; Barbosa, Cristina C.; Santos, Vânia A. F. F. M.; Lopes, Norberto P.; Valentini, Sandro R.; Guido, Rafael V. C.; Furlan, Maysa; Zanelli, Cleslei F.
2016-11-01
Among the biologically active triterpenes, friedelin has the most-rearranged structure produced by the oxidosqualene cyclases and is the only one containing a cetonic group. In this study, we cloned and functionally characterized friedelin synthase and one cycloartenol synthase from Maytenus ilicifolia (Celastraceae). The complete coding sequences of these 2 genes were cloned from leaf mRNA, and their functions were characterized by heterologous expression in yeast. The cycloartenol synthase sequence is very similar to other known OSCs of this type (approximately 80% identity), although the M. ilicifolia friedelin synthase amino acid sequence is more related to β-amyrin synthases (65-74% identity), which is similar to the friedelin synthase cloned from Kalanchoe daigremontiana. Multiple sequence alignments demonstrated the presence of a leucine residue two positions upstream of the friedelin synthase Asp-Cys-Thr-Ala-Glu (DCTAE) active site motif, while the vast majority of OSCs identified so far have a valine or isoleucine residue at the same position. The substitution of the leucine residue with valine, threonine or isoleucine in M. ilicifolia friedelin synthase interfered with substrate recognition and lead to the production of different pentacyclic triterpenes. Hence, our data indicate a key role for the leucine residue in the structure and function of this oxidosqualene cyclase.
Formation of wood secondary cell wall may involve two type cellulose synthase complexes in Populus.
Xi, Wang; Song, Dongliang; Sun, Jiayan; Shen, Junhui; Li, Laigeng
2017-03-01
Cellulose biosynthesis is mediated by cellulose synthases (CesAs), which constitute into rosette-like cellulose synthase complexe (CSC) on the plasma membrane. Two types of CSCs in Arabidopsis are believed to be involved in cellulose synthesis in the primary cell wall and secondary cell walls, respectively. In this work, we found that the two type CSCs participated cellulose biosynthesis in differentiating xylem cells undergoing secondary cell wall thickening in Populus. During the cell wall thickening process, expression of one type CSC genes increased while expression of the other type CSC genes decreased. Suppression of different type CSC genes both affected the wall-thickening and disrupted the multilaminar structure of the secondary cell walls. When CesA7A was suppressed, crystalline cellulose content was reduced, which, however, showed an increase when CesA3D was suppressed. The CesA suppression also affected cellulose digestibility of the wood cell walls. The results suggest that two type CSCs are involved in coordinating the cellulose biosynthesis in formation of the multilaminar structure in Populus wood secondary cell walls.
Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata
2017-08-01
Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.
Komonyi, Orban; Schauer, Tamas; Papai, Gabor; Deak, Peter; Boros, Imre M
2009-03-15
Although telomere formation occurs through a different mechanism in Drosophila compared with other organisms, telomere associations result from mutations in homologous genes, indicating the involvement of similar pathways in chromosome end protection. We report here that mutations of the Drosophila melanogaster gene CG31241 lead to high frequency chromosome end fusions. CG31241 is a bicistronic gene that encodes trimethylguanosine synthase (TGS1), which forms the m3G caps of noncoding small RNAs, and a novel protein, DTL. We show that although TGS1 has no role in telomere protection, DTL is localized at specific sites, including the ends of polytene chromosomes, and its loss results in telomere associations. Mutations of ATM- and Rad3-related (ATR) kinase suppress telomere fusions in the absence of DTL. Thus, genetic interactions place DTL in an ATR-related pathway in telomere protection. In contrast to ATR kinase, mutations of ATM (ataxia telangiectasia mutated) kinase, which acts in a partially overlapping pathway of telomere protection, do not suppress formation of telomere associations in the absence of DTL. Thus, uncovering the role of DTL will help to dissect the evolutionary conserved pathway(s) controlling ATM-ATR-related telomere protection.
Problem-Solving Test: Targeted Gene Disruption
Szeberenyi, Jozsef
2008-01-01
Mutational inactivation of a specific gene is the most powerful technique to analyze the biological function of the gene. This approach has been used for a long time in viruses, bacteria, yeast, and fruit fly, but looked quite hopeless in more complex organisms. Targeted inactivation of specific genes (also known as knock-out mutation) in mice is…
Liao, Shi-Wei; Lee, Jen-Jie; Ptak, Christopher P; Wu, Ying-Chen; Hsuan, Shih-Ling; Kuo, Chih-Jung; Chen, Ter-Hsin
2018-03-01
In this study, six swine-derived multiple-antimicrobial-resistant (MAR) strains of Salmonella Choleraesuis (S. Choleraesuis) were demonstrated to possess higher efflux pump activity than the wild-type (WT). L-Arabinose, a common inducer for gene expression, modulated S. Choleraesuis efflux pump activity in a dose-dependent manner. At low L-arabinose concentrations, increasing L-arabinose led to a corresponding increase in fluorophore efflux, while at higher L-arabinose concentrations, increasing L-arabinose decreased fluorophore efflux activity. The WT S. Choleraesuis that lacks TolC (ΔtolC), an efflux protein associated with bacterial antibiotic resistance and virulence, was demonstrated to possess a significantly reduced ability to extrude L-arabinose. Further, due to the rapid export of L-arabinose, an efficient method for recombination-mediated gene knockout, the L-arabinose-inducible bacteriophage λ Red recombinase system, has a reduced recombination frequency (~ 12.5%) in clinically isolated MAR Salmonella strains. An increased recombination frequency (up to 60%) can be achieved using a higher concentration of L-arabinose (fivefold) for genetic manipulation and functional analysis for MAR Salmonella using the λ Red system. The study suggests that L-arabinose serves not only as an inducer of the TolC-dependent efflux system but also acts as a competitive substrate of the efflux system. In addition, understanding the TolC-dependent efflux of L-arabinose should facilitate the optimization of L-arabinose induction in strains with high efflux activity.
DEFF Research Database (Denmark)
Le Gall, G.; Metzdorff, Stine Broeng; Pedersen, Jan W.
2005-01-01
A metabolite profiling study has been carried out on Arabidopsis thaliana (L.) Heynh. ecotype Wassilewskija and a series of transgenic lines of the ecotype transformed with a CHS (chalcone synthase) antisense construct. Compound identifications by LC/MS and H-1 NMR are discussed. The glucosinolate...
Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.
2018-03-01
Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.
Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan
2016-01-01
Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...
Dubey, J P; Verma, S K; Dunams, D; Calero-Bernal, R; Rosenthal, B M
2015-11-01
The North American opossum (Didelphis virginiana) is the definitive host for at least three named species of Sarcocystis: Sarcocystis falcatula, Sarcocystis neurona and Sarcocystis speeri. The South American opossums (Didelphis albiventris, Didelphis marsupialis and Didelphis aurita) are definitive hosts for S. falcatula and S. lindsayi. The sporocysts of these Sarcocystis species are similar morphologically. They are also not easily distinguished genetically because of the difficulties of DNA extraction from sporocysts and availability of distinguishing genetic markers. Some of these species can be distinguished by bioassay; S. neurona and S. speeri are infective to gamma interferon gene knockout (KO) mice, but not to budgerigars (Melopsittacus undulatus); whereas S. falcatula and S. lindsayi are infective to budgerigars but not to KO mice. The natural intermediate host of S. speeri is unknown. In the present study, development of sarcocysts of S. speeri in the KO mice is described. Sarcocysts were first seen at 12 days post-inoculation (p.i.), and they became macroscopic (up to 4 mm long) by 25 days p.i. The structure of the sarcocyst wall did not change from the time bradyzoites had formed at 50-220 days p.i. Sarcocysts contained unique villar protrusions, 'type 38'. The polymerase chain reaction amplifications and sequences analysis of three nuclear loci (18S rRNA, 28S rRNA and ITS1) and two mitochondrial loci (cox1 and cytb) of S. speeri isolate from an Argentinean opossum (D. albiventris) confirmed its membership among species of Sarcocystis and indicated an especially close relationship to another parasite in this genus that employs opossums as its definitive host, S. neurona. These results should be useful in finding natural intermediate host of S. speeri.
Knockout silkworms reveal a dispensable role for juvenile hormones in holometabolous life cycle.
Daimon, Takaaki; Uchibori, Miwa; Nakao, Hajime; Sezutsu, Hideki; Shinoda, Tetsuro
2015-08-04
Insect juvenile hormones (JHs) prevent precocious metamorphosis and allow larvae to undergo multiple rounds of status quo molts. However, the roles of JHs during the embryonic and very early larval stages have not been fully understood. We generated and characterized knockout silkworms (Bombyx mori) with null mutations in JH biosynthesis or JH receptor genes using genome-editing tools. We found that embryonic growth and morphogenesis are largely independent of JHs in Bombyx and that, even in the absence of JHs or JH signaling, pupal characters are not formed in first- or second-instar larvae, and precocious metamorphosis is induced after the second instar at the earliest. We also show by mosaic analysis that a pupal specifier gene broad, which is dramatically up-regulated in the late stage of the last larval instar, is essential for pupal commitment in the epidermis. Importantly, the mRNA expression level of broad, which is thought to be repressed by JHs, remained at very low basal levels during the early larval instars of JH-deficient or JH signaling-deficient knockouts. Therefore, our study suggests that the long-accepted paradigm that JHs maintain the juvenile status throughout larval life should be revised because the larval status can be maintained by a JH-independent mechanism in very early larval instars. We propose that the lack of competence for metamorphosis during the early larval stages may result from the absence of an unidentified broad-inducing factor, i.e., a competence factor.
One-neutron knockout from {sup 24-28}Ne isotopes
Energy Technology Data Exchange (ETDEWEB)
Rodriguez-Tajes, C., E-mail: carme.rodriguez@usc.e [Departamento de Fisica de Particulas, Universidade de Santiago de Compostela, 15782 Santiago de Compostela (Spain); Cortina-Gil, D.; Alvarez-Pol, H. [Departamento de Fisica de Particulas, Universidade de Santiago de Compostela, 15782 Santiago de Compostela (Spain); Aumann, T. [GSI Helmholtzzentrum fuer Schwerionenforschung, 64291 Darmstadt (Germany); Benjamim, E.; Benlliure, J. [Departamento de Fisica de Particulas, Universidade de Santiago de Compostela, 15782 Santiago de Compostela (Spain); Borge, M.J.G. [Instituto de Estructura de la Materia, CSIC, 28006 Madrid (Spain); Caamano, M.; Casarejos, E. [Departamento de Fisica de Particulas, Universidade de Santiago de Compostela, 15782 Santiago de Compostela (Spain); Chatillon, A. [GSI Helmholtzzentrum fuer Schwerionenforschung, 64291 Darmstadt (Germany); Eppinger, K.; Faestermann, T. [Physik Department E12, Technische Universitaet Muenchen, 85748 Garching (Germany); Gascon, M. [Departamento de Fisica de Particulas, Universidade de Santiago de Compostela, 15782 Santiago de Compostela (Spain); Geissel, H. [GSI Helmholtzzentrum fuer Schwerionenforschung, 64291 Darmstadt (Germany); Gernhaeuser, R. [Physik Department E12, Technische Universitaet Muenchen, 85748 Garching (Germany); Jonson, B. [Fundamental Fysik, Chalmers Tekniska Hoegskola, 412 96 Goeteborg (Sweden); PH Department, CERN, 1211 Geneve 23 (Switzerland); Kanungo, R. [Astronomy and Physics Department, Saint Mary' s University, Halifax, NS B3H 3C3 (Canada); Kruecken, R. [Physik Department E12, Technische Universitaet Muenchen, 85748 Garching (Germany); Kurtukian, T. [Departamento de Fisica de Particulas, Universidade de Santiago de Compostela, 15782 Santiago de Compostela (Spain); Larsson, K. [Fundamental Fysik, Chalmers Tekniska Hoegskola, 412 96 Goeteborg (Sweden)
2010-04-05
One-neutron knockout reactions of {sup 24-28}Ne in a beryllium target have been studied in the Fragment Separator (FRS), at GSI. The results include inclusive one-neutron knockout cross-sections as well as longitudinal-momentum distributions of the knockout fragments. The ground-state structure of the neutron-rich neon isotopes was obtained from an analysis of the measured momentum distributions. The results indicate that the two heaviest isotopes, {sup 27}Ne and {sup 28}Ne, are dominated by a configuration in which a s{sub 1/2} neutron is coupled to an excited state of the {sup 26}Ne and {sup 27}Ne core, respectively.
DEFF Research Database (Denmark)
Maile, C A; Hingst, Janne Rasmuss; Mahalingan, K K
2017-01-01
BACKGROUND: Equine type 1 polysaccharide storage myopathy (PSSM1) is associated with a missense mutation (R309H) in the glycogen synthase (GYS1) gene, enhanced glycogen synthase (GS) activity and excessive glycogen and amylopectate inclusions in muscle. METHODS: Equine muscle biochemical...... had significantly higher glycogen content than control horse muscle despite no difference in GS expression. GS activity was significantly higher in muscle from homozygous mutants than from heterozygote and control horses, in the absence and presence of the allosteric regulator, glucose 6 phosphate (G6...
Directory of Open Access Journals (Sweden)
Chun-Hsien eHung
2016-01-01
Full Text Available Phosphatidylglycerol (PG and cardiolipin (CL are two essential classes of phospholipid in plants and algae. Phosphatidylglycerophosphate synthase (PGPS and cardiolipin synthase (CLS involved in the biosynthesis of PG and CL belong to CDP-alcohol phosphotransferase and share overall amino acid sequence homology. However, it remains elusive whether PGPS and CLS are functionally distinct in vivo. Here, we report identification of a gene encoding CLS in Chlamydomonas reinhardtii, CrCLS1, and its functional compatibility. Whereas CrCLS1 did not complement the growth phenotype of a PGPS mutant of Synechocystis sp. PCC 6803, it rescued the temperature-sensitive growth phenotype, growth profile with different carbon sources, phospholipid composition and enzyme activity of ∆crd1, a CLS mutant of Saccharomyces cerevisiae. These results suggest that CrCLS1 encodes a functional CLS of C. reinhardtii as the first identified algal CLS, whose enzyme function is distinct from that of PGPSs from C. reinhardtii. Comparison of CDP-alcohol phosphotransferase motif between PGPS and CLS among different species revealed a possible additional motif that might define the substrate specificity of these closely related enzymes.
Eliminating graphs by means of parallel knock-out schemes
Broersma, H.J.; Fomin, F.V.; Královic, R.; Woeginger, G.J.
2007-01-01
In 1997 Lampert and Slater introduced parallel knock-out schemes, an iterative process on graphs that goes through several rounds. In each round of this process, every vertex eliminates exactly one of its neighbors. The parallel knock-out number of a graph is the minimum number of rounds after which
Eliminating graphs by means of parallel knock-out schemes
Broersma, Haitze J.; Fomin, F.V.; Královič, R.; Woeginger, Gerhard
In 1997 Lampert and Slater introduced parallel knock-out schemes, an iterative process on graphs that goes through several rounds. In each round of this process, every vertex eliminates exactly one of its neighbors. The parallel knock-out number of a graph is the minimum number of rounds after which
Chalcone synthase genes from milk thistle (Silybum marianum)
Indian Academy of Sciences (India)
... the identification of encoding genes in milk thistle plant can be of great importance. In the current research, fragments of genes were amplified using degenerate primers based on the conserved parts of Asteraceae genes, and then cloned and sequenced. Analysis of the resultant nucleotide and deduced ...
Directory of Open Access Journals (Sweden)
Michelle F. Valentine
2017-05-01
Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.
Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.
2017-01-01
Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898
Zhou, Fei; Sun, Tian-Hu; Zhao, Lei; Pan, Xi-Wu; Lu, Shan
2015-01-01
The Artemisia annua L. β-pinene synthase QH6 was previously determined to be circadian-regulated at the transcriptional level, showing a rhythmic fluctuation of steady-state transcript abundances. Here we isolated both the genomic sequence and upstream promoter region of QH6. Different regulatory elements, such as G-box (TGACACGTGGCA, -421 bp from the translation initiation site) which might have effects on rhythmic gene expression, were found. Using the yeast one-hybrid and electrophoretic mobility shift assay (EMSA), we confirmed that the bZIP transcription factor HY5 binds to this motif of QH6. Studies with promoter truncations before and after this motif suggested that this G-box was important for the diurnal fluctuation of the transgenic β-glucuronidase gene (GUS) transcript abundance in Arabidopsis thaliana. GUS gene driven by the promoter region immediately after G-box showed an arrhythmic expression in both light/dark (LD) and constant dark (DD) conditions, whereas the control with G-box retained its fluctuation in both LD and DD. We further transformed A. thaliana with the luciferase gene (LUC) driven by an 1400 bp fragment upstream QH6 with its G-box intact or mutated, respectively. The luciferase activity assay showed that a peak in the early morning disappeared in the mutant. Gene expression analysis also demonstrated that the rhythmic expression of LUC was abolished in the hy5-1 mutant.
International Nuclear Information System (INIS)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen; Liang, Yu-He; Su, Xiao-Dong
2006-01-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni 2+ -chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution. The crystal belongs to space group P2 1 , with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°
Li, Yuquan; Cheng, Lihong; Qin, Qianhong; Liu, Jian; Lo, Woo-kuen; Brako, Lowrence A; Yang, Qinglin
2009-10-01
Peroxisome proliferator-activated receptor delta (PPARdelta) is an essential determinant of basal myocardial fatty acid oxidation (FAO) and bioenergetics. We wished to determine whether increased lipid loading affects the PPARdelta deficient heart in transcriptional regulation of FAO and in the development of cardiac pathology. Cardiomyocyte-restricted PPARdelta knockout (CR-PPARdelta(-/-)) and control (alpha-MyHC-Cre) mice were subjected to 48 h of fasting and to a long-term maintenance on a (28 weeks) high-fat diet (HFD). The expression of key FAO proteins in heart was examined. Serum lipid profiles, cardiac pathology, and changes of various transduction signaling pathways were also examined. Mice subjected to fasting exhibited upregulated transcript expression of FAO genes in the CR-PPARdelta(-/-) hearts. Moreover, long-term HFD in CR-PPARdelta(-/-) mice induced a strikingly greater transcriptional response. After HFD, genes encoding key FAO enzymes were expressed remarkably more in CR-PPARdelta(-/-) hearts than in those of control mice. Despite the marked rise of FAO gene expression, corresponding protein expression remained low in the CR-PPARdelta(-/-) heart, accompanied by abnormalities in sarcomere structures and mitochondria that were similar to those of CR-PPARdelta(-/-) hearts with regular chow feeding. The CR-PPARdelta(-/-) mice displayed increased expression of PPARgamma co-activator-1alpha (PGC-1alpha) and PPARalpha in the heart with deactivated Akt and p42/44 MAPK signaling in response to HFD. We conclude that PPARdelta is an essential determinant of myocardial FAO. Increased lipid intake activates cardiac expression of FAO genes via PPARalpha/PGC-1alpha pathway, albeit it is not sufficient to improve cardiac pathology due to PPARdelta deficiency.
Shankarishan, Priyanka; Borah, Prasanta Kumar; Ahmed, Giasuddin; Mahanta, Jagadish
2011-01-01
Background & objectives Endothelial nitric oxide is a potent vasodilator and impairment of its generation brought about by gene polymorphism is considered a major predictor for several diseases. A single nucleotide polymorphism G894T within exon 7 of endothelial nitric oxide synthase (eNOS-7) gene, resulting in a replacement of glutamic acid by aspartic acid, has been studied as a putative candidate gene for cardiovascular diseases. The pattern of eNOS-7 Glu298Asp variant in the Indian population is poorly known. The present study was planned to determine the prevalence of the variant of this gene among tea garden community in Assam, North-East India with high prevalence of hypertension. Methods Study participants of both sex aged ≥18 yr were recruited randomly from temporary field clinics established in tea gardens of Dibrugarh, Assam. Genomic DNA was extracted from 409 subjects by the conventional phenol-chloroform method. The prevalence of the eNOS exon 7 Glu298Asp variant was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. Results The study population was in Hardy-Weinberg Equilibrium. The frequency of the eNOS GG, GT and TT genotypes was found to be 75, 22 and 3 per cent respectively and did not show any significant difference in gender wise analysis. Interpretation & conclusions Our results showed that the prevalence of the homozygous GG genotype was high (75%) and the rare mutant genotype (homozygous, TT) was 3 per cent in a population at risk with cardiovascular disease. Such population-based data on various polymorphisms can ultimately be exploited in pharmacogenomics. PMID:21623032
Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang
2017-12-01
Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.
Heterozygous CDKL5 Knockout Female Mice Are a Valuable Animal Model for CDKL5 Disorder
Fuchs, Claudia; Gennaccaro, Laura; Trazzi, Stefania; Bastianini, Stefano; Bettini, Simone; Martire, Viviana Lo; Ren, Elisa; Medici, Giorgio; Zoccoli, Giovanna; Rimondini, Roberto; Ciani, Elisabetta
2018-01-01
CDKL5 disorder is a severe neurodevelopmental disorder caused by mutations in the X-linked CDKL5 (cyclin-dependent kinase-like five) gene. CDKL5 disorder primarily affects girls and is characterized by early-onset epileptic seizures, gross motor impairment, intellectual disability, and autistic features. Although all CDKL5 female patients are heterozygous, the most valid disease-related model, the heterozygous female Cdkl5 knockout (Cdkl5 +/−) mouse, has been little characterized. The lack of...
Chung, Amanda G; Belone, Phillip M; Bímová, Barbora Vošlajerová; Karn, Robert C; Laukaitis, Christina M
2017-04-01
The house mouse Androgen-binding protein ( Abp ) gene family is comprised of 64 paralogs, 30 Abpa and 34 Abpbg , encoding the alpha (ABPA) and beta-gamma (ABPBG) protein subunits that are disulfide-bridged to form dimers in secretions. Only 14 Abp genes are expressed in distinct patterns in the lacrimal (11) and submandibular glands (3). We created a knockout mouse line lacking two of the three genes expressed in submandibular glands, Abpa27 and Abpbg27 , by replacing them with the neomycin resistance gene. The knockout genotype (-/-) showed no Abpa27 or Abpbg27 transcripts in submandibular gland complementary DNA (cDNA) libraries and there was a concomitant lack of protein expression of ABPA27 and ABPBG27 in the -/- genotype saliva, shown by elimination of these two proteins from the saliva proteome and the loss of cross-reactive material in the acinar cells of the submandibular glands. We also observed a decrease in BG26 protein in the -/- animals, suggesting monomer instability. Overall, we observed no major phenotypic changes in the -/- genotype, compared with their +/+ and +/- siblings raised in a laboratory setting, including normal growth curves, tissue histology, fecundity, and longevity. The only difference is that male and female C57BL/6 mice preferred saliva of the opposite sex containing ABP statistically significantly more than saliva of the opposite sex without ABP in a Y-maze test. These results show for the first time that mice can sense the presence of ABP between saliva targets with and without ABPs, and that they spend more time investigating the target containing ABP. Copyright © 2017 by the Genetics Society of America.
International Nuclear Information System (INIS)
Haussühl, K.; Rohde, W.; Weissenböck, G.
1996-01-01
Four chalcone synthase (CHS; EC 2.3.1.74) clones from rye were isolated and characterized. Two of these clones were used for analysis of CHS gene activities in response to ultraviolet and visible radiation in the coleoptile and the primary leaf of the rye seedling. The time-dependence of CHS gene activation and the spatial distribution of CHS were studied by investigation of enzyme activities and CHS mRNA levels, including in situ RNA hybridization. In the primary leaf strong induction of CHS gene activity was localized in the epidermal layers and only marginally found in the mesophyll. The coleoptile showed an even higher response to UV irradiation, but CHS gene activity was evenly distributed throughout the tissues. It is suggested that, in addition to its function as a mechanical protection for the primary leaf during seed germination and seedling emergence through the soil, the coleoptile may also protect the emerging seedling from harmful radiation
Xu, Jinkun; Ai, Ying; Wang, Jianhui; Xu, Jingwei; Zhang, Yongkang; Yang, Dong
2017-05-01
S-limonene synthase is a model monoterpene synthase that cyclizes geranyl pyrophosphate (GPP) to form S-limonene. It is a relatively specific enzyme as the majority of its products are composed of limonene. In this study, we converted it to pinene or phellandrene synthases after introducing N345A/L423A/S454A or N345I mutations. Further studies on N345 suggest the polarity of this residue plays a critical role in limonene production by stabilizing the terpinyl cation intermediate. If it is mutated to a non-polar residue, further cyclization or hydride shifts occurs so the carbocation migrates towards the pyrophosphate, leading to the production of pinene or phellandrene. On the other hand, mutant enzymes that still possess a polar residue at this position produce limonene as the major product. N345 is not the only polar residue that may stabilize the terpinyl cation because it is not strictly conserved among limonene synthases across species and there are also several other polar residues in this area. These residues could form a "polar pocket" that may collectively play this stabilizing role. Our study provides important insights into the catalytic mechanism of limonene synthases. Furthermore, it also has wider implications on the evolution of terpene synthases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.
Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E
2016-11-01
Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.
p21WAF1/Cip1/Sdi1 knockout mice respond to doxorubicin with reduced cardiotoxicity
International Nuclear Information System (INIS)
Terrand, Jerome; Xu, Beibei; Morrissy, Steve; Dinh, Thai Nho; Williams, Stuart; Chen, Qin M.
2011-01-01
Doxorubicin (Dox) is an antineoplastic agent that can cause cardiomyopathy in humans and experimental animals. As an inducer of reactive oxygen species and a DNA damaging agent, Dox causes elevated expression of p21 WAF1/Cip1/Sdi1 (p21) gene. Elevated levels of p21 mRNA and p21 protein have been detected in the myocardium of mice following Dox treatment. With chronic treatment of Dox, wild type (WT) animals develop cardiomyopathy evidenced by elongated nuclei, mitochondrial swelling, myofilamental disarray, reduced cardiac output, reduced ejection fraction, reduced left ventricular contractility, and elevated expression of ANF gene. In contrast, p21 knockout (p21KO) mice did not show significant changes in the same parameters in response to Dox treatment. In an effort to understand the mechanism of the resistance against Dox induced cardiomyopathy, we measured levels of antioxidant enzymes and found that p21KO mice did not contain elevated basal or inducible levels of glutathione peroxidase and catalase. Measurements of 6 circulating cytokines indicated elevation of IL-6, IL-12, IFNγ and TNFα in Dox treated WT mice but not p21KO mice. Dox induced elevation of IL-6 mRNA was detected in the myocardium of WT mice but not p21KO mice. While the mechanism of the resistance against Dox induced cardiomyopathy remains unclear, lack of inflammatory response may contribute to the observed cardiac protection in p21KO mice. -- Highlights: ► Doxorubicin induces p21 elevation in the myocardium. ► Doxorubicin causes dilated cardiomyopathy in wild type mice. ► p21 Knockout mice are resistant against doxorubicin induced cardiomyopathy. ► Lack of inflammatory response correlates with the resistance in p21 knockout mice.
Ji, Gaojie; Zhang, Jie; Zhang, Haiying; Sun, Honghe; Gong, Guoyi; Shi, Jianting; Tian, Shouwei; Guo, Shaogui; Ren, Yi; Shen, Huolin; Gao, Junping; Xu, Yong
2016-09-01
Although it has been reported previously that ethylene plays a critical role in sex determination in cucurbit species, how the andromonoecy that carries both the male and hermaphroditic flowers is determined in watermelon is still unknown. Here we showed that the watermelon gene 1-aminocyclopropane-1-carboxylate synthase 4 (CitACS4), expressed specifically in carpel primordia, determines the andromonoecy in watermelon. Among four single nucleotide polymorphism (SNPs) and one InDel identified in the coding region of CitACS4, the C364W mutation located in the conserved box 6 was co-segregated with andromonoecy. Enzymatic analyses showed that the C364W mutation caused a reduced activity in CitACS4. We believe that the reduced CitACS4 activity may hamper the programmed cell death in stamen primordia, leading to the formation of hermaphroditic flowers. © 2016 Institute of Botany, Chinese Academy of Sciences.
Díaz-Sánchez, Violeta; Avalos, Javier; Limón, M Carmen
2012-10-01
Fusarins are a class of mycotoxins of the polyketide family produced by different Fusarium species, including the gibberellin-producing fungus Fusarium fujikuroi. Based on sequence comparisons between polyketide synthase (PKS) enzymes for fusarin production in other Fusarium strains, we have identified the F. fujikuroi orthologue, called fusA. The participation of fusA in fusarin biosynthesis was demonstrated by targeted mutagenesis. Fusarin production is transiently stimulated by nitrogen availability in this fungus, a regulation paralleled by the fusA mRNA levels in the cell. Illumination of the cultures results in a reduction of the fusarin content, an effect partially explained by a high sensitivity of these compounds to light. Mutants of the fusA gene exhibit no external phenotypic alterations, including morphology and conidiation, except for a lack of the characteristic yellow and/or orange pigmentation of fusarins. Moreover, the fusA mutants are less efficient than the wild type at degrading cellophane on agar cultures, a trait associated with pathogenesis functions in Fusarium oxysporum. The fusA mutants, however, are not affected in their capacities to grow on plant tissues.
Tailoring the Immune Response via Customization of Pathogen Gene Expression.
Runco, Lisa M; Stauft, Charles B; Coleman, J Robert
2014-01-01
The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.
Impaired social behavior in 5-HT3A receptor knockout mice
Directory of Open Access Journals (Sweden)
Laura A Smit-Rigter
2010-11-01
Full Text Available The 5-HT3 receptor is a ligand-gated ion channel expressed on interneurons throughout the brain. So far, analysis of the 5-HT3A knockout mouse revealed changes in nociceptive processing and a reduction in anxiety related behavior. Recently, it was shown that the 5-HT3 receptor is also expressed on Cajal-Retzius cells which play a key role in cortical development and that knockout mice lacking this receptor showed aberrant growth of the dendritic tree of cortical layer II/III pyramidal neurons. Other mouse models in which serotonergic signaling was disrupted during development showed similar morphological changes in the cortex, and in addition, also deficits in social behavior. Here, we subjected male and female 5-HT3A knockout mice and their non-transgenic littermates to several tests of social behavior. We found that 5-HT3A knockout mice display impaired social communication in the social transmission of food preference task. Interestingly, we showed that in the social interaction test only female 5-HT3A knockout mice spent less time in reciprocal social interaction starting after 5 minutes of testing. Moreover, we observed differences in preference for social novelty for male and female 5-HT3A knockout mice during the social approach test. However, no changes in olfaction, exploratory activity and anxiety were detected. These results indicate that the 5-HT3A knockout mouse displays impaired social behavior with specific changes in males and females, reminiscent to other mouse models in which serotonergic signaling is disturbed in the developing brain.
Zou, Yunlong; Li, Zhiyuan; Zou, Yunjing; Hao, Haiyang; Li, Ning; Li, Qiuyan
2018-04-15
The regulatory function of Fbxo40 has been well characterized in mice. As a key component of the SCF-E3 ubiquitin ligase complex, Fbxo40 induces IRS1 ubiquitination, thus inactivating the IGF1/Akt pathway. The expression of Fbxo40 is restricted to muscle, and mice with an Fbxo40 null mutation exhibit muscle hypertrophy. However, the function of FBXO40 has not been elucidated in pigs, and it is not known whether FBXO40 mutations affect their health. We therefore generated FBXO40 knockout pigs using somatic cell nuclear transfer (SCNT) technology. CRISPR/Cas9 technology was combined with G418 selection, making it possible to generate donor cells at an efficiency of 75.86%. In muscle from FBXO40 knockout pigs, IRS1 levels were higher, and the IGF1/Akt pathway was stimulated. Mutant animals also had approximately 4% more muscle mass compared to WT controls. The knockout pigs developed normally and no pathological changes were found in major organs. These results demonstrate that FBXO40 is a promising candidate gene for improving production traits in agricultural livestock and for developing therapeutic interventions for muscle diseases. Copyright © 2018. Published by Elsevier Inc.
Tuan, Pham Anh; Kim, Jae Kwang; Lee, Sanghyun; Chae, Soo Cheon; Park, Sang Un
2012-12-05
Riboflavin (vitamin B2) is the universal precursor of the coenzymes flavin mononucleotide and flavin adenine dinucleotide--cofactors that are essential for the activity of a wide variety of metabolic enzymes in animals, plants, and microbes. Using the RACE PCR approach, cDNAs encoding lumazine synthase (McLS) and riboflavin synthase (McRS), which catalyze the last two steps in the riboflavin biosynthetic pathway, were cloned from bitter melon (Momordica charantia), a popular vegetable crop in Asia. Amino acid sequence alignments indicated that McLS and McRS share high sequence identity with other orthologous genes and carry an N-terminal extension, which is reported to be a plastid-targeting sequence. Organ expression analysis using quantitative real-time RT PCR showed that McLS and McRS were constitutively expressed in M. charantia, with the strongest expression levels observed during the last stage of fruit ripening (stage 6). This correlated with the highest level of riboflavin content, which was detected during ripening stage 6 by HPLC analysis. McLS and McRS were highly expressed in the young leaves and flowers, whereas roots exhibited the highest accumulation of riboflavin. The cloning and characterization of McLS and McRS from M. charantia may aid the metabolic engineering of vitamin B2 in crops.