Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

Energy Technology Data Exchange (ETDEWEB)

Nicholas C Carpita

2009-04-20

Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

Genome-wide analysis of the cellulose synthase-like (Csl) gene family in bread wheat (Triticum aestivum L.).

Science.gov (United States)

Kaur, Simerjeet; Dhugga, Kanwarpal S; Beech, Robin; Singh, Jaswinder

2017-11-03

Hemicelluloses are a diverse group of complex, non-cellulosic polysaccharides, which constitute approximately one-third of the plant cell wall and find use as dietary fibres, food additives and raw materials for biofuels. Genes involved in hemicellulose synthesis have not been extensively studied in small grain cereals. In efforts to isolate the sequences for the cellulose synthase-like (Csl) gene family from wheat, we identified 108 genes (hereafter referred to as TaCsl). Each gene was represented by two to three homeoalleles, which are named as TaCslXY_ZA, TaCslXY_ZB, or TaCslXY_ZD, where X denotes the Csl subfamily, Y the gene number and Z the wheat chromosome where it is located. A quarter of these genes were predicted to have 2 to 3 splice variants, resulting in a total of 137 putative translated products. Approximately 45% of TaCsl genes were located on chromosomes 2 and 3. Sequences from the subfamilies C and D were interspersed between the dicots and grasses but those from subfamily A clustered within each group of plants. Proximity of the dicot-specific subfamilies B and G, to the grass-specific subfamilies H and J, respectively, points to their common origin. In silico expression analysis in different tissues revealed that most of the genes were expressed ubiquitously and some were tissue-specific. More than half of the genes had introns in phase 0, one-third in phase 2, and a few in phase 1. Detailed characterization of the wheat Csl genes has enhanced the understanding of their structural, functional, and evolutionary features. This information will be helpful in designing experiments for genetic manipulation of hemicellulose synthesis with the goal of developing improved cultivars for biofuel production and increased tolerance against various stresses.

Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

Science.gov (United States)

Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

2017-08-01

Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of the trehalose-6-phosphate synthase gene family in ...

Indian Academy of Sciences (India)

2015-03-04

Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

STORAGESEVER

2010-05-24

May 24, 2010 ... chronic periodontitis (CP), 31 with gingivitis (G) and 50 healthy controls. Probing depth ..... Periodontal disease in pregnancy I. Prevalence and severity. ... endothelial nitric oxide synthase gene in premenopausal women with.

Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

Directory of Open Access Journals (Sweden)

Dullat Harpreet K

2011-03-01

Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

PCR cloning of Polyhydroxybutyrate Synthase Gene (phbC) from Aeromonashydrophila

International Nuclear Information System (INIS)

Enan, M. R.; Bashandy, S.A.

2006-01-01

Plastic wastes are considered to be severe environmental contaminantscausing waste disposal problems. Widespread use of biodegradable plastics isone of the solutions, but it is limited by high production cost. A polymerasechain reaction (PCR) protocol was developed for the specific for the specificdetection and isolation of full-length gene coding for polyhydroxybutyrate(PBH). (PCR) strategy using (PHB) primers resulted in the amplification of(DNA) fragments with the expected size from all isolated bacteria (PBH)synthase gene was cloned directly from Aeromonas hydrophila genome for thefirst time. The clonec fragment was named (phbCAh) gene exhibits similarly to(PHB) synthase genes of Alcaligenes latus and Pseudomonas oleovorans (97%),Alcaligenes sp. (81%) and Comamonas acidovorans (84%). (author)

Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

OpenAIRE

Good, Laura Lee

2001-01-01

The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

Endothelial nitric oxide synthase gene polymorphisms associated ...

African Journals Online (AJOL)

Endothelial nitric oxide synthase (NOS3) is involved in key steps of immune response. Genetic factors predispose individuals to periodontal disease. This study's aim was to explore the association between NOS3 gene polymorphisms and clinical parameters in patients with periodontal disease. Genomic DNA was obtained ...

Altered expression of the caffeine synthase gene in a naturally caffeine-free mutant of Coffea arabica

Directory of Open Access Journals (Sweden)

Mirian Perez Maluf

2009-01-01

Full Text Available In this work, we studied the biosynthesis of caffeine by examining the expression of genes involved in this biosynthetic pathway in coffee fruits containing normal or low levels of this substance. The amplification of gene-specific transcripts during fruit development revealed that low-caffeine fruits had a lower expression of the theobromine synthase and caffeine synthase genes and also contained an extra transcript of the caffeine synthase gene. This extra transcript contained only part of exon 1 and all of exon 3. The sequence of the mutant caffeine synthase gene revealed the substitution of isoleucine for valine in the enzyme active site that probably interfered with enzymatic activity. These findings indicate that the absence of caffeine in these mutants probably resulted from a combination of transcriptional regulation and the presence of mutations in the caffeine synthase amino acid sequence.

An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

Science.gov (United States)

Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

Dihydropteroate synthase gene mutations in Pneumocystis and sulfa resistance

DEFF Research Database (Denmark)

Huang, Laurence; Crothers, Kristina; Atzori, Chiara

2004-01-01

in the dihydropteroate synthase (DHPS) gene. Similar mutations have been observed in P. jirovecii. Studies have consistently demonstrated a significant association between the use of sulfa drugs for PCP prophylaxis and DHPS gene mutations. Whether these mutations confer resistance to TMP-SMX or dapsone plus trimethoprim...

The Phytoene synthase gene family of apple (Malus x domestica) and its role in controlling fruit carotenoid content.

Science.gov (United States)

Ampomah-Dwamena, Charles; Driedonks, Nicky; Lewis, David; Shumskaya, Maria; Chen, Xiuyin; Wurtzel, Eleanore T; Espley, Richard V; Allan, Andrew C

2015-07-28

Carotenoid compounds play essential roles in plants such as protecting the photosynthetic apparatus and in hormone signalling. Coloured carotenoids provide yellow, orange and red colour to plant tissues, as well as offering nutritional benefit to humans and animals. The enzyme phytoene synthase (PSY) catalyses the first committed step of the carotenoid biosynthetic pathway and has been associated with control of pathway flux. We characterised four PSY genes found in the apple genome to further understand their involvement in fruit carotenoid accumulation. The apple PSY gene family, containing six members, was predicted to have three functional members, PSY1, PSY2, and PSY4, based on translation of the predicted gene sequences and/or corresponding cDNAs. However, only PSY1 and PSY2 showed activity in a complementation assay. Protein localisation experiments revealed differential localization of the PSY proteins in chloroplasts; PSY1 and PSY2 localized to the thylakoid membranes, while PSY4 localized to plastoglobuli. Transcript levels in 'Granny Smith' and 'Royal Gala' apple cultivars showed PSY2 was most highly expressed in fruit and other vegetative tissues. We tested the transient activation of the apple PSY1 and PSY2 promoters and identified potential and differential regulation by AP2/ERF transcription factors, which suggested that the PSY genes are controlled by different transcriptional mechanisms. The first committed carotenoid pathway step in apple is controlled by MdPSY1 and MdPSY2, while MdPSY4 play little or no role in this respect. This has implications for apple breeding programmes where carotenoid enhancement is a target and would allow co-segregation with phenotypes to be tested during the development of new cultivars.

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

Science.gov (United States)

Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

2009-02-01

Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

Directory of Open Access Journals (Sweden)

Bechard Matthew E.

2003-01-01

Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

Science.gov (United States)

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Nuclear receptor 5A (NR5A) family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells.

Science.gov (United States)

Ju, Yunfeng; Mizutani, Tetsuya; Imamichi, Yoshitaka; Yazawa, Takashi; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Umezawa, Akihiro; Kangawa, Kenji; Miyamoto, Kaoru

2012-11-01

5-Aminolevulinic acid synthase 1 (ALAS1) is a rate-limiting enzyme for heme biosynthesis in mammals. Heme is essential for the catalytic activities of P450 enzymes including steroid metabolic enzymes. Nuclear receptor 5A (NR5A) family proteins, steroidogenic factor-1 (SF-1), and liver receptor homolog-1 (LRH-1) play pivotal roles in regulation of steroidogenic enzymes. Recently, we showed that expression of SF-1/LRH-1 induces differentiation of mesenchymal stem cells into steroidogenic cells. In this study, genome-wide analysis revealed that ALAS1 was a novel SF-1-target gene in differentiated mesenchymal stem cells. Chromatin immunoprecipitation and reporter assays revealed that SF-1/LRH-1 up-regulated ALAS1 gene transcription in steroidogenic cells via binding to a 3.5-kb upstream region of ALAS1. The ALAS1 gene was up-regulated by overexpression of SF-1/LRH-1 in steroidogenic cells and down-regulated by knockdown of SF-1 in these cells. Peroxisome proliferator-activated receptor-γ coactivator-1α, a coactivator of nuclear receptors, also strongly coactivated expression of NR5A-target genes. Reporter analysis revealed that peroxisome proliferator-activated receptor-γ coactivator-1α strongly augmented ALAS1 gene transcription caused by SF-1 binding to the 3.5-kb upstream region. Finally knockdown of ALAS1 resulted in reduced progesterone production by steroidogenic cells. These results indicate that ALAS1 is a novel NR5A-target gene and participates in steroid hormone production.

Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

Science.gov (United States)

Yang, Ji; Gu, Hongya; Yang, Ziheng

2004-01-01

Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

Directory of Open Access Journals (Sweden)

Leila ePazouki

2015-03-01

Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

Science.gov (United States)

Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

2017-10-01

Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

Science.gov (United States)

Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

2017-01-01

Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

Science.gov (United States)

Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

2015-01-01

Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

Directory of Open Access Journals (Sweden)

Yan Yang

2017-04-01

Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

Engineering of the aspartate family biosynthetic pathway in barley (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and dihydrodipicolinate synthase

DEFF Research Database (Denmark)

Brinch-Pedersen, H.; Galili, G.; Sørensen, K.

1996-01-01

In prokaryotes and plants the synthesis of the essential amino acids lysine and threonine is predominantly regulated by feed-back inhibition of aspartate kinase (AK) and dihydrodipicolinate synthase (DHPS). In order to modify the flux through the aspartate family pathway in barley and enhance...... the accumulation of the corresponding amino acids, we have generated transgenic barley plants that constitutively express mutant Escherichia coli genes encoding lysine feed-back insensitive forms of AK and DHPS. As a result, leaves of primary transformants (T0) exhibited a 14-fold increase of free lysine and an 8......, no differences were observed in the composition of total amino acids. The introduced genes were inherited in the T1 generation where enzymic activities revealed a 2.3-fold increase of AK activity and a 4.0-9.5-fold increase for DHPS. T1 seeds of DHPS transformants showed the same changes in free amino acids...

Delineating the structural, functional and evolutionary relationships of sucrose phosphate synthase gene family II in wheat and related grasses

Directory of Open Access Journals (Sweden)

Khalil Zaynali

2010-06-01

Full Text Available Abstract Background Sucrose phosphate synthase (SPS is an important component of the plant sucrose biosynthesis pathway. In the monocotyledonous Poaceae, five SPS genes have been identified. Here we present a detailed analysis of the wheat SPSII family in wheat. A set of homoeologue-specific primers was developed in order to permit both the detection of sequence variation, and the dissection of the individual contribution of each homoeologue to the global expression of SPSII. Results The expression in bread wheat over the course of development of various sucrose biosynthesis genes monitored on an Affymetrix array showed that the SPS genes were regulated over time and space. SPSII homoeologue-specific assays were used to show that the three homoeologues contributed differentially to the global expression of SPSII. Genetic mapping placed the set of homoeoloci on the short arms of the homoeologous group 3 chromosomes. A resequencing of the A and B genome copies allowed the detection of four haplotypes at each locus. The 3B copy includes an unspliced intron. A comparison of the sequences of the wheat SPSII orthologues present in the diploid progenitors einkorn, goatgrass and Triticum speltoides, as well as in the more distantly related species barley, rice, sorghum and purple false brome demonstrated that intronic sequence was less well conserved than exonic. Comparative sequence and phylogenetic analysis of SPSII gene showed that false purple brome was more similar to Triticeae than to rice. Wheat - rice synteny was found to be perturbed at the SPS region. Conclusion The homoeologue-specific assays will be suitable to derive associations between SPS functionality and key phenotypic traits. The amplicon sequences derived from the homoeologue-specific primers are informative regarding the evolution of SPSII in a polyploid context.

Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

Science.gov (United States)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

Genome-wide identification, functional and evolutionary analysis of terpene synthases in pineapple.

Science.gov (United States)

Chen, Xiaoe; Yang, Wei; Zhang, Liqin; Wu, Xianmiao; Cheng, Tian; Li, Guanglin

2017-10-01

Terpene synthases (TPSs) are vital for the biosynthesis of active terpenoids, which have important physiological, ecological and medicinal value. Although terpenoids have been reported in pineapple (Ananas comosus), genome-wide investigations of the TPS genes responsible for pineapple terpenoid synthesis are still lacking. By integrating pineapple genome and proteome data, twenty-one putative terpene synthase genes were found in pineapple and divided into five subfamilies. Tandem duplication is the cause of TPS gene family duplication. Furthermore, functional differentiation between each TPS subfamily may have occurred for several reasons. Sixty-two key amino acid sites were identified as being type-II functionally divergence between TPS-a and TPS-c subfamily. Finally, coevolution analysis indicated that multiple amino acid residues are involved in coevolutionary processes. In addition, the enzyme activity of two TPSs were tested. This genome-wide identification, functional and evolutionary analysis of pineapple TPS genes provide a new insight into understanding the roles of TPS family and lay the basis for further characterizing the function and evolution of TPS gene family. Copyright © 2017 Elsevier Ltd. All rights reserved.

Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

Directory of Open Access Journals (Sweden)

Meng eWang

2013-05-01

Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

Science.gov (United States)

Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

2015-01-01

Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

Energy Technology Data Exchange (ETDEWEB)

Somerville, Chris R.; Scieble, Wolf

2000-10-11

Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

DEFF Research Database (Denmark)

von Wettstein, Penny

2017-01-01

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

Nitric oxide synthase gene G298 allele

International Nuclear Information System (INIS)

Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

2004-01-01

Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

Molecular cloning of a seed specific multifunctional RFO synthase/ galactosylhydrolase in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Roman eGangl

2015-09-01

Full Text Available Stachyose is among the raffinose family oligosaccharides one of the major water-soluble carbohydrates next to sucrose in seeds of a number of plant species. Especially in leguminous seeds, e.g. chickpea, stachyose is reported as the major component. In contrast to their ambiguous potential as essential source of carbon for germination, raffinose family oligosaccharides are indigestible for humans and can contribute to diverse abdominal disorders.In the genome of Arabidopsis thaliana, six putative raffinose synthase genes are reported, whereas little is known about these putative raffinose synthases and their biochemical characteristics or their contribution to the raffinose family oligosaccharide physiology in A. thaliana.In this paper, we report on the molecular cloning, functional expression in Escherichia coli and purification of recombinant AtRS4 from A. thaliana and the biochemical characterisation of the putative stachyose synthase (AtSTS, At4g01970 as a raffinose and high affinity stachyose synthase (Km for raffinose 259.2 ± 21.15 µM as well as stachyose and galactinol specific galactosylhydrolase. A T-DNA insertional mutant in the AtRS4 gene was isolated. Only sqPCR from WT siliques showed a specific transcriptional AtRS4 PCR product. Metabolite measurements in seeds of ΔAtRS4 mutant plants revealed a total loss of stachyose in ΔAtRS4 mutant seeds. We conclude that AtRS4 is the only stachyose synthase in the genome of A. thaliana that AtRS4 represents a key regulation mechanism in the raffinose family oligosaccharide physiology of A. thaliana due to its multifunctional enzyme activity and that AtRS4 is possibly the second seed specific raffinose synthase beside AtRS5, which is responsible for Raf-accumulation under abiotic stress.

The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

Science.gov (United States)

von Wettstein-Knowles, Penny

2017-07-10

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

DEFF Research Database (Denmark)

Edman, U; Edman, J C; Lundgren, B

1989-01-01

The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

Energy Technology Data Exchange (ETDEWEB)

Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

2014-03-07

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

International Nuclear Information System (INIS)

Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

2014-01-01

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

Science.gov (United States)

Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

2016-12-01

Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

Science.gov (United States)

Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

2017-02-01

Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

Isolation of MA-ACS Gene Family and Expression Study of MA-ACS1 Gene in Musa acuminata Cultivar Pisang Ambon Lumut

Directory of Open Access Journals (Sweden)

LISTYA UTAMI KARMAWAN

2009-03-01

Full Text Available Musa acuminata cultivar pisang ambon lumut is a native climacteric fruit from Indonesia. Climacteric fruit ripening process is triggered by the gaseous plant hormone ethylene. The rate limiting enzyme involved in ethylene biosynthesis is ACC synthase (ACS which is encoded by ACS gene family. The objective of this study is to identify MA-ACS gene family in M. acuminata cultivar pisang ambon lumut and to study the MA-ACS1 gene expression. The result showed that there were nine M. acuminata ACS gene family members called MA-ACS1–9. Two of them (MA-ACS1 and MA-ACS2 were assessed using reverse transcriptase PCR (RT-PCR for gene expression study and it was only MA-ACS1 correlated with fruit ripening. The MA-ACS1 gene fragment has been successfully isolated and characterized and it has three introns, four exons, and one stop codon. It also shows highest homology with MACS1 gene from M. acuminata cultivar Hsian Jien Chiao (GenBank accession number AF056164. Expression analysis of MA-ACS1 using quantitative PCR (qPCR showed that MA-ACS1 gene expression increased significantly in the third day, reached maximum at the fifth day, and then decreased in the seventh day after harvesting. The qPCR expression analysis result correlated with the result of physical analysis during fruit ripening.

Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

Energy Technology Data Exchange (ETDEWEB)

Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

1995-08-28

Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

Science.gov (United States)

Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

2015-12-01

Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Cloning and characterization of ATP synthase CF1 α gene from ...

African Journals Online (AJOL)

ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

Evolution and functional insights of different ancestral orthologous clades of chitin synthase genes in the fungal tree of life

Directory of Open Access Journals (Sweden)

Mu eLi

2016-02-01

Full Text Available Chitin synthases (CHSs are key enzymes in the biosynthesis of chitin, an important structural component of fungal cell walls that can trigger innate immune responses in host plants and animals. Members of CHS gene family perform various functions in fungal cellular processes. Previous studies focused primarily on classifying diverse CHSs into different classes, regardless of their functional diversification, or on characterizing their functions in individual fungal species. A complete and systematic comparative analysis of CHS genes based on their orthologous relationships will be valuable for elucidating the evolution and functions of different CHS genes in fungi. Here, we identified and compared members of the CHS gene family across the fungal tree of life, including 18 divergent fungal lineages. Phylogenetic analysis revealed that the fungal CHS gene family is comprised of at least 10 ancestral orthologous clades, which have undergone multiple independent duplications and losses in different fungal lineages during evolution. Interestingly, one of these CHS clades (class III was expanded in plant or animal pathogenic fungi belonging to different fungal lineages. Two clades (classes VIb and VIc identified for the first time in this study occurred mainly in plant pathogenic fungi from Sordariomycetes and Dothideomycetes. Moreover, members of classes III and VIb were specifically up-regulated during plant infection, suggesting important roles in pathogenesis. In addition, CHS-associated networks conserved among plant pathogenic fungi are involved in various biological processes, including sexual reproduction and plant infection. We also identified specificity-determining sites, many of which are located at or adjacent to important structural and functional sites that are potentially responsible for functional divergence of different CHS classes. Overall, our results provide new insights into the evolution and function of members of CHS gene

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

Science.gov (United States)

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Disruption of ATCSLD5 results in reduced growth, reduced xylan and homogalacturonan synthase activity and altered xylan occurrence in Arabidopsis

DEFF Research Database (Denmark)

Bernal Giraldo, Adriana Jimena; Jensen, Jacob Krüger; Harholt, Jesper

2007-01-01

Members of a large family of cellulose synthase-like genes (CSLs) are predicted to encode glycosyl transferases (GTs) involved in the biosynthesis of plant cell walls. The CSLA and CSLF families are known to contain mannan and glucan synthases, respectively, but the products of other CSLs...... are unknown. Here we report the effects of disrupting ATCSLD5 expression in Arabidopsis. Both stem and root growth were significantly reduced in ATCSLD5 knock-out plants, and these plants also had increased susceptibility to the cellulose synthase inhibitor isoxaben. Antibody and carbohydrate-binding module...

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

OpenAIRE

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

Polymorphisms in nitric oxide synthase and endothelin genes among children with obstructive sleep apnea.

Science.gov (United States)

Chatsuriyawong, Siriporn; Gozal, David; Kheirandish-Gozal, Leila; Bhattacharjee, Rakesh; Khalyfa, Ahamed A; Wang, Yang; Sukhumsirichart, Wasana; Khalyfa, Abdelnaby

2013-09-06

Obstructive sleep apnea (OSA) is associated with adverse and interdependent cognitive and cardiovascular consequences. Increasing evidence suggests that nitric oxide synthase (NOS) and endothelin family (EDN) genes underlie mechanistic aspects of OSA-associated morbidities. We aimed to identify single nucleotide polymorphisms (SNPs) in the NOS family (3 isoforms), and EDN family (3 isoforms) to identify potential associations of these SNPs in children with OSA. A pediatric community cohort (ages 5-10 years) enriched for snoring underwent overnight polysomnographic (NPSG) and a fasting morning blood draw. The diagnostic criteria for OSA were an obstructive apnea-hypopnea Index (AHI) >2/h total sleep time (TST), snoring during the night, and a nadir oxyhemoglobin saturation DNA from peripheral blood was extracted and allelic frequencies were assessed for, NOS1 (209 SNPs), NOS2 (122 SNPs), NOS3 (50 SNPs), EDN1 (43 SNPs), EDN2 (48 SNPs), EDN3 (14 SNPs), endothelin receptor A, EDNRA, (27 SNPs), and endothelin receptor B, EDNRB (23 SNPs) using a custom SNPs array. The relative frequencies of NOS-1,-2, and -3, and EDN-1,-2,-3,-EDNRA, and-EDNRB genotypes were evaluated in 608 subjects [128 with OSA, and 480 without OSA (NOSA)]. Furthermore, subjects with OSA were divided into 2 subgroups: OSA with normal endothelial function (OSA-NEF), and OSA with endothelial dysfunction (OSA-ED). Linkage disequilibrium was analyzed using Haploview version 4.2 software. For NOSA vs. OSA groups, 15 differentially distributed SNPs for NOS1 gene, and 1 SNP for NOS3 emerged, while 4 SNPs for EDN1 and 1 SNP for both EDN2 and EDN3 were identified. However, in the smaller sub-group for whom endothelial function was available, none of the significant SNPs was retained due to lack of statistical power. Differences in the distribution of polymorphisms among NOS and EDN gene families suggest that these SNPs could play a contributory role in the pathophysiology and risk of OSA-induced cardiovascular

The chalcone synthase multigene family of Petunia hybrida (V30): differential, light-regulated expression during flower development and UV light induction

International Nuclear Information System (INIS)

Koes, R.E.; Spelt, C.E.; Mol, J.N.M.

1989-01-01

We have analysed the expression of the 8-10 members of the gene family encoding the flavonoid biosynthetic enzyme chalcone synthase (CHS) from Petunia hybrida. During normal plant development only two members of the gene family (CHS-A and CHS-J) are expressed. Their expression is restricted to floral tissues mainly. About 90% of the total CHS mRNA pool is transcribed from CHS-A, wheares CHS-J delivers about 10% in flower corolla, tube and anthers. Expression of CHS-A and CHS-J during flower development is coordinated and (red) light-dependent. In young seedlings and cell suspension cultures expression of CHS-A and CHS-J can be induced with UV light. In addition to CHS-A and CHS-J, expression of another two CHS genes (CHS-B and CHS-G) is induced in young seedlings by UV light, albeit at a low level. In contrast to CHS genes from Leguminoseae, Petunia CHS genes are not inducible by phytopathogen-derived elicitors. Expression of CHS-A and CHS-J is reduced to a similar extent in a regulatory CHS mutant, Petunia hybrida Red Star, suggesting that both genes are regulated by the same trans-acting factors. Comparison of the promoter sequences of CHS-A and CHS-J reveals some striking homologies, which might represent cis-acting regulatory sequences. (author)

Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

International Nuclear Information System (INIS)

Rothenberg, M.; Hanson, M.R.

1988-01-01

A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

Science.gov (United States)

Cascini, Fidelia; Passerotti, Stella; Martello, Simona

2012-04-10

In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

Directory of Open Access Journals (Sweden)

Yanjing Su

2012-06-01

Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

Gene cluster statistics with gene families.

Science.gov (United States)

Raghupathy, Narayanan; Durand, Dannie

2009-05-01

Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

PCR screening reveals considerable unexploited biosynthetic potential of ansamycins and a mysterious family of AHBA-containing natural products in actinomycetes.

Science.gov (United States)

Wang, H-X; Chen, Y-Y; Ge, L; Fang, T-T; Meng, J; Liu, Z; Fang, X-Y; Ni, S; Lin, C; Wu, Y-Y; Wang, M-L; Shi, N-N; He, H-G; Hong, K; Shen, Y-M

2013-07-01

Ansamycins are a family of macrolactams that are synthesized by type I polyketide synthase (PKS) using 3-amino-5-hydroxybenzoic acid (AHBA) as the starter unit. Most members of the family have strong antimicrobial, antifungal, anticancer and/or antiviral activities. We aimed to discover new ansamycins and/or other AHBA-containing natural products from actinobacteria. Through PCR screening of AHBA synthase gene, we identified 26 AHBA synthase gene-positive strains from 206 plant-associated actinomycetes (five positives) and 688 marine-derived actinomycetes (21 positives), representing a positive ratio of 2·4-3·1%. Twenty-five ansamycins, including eight new compounds, were isolated from six AHBA synthase gene-positive strains through TLC-guided fractionations followed by repeated column chromatography. To gain information about those potential ansamycin gene clusters whose products were unknown, seven strains with phylogenetically divergent AHBA synthase genes were subjected to fosmid library construction. Of the seven gene clusters we obtained, three show characteristics for typical ansamycin gene clusters, and other four, from Micromonospora spp., appear to lack the amide synthase gene, which is unusual for ansamycin biosynthesis. The gene composition of these four gene clusters suggests that they are involved in the biosynthesis of a new family of hybrid PK-NRP compounds containing AHBA substructure. PCR screening of AHBA synthase is an efficient approach to discover novel ansamycins and other AHBA-containing natural products. This work demonstrates that the AHBA-based screening method is a useful approach for discovering novel ansamycins and other AHBA-containing natural products from new microbial resources. Journal of Applied Microbiology © 2013 The Society for Applied Microbiology.

The Caenorhabditis chemoreceptor gene families

Directory of Open Access Journals (Sweden)

Robertson Hugh M

2008-10-01

Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

The Caenorhabditis chemoreceptor gene families.

Science.gov (United States)

Thomas, James H; Robertson, Hugh M

2008-10-06

Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

OpenAIRE

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

Genome-Wide Comparative Gene Family Classification

Science.gov (United States)

Frech, Christian; Chen, Nansheng

2010-01-01

Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

Science.gov (United States)

Flynn, Christopher M; Schmidt-Dannert, Claudia

2018-06-01

The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

DEFF Research Database (Denmark)

Vestergaard, H; Lund, S; Bjørbaek, C

1995-01-01

We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

The CSLA and CSLC Families: Recent Advances and Future Perspectives

Directory of Open Access Journals (Sweden)

Aaron Howard Liepman

2012-05-01

Full Text Available The CELLULOSE SYNTHASE (CESA superfamily of proteins contains several sub-families of closely related CELLULOSE SYNTHASE-LIKE (CSL sequences, Among these, the CSLA and CSLC families are closely related to each other and are the most evolutionarily divergent from the CESA family. Significant progress has been made with the functional characterization of CSLA and CSLC genes, which have been shown to encode enzymes with 1,4-B-glycan synthase activities involved in the biosynthesis of mannan and possibly xyloglucan backbones, respectively. This review examines recent work on the CSLA and CSLC families from evolutionary, molecular, and biochemical perspectives. We pose a series of questions, whose answers likely will provide further insight about the specific functions of members of the CSLA and CSLC families and about plant polysaccharide biosynthesis is general.

Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

Directory of Open Access Journals (Sweden)

R. Vasudevan

2014-06-01

Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

Directory of Open Access Journals (Sweden)

Xiudao Yu

2013-10-01

Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

Science.gov (United States)

Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

2013-03-01

Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

carboxylate synthase gene family in Arabidopsis, rice, grapevine

African Journals Online (AJOL)

Yomi

2012-01-16

Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

Science.gov (United States)

Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

2014-01-13

Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

Directory of Open Access Journals (Sweden)

Mariateresa eVolpicella

2016-03-01

Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

Science.gov (United States)

Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

2014-01-01

Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne

2004-01-01

The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

Science.gov (United States)

Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

2012-06-01

Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

Directory of Open Access Journals (Sweden)

Piotr Szymczyk

2016-09-01

Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

DEFF Research Database (Denmark)

Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

2008-01-01

A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

DEFF Research Database (Denmark)

Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

2016-01-01

identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

Science.gov (United States)

Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

2016-02-10

In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

A Genome-Wide Association Study for Culm Cellulose Content in Barley Reveals Candidate Genes Co-Expressed with Members of the CELLULOSE SYNTHASE A Gene Family

Science.gov (United States)

Houston, Kelly; Burton, Rachel A.; Sznajder, Beata; Rafalski, Antoni J.; Dhugga, Kanwarpal S.; Mather, Diane E.; Taylor, Jillian; Steffenson, Brian J.; Waugh, Robbie; Fincher, Geoffrey B.

2015-01-01

Cellulose is a fundamentally important component of cell walls of higher plants. It provides a scaffold that allows the development and growth of the plant to occur in an ordered fashion. Cellulose also provides mechanical strength, which is crucial for both normal development and to enable the plant to withstand both abiotic and biotic stresses. We quantified the cellulose concentration in the culm of 288 two – rowed and 288 six – rowed spring type barley accessions that were part of the USDA funded barley Coordinated Agricultural Project (CAP) program in the USA. When the population structure of these accessions was analysed we identified six distinct populations, four of which we considered to be comprised of a sufficient number of accessions to be suitable for genome-wide association studies (GWAS). These lines had been genotyped with 3072 SNPs so we combined the trait and genetic data to carry out GWAS. The analysis allowed us to identify regions of the genome containing significant associations between molecular markers and cellulose concentration data, including one region cross-validated in multiple populations. To identify candidate genes we assembled the gene content of these regions and used these to query a comprehensive RNA-seq based gene expression atlas. This provided us with gene annotations and associated expression data across multiple tissues, which allowed us to formulate a supported list of candidate genes that regulate cellulose biosynthesis. Several regions identified by our analysis contain genes that are co-expressed with CELLULOSE SYNTHASE A (HvCesA) across a range of tissues and developmental stages. These genes are involved in both primary and secondary cell wall development. In addition, genes that have been previously linked with cellulose synthesis by biochemical methods, such as HvCOBRA, a gene of unknown function, were also associated with cellulose levels in the association panel. Our analyses provide new insights into the

High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

Directory of Open Access Journals (Sweden)

Mariela V Catone

Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

Directory of Open Access Journals (Sweden)

Michelle F. Valentine

2017-05-01

Full Text Available Soybean [Glycine max (L. Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2, to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets.

Silencing of Soybean Raffinose Synthase Gene Reduced Raffinose Family Oligosaccharides and Increased True Metabolizable Energy of Poultry Feed

Science.gov (United States)

Valentine, Michelle F.; De Tar, Joann R.; Mookkan, Muruganantham; Firman, Jeffre D.; Zhang, Zhanyuan J.

2017-01-01

Soybean [Glycine max (L.) Merr.] is the number one oil and protein crop in the United States, but the seed contains several anti-nutritional factors that are toxic to both humans and livestock. RNA interference technology has become an increasingly popular technique in gene silencing because it allows for both temporal and spatial targeting of specific genes. The objective of this research is to use RNA-mediated gene silencing to down-regulate the soybean gene raffinose synthase 2 (RS2), to reduce total raffinose content in mature seed. Raffinose is a trisaccharide that is indigestible to humans and monogastric animals, and as monogastric animals are the largest consumers of soy products, reducing raffinose would improve the nutritional quality of soybean. An RNAi construct targeting RS2 was designed, cloned, and transformed to the soybean genome via Agrobacterium-mediated transformation. Resulting plants were analyzed for the presence and number of copies of the transgene by PCR and Southern blot. The efficiency of mRNA silencing was confirmed by real-time quantitative PCR. Total raffinose content was determined by HPLC analysis. Transgenic plant lines were recovered that exhibited dramatically reduced levels of raffinose in mature seed, and these lines were further analyzed for other phenotypes such as development and yield. Additionally, a precision-fed rooster assay was conducted to measure the true metabolizable energy (TME) in full-fat soybean meal made from the wild-type or transgenic low-raffinose soybean lines. Transgenic low-raffinose soy had a measured TME of 2,703 kcal/kg, an increase as compared with 2,411 kcal/kg for wild-type. As low digestible energy is a major limiting factor in the percent of soybean meal that can be used in poultry diets, these results may substantiate the use of higher concentrations of low-raffinose, full-fat soy in formulated livestock diets. PMID:28559898

The cellulose synthase companion proteins act non-redundantly with CELLULOSE SYNTHASE INTERACTING1/POM2 and CELLULOSE SYNTHASE 6

OpenAIRE

Endler, Anne; Schneider, Rene; Kesten, Christopher; Lampugnani, Edwin R.; Persson, Staffan

2016-01-01

Cellulose is a cell wall constituent that is essential for plant growth and development, and an important raw material for a range of industrial applications. Cellulose is synthesized at the plasma membrane by massive cellulose synthase (CesA) complexes that track along cortical microtubules in elongating cells of Arabidopsis through the activity of the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1). In a recent study we identified another family of proteins that also are associated with the ...

Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

Science.gov (United States)

Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

2016-03-01

Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

Directory of Open Access Journals (Sweden)

Bua-In Saowaluck

2014-01-01

Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

Personalized Nutrition-Genes, Diet, and Related Interactive Parameters as Predictors of Cancer in Multiethnic Colorectal Cancer Families.

Science.gov (United States)

Shiao, S Pamela K; Grayson, James; Lie, Amanda; Yu, Chong Ho

2018-06-20

To personalize nutrition, the purpose of this study was to examine five key genes in the folate metabolism pathway, and dietary parameters and related interactive parameters as predictors of colorectal cancer (CRC) by measuring the healthy eating index (HEI) in multiethnic families. The five genes included methylenetetrahydrofolate reductase ( MTHFR ) 677 and 1298, methionine synthase ( MTR ) 2756, methionine synthase reductase ( MTRR 66), and dihydrofolate reductase ( DHFR ) 19bp , and they were used to compute a total gene mutation score. We included 53 families, 53 CRC patients and 53 paired family friend members of diverse population groups in Southern California. We measured multidimensional data using the ensemble bootstrap forest method to identify variables of importance within domains of genetic, demographic, and dietary parameters to achieve dimension reduction. We then constructed predictive generalized regression (GR) modeling with a supervised machine learning validation procedure with the target variable (cancer status) being specified to validate the results to allow enhanced prediction and reproducibility. The results showed that the CRC group had increased total gene mutation scores compared to the family members ( p < 0.05). Using the Akaike's information criterion and Leave-One-Out cross validation GR methods, the HEI was interactive with thiamine (vitamin B1), which is a new finding for the literature. The natural food sources for thiamine include whole grains, legumes, and some meats and fish which HEI scoring included as part of healthy portions (versus limiting portions on salt, saturated fat and empty calories). Additional predictors included age, as well as gender and the interaction of MTHFR 677 with overweight status (measured by body mass index) in predicting CRC, with the cancer group having more men and overweight cases. The HEI score was significant when split at the median score of 77 into greater or less scores, confirmed through

Expansion, retention and loss in the Acyl-CoA synthetase "Bubblegum" (Acsbg) gene family in vertebrate history.

Science.gov (United States)

Lopes-Marques, Mónica; Machado, André M; Ruivo, Raquel; Fonseca, Elza; Carvalho, Estela; Castro, L Filipe C

2018-07-20

Fatty acids (FAs) constitute a considerable fraction of all lipid molecules with a fundamental role in numerous physiological processes. In animals, the majority of complex lipid molecules are derived from the transformation of FAs through several biochemical pathways. Yet, for FAs to enroll in these pathways they require an activation step. FA activation is catalyzed by the rate limiting action of Acyl-CoA synthases. Several Acyl-CoA enzyme families have been previously described and classified according to the chain length of FAs they process. Here, we address the evolutionary history of the ACSBG gene family which activates, FAs with >16 carbons. Currently, two different ACSBG gene families, ACSBG1 and ACSBG2, are recognized in vertebrates. We provide evidence that a wider and unequal ACSBG gene repertoire is present in vertebrate lineages. We identify a novel ACSBG-like gene lineage which occurs specifically in amphibians, ray finned fishes, coelacanths and cartilaginous fishes named ACSBG3. Also, we show that the ACSBG2 gene lineage duplicated in the Theria ancestor. Our findings, thus offer a far richer understanding on FA activation in vertebrates and provide key insights into the relevance of comparative and functional analysis to perceive physiological differences, namely those related with lipid metabolic pathways. Copyright © 2018 Elsevier B.V. All rights reserved.

Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

Science.gov (United States)

Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

2017-08-09

Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

Gene structure, phylogeny and expression profile of the sucrose ...

Indian Academy of Sciences (India)

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in .... 24, 701–713. Bate N. and Twell D. 1998 Functional architecture of a late pollen .... Manzara T. and Gruissem W. 1988 Organization and expression.

Characterization of the serine acetyltransferase gene family of Vitis vinifera uncovers differences in regulation of OAS synthesis in woody plants

OpenAIRE

Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara

2015-01-01

In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family...

Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

Science.gov (United States)

Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

2011-10-01

Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

Comparative study of Chalcone synthase promoters across plant families

Directory of Open Access Journals (Sweden)

Francisco Buitrago

2009-07-01

Full Text Available En la era post-genómica, el entendimiento de la regulación génica se ha convertido en un reto y una prioridad de investigación. En este trabajo realizamos un estudio comparativo de las secuencias reguladoras del gen de la chalcón sintetasa de varias familias botánicas. Veintidós secuencias de promotores de Chalcone Synthase fueron comparados teniendo en cuenta tres elementos Cis reguladores: Caja-G, Caja-H y Caja-TATA, que podrían estar actuando como una sola unidad cooperativa. Nuestra comparación muestra que estos elementos puede que se conserven en algunas especies e inclusive que se conserven a nivel de familia. Sin embargo, en algunas especies no todos los elementos Cis fueron encontrados, mostrando que no todas las especies se regulan bajo los mismos parámetros. Adicionalmente, una comparación entre promotores de una misma especie con una familia de multigenes Chs, mostró que los genes duplicados son variables en la composición del elemento Cis, sugiriendo que estos genes pueden estarse expresando de maneras diferentes.

Sunflower (Helianthus annuus) fatty acid synthase complex: enoyl-[acyl carrier protein]-reductase genes.

Science.gov (United States)

González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

2015-01-01

Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.

Phylogenomic and functional domain analysis of polyketide synthases in Fusarium

Energy Technology Data Exchange (ETDEWEB)

Brown, Daren W.; Butchko, Robert A.; Baker, Scott E.; Proctor, Robert H.

2012-02-01

Fusarium species are ubiquitous in nature, cause a range of plant diseases, and produce a variety of chemicals often referred to as secondary metabolites. Although some fungal secondary metabolites affect plant growth or protect plants from other fungi and bacteria, their presence in grain based food and feed is more often associated with a variety of diseases in plants and in animals. Many of these structurally diverse metabolites are derived from a family of related enzymes called polyketide synthases (PKSs). A search of genomic sequence of Fusarium verticillioides, F. graminearum, F. oxysporum and Nectria haematococca (anamorph F. solani) identified a total of 58 PKS genes. To gain insight into how this gene family evolved and to guide future studies, we conducted a phylogenomic and functional domain analysis. The resulting genealogy suggested that Fusarium PKSs represent 34 different groups responsible for synthesis of different core metabolites. The analyses indicate that variation in the Fusarium PKS gene family is due to gene duplication and loss events as well as enzyme gain-of-function due to the acquisition of new domains or of loss-of-function due to nucleotide mutations. Transcriptional analysis indicate that the 16 F. verticillioides PKS genes are expressed under a range of conditions, further evidence that they are functional genes that confer the ability to produce secondary metabolites.

Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

Directory of Open Access Journals (Sweden)

Gnanasambandan Ramanathan

2017-01-01

Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

Science.gov (United States)

Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

2016-06-01

Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

Science.gov (United States)

Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

2016-11-18

Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

OpenAIRE

Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

2012-01-01

The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

Identification of Cannabis sativa L. using the 1-kbTHCA synthase-fluorescence in situ hybridization probe.

Science.gov (United States)

Jeangkhwoa, Pattraporn; Bandhaya, Achirapa; Umpunjun, Puangpaka; Chuenboonngarm, Ngarmnij; Panvisavas, Nathinee

2017-03-01

This study reports a successful application of fluorescence in situ hybridization (FISH) technique in the identification of Cannabis sativa L. cells recovered from fresh and dried powdered plant materials. Two biotin-16-dUTP-labeled FISH probes were designed from the Cannabis-specific tetrahydrocannabinolic acid synthase (THCAS) gene and the ITS region of the 45S rRNA gene. Specificity of probe-target hybridization was tested against the target and 4 non-target plant species, i.e., Humulus lupulus, Mitragyna speciosa, Papaver sp., and Nicotiana tabacum. The 1-kb THCA synthase hybridization probe gave Cannabis-specific hybridization signals, unlike the 700-bp Cannabis-ITS hybridization probe. Probe-target hybridization was also confirmed against 20 individual Cannabis plant samples. The 1-kb THCA synthase and 700-bp Cannabis-ITS hybridization probes clearly showed 2 hybridization signals per cell with reproducibility. The 1-kb THCA synthase probe did not give any FISH signal when tested against H. lupulus, its closely related member of the Canabaceae family. It was also showed that 1-kb THCA synthase FISH probe can be applied to identify small amount of dried powdered Cannabis material with an addition of rehydration step prior to the experimental process. This study provided an alternative identification method for Cannabis trace. Copyright © 2016. Published by Elsevier B.V.

Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

DEFF Research Database (Denmark)

Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

2003-01-01

The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

Directory of Open Access Journals (Sweden)

Bin Wang

2010-07-01

Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA) Genes in Flax (Linum usitatissimum L.).

Science.gov (United States)

Yurkevich, Olga Y; Kirov, Ilya V; Bolsheva, Nadezhda L; Rachinskaya, Olga A; Grushetskaya, Zoya E; Zoschuk, Svyatoslav A; Samatadze, Tatiana E; Bogdanova, Marina V; Lemesh, Valentina A; Amosova, Alexandra V; Muravenko, Olga V

2017-01-01

Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase ( CesA ) multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH)-based chromosomal localization of the CesA conserved fragment (KF011584.1), 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum . Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG) 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

Science.gov (United States)

Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

2013-03-01

Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

Science.gov (United States)

Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

2018-04-01

Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

Chitinase-like (CTL) and cellulose synthase (CESA) gene expression in gelatinous-type cellulosic walls of flax (Linum usitatissimum L.) bast fibers.

Science.gov (United States)

Mokshina, Natalia; Gorshkova, Tatyana; Deyholos, Michael K

2014-01-01

Plant chitinases (EC 3.2.1.14) and chitinase-like (CTL) proteins have diverse functions including cell wall biosynthesis and disease resistance. We analyzed the expression of 34 chitinase and chitinase-like genes of flax (collectively referred to as LusCTLs), belonging to glycoside hydrolase family 19 (GH19). Analysis of the transcript expression patterns of LusCTLs in the stem and other tissues identified three transcripts (LusCTL19, LusCTL20, LusCTL21) that were highly enriched in developing bast fibers, which form cellulose-rich gelatinous-type cell walls. The same three genes had low relative expression in tissues with primary cell walls and in xylem, which forms a xylan type of secondary cell wall. Phylogenetic analysis of the LusCTLs identified a flax-specific sub-group that was not represented in any of other genomes queried. To provide further context for the gene expression analysis, we also conducted phylogenetic and expression analysis of the cellulose synthase (CESA) family genes of flax, and found that expression of secondary wall-type LusCESAs (LusCESA4, LusCESA7 and LusCESA8) was correlated with the expression of two LusCTLs (LusCTL1, LusCTL2) that were the most highly enriched in xylem. The expression of LusCTL19, LusCTL20, and LusCTL21 was not correlated with that of any CESA subgroup. These results defined a distinct type of CTLs that may have novel functions specific to the development of the gelatinous (G-type) cellulosic walls.

Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

Directory of Open Access Journals (Sweden)

Maria V. Fernández

2018-04-01

Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-01-01

Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Directory of Open Access Journals (Sweden)

Roslyn D Noar

Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

Science.gov (United States)

Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

2018-03-06

Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

Directory of Open Access Journals (Sweden)

Ritland Carol

2009-08-01

Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

Science.gov (United States)

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The

Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

Directory of Open Access Journals (Sweden)

Resnanti Utami Handayani

2014-07-01

Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications.

Science.gov (United States)

Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila

2014-05-01

Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

Science.gov (United States)

Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

2014-10-01

Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

Science.gov (United States)

Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

2017-12-01

An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

Different patterns of gene expression in rice varieties undergoing a ...

African Journals Online (AJOL)

Some genes specifically up-regulated in infected 9804-Rxo1 were defenserelated, including the genes encoding pathogenesis-related protein, terpene synthase family, transcription factors (TFs) AP2 domain containing protein, myb-like deoxyribonucleic acid (DNA)- binding domain containing protein, and C2H2-type ...

Integration of Physical, Genetic, and Cytogenetic Mapping Data for Cellulose Synthase (CesA Genes in Flax (Linum usitatissimum L.

Directory of Open Access Journals (Sweden)

Olga Y. Yurkevich

2017-08-01

Full Text Available Flax, Linum usitatissimum L., is a valuable multi-purpose plant, and currently, its genome is being extensively investigated. Nevertheless, mapping of genes in flax genome is still remaining a challenging task. The cellulose synthase (CesA multigene family involving in the process of cellulose synthesis is especially important for metabolism of this fiber crop. For the first time, fluorescent in situ hybridization (FISH-based chromosomal localization of the CesA conserved fragment (KF011584.1, 5S, and 26S rRNA genes was performed in landrace, oilseed, and fiber varieties of L. usitatissimum. Intraspecific polymorphism in chromosomal distribution of KF011584.1 and 5S DNA loci was revealed, and the generalized chromosome ideogram was constructed. Using BLAST analysis, available data on physical/genetic mapping and also whole-genome sequencing of flax, localization of KF011584.1, 45S, and 5S rRNA sequences on genomic scaffolds, and their anchoring to the genetic map were conducted. The alignment of the results of FISH and BLAST analyses indicated that KF011584.1 fragment revealed on chromosome 3 could be anchored to linkage group (LG 11. The common LG for 45S and 5S rDNA was not found probably due to the polymorphic localization of 5S rDNA on chromosome 1. Our findings indicate the complexity of integration of physical, genetic, and cytogenetic mapping data for multicopy gene families in plants. Nevertheless, the obtained results can be useful for future progress in constructing of integrated physical/genetic/cytological maps in L. usitatissimum which are essential for flax breeding.

Molecular evolution of flavonoid dioxygenases in the family Apiaceae.

Science.gov (United States)

Gebhardt, Yvonne; Witte, Simone; Forkmann, Gert; Lukacin, Richard; Matern, Ulrich; Martens, Stefan

2005-06-01

Plant species of the family Apiaceae are known to accumulate flavonoids mainly in the form of flavones and flavonols. Three 2-oxoglutarate-dependent dioxygenases, flavone synthase or flavanone 3 beta-hydroxylase and flavonol synthase are involved in the biosynthesis of these secondary metabolites. The corresponding genes were cloned recently from parsley (Petroselinum crispum) leaves. Flavone synthase I appears to be confined to the Apiaceae, and the unique occurrence as well as its high sequence similarity to flavanone 3beta-hydroxylase laid the basis for evolutionary studies. In order to examine the relationship of these two enzymes throughout the Apiaceae, RT-PCR based cloning and functional identification of flavone synthases I or flavanone 3beta-hydroxylases were accomplished from Ammi majus, Anethum graveolens, Apium graveolens, Pimpinella anisum, Conium maculatum and Daucus carota, yielding three additional synthase and three additional hydroxylase cDNAs. Molecular and phylogenetic analyses of these sequences were compatible with the phylogeny based on morphological characteristics and suggested that flavone synthase I most likely resulted from gene duplication of flavanone 3beta-hydroxylase, and functional diversification at some point during the development of the apiaceae subfamilies. Furthermore, the genomic sequences from Petroselinum crispum and Daucus carota revealed two introns in each of the synthases and a lack of introns in the hydroxylases. These results might be explained by intron losses from the hydroxylases occurring at a later stage of evolution.

ATP Synthase Deficiency due to TMEM70 Mutation Leads to Ultrastructural Mitochondrial Degeneration and Is Amenable to Treatment

Directory of Open Access Journals (Sweden)

Anne K. Braczynski

2015-01-01

Full Text Available TMEM70 is involved in the biogenesis of mitochondrial ATP synthase and mutations in the TMEM70 gene impair oxidative phosphorylation. Herein, we report on pathology and treatment of ATP synthase deficiency in four siblings. A consanguineous family of Roma (Gipsy ethnic origin gave birth to 6 children of which 4 were affected presenting with dysmorphic features, failure to thrive, cardiomyopathy, metabolic crises, and 3-methylglutaconic aciduria as clinical symptoms. Genetic testing revealed a homozygous mutation (c.317-2A>G in the TMEM70 gene. While light microscopy was unremarkable, ultrastructural investigation of muscle tissue revealed accumulation of swollen degenerated mitochondria with lipid crystalloid inclusions, cristae aggregation, and exocytosis of mitochondrial material. Biochemical analysis of mitochondrial complexes showed an almost complete ATP synthase deficiency. Despite harbouring the same mutation, the clinical outcome in the four siblings was different. Two children died within 60 h after birth; the other two had recurrent life-threatening metabolic crises but were successfully managed with supplementation of anaplerotic amino acids, lipids, and symptomatic treatment during metabolic crisis. In summary, TMEM70 mutations can cause distinct ultrastructural mitochondrial degeneration and almost complete deficiency of ATP synthase but are still amenable to treatment.

Transcriptional expression of Stilbene synthase genes are regulated developmentally and differentially in response to powdery mildew in Norton and Cabernet Sauvignon grapevine.

Science.gov (United States)

Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping

2012-12-01

Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All

Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

International Nuclear Information System (INIS)

Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

2008-01-01

Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

NARCIS (Netherlands)

Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

2000-01-01

The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana)

Science.gov (United States)

2013-01-01

Background The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. Results We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. Conclusion In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine. PMID:23679205

Transcriptome resources and functional characterization of monoterpene synthases for two host species of the mountain pine beetle, lodgepole pine (Pinus contorta) and jack pine (Pinus banksiana).

Science.gov (United States)

Hall, Dawn E; Yuen, Macaire M S; Jancsik, Sharon; Quesada, Alfonso Lara; Dullat, Harpreet K; Li, Maria; Henderson, Hannah; Arango-Velez, Adriana; Liao, Nancy Y; Docking, Roderick T; Chan, Simon K; Cooke, Janice Ek; Breuil, Colette; Jones, Steven Jm; Keeling, Christopher I; Bohlmann, Jörg

2013-05-16

The mountain pine beetle (MPB, Dendroctonus ponderosae) epidemic has affected lodgepole pine (Pinus contorta) across an area of more than 18 million hectares of pine forests in western Canada, and is a threat to the boreal jack pine (Pinus banksiana) forest. Defence of pines against MPB and associated fungal pathogens, as well as other pests, involves oleoresin monoterpenes, which are biosynthesized by families of terpene synthases (TPSs). Volatile monoterpenes also serve as host recognition cues for MPB and as precursors for MPB pheromones. The genes responsible for terpene biosynthesis in jack pine and lodgepole pine were previously unknown. We report the generation and quality assessment of assembled transcriptome resources for lodgepole pine and jack pine using Sanger, Roche 454, and Illumina sequencing technologies. Assemblies revealed transcripts for approximately 20,000 - 30,000 genes from each species and assembly analyses led to the identification of candidate full-length prenyl transferase, TPS, and P450 genes of oleoresin biosynthesis. We cloned and functionally characterized, via expression of recombinant proteins in E. coli, nine different jack pine and eight different lodgepole pine mono-TPSs. The newly identified lodgepole pine and jack pine mono-TPSs include (+)-α-pinene synthases, (-)-α-pinene synthases, (-)-β-pinene synthases, (+)-3-carene synthases, and (-)-β-phellandrene synthases from each of the two species. In the absence of genome sequences, transcriptome assemblies are important for defence gene discovery in lodgepole pine and jack pine, as demonstrated here for the terpenoid pathway genes. The product profiles of the functionally annotated mono-TPSs described here can account for the major monoterpene metabolites identified in lodgepole pine and jack pine.

The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

Science.gov (United States)

Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

2013-05-29

Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

Science.gov (United States)

Lane, Courtney E; Benton, Michael G

2015-12-01

A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

Science.gov (United States)

Ober, Dietrich; Hartmann, Thomas

1999-01-01

Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

Identification and regulation of fusA, the polyketide synthase gene responsible for fusarin production in Fusarium fujikuroi.

Science.gov (United States)

Díaz-Sánchez, Violeta; Avalos, Javier; Limón, M Carmen

2012-10-01

Fusarins are a class of mycotoxins of the polyketide family produced by different Fusarium species, including the gibberellin-producing fungus Fusarium fujikuroi. Based on sequence comparisons between polyketide synthase (PKS) enzymes for fusarin production in other Fusarium strains, we have identified the F. fujikuroi orthologue, called fusA. The participation of fusA in fusarin biosynthesis was demonstrated by targeted mutagenesis. Fusarin production is transiently stimulated by nitrogen availability in this fungus, a regulation paralleled by the fusA mRNA levels in the cell. Illumination of the cultures results in a reduction of the fusarin content, an effect partially explained by a high sensitivity of these compounds to light. Mutants of the fusA gene exhibit no external phenotypic alterations, including morphology and conidiation, except for a lack of the characteristic yellow and/or orange pigmentation of fusarins. Moreover, the fusA mutants are less efficient than the wild type at degrading cellophane on agar cultures, a trait associated with pathogenesis functions in Fusarium oxysporum. The fusA mutants, however, are not affected in their capacities to grow on plant tissues.

A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

Science.gov (United States)

Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

2016-12-28

The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

International Nuclear Information System (INIS)

Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

2006-01-01

The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

Proto-oncogene FBI-1 (Pokemon) and SREBP-1 Synergistically Activate Transcription of Fatty-acid Synthase Gene (FASN)*S⃞

Science.gov (United States)

Choi, Won-Il; Jeon, Bu-Nam; Park, Hyejin; Yoo, Jung-Yoon; Kim, Yeon-Sook; Koh, Dong-In; Kim, Myung-Hwa; Kim, Yu-Ri; Lee, Choong-Eun; Kim, Kyung-Sup; Osborne, Timothy F.; Hur, Man-Wook

2008-01-01

FBI-1 (Pokemon/ZBTB7A) is a proto-oncogenic transcription factor of the BTB/POZ (bric-à-brac, tramtrack, and broad complex and pox virus zinc finger) domain family. Recent evidence suggested that FBI-1 might be involved in adipogenic gene expression. Coincidentally, expression of FBI-1 and fatty-acid synthase (FASN) genes are often increased in cancer and immortalized cells. Both FBI-1 and FASN are important in cancer cell proliferation. SREBP-1 is a major regulator of many adipogenic genes, and FBI-1 and SREBP-1 (sterol-responsive element (SRE)-binding protein 1) interact with each other directly via their DNA binding domains. FBI-1 enhanced the transcriptional activation of SREBP-1 on responsive promoters, pGL2-6x(SRE)-Luc and FASN gene. FBI-1 and SREBP-1 synergistically activate transcription of the FASN gene by acting on the proximal GC-box and SRE/E-box. FBI-1, Sp1, and SREBP-1 can bind to all three SRE, GC-box, and SRE/E-box. Binding competition among the three transcription factors on the GC-box and SRE/E-box appears important in the transcription regulation. FBI-1 is apparently changing the binding pattern of Sp1 and SREBP-1 on the two elements in the presence of induced SREBP-1 and drives more Sp1 binding to the proximal promoter with less of an effect on SREBP-1 binding. The changes induced by FBI-1 appear critical in the synergistic transcription activation. The molecular mechanism revealed provides insight into how proto-oncogene FBI-1 may attack the cellular regulatory mechanism of FASN gene expression to provide more phospholipid membrane components needed for rapid cancer cell proliferation. PMID:18682402

Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

Energy Technology Data Exchange (ETDEWEB)

Rinker, Torri E.; Baker, Scott E.

2007-01-29

Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

Science.gov (United States)

Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

2010-10-07

PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

DEFF Research Database (Denmark)

Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

2008-01-01

of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

Science.gov (United States)

Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

2017-02-01

Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

DEFF Research Database (Denmark)

Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri

2014-01-01

BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...

Gene family size conservation is a good indicator of evolutionary rates.

Science.gov (United States)

Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

2010-08-01

The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

Kernel based machine learning algorithm for the efficient prediction of type III polyketide synthase family of proteins

Directory of Open Access Journals (Sweden)

Mallika V

2010-03-01

Full Text Available Type III Polyketide synthases (PKS are family of proteins considered to have significant role in the biosynthesis of various polyketides in plants, fungi and bacteria. As these proteins show positive effects to human health, more researches are going on regarding this particular protein. Developing a tool to identify the probability of sequence, being a type III polyketide synthase will minimize the time consumption and manpower efforts. In this approach, we have designed and implemented PKSIIIpred, a high performance prediction server for type III PKS where the classifier is Support Vector Machine (SVM. Based on the limited training dataset, the tool efficiently predicts the type III PKS superfamily of proteins with high sensitivity and specificity. PKSIIIpred is available at http://type3pks.in/prediction/. We expect that this tool may serve as a useful resource for type III PKS researchers. Currently work is being progressed for further betterment of prediction accuracy by including more sequence features in the training dataset.

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

Science.gov (United States)

Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

2016-03-09

Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

Science.gov (United States)

Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

2012-03-01

Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

Science.gov (United States)

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Baumgarten Andrew

2004-06-01

Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

Science.gov (United States)

Xiang, Lin; Zhao, Kaige; Chen, Longqing

2010-01-01

Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Detection and molecular cloning of CYP74Q1 gene: identification of Ranunculus acris leaf divinyl ether synthase.

Science.gov (United States)

Gorina, Svetlana S; Toporkova, Yana Y; Mukhtarova, Lucia S; Chechetkin, Ivan R; Khairutdinov, Bulat I; Gogolev, Yuri V; Grechkin, Alexander N

2014-09-01

Enzymes of the CYP74 family, including the divinyl ether synthase (DES), play important roles in plant cell signalling and defence. The potent DES activities have been detected before in the leaves of the meadow buttercup (Ranunculus acris L.) and few other Ranunculaceae species. The nature of these DESs and their genes remained unrevealed. The PCR with degenerate primers enabled to detect the transcript of unknown P450 gene assigned as CYP74Q1. Besides, two more CYP74Q1 isoforms with minimal sequence variations have been found. The full length recombinant CYP74Q1 protein was expressed in Escherichia coli. The preferred substrates of this enzyme are the 13-hydroperoxides of α-linolenic and linoleic acids, which are converted to the divinyl ether oxylipins (ω5Z)-etherolenic acid, (9Z,11E)-12-[(1'Z,3'Z)-hexadienyloxy]-9,11-dodecadienoic acid, and (ω5Z)-etheroleic acid, (9Z,11E)-12-[(1'Z)-hexenyloxy]-9,11-dodecadienoic acid, respectively, as revealed by the data of mass spectrometry, NMR and UV spectroscopy. Thus, CYP74Q1 protein was identified as the R. acris DES (RaDES), a novel DES type and the opening member of new CYP74Q subfamily. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

Science.gov (United States)

Schindler, Daniel; Nowrousian, Minou

2014-07-01

Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

Directory of Open Access Journals (Sweden)

Ro Dae-Kyun

2009-07-01

Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

Gene Coexpression Analysis Reveals Complex Metabolism of the Monoterpene Alcohol Linalool in Arabidopsis FlowersW

NARCIS (Netherlands)

Ginglinger, J.F.; Boachon, B.; Hofer, R.; Paetz, C.; Kollner, T.G.; Miesch, L.; Lugan, R.; Baltenweck, R.; Mutterer, J.; Ullman, P.; Verstappen, F.W.A.; Bouwmeester, H.J.

2013-01-01

The cytochrome P450 family encompasses the largest family of enzymes in plant metabolism, and the functions of many of its members in Arabidopsis thaliana are still unknown. Gene coexpression analysis pointed to two P450s that were coexpressed with two monoterpene synthases in flowers and were thus

Terpene synthases from Cannabis sativa.

Science.gov (United States)

Booth, Judith K; Page, Jonathan E; Bohlmann, Jörg

2017-01-01

Cannabis (Cannabis sativa) plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS) were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E)-β-ocimene, (-)-limonene, (+)-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

DEFF Research Database (Denmark)

Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

1999-01-01

Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

Identification, Characterization and Expression Analysis of Cell Wall Related Genes in Sorghum bicolor (L. Moench, a Food, Fodder and Biofuel Crop

Directory of Open Access Journals (Sweden)

KRISHAN MOHAN RAI

2016-08-01

Full Text Available Biomass based alternative fuels offer a solution to the world’s ever-increasing energy demand. With the ability to produce high biomass in marginal lands with low inputs, sorghum has a great potential to meet second-generation biofuel needs. Despite the sorghum crop importance in biofuel and fodder industry, there is no comprehensive information available on the cell wall related genes and gene families (biosynthetic and modification. It is important to identify the cell wall related genes to understand the cell wall biosynthetic process as well as to facilitate biomass manipulation. Genome-wide analysis using gene family specific Hidden Markov Model of conserved domains identified 520 genes distributed among 20 gene families related to biosynthesis/modification of various cell wall polymers such as cellulose, hemicellulose, pectin and lignin. Chromosomal localization analysis of these genes revealed that about 65% of cell wall related genes were confined to four chromosomes (Chr. 1-4. Further, 53 tandem duplication events involving 146 genes were identified in these gene families which could be associated with expansion of genes within families in sorghum. Additionally, we also identified 137 Simple Sequence Repeats related to 112 genes and target sites for 10 miRNAs in some important families such as cellulose synthase, cellulose synthase-like and laccases, etc. To gain further insight into potential functional roles, expression analysis of these gene families was performed using publicly available data sets in various tissues and under abiotic stress conditions. Expression analysis showed tissue specificity as well as differential expression under abiotic stress conditions. Overall, our study provides a comprehensive information on cell wall related genes families in sorghum which offers a valuable resource to develop strategies for altering biomass composition by plant breeding and genetic engineering approaches.

Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

International Nuclear Information System (INIS)

Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

2014-01-01

Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

Energy Technology Data Exchange (ETDEWEB)

Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

2014-07-01

Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

Directory of Open Access Journals (Sweden)

Praveen Balabaskaran Nina

2010-07-01

Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

Science.gov (United States)

Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

2008-07-01

Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

Directory of Open Access Journals (Sweden)

Emilia Wilmowicz

2016-03-01

Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

Science.gov (United States)

Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

2013-01-01

The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

Interferon induced IFIT family genes in host antiviral defense.

Science.gov (United States)

Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

2013-01-01

Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

Science.gov (United States)

Ghosh, Subhabrata; Mandi, Swati Sen

2015-07-25

Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

Science.gov (United States)

Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

1999-03-01

The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

Isolation and characterization of an oxidosqualene cyclase gene encoding a β-amyrin synthase involved in Polygala tenuifolia Willd. saponin biosynthesis.

Science.gov (United States)

Jin, Mei Lan; Lee, Dae Young; Um, Yurry; Lee, Jeong Hoon; Park, Chun Geun; Jetter, Reinhard; Kim, Ok Tae

2014-03-01

Expression of PtBS (Polygala tenuifolia β-amyrin synthase) led to the production of β-amyrin as sole product. Polygala tenuifolia Willdenow is a rich source of triterpene saponins, onjisaponins and polygalasaponins, used as herbal medicine to treat phlegms and for detumescence in traditional Asian healing. The Polygala saponins share the oleanane backbone structure and are, therefore, likely synthesized via β-amyrin as a common precursor. We hypothesized that, in analogy to diverse other plant species, this central intermediate should be formed by a β-amyrin synthase catalyzing the complex cyclization of oxidosqualene. This member of the oxidosqualene cyclase (OSC) family of enzymes is thus defining an important branch point between primary and secondary metabolisms, and playing a crucial role in the control of oleanane-type triterpene saponin biosynthesis. From P. tenuifolia roots, we isolated an OSC cDNA containing a reading frame of 2,289 bp nucleotides. The predicted protein of 763 amino acids (molecular weight 87.353 kDa) showed particularly high amino acid sequence identities to known β-amyrin synthases (85-87 %) and was, therefore, named PtBS. Expression of PtBS in the triterpenoid synthase-deficient yeast mutant GIL77 led to the production of β-amyrin as sole product. qRT-PCR analysis of various P. tenuifolia organs showed that PtBS transcript levels were highest in the roots, consistent with onjisaponin accumulation patterns. Therefore, we conclude that PtBS is the β-amyrin synthase enzyme catalyzing the first committed step in the biosynthesis of onjisaponins and polygalasaponins in P. tenuifolia.

Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

Directory of Open Access Journals (Sweden)

Lin-Hui Gao

2018-01-01

Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

Transmission of the PabI family of restriction DNA glycosylase genes: mobility and long-term inheritance.

Science.gov (United States)

Kojima, Kenji K; Kobayashi, Ichizo

2015-10-19

R.PabI is an exceptional restriction enzyme that functions as a DNA glycosylase. The enzyme excises an unmethylated base from its recognition sequence to generate apurinic/apyrimidinic (AP) sites, and also displays AP lyase activity, cleaving the DNA backbone at the AP site to generate the 3'-phospho alpha, beta-unsaturated aldehyde end in addition to the 5'-phosphate end. The resulting ends are difficult to religate with DNA ligase. The enzyme was originally isolated in Pyrococcus, a hyperthermophilic archaeon, and additional homologs subsequently identified in the epsilon class of the Gram-negative bacterial phylum Proteobacteria, such as Helicobacter pylori. Systematic analysis of R.PabI homologs and their neighboring genes in sequenced genomes revealed co-occurrence of R.PabI with M.PabI homolog methyltransferase genes. R.PabI and M.PabI homolog genes are occasionally found at corresponding (orthologous) loci in different species, such as Helicobacter pylori, Helicobacter acinonychis and Helicobacter cetorum, indicating long-term maintenance of the gene pair. One R.PabI and M.PabI homolog gene pair is observed immediately after the GMP synthase gene in both Campylobacter and Helicobacter, representing orthologs beyond genera. The mobility of the PabI family of restriction-modification (RM) system between genomes is evident upon comparison of genomes of sibling strains/species. Analysis of R.PabI and M.PabI homologs in H. pylori revealed an insertion of integrative and conjugative elements (ICE), and replacement with a gene of unknown function that may specify a membrane-associated toxin (hrgC). In view of the similarity of HrgC with toxins in type I toxin-antitoxin systems, we addressed the biological significance of this substitution. Our data indicate that replacement with hrgC occurred in the common ancestor of hspAmerind and hspEAsia. Subsequently, H. pylori with and without hrgC were intermixed at this locus, leading to complex distribution of hrgC in East

A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

NARCIS (Netherlands)

Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

2001-01-01

Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

Directory of Open Access Journals (Sweden)

Smrati Mishra

Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

Directory of Open Access Journals (Sweden)

T. Angeline

2011-01-01

Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

NARCIS (Netherlands)

Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

2001-01-01

Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

The Caenorhabditis chemoreceptor gene families

OpenAIRE

Robertson Hugh M; Thomas James H

2008-01-01

Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

Science.gov (United States)

Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

2016-01-01

Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

Directory of Open Access Journals (Sweden)

Wang Bo

2015-01-01

Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

Cloning and sequence analysis of putative type II fatty acid synthase ...

Indian Academy of Sciences (India)

Prakash

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

Directory of Open Access Journals (Sweden)

Patrick C Y Woo

Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

International Nuclear Information System (INIS)

Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

2010-01-01

The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

Deciphering the genomic structure, function and evolution of carotenogenesis related phytoene synthases in grasses

Directory of Open Access Journals (Sweden)

Dibari Bianca

2012-06-01

Full Text Available Abstract Background Carotenoids are isoprenoid pigments, essential for photosynthesis and photoprotection in plants. The enzyme phytoene synthase (PSY plays an essential role in mediating condensation of two geranylgeranyl diphosphate molecules, the first committed step in carotenogenesis. PSY are nuclear enzymes encoded by a small gene family consisting of three paralogous genes (PSY1-3 that have been widely characterized in rice, maize and sorghum. Results In wheat, for which yellow pigment content is extremely important for flour colour, only PSY1 has been extensively studied because of its association with QTLs reported for yellow pigment whereas PSY2 has been partially characterized. Here, we report the isolation of bread wheat PSY3 genes from a Renan BAC library using Brachypodium as a model genome for the Triticeae to develop Conserved Orthologous Set markers prior to gene cloning and sequencing. Wheat PSY3 homoeologous genes were sequenced and annotated, unravelling their novel structure associated with intron-loss events and consequent exonic fusions. A wheat PSY3 promoter region was also investigated for the presence of cis-acting elements involved in the response to abscisic acid (ABA, since carotenoids also play an important role as precursors of signalling molecules devoted to plant development and biotic/abiotic stress responses. Expression of wheat PSYs in leaves and roots was investigated during ABA treatment to confirm the up-regulation of PSY3 during abiotic stress. Conclusions We investigated the structural and functional determinisms of PSY genes in wheat. More generally, among eudicots and monocots, the PSY gene family was found to be associated with differences in gene copy numbers, allowing us to propose an evolutionary model for the entire PSY gene family in Grasses.

The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

Science.gov (United States)

Karn, Robert C; Laukaitis, Christina M

2012-01-01

Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

Science.gov (United States)

Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

2014-02-01

Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Terpene synthases from Cannabis sativa.

Directory of Open Access Journals (Sweden)

Judith K Booth

Full Text Available Cannabis (Cannabis sativa plants produce and accumulate a terpene-rich resin in glandular trichomes, which are abundant on the surface of the female inflorescence. Bouquets of different monoterpenes and sesquiterpenes are important components of cannabis resin as they define some of the unique organoleptic properties and may also influence medicinal qualities of different cannabis strains and varieties. Transcriptome analysis of trichomes of the cannabis hemp variety 'Finola' revealed sequences of all stages of terpene biosynthesis. Nine cannabis terpene synthases (CsTPS were identified in subfamilies TPS-a and TPS-b. Functional characterization identified mono- and sesqui-TPS, whose products collectively comprise most of the terpenes of 'Finola' resin, including major compounds such as β-myrcene, (E-β-ocimene, (--limonene, (+-α-pinene, β-caryophyllene, and α-humulene. Transcripts associated with terpene biosynthesis are highly expressed in trichomes compared to non-resin producing tissues. Knowledge of the CsTPS gene family may offer opportunities for selection and improvement of terpene profiles of interest in different cannabis strains and varieties.

Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

Directory of Open Access Journals (Sweden)

Hongxia Miao

Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

Science.gov (United States)

Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

2014-01-01

Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

Functional Characterization of Sesquiterpene Synthase from Polygonum minus

Directory of Open Access Journals (Sweden)

Su-Fang Ee

2014-01-01

Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

Cloning and expression of pineapple sucrose- phosphate synthase ...

African Journals Online (AJOL)

hope&shola

2010-12-06

Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

Directory of Open Access Journals (Sweden)

Yue Ming

2009-06-01

Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

Recurrent APC gene mutations in Polish FAP families

Directory of Open Access Journals (Sweden)

Pławski Andrzej

2007-12-01

Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

The IQD gene family in soybean: structure, phylogeny, evolution and expression.

Directory of Open Access Journals (Sweden)

Lin Feng

Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

PlantTribes: a gene and gene family resource for comparative genomics in plants

OpenAIRE

Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

2007-01-01

The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

International Nuclear Information System (INIS)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-01-01

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

Energy Technology Data Exchange (ETDEWEB)

Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

2000-09-18

A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

Science.gov (United States)

Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

2007-10-01

Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

Directory of Open Access Journals (Sweden)

Philipp H. Schiffer

2016-08-01

Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

The effect of inoculation with mycorrhizal arbuscular fungi on expression of limonene synthase in Mentha spicata L. genotypes

Directory of Open Access Journals (Sweden)

Leila Shabani

2015-03-01

Full Text Available Spearmint (Mentha spicata L. is an important economical and medicinal plant from Lamiaceae family, which has gained research attraction as a model for biosynthesis of essential oils due to its high capability for synthesis of monoterpenes. Limonene is a simple monoterpene and its biosynthesis is catalyzed by limonene synthase a key regulatory enzyme in the biosynthesis pathway of monoterpenes in spearmint plant. This study was concerned with the effect of colonization of roots with Funneliformis mosseae and F. etunicatum fungi on spearmint plant growth indices, leaf essential oils and changes in the expression of limonene synthase (LS gene. This study also explained the application of GADPH gene as the internal standard for real-time quantitative PCR (RTqPCR analysis of LS in spearmints. Our results showed that essential oil content of leaf in spearmint genotype Meybod inoculated with F. etunicatum was higher than that of genotypes from populations Kashan and Bojnourd and was 130% higher than the control. According to the results of this study, increase in transcript accumulation of the LS gene in leaves of spearmint plants inoculated with F. etunicatum was concordant with the increased essential oil contents and was dependent on the plant genotype.

Analysis of genetic variation of inducible nitric oxide synthase and ...

African Journals Online (AJOL)

The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

The ALMT Gene Family Performs Multiple Functions in Plants

Directory of Open Access Journals (Sweden)

Jie Liu

2018-02-01

Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

Science.gov (United States)

Jain, Parul; Tar'an, Bunyamin

2014-11-01

Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

Suites of terpene synthases explain differential terpenoid production in ginger and turmeric tissues.

Directory of Open Access Journals (Sweden)

Hyun Jo Koo

Full Text Available The essential oils of ginger (Zingiber officinale and turmeric (Curcuma longa contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+-germacrene D synthase and (S-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (--caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+-α-turmerone and (+-β-turmerone, are produced from (--α-zingiberene and (--β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase.

Suites of Terpene Synthases Explain Differential Terpenoid Production in Ginger and Turmeric Tissues

Science.gov (United States)

Koo, Hyun Jo; Gang, David R.

2012-01-01

The essential oils of ginger (Zingiber officinale) and turmeric (Curcuma longa) contain a large variety of terpenoids, some of which possess anticancer, antiulcer, and antioxidant properties. Despite their importance, only four terpene synthases have been identified from the Zingiberaceae family: (+)-germacrene D synthase and (S)-β-bisabolene synthase from ginger rhizome, and α-humulene synthase and β-eudesmol synthase from shampoo ginger (Zingiber zerumbet) rhizome. We report the identification of 25 mono- and 18 sesquiterpene synthases from ginger and turmeric, with 13 and 11, respectively, being functionally characterized. Novel terpene synthases, (−)-caryolan-1-ol synthase and α-zingiberene/β-sesquiphellandrene synthase, which is responsible for formation of the major sesquiterpenoids in ginger and turmeric rhizomes, were also discovered. These suites of enzymes are responsible for formation of the majority of the terpenoids present in these two plants. Structures of several were modeled, and a comparison of sets of paralogs suggests how the terpene synthases in ginger and turmeric evolved. The most abundant and most important sesquiterpenoids in turmeric rhizomes, (+)-α-turmerone and (+)-β-turmerone, are produced from (−)-α-zingiberene and (−)-β-sesquiphellandrene, respectively, via α-zingiberene/β-sesquiphellandrene oxidase and a still unidentified dehydrogenase. PMID:23272109

Repeat-associated plasticity in the Helicobacter pylori RD gene family.

Science.gov (United States)

Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

2009-11-01

The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

Directory of Open Access Journals (Sweden)

Bhubalan, K.

2010-01-01

Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

Developmental evolution of flowering plant pollen tube cell walls: callose synthase (CalS gene expression patterns

Directory of Open Access Journals (Sweden)

Abercrombie Jason M

2011-07-01

Full Text Available Abstract Background A number of innovations underlie the origin of rapid reproductive cycles in angiosperms. A critical early step involved the modification of an ancestrally short and slow-growing pollen tube for faster and longer distance transport of sperm to egg. Associated with this shift are the predominantly callose (1,3-β-glucan walls and septae (callose plugs of angiosperm pollen tubes. Callose synthesis is mediated by callose synthase (CalS. Of 12 CalS gene family members in Arabidopsis, only one (CalS5 has been directly linked to pollen tube callose. CalS5 orthologues are present in several monocot and eudicot genomes, but little is known about the evolutionary origin of CalS5 or what its ancestral function may have been. Results We investigated expression of CalS in pollen and pollen tubes of selected non-flowering seed plants (gymnosperms and angiosperms within lineages that diverged below the monocot/eudicot node. First, we determined the nearly full length coding sequence of a CalS5 orthologue from Cabomba caroliniana (CcCalS5 (Nymphaeales. Semi-quantitative RT-PCR demonstrated low CcCalS5 expression within several vegetative tissues, but strong expression in mature pollen. CalS transcripts were detected in pollen tubes of several species within Nymphaeales and Austrobaileyales, and comparative analyses with a phylogenetically diverse group of sequenced genomes indicated homology to CalS5. We also report in silico evidence of a putative CalS5 orthologue from Amborella. Among gymnosperms, CalS5 transcripts were recovered from germinating pollen of Gnetum and Ginkgo, but a novel CalS paralog was instead amplified from germinating pollen of Pinus taeda. Conclusion The finding that CalS5 is the predominant callose synthase in pollen tubes of both early-diverging and model system angiosperms is an indicator of the homology of their novel callosic pollen tube walls and callose plugs. The data suggest that CalS5 had transient expression

Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

International Nuclear Information System (INIS)

Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

1987-01-01

The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

The SPINK gene family and celiac disease susceptibility

NARCIS (Netherlands)

Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

2007-01-01

The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

The SPINK gene family and celiac disease susceptibility

NARCIS (Netherlands)

Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

Isolation of developing secondary xylem specific cellulose synthase ...

Indian Academy of Sciences (India)

The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

International Nuclear Information System (INIS)

Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

2017-01-01

Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

Comparative analysis of miRNAs of two rapeseed genotypes in response to acetohydroxyacid synthase-inhibiting herbicides by high-throughput sequencing.

Directory of Open Access Journals (Sweden)

Maolong Hu

Full Text Available Acetohydroxyacid synthase (AHAS, also called acetolactate synthase, is a key enzyme involved in the first step of the biosynthesis of the branched-chain amino acids valine, isoleucine and leucine. Acetohydroxyacid synthase-inhibiting herbicides (AHAS herbicides are five chemical families of herbicides that inhibit AHAS enzymes, including imidazolinones (IMI, sulfonylureas (SU, pyrimidinylthiobenzoates, triazolinones and triazolopyrimidines. Five AHAS genes have been identified in rapeseed, but little information is available regarding the role of miRNAs in response to AHAS herbicides. In this study, an AHAS herbicides tolerant genotype and a sensitive genotype were used for miRNA comparative analysis. A total of 20 small RNA libraries were obtained of these two genotypes at three time points (0h, 24 h and 48 h after spraying SU and IMI herbicides with two replicates. We identified 940 conserved miRNAs and 1515 novel candidate miRNAs in Brassica napus using high-throughput sequencing methods combined with computing analysis. A total of 3284 genes were predicted to be targets of these miRNAs, and their functions were shown using GO, KOG and KEGG annotations. The differentiation expression results of miRNAs showed almost twice as many differentiated miRNAs were found in tolerant genotype M342 (309 miRNAs after SU herbicide application than in sensitive genotype N131 (164 miRNAs. In additiond 177 and 296 miRNAs defined as differentiated in sensitive genotype and tolerant genotype in response to SU herbicides. The miR398 family was observed to be associated with AHAS herbicide tolerance because their expression increased in the tolerant genotype but decreased in the sensitive genotype. Moreover, 50 novel miRNAs from 39 precursors were predicted. There were 8 conserved miRNAs, 4 novel miRNAs and 3 target genes were validated by quantitative real-time PCR experiment. This study not only provides novel insights into the miRNA content of AHAS herbicides

Glycogen synthase from the parabasalian parasite Trichomonas vaginalis: An unusual member of the starch/glycogen synthase family.

Science.gov (United States)

Wilson, Wayne A; Pradhan, Prajakta; Madhan, Nayasha; Gist, Galen C; Brittingham, Andrew

2017-07-01

Trichomonas vaginalis, a parasitic protist, is the causative agent of the common sexually-transmitted infection trichomoniasis. The organism has long been known to synthesize substantial glycogen as a storage polysaccharide, presumably mobilizing this compound during periods of carbohydrate limitation, such as might be encountered during transmission between hosts. However, little is known regarding the enzymes of glycogen metabolism in T. vaginalis. We had previously described the identification and characterization of two forms of glycogen phosphorylase in the organism. Here, we measure UDP-glucose-dependent glycogen synthase activity in cell-free extracts of T. vaginalis. We then demonstrate that the TVAG_258220 open reading frame encodes a glycosyltransferase that is presumably responsible for this synthetic activity. We show that expression of TVAG_258220 in a yeast strain lacking endogenous glycogen synthase activity is sufficient to restore glycogen accumulation. Furthermore, when TVAG_258220 is expressed in bacteria, the resulting recombinant protein has glycogen synthase activity in vitro, transferring glucose from either UDP-glucose or ADP-glucose to glycogen and using both substrates with similar affinity. This protein is also able to transfer glucose from UDP-glucose or ADP-glucose to maltose and longer oligomers of glucose but not to glucose itself. However, with these substrates, there is no evidence of processivity and sugar transfer is limited to between one and three glucose residues. Taken together with our earlier work on glycogen phosphorylase, we are now well positioned to define both how T. vaginalis synthesizes and utilizes glycogen, and how these processes are regulated. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

Science.gov (United States)

Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

2014-07-22

Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

Directory of Open Access Journals (Sweden)

Bin Tang

2018-01-01

Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

Isolation and identification of a thermophilic strain producing trehalose synthase from geothermal water in China.

Science.gov (United States)

Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun

2008-08-01

A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.

Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

Science.gov (United States)

Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

2015-08-01

Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Physical mapping of the major early-onset familial Alzheimer`s disease locus on chromosome 14 and analysis of candidate gene sequences

Energy Technology Data Exchange (ETDEWEB)

Tanzi, R.E.; Romano, D.M.; Crowley, A.C. [Harvard Medical School, Charlestown, MA (United States)] [and others

1994-09-01

Genetic studies of kindreds displaying evidence for familial AD (FAD) have led to the localization of gene defects responsible for this disorder on chromosomes 14, 19, and 21. A minor early-onset FAD gene on chromosome 21 has been identified to enode the amyloid precursor protein (APP), and the late-onset FAD susceptibility locus on chromosome 19 has been shown to be in linkage disequilibrium with the E4 allele of the APOE gene. Meanwhile, the locus responsible for the major form of early-onset FAD on chromosome 14q24 has not yet been identified. By recombinational analysis, we have refined the minimal candidate region containing the gene defect to approximately 3 megabases in 14q24. We will describe our laboratory`s progress on attempts to finely localize this locus, as well as test known candidate genes from this region for either inclusion in the minimal candidate region or the presence of pathogenic mutations. Candidate genes that have been tested so far include cFOS, heat shock protein 70 member (HSF2A), transforming growth factor beta (TGFB3), the trifunctional protein C1-THF synthase (MTHFD), bradykinin receptor (BR), and the E2k component of a-ketoglutarate dehydrogenase. HSP2A, E2k, MTHFD, and BR do not map to the current defined minimal candidate region; however, sequence analysis must be performed to confirm exclusion of these genes as true candidates. Meanwhile, no pathogenic mutations have yet been found in cFOS or TGFB3. We have also isolated a large number of novel transcribed sequences from the minimal candidate region in the form of {open_quotes}trapped exons{close_quotes} from cosmids identified by hybridization to select YAC clones; we are currently in the process of searching for pathogenic mutations in these exons in affected individuals from FAD families.

Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

International Nuclear Information System (INIS)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-01-01

The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

Molecular evolution of the major chemosensory gene families in insects.

Science.gov (United States)

Sánchez-Gracia, A; Vieira, F G; Rozas, J

2009-09-01

Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

Science.gov (United States)

Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

2015-10-01

GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

The nitrate transporter (NRT gene family in poplar.

Directory of Open Access Journals (Sweden)

Hua Bai

Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

NARCIS (Netherlands)

Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

2004-01-01

The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105

Directory of Open Access Journals (Sweden)

Hiroaki Iwasaka

2018-04-01

Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.

Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

Directory of Open Access Journals (Sweden)

Parker Nadeene

2004-01-01

Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

Science.gov (United States)

Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

2014-11-01

We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

Science.gov (United States)

Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

2016-04-01

Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

2-Methyl-3-buten-2-ol (MBO) synthase expression in Nostoc punctiforme leads to over production of phytols.

Science.gov (United States)

Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak

2015-01-01

Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.

Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

DEFF Research Database (Denmark)

Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

2007-01-01

Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

Directory of Open Access Journals (Sweden)

Nishida Mutsumi

2007-11-01

Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

Directory of Open Access Journals (Sweden)

Vanessa Rodrigues Paixão-Côrtes

Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

Evolution of the YABBY gene family in seed plants.

Science.gov (United States)

Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

2016-01-01

Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

Isolation and characterization of terpene synthases in cotton (Gossypium hirsutum).

Science.gov (United States)

Yang, Chang-Qing; Wu, Xiu-Ming; Ruan, Ju-Xin; Hu, Wen-Li; Mao, Yin-Bo; Chen, Xiao-Ya; Wang, Ling-Jian

2013-12-01

Cotton plants accumulate gossypol and related sesquiterpene aldehydes, which function as phytoalexins against pathogens and feeding deterrents to herbivorous insects. However, to date little is known about the biosynthesis of volatile terpenes in this crop. Herein is reported that 5 monoterpenes and 11 sesquiterpenes from extracts of a glanded cotton cultivar, Gossypium hirsutum cv. CCRI12, were detected by gas chromatography-mass spectrometry (GC-MS). By EST data mining combined with Rapid Amplification of cDNA Ends (RACE), full-length cDNAs of three terpene synthases (TPSs), GhTPS1, GhTPS2 and GhTPS3 were isolated. By in vitro assays of the recombinant proteins, it was found that GhTPS1 and GhTPS2 are sesquiterpene synthases: the former converted farnesyl pyrophosphate (FPP) into β-caryophyllene and α-humulene in a ratio of 2:1, whereas the latter produced several sesquiterpenes with guaia-1(10),11-diene as the major product. By contrast, GhTPS3 is a monoterpene synthase, which produced α-pinene, β-pinene, β-phellandrene and trace amounts of other monoterpenes from geranyl pyrophosphate (GPP). The TPS activities were also supported by Virus Induced Gene Silencing (VIGS) in the cotton plant. GhTPS1 and GhTPS3 were highly expressed in the cotton plant overall, whereas GhTPS2 was expressed only in leaves. When stimulated by mechanical wounding, Verticillium dahliae (Vde) elicitor or methyl jasmonate (MeJA), production of terpenes and expression of the corresponding synthase genes were induced. These data demonstrate that the three genes account for the biosynthesis of volatile terpenes of cotton, at least of this Upland cotton. Copyright © 2013 Elsevier Ltd. All rights reserved.

Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

Directory of Open Access Journals (Sweden)

Yi-Bing Zhang

Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

Cloning and Characterization of Farnesyl Diphosphate Synthase Gene Involved in Triterpenoids Biosynthesis from Poria cocos

Directory of Open Access Journals (Sweden)

Jianrong Wang

2014-12-01

Full Text Available Poria cocos (P. cocos has long been used as traditional Chinese medicine and triterpenoids are the most important pharmacologically active constituents of this fungus. Farnesyl pyrophosphate synthase (FPS is a key enzyme of triterpenoids biosynthesis. The gene encoding FPS was cloned from P. cocos by degenerate PCR, inverse PCR and cassette PCR. The open reading frame of the gene is 1086 bp in length, corresponding to a predicted polypeptide of 361 amino acid residues with a molecular weight of 41.2 kDa. Comparison of the P. cocos FPS deduced amino acid sequence with other species showed the highest identity with Ganoderma lucidum (74%. The predicted P. cocos FPS shares at least four conserved regions involved in the enzymatic activity with the FPSs of varied species. The recombinant protein was expressed in Pichia pastoris and purified. Gas chromatography analysis showed that the recombinant FPS could catalyze the formation of farnesyl diphosphate (FPP from geranyl diphosphate (GPP and isopentenyl diphosphate (IPP. Furthermore, the expression profile of the FPS gene and content of total triterpenoids under different stages of development and methyl jasmonate treatments were determined. The results indicated that there is a positive correlation between the activity of FPS and the amount of total triterpenoids produced in P. cocos.

Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

Energy Technology Data Exchange (ETDEWEB)

Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

2011-07-01

Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

Science.gov (United States)

Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

2017-07-01

Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

Genetic variants in promoters and coding regions of the muscle glycogen synthase and the insulin-responsive GLUT4 genes in NIDDM

DEFF Research Database (Denmark)

Bjørbaek, C; Echwald, Søren Morgenthaler; Hubricht, P

1994-01-01

To examine the hypothesis that variants in the regulatory or coding regions of the glycogen synthase (GS) and insulin-responsive glucose transporter (GLUT4) genes contribute to insulin-resistant glucose processing of muscle from non-insulin-dependent diabetes mellitus (NIDDM) patients, promoter...... volunteers. By applying inverse polymerase chain reaction and direct DNA sequencing, 532 base pairs (bp) of the GS promoter were identified and the transcriptional start site determined by primer extension. SSCP scanning of the promoter region detected five single nucleotide substitutions, positioned at 42......'-untranslated region, and the coding region of the GLUT4 gene showed four polymorphisms, all single nucleotide substitutions, positioned at -581, 1, 30, and 582. None of the three changes in the regulatory region of the gene had any major influence on expression of the GLUT4 gene in muscle. The variant at 582...

Early evolution of the LIM homeobox gene family

Energy Technology Data Exchange (ETDEWEB)

Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

2010-01-01

LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

Early evolution of the LIM homeobox gene family

Directory of Open Access Journals (Sweden)

Degnan Bernard M

2010-01-01

Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

TreeFam: a curated database of phylogenetic trees of animal gene families

DEFF Research Database (Denmark)

Li, Heng; Coghlan, Avril; Ruan, Jue

2006-01-01

TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

Plant oxidosqualene metabolism: cycloartenol synthase-dependent sterol biosynthesis in Nicotiana benthamiana.

Science.gov (United States)

Gas-Pascual, Elisabet; Berna, Anne; Bach, Thomas J; Schaller, Hubert

2014-01-01

The plant sterol pathway exhibits a major biosynthetic difference as compared with that of metazoans. The committed sterol precursor is the pentacyclic cycloartenol (9β,19-cyclolanost-24-en-3β-ol) and not lanosterol (lanosta-8,24-dien-3β-ol), as it was shown in the late sixties. However, plant genome mining over the last years revealed the general presence of lanosterol synthases encoding sequences (LAS1) in the oxidosqualene cyclase repertoire, in addition to cycloartenol synthases (CAS1) and to non-steroidal triterpene synthases that contribute to the metabolic diversity of C30H50O compounds on earth. Furthermore, plant LAS1 proteins have been unambiguously identified by peptidic signatures and by their capacity to complement the yeast lanosterol synthase deficiency. A dual pathway for the synthesis of sterols through lanosterol and cycloartenol was reported in the model Arabidopsis thaliana, though the contribution of a lanosterol pathway to the production of 24-alkyl-Δ(5)-sterols was quite marginal (Ohyama et al. (2009) PNAS 106, 725). To investigate further the physiological relevance of CAS1 and LAS1 genes in plants, we have silenced their expression in Nicotiana benthamiana. We used virus induced gene silencing (VIGS) based on gene specific sequences from a Nicotiana tabacum CAS1 or derived from the solgenomics initiative (http://solgenomics.net/) to challenge the respective roles of CAS1 and LAS1. In this report, we show a CAS1-specific functional sterol pathway in engineered yeast, and a strict dependence on CAS1 of tobacco sterol biosynthesis.

Use of octaketide synthases to produce kermesic acid and flavokermesic acid

DEFF Research Database (Denmark)

2017-01-01

A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

Use of octaketide synthases to produce kermesic acid and flavokermesic acid

DEFF Research Database (Denmark)

2016-01-01

A method for producing an octaketide derived aromatic compound of interest (e.g. carminic acid), wherein the method comprises (I): heterologous expression of a recombinantly introduced Type III polyketide synthase (PKS) gene encoding an octaketide synthase (OKS) to obtain non-reduced octaketide...... in vivo within the recombinant host cell and (II): converting in vivo the non-reduced octaketide of step (I) into a C14-C34 aromatic compound of interest (e.g. carminic acid)....

Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

Science.gov (United States)

Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

2011-02-01

  This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

Effects and mechanism of acid rain on plant chloroplast ATP synthase.

Science.gov (United States)

Sun, Jingwen; Hu, Huiqing; Li, Yueli; Wang, Lihong; Zhou, Qing; Huang, Xiaohua

2016-09-01

Acid rain can directly or indirectly affect plant physiological functions, especially photosynthesis. The enzyme ATP synthase is the key in photosynthetic energy conversion, and thus, it affects plant photosynthesis. To clarify the mechanism by which acid rain affects photosynthesis, we studied the effects of acid rain on plant growth, photosynthesis, chloroplast ATP synthase activity and gene expression, chloroplast ultrastructure, intracellular H(+) level, and water content of rice seedlings. Acid rain at pH 4.5 remained the chloroplast structure unchanged but increased the expression of six chloroplast ATP synthase subunits, promoted chloroplast ATP synthase activity, and increased photosynthesis and plant growth. Acid rain at pH 4.0 or less decreased leaf water content, destroyed chloroplast structure, inhibited the expression of six chloroplast ATP synthase subunits, decreased chloroplast ATP synthase activity, and reduced photosynthesis and plant growth. In conclusion, acid rain affected the chloroplast ultrastructure, chloroplast ATPase transcription and activity, and P n by changing the acidity in the cells, and thus influencing the plant growth and development. Finally, the effects of simulated acid rain on the test indices were found to be dose-dependent.

Impaired glycogen synthase activity and mitochondrial dysfunction in skeletal muscle

DEFF Research Database (Denmark)

Højlund, Kurt; Beck-Nielsen, Henning

2006-01-01

Insulin resistance in skeletal muscle is a major hallmark of type 2 diabetes and an early detectable abnormality in the development of this disease. The cellular mechanisms of insulin resistance include impaired insulin-mediated muscle glycogen synthesis and increased intramyocellular lipid content......, whereas impaired insulin activation of muscle glycogen synthase represents a consistent, molecular defect found in both type 2 diabetic and high-risk individuals. Despite several studies of the insulin signaling pathway believed to mediate dephosphorylation and hence activation of glycogen synthase......, the molecular mechanisms responsible for this defect remain unknown. Recently, the use of phospho-specific antibodies in human diabetic muscle has revealed hyperphosphorylation of glycogen synthase at sites not regulated by the classical insulin signaling pathway. In addition, novel approaches such as gene...

RNA-Seq mediated root transcriptome analysis of Chlorophytum borivilianum for identification of genes involved in saponin biosynthesis.

Science.gov (United States)

Kumar, Sunil; Kalra, Shikha; Singh, Baljinder; Kumar, Avneesh; Kaur, Jagdeep; Singh, Kashmir

2016-01-01

Chlorophytum borivilianum is an important species of liliaceae family, owing to its vital medicinal properties. Plant roots are used for aphrodisiac, adaptogen, anti-aging, health-restorative and health-promoting purposes. Saponins, are considered to be the principal bioactive components responsible for the wide variety of pharmacological properties of this plant. In the present study, we have performed de novo root transcriptome sequencing of C. borivilianum using Illumina Hiseq 2000 platform, to gain molecular insight into saponins biosynthesis. A total of 33,963,356 high-quality reads were obtained after quality filtration. Sequences were assembled using various programs which generated 97,344 transcripts with a size range of 100-5,216 bp and N50 value of 342. Data was analyzed against non-redundant proteins, gene ontology (GO), and enzyme commission (EC) databases. All the genes involved in saponins biosynthesis along with five full-length genes namely farnesyl pyrophosphate synthase, cycloartenol synthase, β-amyrin synthase, cytochrome p450, and sterol-3-glucosyltransferase were identified. Read per exon kilobase per million (RPKM)-based comparative expression profiling was done to study the differential regulation of the genes. In silico expression analysis of seven selected genes of saponin biosynthetic pathway was validated by qRT-PCR.

Biosynthesis of Akaeolide and Lorneic Acids and Annotation of Type I Polyketide Synthase Gene Clusters in the Genome of Streptomyces sp. NPS554

Directory of Open Access Journals (Sweden)

Tao Zhou

2015-01-01

Full Text Available The incorporation pattern of biosynthetic precursors into two structurally unique polyketides, akaeolide and lorneic acid A, was elucidated by feeding experiments with 13C-labeled precursors. In addition, the draft genome sequence of the producer, Streptomyces sp. NPS554, was performed and the biosynthetic gene clusters for these polyketides were identified. The putative gene clusters contain all the polyketide synthase (PKS domains necessary for assembly of the carbon skeletons. Combined with the 13C-labeling results, gene function prediction enabled us to propose biosynthetic pathways involving unusual carbon-carbon bond formation reactions. Genome analysis also indicated the presence of at least ten orphan type I PKS gene clusters that might be responsible for the production of new polyketides.

Regulation of C. elegans fat uptake and storage by acyl-CoA synthase-3 is dependent on NR5A family nuclear hormone receptor nhr-25

DEFF Research Database (Denmark)

Mullaney, Brendan C; Blind, Raymond D; Lemieux, George A

2010-01-01

Acyl-CoA synthases are important for lipid synthesis and breakdown, generation of signaling molecules, and lipid modification of proteins, highlighting the challenge of understanding metabolic pathways within intact organisms. From a C. elegans mutagenesis screen, we found that loss of ACS-3...... mutant phenotypes require the nuclear hormone receptor NHR-25, a key regulator of C. elegans molting. Our findings suggest that ACS-3-derived long-chain fatty acyl-CoAs, perhaps incorporated into complex ligands such as phosphoinositides, modulate NHR-25 function, which in turn regulates an endocrine...... program of lipid uptake and synthesis. These results reveal a link between acyl-CoA synthase function and an NR5A family nuclear receptor in C. elegans....

Altering the expression of two chitin synthase genes differentially affects the growth and morphology of Aspergillus oryzae

DEFF Research Database (Denmark)

Müller, Christian; Hjort, C.M.; Hansen, K.

2002-01-01

In Aspergillus oryzae, one full-length chitin synthase (chsB) and fragments of two other chitin synthases (csmA and chsC) were identified. The deduced amino acid sequence of chsB was similar (87% identity) to chsB from Aspergillus nidulans, which encodes a class III chitin synthase. The sequence...

Regulation of RNA-dependent RNA polymerase 1 and isochorismate synthase gene expression in Arabidopsis.

Directory of Open Access Journals (Sweden)

Lydia J R Hunter

Full Text Available RNA-dependent RNA polymerases (RDRs function in anti-viral silencing in Arabidopsis thaliana and other plants. Salicylic acid (SA, an important defensive signal, increases RDR1 gene expression, suggesting that RDR1 contributes to SA-induced virus resistance. In Nicotiana attenuata RDR1 also regulates plant-insect interactions and is induced by another important signal, jasmonic acid (JA. Despite its importance in defense RDR1 regulation has not been investigated in detail.In Arabidopsis, SA-induced RDR1 expression was dependent on 'NON-EXPRESSER OF PATHOGENESIS-RELATED GENES 1', indicating regulation involves the same mechanism controlling many other SA- defense-related genes, including pathogenesis-related 1 (PR1. Isochorismate synthase 1 (ICS1 is required for SA biosynthesis. In defensive signal transduction RDR1 lies downstream of ICS1. However, supplying exogenous SA to ics1-mutant plants did not induce RDR1 or PR1 expression to the same extent as seen in wild type plants. Analysing ICS1 gene expression using transgenic plants expressing ICS1 promoter:reporter gene (β-glucuronidase constructs and by measuring steady-state ICS1 transcript levels showed that SA positively regulates ICS1. In contrast, ICS2, which is expressed at lower levels than ICS1, is unaffected by SA. The wound-response hormone JA affects expression of Arabidopsis RDR1 but jasmonate-induced expression is independent of CORONATINE-INSENSITIVE 1, which conditions expression of many other JA-responsive genes. Transiently increased RDR1 expression following tobacco mosaic virus inoculation was due to wounding and was not a direct effect of infection. RDR1 gene expression was induced by ethylene and by abscisic acid (an important regulator of drought resistance. However, rdr1-mutant plants showed normal responses to drought.RDR1 is regulated by a much broader range of phytohormones than previously thought, indicating that it plays roles beyond those already suggested in virus

Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1) in Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.)

OpenAIRE

Bua-In Saowaluck; Paisooksantivatana Yingyong; Weimer Bart C.; Chowpongpang Srimek

2014-01-01

Cassumunar ginger (Zingiber montanum (Koenig) Link ex Dietr.) is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant an...

Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

International Nuclear Information System (INIS)

Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

2013-01-01

1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd.

Science.gov (United States)

Jin, Mei Lan; Lee, Woo Moon; Kim, Ok Tae

2017-11-15

Oxidosqualene cyclases (OSCs) are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA), RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated) were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG) values calculated by fragments per kilobase million (FPKM). In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1 , and PtCAS2 , were found, in addition to the PtBS (β-amyrin synthase) gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia . All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

Two Cycloartenol Synthases for Phytosterol Biosynthesis in Polygala tenuifolia Willd

Directory of Open Access Journals (Sweden)

Mei Lan Jin

2017-11-01

Full Text Available Oxidosqualene cyclases (OSCs are enzymes that play a key role in control of the biosynthesis of phytosterols and triterpene saponins. In order to uncover OSC genes from Polygala tenuifolia seedlings induced by methyl jasmonate (MeJA, RNA-sequencing analysis was performed using the Illumina sequencing platform. A total of 148,488,632 high-quality reads from two samples (control and the MeJA treated were generated. We screened genes related to phytosterol and triterpene saponin biosynthesis and analyzed the transcriptional changes of differentially expressed unigene (DEUG values calculated by fragments per kilobase million (FPKM. In our datasets, two full-length cDNAs of putative OSC genes, PtCAS1, and PtCAS2, were found, in addition to the PtBS (β-amyrin synthase gene reported in our previous studies and the two cycloartenol synthase genes of P. tenuifolia. All genes were isolated and characterized in yeast cells. The functional expression of the two PtCAS genes in yeast cells showed that the genes all produce a cycloartenol as the sole product. When qRT-PCR analysis from different tissues was performed, the expressions of PtCAS1 and PtCAS2 were highest in flowers and roots, respectively. After MeJA treatment, the transcripts of PtCAS1 and PtCAS2 genes increased by 1.5- and 2-fold, respectively. Given these results, we discuss the potential roles of the two PtCAS genes in relation to triterpenoid biosynthesis.

Molecular characterization of two alkylresorcylic acid synthases from Sordariomycetes fungi

DEFF Research Database (Denmark)

Ramakrishnan, Dhivya; Tiwari, Manish Kumar; Manoharan, Gomathi

2018-01-01

Two putative type III polyketide synthase genes (PKS) were identified from Sordariomycetes fungi. These two type III PKS genes from Sordaria macrospora (SmPKS) and Chaetomium thermophilum (CtPKS), shared 59.8% sequence identity. Both, full-length and truncated versions of type III PKSs were...

Molecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq

Directory of Open Access Journals (Sweden)

Kawamukai Makoto

2004-11-01

Full Text Available Abstract Background Isopentenyl diphosphate (IPP, a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq. Results The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots. Conclusion This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.

Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

Science.gov (United States)

Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

2015-01-01

"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

cDNA cloning and expression of carotenogenic genes during flower development in Gentiana lutea.

Science.gov (United States)

Zhu, Changfu; Yamamura, Saburo; Koiwa, Hiroyuki; Nishihara, Masashiro; Sandmann, Gerhard

2002-02-01

All cDNAs involved in carotenoid biosynthesis leading to lycopene in yellow petals of Gentiana lutea have been cloned from a cDNA library. They encode a geranylgeranyl pyrophosphate synthase, a phytoene synthase, a phytoene desaturase and a zeta-carotene desaturase. The indicated function of all cDNAs was established by heterologous complementation in Escherichia coli. The amino acid sequences deduced from the cDNAs were between 47.5% and 78.9% identical to those reported for the corresponding enzymes from other higher plants. Southern analysis suggested that the genes for each enzyme probably represent a small multi-gene family. Tissue-specific expression of the genes and expression during flower development was investigated. The expression of the phytoene synthase gene, psy, was enhanced in flowers but transcripts were not detected in stems and leaves by northern blotting. Transcripts of the genes for geranylgeranyl pyrophosphate (ggpps), phytoene desaturase (pds) and zeta-carotene desaturase (zds) were detected in flowers and leaves but not in stems. Analysis of the expression of psy and zds in petals revealed that levels of the transcripts were lowest in young buds and highest in fully open flowers, in parallel with the formation of carotenoids. Obviously, the transcription of these genes control the accumulation of carotenoids during flower development in G. lutea. For pds only a very slight increase of mRNA was found whereas the transcripts of ggpps decreased during flower development.

Expression Patterns, Activities and Carbohydrate-Metabolizing Regulation of Sucrose Phosphate Synthase, Sucrose Synthase and Neutral Invertase in Pineapple Fruit during Development and Ripening

Science.gov (United States)

Zhang, Xiu-Mei; Wang, Wei; Du, Li-Qing; Xie, Jiang-Hui; Yao, Yan-Li; Sun, Guang-Ming

2012-01-01

Differences in carbohydrate contents and metabolizing-enzyme activities were monitored in apical, medial, basal and core sections of pineapple (Ananas comosus cv. Comte de paris) during fruit development and ripening. Fructose and glucose of various sections in nearly equal amounts were the predominant sugars in the fruitlets, and had obvious differences until the fruit matured. The large rise of sucrose/hexose was accompanied by dramatic changes in sucrose phosphate synthase (SPS) and sucrose synthase (SuSy) activities. By contrast, neutral invertase (NI) activity may provide a mechanism to increase fruit sink strength by increasing hexose concentrations. Furthermore, two cDNAs of Ac-sps (accession no. GQ996582) and Ac-ni (accession no. GQ996581) were first isolated from pineapple fruits utilizing conserved amino-acid sequences. Homology alignment reveals that the amino acid sequences contain some conserved function domains. Transcription expression analysis of Ac-sps, Ac-susy and Ac-ni also indicated distinct patterns related to sugar accumulation and composition of pineapple fruits. It suggests that differential expressions of multiple gene families are necessary for sugar metabolism in various parts and developmental stages of pineapple fruit. A cycle of sucrose breakdown in the cytosol of sink tissues could be mediated through both Ac-SuSy and Ac-NI, and Ac-NI could be involved in regulating crucial steps by generating sugar signals to the cells in a temporally and spatially restricted fashion. PMID:22949808

Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

Directory of Open Access Journals (Sweden)

Besic Nikola

2008-09-01

Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

Structural Basis of Catalysis in the Bacterial Monoterpene Synthases Linalool Synthase and 1,8-Cineole Synthase

OpenAIRE

Karuppiah, Vijaykumar; Ranaghan, Kara E.; Leferink, Nicole G. H.; Johannissen, Linus O.; Shanmugam, Muralidharan; Ní Cheallaigh, Aisling; Bennett, Nathan J.; Kearsey, Lewis J.; Takano, Eriko; Gardiner, John M.; van der Kamp, Marc W.; Hay, Sam; Mulholland, Adrian J.; Leys, David; Scrutton, Nigel S.

2017-01-01

Terpenoids form the largest and stereochemically most diverse class of natural products, and there is considerable interest in producing these by biocatalysis with whole cells or purified enzymes, and by metabolic engineering. The monoterpenes are an important class of terpenes and are industrially important as flavors and fragrances. We report here structures for the recently discovered Streptomyces clavuligerus monoterpene synthases linalool synthase (bLinS) and 1,8-cineole synthase (bCinS)...

Structural and functional analysis of validoxylamine A 7'-phosphate synthase ValL involved in validamycin A biosynthesis.

Directory of Open Access Journals (Sweden)

Lina Zheng

Full Text Available Validamycin A (Val-A is an effective antifungal agent widely used in Asian countries as crop protectant. Validoxylamine A, the core structure and intermediate of Val-A, consists of two C(7-cyclitol units connected by a rare C-N bond. In the Val-A biosynthetic gene cluster in Streptomyces hygroscopicus 5008, the ORF valL was initially annotated as a validoxylamine A 7'-phosphate(V7P synthase, whose encoded 497-aa protein shows high similarity with trehalose 6-phosphate(T6P synthase. Gene inactivation of valL abolished both validoxylamine A and validamycin A productivity, and complementation with a cloned valL recovered 10% production of the wild-type in the mutant, indicating the involvement of ValL in validoxylamine A biosynthesis. Also we determined the structures of ValL and ValL/trehalose complex. The structural data indicates that ValL adopts the typical fold of GT-B protein family, featuring two Rossmann-fold domains and an active site at domain junction. The residues in the active site are arranged in a manner homologous to that of Escherichia coli (E.coli T6P synthase OtsA. However, a significant discrepancy is found in the active-site loop region. Also noticeable structural variance is found around the active site entrance in the apo ValL structure while the region takes an ordered configuration upon binding of product analog trehalose. Furthermore, the modeling of V7P in the active site of ValL suggests that ValL might have a similar SNi-like mechanism as OtsA.

Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

Energy Technology Data Exchange (ETDEWEB)

Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

1994-09-01

Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

Examination of tetrahydrobiopterin pathway genes in autism.

Science.gov (United States)

Schnetz-Boutaud, N C; Anderson, B M; Brown, K D; Wright, H H; Abramson, R K; Cuccaro, M L; Gilbert, J R; Pericak-Vance, M A; Haines, J L

2009-11-01

Autism is a complex disorder with a high degree of heritability and significant phenotypic and genotypic heterogeneity. Although candidate gene studies and genome-wide screens have failed to identify major causal loci associated with autism, numerous studies have proposed association with several variations in genes in the dopaminergic and serotonergic pathways. Because tetrahydrobiopterin (BH4) is the essential cofactor in the synthesis of these two neurotransmitters, we genotyped 25 SNPs in nine genes of the BH4 pathway in a total of 403 families. Significant nominal association was detected in the gene for 6-pyruvoyl-tetrahydropterin synthase, PTS (chromosome 11), with P = 0.009; this result was not restricted to an affected male-only subset. Multilocus interaction was detected in the BH4 pathway alone, but not across the serotonin, dopamine and BH4 pathways.

The human protein disulfide isomerase gene family

Directory of Open Access Journals (Sweden)

Galligan James J

2012-07-01

Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

Enantiospecific (+)- and (-)-germacrene D synthases, cloned from goldenrod, reveal a functionally active variant of the universal isoprenoid-biosynthesis aspartate-rich motif.

Science.gov (United States)

Prosser, Ian; Altug, Iris G; Phillips, Andy L; König, Wilfried A; Bouwmeester, Harro J; Beale, Michael H

2004-12-15

The naturally occurring, volatile sesquiterpene hydrocarbon germacrene D has strong effects on insect behaviour and genes encoding enzymes that produce this compound are of interest in the study of plant-insect interactions and in a number of biotechnological approaches to pest control. Goldenrod, Solidago canadensis, is unusual in that it produces both enantiomers of germacrene D. Two new sesquiterpene synthase cDNAs, designated Sc11 and Sc19, have been isolated from goldenrod and functional expression in Escherichia coli identified Sc11 as (+)-germacrene D synthase and Sc19 as (-)-germacrene D synthase. Thus, the enantiomers of germacrene D are the products of separate, but closely related (85% amino-acid identity), enzymes. Unlike other sesquiterpene synthases and the related monoterpene synthases and prenyl transferases, which contain the characteristic amino-acid motif DDXX(D,E), Sc11 is unusual in that this motif occurs as (303)NDTYD. Mutagenesis of this motif to (303)DDTYD gave rise to an enzyme that fully retained (+)-germacrene D synthase activity. The converse mutation in Sc19 (D303N) resulted in a less efficient but functional enzyme. Mutagenesis of position 303 to glutamate in both enzymes resulted in loss of activity. These results indicate that the magnesium ion-binding role of the first aspartate in the DDXXD motif may not be as critical as previously thought. Further amino-acid sequence comparisons and molecular modelling of the enzyme structures revealed that very subtle changes to the active site of this family of enzymes are required to alter the reaction pathway to form, in this case, different enantiomers from the same enzyme-bound carbocationic intermediate.

A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

DEFF Research Database (Denmark)

Hansen, Martin A; Nielsen, John E; Retelska, Dorota

2008-01-01

, sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

Dichotomy in the NRT gene families of dicots and grass species.

Directory of Open Access Journals (Sweden)

Darren Plett

Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

HAEM SYNTHASE AND COBALT PORPHYRIN SYNTHASE IN VARIOUS MICRO-ORGANISMS.

Science.gov (United States)

PORRA, R J; ROSS, B D

1965-03-01

1. The preparation of a crude extract of Clostridium tetanomorphum containing cobalt porphyrin synthase but little haem-synthase activity is described. 2. The properties of cobalt porphyrin synthase in the clostridial extracts is compared with the properties of a haem synthase present in crude extracts of the yeast Torulopsis utilis. 3. Cobalt porphyrin synthase in extracts of C. tetanomorphum inserts Co(2+) ions into the following dicarboxylic porphyrins in descending order of rate of insertion: meso-, deutero- and proto-porphyrins. Esterification renders meso- and deutero-porphyrins inactive as substrates. Neither the tetracarboxylic (coproporphyrin III) nor the octacarboxylic (uroporphyrin III) compounds are converted into cobalt porphyrins by the extract, but the non-enzymic incorporation of Co(2+) ions into these two porphyrins is rapid. These extracts are unable to insert Mn(2+), Zn(2+), Mg(2+) or Cu(2+) ions into mesoporphyrin. 4. Crude extracts of T. utilis readily insert both Co(2+) and Fe(2+) ions into deutero-, meso, and proto-porphyrins. Unlike the extracts of C. tetanomorphum, these preparations catalyse the insertion of Co(2+) ions into deuteroporphyrin more rapidly than into mesoporphyrin. This parallels the formation of haems by the T. utilis extract. 5. Cobalt porphyrin synthase is present in the particulate fraction of the extracts of C. tetanomorphum but requires a heat-stable factor present in the soluble fraction. This soluble factor can be replaced by GSH. 6. Cobalt porphyrin synthase in the clostridial extract is inhibited by iodoacetamide and to a smaller extent by p-chloromercuribenzoate and N-ethylmaleimide. The haem synthases of T. utilis and Micrococcus denitrificans are also inhibited by various thiol reagents.

Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

Science.gov (United States)

Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

2013-01-01

The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

Citric acid production and citrate synthase genes in distinct strains of ...

African Journals Online (AJOL)

SAM

2014-05-28

May 28, 2014 ... synthase in lactic acid production by A. niger and with the ... A number of microorganisms, including both bacteria and fungi, possess the capacity ..... citric acid production by solid-state fermentation from cassava bagasse and ...

Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

Science.gov (United States)

Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

2016-10-01

Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

Directory of Open Access Journals (Sweden)

Jie Luo

2018-01-01

Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

Association of a neuronal nitric oxide synthase gene polymorphism with levodopa-induced dyskinesia in Parkinson's disease.

Science.gov (United States)

Santos-Lobato, Bruno Lopes; Borges, Vanderci; Ferraz, Henrique Ballalai; Mata, Ignacio Fernandez; Zabetian, Cyrus P; Tumas, Vitor

2018-04-01

Levodopa-induced dyskinesia (LID) is a common complication of advanced Parkinson's disease (PD). PD physiopathology is associated with dopaminergic and non-dopaminergic pathways, including the nitric oxide system. The present study aims to examine the association of a neuronal nitric oxide synthase gene (NOS1) single nucleotide polymorphism (rs2682826) with LID in PD patients. We studied 186 PD patients using levodopa. The presence of LID was defined as a MDS-UPDRS Part IV score ≥1 on item 4.1. We tested for association between NOS1 rs2682826 and the presence, daily frequency, and functional impact of LID using regression models, adjusting for important covariates. There was no significant association between genotype and any of the LID-related variables examined. Our results suggest that this NOS1 polymorphism does not contribute to LID susceptibility or severity. However, additional studies that include a comprehensive set of NOS1 variants will be needed to fully define the role of this gene in LID. Copyright © 2017 Elsevier Inc. All rights reserved.

Aspirin inhibits interleukin 1-induced prostaglandin H synthase expression in cultured endothelial cells

International Nuclear Information System (INIS)

Wu, K.K.; Sanduja, R.; Tsai, A.L.; Ferhanoglu, B.; Loose-Mitchell, D.S.

1991-01-01

Prostaglandin H (PGH) synthase is a key enzyme in the biosynthesis of prostaglandins, thromboxane, and prostacyclin. In cultured human umbilical vein endothelial cells, interleukin 1 (IL-1) is known to induce the synthesis of this enzyme, thereby raising the level of PGH synthase protein severalfold over the basal level. Pretreatment with aspirin at low concentrations inhibited more than 60% of the enzyme mass and also the cyclooxygenase activity in IL-1-induced cells with only minimal effects on the basal level of the synthase enzyme in cells without IL-1. Sodium salicylate exhibited a similar inhibitory action whereas indomethacin had no apparent effect. Similarly low levels of aspirin inhibited the increased L-[ 35 S]methionine incorporation into PGH synthase that was induced by IL0-1 and also suppressed expression of the 2.7-kilobase PGH synthase mRNA. These results suggest that in cultured endothelial cells a potent inhibition of eicosanoid biosynthetic capacity can be effected by aspirin or salicylate at the level of PGH synthase gene expression. The aspirin effect may well be due to degradation of salicylate

Evolutionary history of callose synthases in terrestrial plants with emphasis on proteins involved in male gametophyte development.

Directory of Open Access Journals (Sweden)

Lenka Záveská Drábková

Full Text Available Callose is a plant-specific polysaccharide (β-1,3-glucan playing an important role in angiosperms in many developmental processes and responses to biotic and abiotic stresses. Callose is synthesised at the plasma membrane of plant cells by callose synthase (CalS and, among others, represents the main polysaccharide in the callose wall surrounding the tetrads of developing microspores and in the growing pollen tube wall. CalS proteins involvement in spore development is a plesiomorphic feature of terrestrial plants, but very little is known about their evolutionary origin and relationships amongst the members of this protein family. We performed thorough comparative analyses of callose synthase family proteins from major plant lineages to determine their evolutionary history across the plant kingdom. A total of 1211 candidate CalS sequences were identified and compared amongst diverse taxonomic groups of plants, from bryophytes to angiosperms. Phylogenetic analyses identified six main clades of CalS proteins and suggested duplications during the evolution of specialised functions. Twelve family members had previously been identified in Arabidopsis thaliana. We focused on five CalS subfamilies directly linked to pollen function and found that proteins expressed in pollen evolved twice. CalS9/10 and CalS11/12 formed well-defined clades, whereas pollen-specific CalS5 was found within subfamilies that mostly did not express in mature pollen vegetative cell, although were found in sperm cells. Expression of five out of seven mature pollen-expressed CalS genes was affected by mutations in bzip transcription factors. Only three subfamilies, CalS5, CalS10, and CalS11, however, formed monophyletic, mostly conserved clades. The pairs CalS9/CalS10, CalS11/CalS12 and CalS3 may have diverged after angiosperms diversified from lycophytes and bryophytes. Our analysis of fully sequenced plant proteins identified new evolutionary lineages of callose synthase

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

KAUST Repository

Lawton, Jennifer

2012-03-29

Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

Directory of Open Access Journals (Sweden)

Lawton Jennifer

2012-03-01

Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

KAUST Repository

Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

2012-01-01

Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

Directory of Open Access Journals (Sweden)

Petar Petrov

Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

The phosphatidylinositol synthase gene (GhPIS) contributes to longer, stronger, and finer fibers in cotton.

Science.gov (United States)

Long, Qin; Yue, Fang; Liu, Ruochen; Song, Shuiqing; Li, Xianbi; Ding, Bo; Yan, Xingying; Pei, Yan

2018-05-11

Cotton fibers are the most important natural raw material used in textile industries world-wide. Fiber length, strength, and fineness are the three major traits which determine the quality and economic value of cotton. It is known that exogenous application of phosphatidylinositols (PtdIns), important structural phospholipids, can promote cotton fiber elongation. Here, we sought to increase the in planta production of PtdIns to improve fiber traits. Transgenic cotton plants were generated in which the expression of a cotton phosphatidylinositol synthase gene (i.e., GhPIS) was controlled by the fiber-specific SCFP promoter element, resulting in the specific up-regulation of GhPIS during cotton fiber development. We demonstrate that PtdIns content was significantly enhanced in transgenic cotton fibers and the elevated level of PtdIns stimulated the expression of genes involved in PtdIns phosphorylation as well as promoting lignin/lignin-like phenolic biosynthesis. Fiber length, strength and fineness were also improved in the transgenic plants as compared to the wild-type cotton, with no loss in overall fiber yield. Our data indicate that fiber-specific up-regulation of PtdIns synthesis is a promising strategy for cotton fiber quality improvement.

Cystathionine β-synthase T833C/844INS68 polymorphism: a family-based study on mentally retarded children

Directory of Open Access Journals (Sweden)

Mukhopadhyay Jotideb

2005-12-01

Full Text Available Abstract Background Cystathionine β-synthase (CBS mediates conversion of homocysteine to cystathionine and deficiency in enzyme activity may lead to hyperhomocysteinemia/homocystinuria, which are often associated with mental retardation (MR. A large number of polymorphisms have been reported in the CBS gene, some of which impair its activity and among these, a T833C polymorphism in cis with a 68 bp insertion at 844 in the exon 8 is found to be associated with mild hyperhomocysteinemia in different ethnic groups. Methods The present study is aimed at investigating the association between T833C/844ins68 polymorphism and MR. One hundred and ninety MR cases were recruited after psychometric evaluation. Hundred and thirty-eight control subjects, two hundred and sixty-seven parents of MR probands and thirty cardiovascular disorder (CVD patients were included for comparison. Peripheral blood was collected after obtaining informed written consent. The T833C/844ins68 polymorphism was investigated by PCR amplification of genomic DNA and restriction fragment length polymorphism analysis, followed by statistical analysis. Results The genotypic distribution of the polymorphism was within the Hardy-Weinberg equilibrium. A slightly increased genotypic frequency was observed in the Indian control population as compared to other Asian populations. Both haplotype-based haplotype relative risk analysis and transmission disequilibrium test reveled lack of association of the T833C/844ins68 polymorphism with MR; nevertheless, the relative risk calculated was higher (>1 and in a limited number of informative MR families, preferential transmission of the double mutant from heterozygous mothers to the MR probands was noticed (χ2 = 4.00, P Conclusion This is the first molecular genetic study of CBS gene dealing with T833C/844ins68 double mutation in MR subjects. Our preliminary data indicate lack of association between T833C/844ins68 polymorphism with MR. However

Plant ion channels: gene families, physiology, and functional genomics analyses.

Science.gov (United States)

Ward, John M; Mäser, Pascal; Schroeder, Julian I

2009-01-01

Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

Directory of Open Access Journals (Sweden)

Li Guo

2014-01-01

Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

Novel genetic variants in miR-191 gene and familial ovarian cancer

International Nuclear Information System (INIS)

Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

2010-01-01

Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

SEQUENCE OF THE STRUCTURAL GENE FOR GRANULE-BOUND STARCH SYNTHASE OF POTATO (SOLANUM-TUBEROSUM L) AND EVIDENCE FOR A SINGLE POINT DELETION IN THE AMF ALLELE

NARCIS (Netherlands)

van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem

The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type

Four Novel Cellulose Synthase (CESA Genes from Birch (Betula platyphylla Suk. Involved in Primary and Secondary Cell Wall Biosynthesis

Directory of Open Access Journals (Sweden)

Xuemei Liu

2012-09-01

Full Text Available Cellulose synthase (CESA, which is an essential catalyst for the generation of plant cell wall biomass, is mainly encoded by the CesA gene family that contains ten or more members. In this study; four full-length cDNAs encoding CESA were isolated from Betula platyphylla Suk., which is an important timber species, using RT-PCR combined with the RACE method and were named as BplCesA3, −4, −7 and −8. These deduced CESAs contained the same typical domains and regions as their Arabidopsis homologs. The cDNA lengths differed among these four genes, as did the locations of the various protein domains inferred from the deduced amino acid sequences, which shared amino acid sequence identities ranging from only 63.8% to 70.5%. Real-time RT-PCR showed that all four BplCesAs were expressed at different levels in diverse tissues. Results indicated that BplCESA8 might be involved in secondary cell wall biosynthesis and floral development. BplCESA3 appeared in a unique expression pattern and was possibly involved in primary cell wall biosynthesis and seed development; it might also be related to the homogalacturonan synthesis. BplCESA7 and BplCESA4 may be related to the formation of a cellulose synthase complex and participate mainly in secondary cell wall biosynthesis. The extremely low expression abundance of the four BplCESAs in mature pollen suggested very little involvement of them in mature pollen formation in Betula. The distinct expression pattern of the four BplCesAs suggested they might participate in developments of various tissues and that they are possibly controlled by distinct mechanisms in Betula.

The Dendrobium catenatum Lindl. genome sequence provides insights into polysaccharide synthase, floral development and adaptive evolution.

Science.gov (United States)

Zhang, Guo-Qiang; Xu, Qing; Bian, Chao; Tsai, Wen-Chieh; Yeh, Chuan-Ming; Liu, Ke-Wei; Yoshida, Kouki; Zhang, Liang-Sheng; Chang, Song-Bin; Chen, Fei; Shi, Yu; Su, Yong-Yu; Zhang, Yong-Qiang; Chen, Li-Jun; Yin, Yayi; Lin, Min; Huang, Huixia; Deng, Hua; Wang, Zhi-Wen; Zhu, Shi-Lin; Zhao, Xiang; Deng, Cao; Niu, Shan-Ce; Huang, Jie; Wang, Meina; Liu, Guo-Hui; Yang, Hai-Jun; Xiao, Xin-Ju; Hsiao, Yu-Yun; Wu, Wan-Lin; Chen, You-Yi; Mitsuda, Nobutaka; Ohme-Takagi, Masaru; Luo, Yi-Bo; Van de Peer, Yves; Liu, Zhong-Jian

2016-01-12

Orchids make up about 10% of all seed plant species, have great economical value, and are of specific scientific interest because of their renowned flowers and ecological adaptations. Here, we report the first draft genome sequence of a lithophytic orchid, Dendrobium catenatum. We predict 28,910 protein-coding genes, and find evidence of a whole genome duplication shared with Phalaenopsis. We observed the expansion of many resistance-related genes, suggesting a powerful immune system responsible for adaptation to a wide range of ecological niches. We also discovered extensive duplication of genes involved in glucomannan synthase activities, likely related to the synthesis of medicinal polysaccharides. Expansion of MADS-box gene clades ANR1, StMADS11, and MIKC(*), involved in the regulation of development and growth, suggests that these expansions are associated with the astonishing diversity of plant architecture in the genus Dendrobium. On the contrary, members of the type I MADS box gene family are missing, which might explain the loss of the endospermous seed. The findings reported here will be important for future studies into polysaccharide synthesis, adaptations to diverse environments and flower architecture of Orchidaceae.

Alternative splicing of the porcine glycogen synthase kinase 3β (GSK-3β gene with differential expression patterns and regulatory functions.

Directory of Open Access Journals (Sweden)

Linjie Wang

Full Text Available Glycogen synthase kinase 3 (GSK3α and GSK3β are serine/threonine kinases involved in numerous cellular processes and diverse diseases including mood disorders, Alzheimer's disease, diabetes, and cancer. However, in pigs, the information on GSK3 is very limited. Identification and characterization of pig GSK3 are not only important for pig genetic improvement, but also contribute to the understanding and development of porcine models for human disease prevention and treatment.Five different isoforms of GSK3β were identified in porcine different tissues, in which three isoforms are novel. These isoforms had differential expression patterns in the fetal and adult of the porcine different tissues. The mRNA expression level of GSK3β isoforms was differentially regulated during the course of the insulin treatment, suggesting that different GSK3β isoforms may have different roles in insulin signaling pathway. Moreover, GSK3β5 had a different role on regulating the glycogen synthase activity, phosphorylation and the expression of porcine GYS1 and GYS2 gene compared to other GSK3β isoforms.We are the first to report five different isoforms of GSK3β identified from the porcine different tissues. Splice variants of GSK3β exhibit differential activity towards glycogen synthase. These results provide new insight into roles of the GSK3β on regulating glycogen metabolism.

Molecular analysis of the NDP gene in two families with Norrie disease.

Science.gov (United States)

Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

2005-04-01

To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

DEFF Research Database (Denmark)

Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

2006-01-01

MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

Science.gov (United States)

Al-Salam, Ahmad; Irwin, David M

2017-06-23

Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

Polymorphism in the interferon-{alpha} gene family

Energy Technology Data Exchange (ETDEWEB)

Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

1996-09-01

A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

msh/Msx gene family in neural development.

Science.gov (United States)

Ramos, Casto; Robert, Benoît

2005-11-01

The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

OpenAIRE

Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

2010-01-01

The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

Science.gov (United States)

Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

2012-01-01

Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

International Nuclear Information System (INIS)

Dotson, G.D.; Woodard, R.W.

1994-01-01

The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3 2 H)PEP, (2- 13 C)PEP, and (2- 13 C, 18 O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our 1 H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3- 2 H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3- 2 H)PEP gave predominantly (3S)-(3 2 H)KDO 8-P and (E)-(3- 2 H)PEP gave predominantly (3R)-(3 2 H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2- 13 C, 18 O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both 13 C- and 31 P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the 18 O

Mechanistic studies of 3-deoxy-D-manno-octulosonic acid 8-phosphate synthase

Energy Technology Data Exchange (ETDEWEB)

Dotson, G.D.; Woodard, R.W. [Univ. of Michigan, Ann Arbor, MI (United States)

1994-12-01

The enzyme 3-deOXY-D-manno-octulosonic acid 8-phosphate synthase (KDO 8-P synthase) catalyses the condensation of arabinose 5-phosphate (A 5-P) with phosphoenolpyruvate (PEP) to give the unique eight-carbon acidic sugar 3-deoxy-D-nianno-octulosonic acid 8-phosphate (KDO 8-P) found only in gram-negative bacteria and required for lipid A maturation and cellular growth. The E. coli gene kdsA that encodes KDO 8-P synthase has been amplified by standard PCR methodologies. The synthetic gene, subcloned into the expression vector pT7-7 was used to infect E. coli BL 21 (DE 3). Purification of crude supernatant from this transformant on Q Sepharose yields >200 mg of near-homogeneous KDO 8-P synthase per liter of cell culture. To explore the mechanism of KDO 8-P synthase, we prepared (E)- and (Z)-(3{sup 2}H)PEP, (2-{sup 13}C)PEP, and (2-{sup 13}C,{sup 18}O)PEP chemically from the appropriately labeled 3-bromopyruvates by reaction with trimethylphosphite under Perkow reaction conditions. Our {sup 1}H-NMR analysis of the stereochemistry at C3 of the KDO 8-Ps, obtained by separate incubation of (E)- and (Z)-(3-{sup 2}H)PEP with A 5-P in the presence of KDO 8-P synthase, demonstrated that the reaction is stereospecific with respect to both the C3 of PEP and the C1 carbonyl of A 5-P. (Z)-(3-{sup 2}H)PEP gave predominantly (3S)-(3{sup 2}H)KDO 8-P and (E)-(3-{sup 2}H)PEP gave predominantly (3R)-(3{sup 2}H)KDO-8P, which indicates condensation of the si face of PEP upon the re face of A 5-P-an orientation analogous to that seen with the similar aldehyde Iyase DAH 7-P synthase. The fate of the enolic oxygen of (2-{sup 13}C, {sup 18}O)PEP, during the course of the KDO 8-P synthase-catalyzed reaction as monitored by both {sup 13}C- and {sup 31}P-NMR spectroscopy demonstrated that the inorganic phosphate (Pi) and not the KDO 8-P contained the {sup 18}O.

Silybin content and overexpression of chalcone synthase genes in Silybum marianum L. plants under abiotic elicitation.

Science.gov (United States)

El-Garhy, Hoda A S; Khattab, Salah; Moustafa, Mahmoud M A; Abou Ali, Rania; Abdel Azeiz, Ahmed Z; Elhalwagi, Abeer; El Sherif, Fadia

2016-11-01

Silymarin, a Silybum marianum seed extract containing a mixture of flavonolignans including silybin, is being used as an antihepatotoxic therapy for liver diseases. In this study, the enhancing effect of gamma irradiation on plant growth parameters of S. marianum under salt stress was investigated. The effect of gamma irradiation, either as a single elicitor or coupled with salinity, on chalcone synthase (CHS) gene expression and silybin A + B yield was also evaluated. The silybin A + B content in S. marianum fruits was estimated by liquid chromatography-mass spectrometry (LC-MS/MS). An increase in silybin content was accompanied by up-regulation of the CHS1, CHS2 and CHS3 genes, which are involved in the silybin biosynthetic pathway. The highest silybin A + B production (0.77 g/100 g plant DW) and transcript levels of the three studied genes (100.2-, 91.9-, and 24.3-fold increase, respectively) were obtained with 100GY gamma irradiation and 4000 ppm salty water. The CHS2 and CHS3 genes were partially sequenced and submitted to the NCBI database under the accession numbers KT252908.1 and KT252909.1, respectively. Developing new approaches to stimulate silybin biosynthetic pathways could be a useful tool to potentiate the use of plants as renewable resources of medicinal compounds. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Chalcone Synthase (CHS) Gene Suppression in Flax Leads to Changes in Wall Synthesis and Sensing Genes, Cell Wall Chemistry and Stem Morphology Parameters

Science.gov (United States)

Zuk, Magdalena; Działo, Magdalena; Richter, Dorota; Dymińska, Lucyna; Matuła, Jan; Kotecki, Andrzej; Hanuza, Jerzy; Szopa, Jan

2016-01-01

The chalcone synthase (CHS) gene controls the first step in the flavonoid biosynthesis. In flax, CHS down-regulation resulted in tannin accumulation and reduction in lignin synthesis, but plant growth was not affected. This suggests that lignin content and thus cell wall characteristics might be modulated through CHS activity. This study investigated the possibility that CHS affects cell wall sensing as well as polymer content and arrangement. CHS-suppressed and thus lignin-reduced plants showed significant changes in expression of genes involved in both synthesis of components and cell wall sensing. This was accompanied by increased levels of cellulose and hemicellulose. CHS-reduced flax also showed significant changes in morphology and arrangement of the cell wall. The stem tissue layers were enlarged averagely twofold compared to the control, and the number of fiber cells more than doubled. The stem morphology changes were accompanied by reduction of the crystallinity index of the cell wall. CHS silencing induces a signal transduction cascade that leads to modification of plant metabolism in a wide range and thus cell wall structure. PMID:27446124

Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases

Directory of Open Access Journals (Sweden)

Saito Koji

2005-08-01

Full Text Available Abstract Background In Arabidopsis, ETO1 (ETHYLENE-OVERPRODUCER1 is a negative regulator of ethylene evolution by interacting with AtACS5, an isoform of the rate-limiting enzyme, 1-aminocyclopropane-1-carboxylate synthases (ACC synthase or ACS, in ethylene biosynthetic pathway. ETO1 directly inhibits the enzymatic activity of AtACS5. In addition, a specific interaction between ETO1 and AtCUL3, a constituent of a new type of E3 ubiquitin ligase complex, suggests the molecular mechanism in promoting AtACS5 degradation by the proteasome-dependent pathway. Because orthologous sequences to ETO1 are found in many plant species including tomato, we transformed tomato with Arabidopsis ETO1 to evaluate its ability to suppress ethylene production in tomato fruits. Results Transgenic tomato lines that overexpress Arabidopsis ETO1 (ETO1-OE did not show a significant delay of fruit ripening. So, we performed yeast two-hybrid assays to investigate potential heterologous interaction between ETO1 and three isozymes of ACC synthases from tomato. In the yeast two-hybrid system, ETO1 interacts with LE-ACS3 as well as AtACS5 but not with LE-ACS2 or LE-ACS4, two major isozymes whose gene expression is induced markedly in ripening fruits. According to the classification of ACC synthases, which is based on the C-terminal amino acid sequences, both LE-ACS3 and AtACS5 are categorized as type 2 isozymes and possess a consensus C-terminal sequence. In contrast, LE-ACS2 and LE-ACS4 are type 1 and type 3 isozymes, respectively, both of which do not possess this specific C-terminal sequence. Yeast two-hybrid analysis using chimeric constructs between LE-ACS2 and LE-ACS3 revealed that the type-2-ACS-specific C-terminal tail is required for interaction with ETO1. When treated with auxin to induce LE-ACS3, seedlings of ETO1-OE produced less ethylene than the wild type, despite comparable expression of the LE-ACS3 gene in the wild type. Conclusion These results suggest that ETO1

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

Science.gov (United States)

Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

2013-12-05

The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

Genome-wide identification, phylogenetic analysis, and expression profiling of polyamine synthesis gene family members in tomato.

Science.gov (United States)

Liu, Taibo; Huang, Binbin; Chen, Lin; Xian, Zhiqiang; Song, Shiwei; Chen, Riyuan; Hao, Yanwei

2018-06-30

Polyamines (PAs), including putrescine (Put), spermidine (Spd), spermine (Spm), and thermospermine (T-Spm), play key roles in plant development, including fruit setting and ripening, morphogenesis, and abiotic/biotic stress. Their functions appear to be intimately related to their synthesis, which occurs via arginine/ornithine decarboxylase (ADC/ODC), Spd synthase (SPDS), Spm synthase (SPMS), and Acaulis5 (ACL5), respectively. Unfortunately, the expression and function of these PA synthesis-relate genes during specific developmental process or under stress have not been fully elucidated. Here, we present the results of a genome-wide analysis of the PA synthesis genes (ADC, ODC, SPDS, SPMS, ACL5) in the tomato (Solanum lycopersicum). In total, 14 PA synthesis-related genes were identified. Further analysis of their structures, conserved domains, phylogenetic trees, predicted subcellular localization, and promoter cis-regulatory elements were analyzed. Furthermore, we also performed experiments to evaluate their tissue expression patterns and under hormone and various stress treatments. To our knowledge, this is the first study to elucidate the mechanisms underlying PA function in this variety of tomato. Taken together, these data provide valuable information for future functional characterization of specific genes in the PA synthesis pathway in this and other plant species. Although additional research is required, the insight gained by this and similar studies can be used to improve our understanding of PA metabolism ultimately leading to more effective and consistent plant cultivation. Copyright © 2018 Elsevier B.V. All rights reserved.

of endothelial nitric oxide synthase gene and serum level of vascular ...

African Journals Online (AJOL)

uwerhiavwe

Davignon and Ganz, 2004). NO is synthe- sized via a reaction that includes the conversion of L- arginine to L-citruline catalyzed by endothelial nitric oxide synthase (eNOS), which is one of the three isoforms of the enzyme (Mayer and Hemmens, 1997) ...

Factors influencing gene silencing of granule-bound starch synthase in potato

NARCIS (Netherlands)

Heilersig, H.J.B.

2005-01-01

In the past, antisense RNA technology was used to modify the composition of potato tuber starch. Potato starch comprises amylose and amylopectin, polymers of glucose. Amylose production in potato is completely dependent on the presence of granule-bound starch synthase I (GBSSI). Inhibition of GBSSI

Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

Science.gov (United States)

Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

2016-01-01

WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

A high-throughput colorimetric screening assay for terpene synthase activity based on substrate consumption.

Directory of Open Access Journals (Sweden)

Maiko Furubayashi

Full Text Available Terpene synthases catalyze the formation of a variety of terpene chemical structures. Systematic mutagenesis studies have been effective in providing insights into the characteristic and complex mechanisms of C-C bond formations and in exploring the enzymatic potential for inventing new chemical structures. In addition, there is growing demand to increase terpene synthase activity in heterologous hosts, given the maturation of metabolic engineering and host breeding for terpenoid synthesis. We have developed a simple screening method for the cellular activities of terpene synthases by scoring their substrate consumption based on the color loss of the cell harboring carotenoid pathways. We demonstrate that this method can be used to detect activities of various terpene synthase or prenyltransferase genes in a high-throughput manner, irrespective of the product type, enabling the mutation analysis and directed evolution of terpene synthases. We also report the possibility for substrate-specific screening system of terpene synthases by taking advantage of the substrate-size specificity of C30 and C40 carotenoid pathways.

Sunflower (Helianthus annuus) fatty acid synthase complex: β-hydroxyacyl-[acyl carrier protein] dehydratase genes.

Science.gov (United States)

González-Thuillier, Irene; Venegas-Calerón, Mónica; Sánchez, Rosario; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique

2016-02-01

Two sunflower hydroxyacyl-[acyl carrier protein] dehydratases evolved into two different isoenzymes showing distinctive expression levels and kinetics' efficiencies. β-Hydroxyacyl-[acyl carrier protein (ACP)]-dehydratase (HAD) is a component of the type II fatty acid synthase complex involved in 'de novo' fatty acid biosynthesis in plants. This complex, formed by four intraplastidial proteins, is responsible for the sequential condensation of two-carbon units, leading to 16- and 18-C acyl-ACP. HAD dehydrates 3-hydroxyacyl-ACP generating trans-2-enoyl-ACP. With the aim of a further understanding of fatty acid biosynthesis in sunflower (Helianthus annuus) seeds, two β-hydroxyacyl-[ACP] dehydratase genes have been cloned from developing seeds, HaHAD1 (GenBank HM044767) and HaHAD2 (GenBank GU595454). Genomic DNA gel blot analyses suggest that both are single copy genes. Differences in their expression patterns across plant tissues were detected. Higher levels of HaHAD2 in the initial stages of seed development inferred its key role in seed storage fatty acid synthesis. That HaHAD1 expression levels remained constant across most tissues suggest a housekeeping function. Heterologous expression of these genes in E. coli confirmed both proteins were functional and able to interact with the bacterial complex 'in vivo'. The large increase of saturated fatty acids in cells expressing HaHAD1 and HaHAD2 supports the idea that these HAD genes are closely related to the E. coli FabZ gene. The proposed three-dimensional models of HaHAD1 and HaHAD2 revealed differences at the entrance to the catalytic tunnel attributable to Phe166/Val1159, respectively. HaHAD1 F166V was generated to study the function of this residue. The 'in vitro' enzymatic characterization of the three HAD proteins demonstrated all were active, with the mutant having intermediate K m and V max values to the wild-type proteins.

Citrate synthase gene sequence: a new tool for phylogenetic analysis and identification of Ehrlichia.

Science.gov (United States)

Inokuma, H; Brouqui, P; Drancourt, M; Raoult, D

2001-09-01

The sequence of the citrate synthase gene (gltA) of 13 ehrlichial species (Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia muris, an Ehrlichia species recently detected from Ixodes ovatus, Cowdria ruminantium, Ehrlichia phagocytophila, Ehrlichia equi, the human granulocytic ehrlichiosis [HGE] agent, Anaplasma marginale, Anaplasma centrale, Ehrlichia sennetsu, Ehrlichia risticii, and Neorickettsia helminthoeca) have been determined by degenerate PCR and the Genome Walker method. The ehrlichial gltA genes are 1,197 bp (E. sennetsu and E. risticii) to 1,254 bp (A. marginale and A. centrale) long, and GC contents of the gene vary from 30.5% (Ehrlichia sp. detected from I. ovatus) to 51.0% (A. centrale). The percent identities of the gltA nucleotide sequences among ehrlichial species were 49.7% (E. risticii versus A. centrale) to 99.8% (HGE agent versus E. equi). The percent identities of deduced amino acid sequences were 44.4% (E. sennetsu versus E. muris) to 99.5% (HGE agent versus E. equi), whereas the homology range of 16S rRNA genes was 83.5% (E. risticii versus the Ehrlichia sp. detected from I. ovatus) to 99.9% (HGE agent, E. equi, and E. phagocytophila). The architecture of the phylogenetic trees constructed by gltA nucleotide sequences or amino acid sequences was similar to that derived from the 16S rRNA gene sequences but showed more-significant bootstrap values. Based upon the alignment analysis of the ehrlichial gltA sequences, two sets of primers were designed to amplify tick-borne Ehrlichia and Neorickettsia genogroup Ehrlichia (N. helminthoeca, E. sennetsu, and E. risticii), respectively. Tick-borne Ehrlichia species were specifically identified by restriction fragment length polymorphism (RFLP) patterns of AcsI and XhoI with the exception of E. muris and the very closely related ehrlichia derived from I. ovatus for which sequence analysis of the PCR product is needed. Similarly, Neorickettsia genogroup Ehrlichia species were specifically identified by

Genome-wide identification of the SWEET gene family in wheat.

Science.gov (United States)

Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

2018-02-05

The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

Crystallization and preliminary crystallographic analysis of mannosyl-3-phosphoglycerate synthase from Rubrobacter xylanophilus

International Nuclear Information System (INIS)

Sá-Moura, Bebiana; Albuquerque, Luciana; Empadinhas, Nuno; Costa, Milton S. da; Pereira, Pedro José Barbosa; Macedo-Ribeiro, Sandra

2008-01-01

The enzyme mannosyl-3-phosphoglycerate synthase from R. xylanophilus has been expressed, purified and crystallized. The crystals belong to the hexagonal space group P6 5 22 and diffract to 2.2 Å resolution. Rubrobacter xylanophilus is the only Gram-positive bacterium known to synthesize the compatible solute mannosylglycerate (MG), which is commonly found in hyperthermophilic archaea and some thermophilic bacteria. Unlike the salt-dependent pattern of accumulation observed in (hyper)thermophiles, in R. xylanophilus MG accumulates constitutively. The synthesis of MG in R. xylanophilus was tracked from GDP-mannose and 3-phosphoglycerate, but the genome sequence of the organism failed to reveal any of the genes known to be involved in this pathway. The native enzyme was purified and its N-terminal sequence was used to identify the corresponding gene (mpgS) in the genome of R. xylanophilus. The gene encodes a highly divergent mannosyl-3-phosphoglycerate synthase (MpgS) without relevant sequence homology to known mannosylphosphoglycerate synthases. In order to understand the specificity and enzymatic mechanism of this novel enzyme, it was expressed in Escherichia coli, purified and crystallized. The crystals thus obtained belonged to the hexagonal space group P6 5 22 and contained two protein molecules per asymmetric unit. The structure was solved by SIRAS using a mercury derivative

Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

Directory of Open Access Journals (Sweden)

Walker Angela M

2009-04-01

Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

Identification and characterization of NF-YB family genes in tung tree.

Science.gov (United States)

Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

2015-12-01

The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

Monoterpene synthases from common sage (Salvia officinalis)

Energy Technology Data Exchange (ETDEWEB)

Croteau, Rodney Bruce (Pullman, WA); Wise, Mitchell Lynn (Pullman, WA); Katahira, Eva Joy (Pullman, WA); Savage, Thomas Jonathan (Christchurch 5, NZ)

1999-01-01

cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

Glycogen Synthase Kinase-3 regulates IGFBP-1 gene transcription through the Thymine-rich Insulin Response Element

Directory of Open Access Journals (Sweden)

Marquez Rodolfo

2004-09-01

Full Text Available Abstract Background Hepatic expression of several gene products involved in glucose metabolism, including phosphoenolpyruvate carboxykinase (PEPCK, glucose-6-phosphatase (G6Pase and insulin-like growth factor binding protein-1 (IGFBP-1, is rapidly and completely inhibited by insulin. This inhibition is mediated through the regulation of a DNA element present in each of these gene promoters, that we call the Thymine-rich Insulin Response Element (TIRE. The insulin signalling pathway that results in the inhibition of these gene promoters requires the activation of phosphatidylinositol 3-kinase (PI 3-kinase. However, the molecules that connect PI 3-kinase to these gene promoters are not yet fully defined. Glycogen Synthase Kinase 3 (GSK-3 is inhibited following activation of PI 3-kinase. We have shown previously that inhibitors of GSK-3 reduce the activity of two TIRE-containing gene promoters (PEPCK and G6Pase, whose products are required for gluconeogenesis. Results In this report we demonstrate that in H4IIE-C3 cells, four distinct classes of GSK-3 inhibitor mimic the effect of insulin on a third TIRE-containing gene, IGFBP-1. We identify the TIRE as the minimum requirement for inhibition by these agents, and demonstrate that the target of GSK-3 is unlikely to be the postulated TIRE-binding protein FOXO-1. Importantly, overexpression of GSK-3 in cells reduces the insulin regulation of TIRE activity as well as endogenous IGFBP-1 expression. Conclusions These results implicate GSK-3 as an intermediate in the pathway from the insulin receptor to the TIRE. Indeed, this is the first demonstration of an absolute requirement for GSK-3 inhibition in insulin regulation of gene transcription. These data support the potential use of GSK-3 inhibitors in the treatment of insulin resistant states such as Type 2 diabetes mellitus, but suggest that it will be important to identify all TIRE-containing genes to assess potential side effects of these agents.

A CESA from Griffithsia monilis (Rhodophyta, Florideophyceae) has a family 48 carbohydrate-binding module.

Science.gov (United States)

Matthews, Peter R; Schindler, Michael; Howles, Paul; Arioli, Tony; Williamson, Richard E

2010-10-01

Cellulose synthases form rosette terminal complexes in the plasma membranes of Streptophyta and various linear terminal complexes in other taxa. The sequence of a putative CESA from Griffithsia monilis (Rhodophyta, Floridiophyceae) was deduced using a cloning strategy involving degenerate primers, a cDNA library screen, and 5' and 3' rapid amplification of cDNA ends (RACE). RACE identified two alternative transcriptional starts and four alternative polyadenylation sites. The first translation start codon provided an open reading frame of 2610 bp encoding 870 amino acids and was PCR amplified without introns from genomic DNA. Southern hybridization indicated one strongly hybridizing gene with possible weakly related genes or pseudogenes. Amino acid sequence analysis identified a family 48 carbohydrate-binding module (CBM) upstream of the protein's first predicted transmembrane domain. There are broad similarities in predicted 3D structures of the family 48 modules from CESA, from several glycogen- and starch-binding enzymes, and from protein kinases, but there are substitutions at some residues thought to be involved in ligand binding. The module in G. monilis CESA will be on the cytoplasmic face of the plasma membrane so that it could potentially bind either low molecular weight ligands or starch which is cytosolic rather than inside membrane-bound plastids in red algae. Possible reasons why red algal CESAs have evolved family 48 modules perhaps as part of a system to regulate cellulose synthase activity in relation to cellular carbohydrate status are briefly discussed.

A CESA from Griffithsia monilis (Rhodophyta, Florideophyceae) has a family 48 carbohydrate-binding module

Science.gov (United States)

Matthews, Peter R.; Schindler, Michael; Howles, Paul; Arioli, Tony; Williamson, Richard E.

2010-01-01

Cellulose synthases form rosette terminal complexes in the plasma membranes of Streptophyta and various linear terminal complexes in other taxa. The sequence of a putative CESA from Griffithsia monilis (Rhodophyta, Floridiophyceae) was deduced using a cloning strategy involving degenerate primers, a cDNA library screen, and 5′ and 3′ rapid amplification of cDNA ends (RACE). RACE identified two alternative transcriptional starts and four alternative polyadenylation sites. The first translation start codon provided an open reading frame of 2610 bp encoding 870 amino acids and was PCR amplified without introns from genomic DNA. Southern hybridization indicated one strongly hybridizing gene with possible weakly related genes or pseudogenes. Amino acid sequence analysis identified a family 48 carbohydrate-binding module (CBM) upstream of the protein's first predicted transmembrane domain. There are broad similarities in predicted 3D structures of the family 48 modules from CESA, from several glycogen- and starch-binding enzymes, and from protein kinases, but there are substitutions at some residues thought to be involved in ligand binding. The module in G. monilis CESA will be on the cytoplasmic face of the plasma membrane so that it could potentially bind either low molecular weight ligands or starch which is cytosolic rather than inside membrane-bound plastids in red algae. Possible reasons why red algal CESAs have evolved family 48 modules perhaps as part of a system to regulate cellulose synthase activity in relation to cellular carbohydrate status are briefly discussed. PMID:20702566

Co-expression of peppermint geranyl diphosphate synthase small subunit enhances monoterpene production in transgenic tobacco plants.

Science.gov (United States)

Yin, Jun-Lin; Wong, Woon-Seng; Jang, In-Cheol; Chua, Nam-Hai

2017-02-01

Monoterpenes are important for plant survival and useful to humans. In addition to their function in plant defense, monoterpenes are also used as flavors, fragrances and medicines. Several metabolic engineering strategies have been explored to produce monoterpene in tobacco but only trace amounts of monoterpenes have been detected. We investigated the effects of Solanum lycopersicum 1-deoxy-d-xylulose-5-phosphate synthase (SlDXS), Arabidopsis thaliana geranyl diphosphate synthase 1 (AtGPS) and Mentha × piperita geranyl diphosphate synthase small subunit (MpGPS.SSU) on production of monoterpene and geranylgeranyl diphosphate (GGPP) diversities, and plant morphology by transient expression in Nicotiana benthamiana and overexpression in transgenic Nicotiana tabacum. We showed that MpGPS.SSU could enhance the production of various monoterpenes such as (-)-limonene, (-)-linalool, (-)-α-pinene/β-pinene or myrcene, in transgenic tobacco by elevating geranyl diphosphate synthase (GPS) activity. In addition, overexpression of MpGPS.SSU in tobacco caused early flowering phenotype and increased shoot branching by elevating contents of GA 3 and cytokinins due to upregulated transcript levels of several plastidic 2-C-methyl-d-erythritol-4-phosphate (MEP) pathway genes, geranylgeranyl diphosphate synthases 3 (GGPPS3) and GGPPS4. Our method would allow the identification of new monoterpene synthase genes using transient expression in N. benthamiana and the improvement of monoterpene production in transgenic tobacco plants. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Duplications and losses in gene families of rust pathogens highlight putative effectors.

Science.gov (United States)

Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

2014-01-01

Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

Genomewide analysis of TCP transcription factor gene family in ...

Indian Academy of Sciences (India)

Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

Human METTL12 is a mitochondrial methyltransferase that modifies citrate synthase.

Science.gov (United States)

Rhein, Virginie F; Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

2017-06-01

The protein methylome in mammalian mitochondria has been little studied until recently. Here, we describe that lysine-368 of human citrate synthase is methylated and that the modifying enzyme, localized in the mitochondrial matrix, is methyltransferase-like protein 12 (METTL12), a member of the family of 7β-strand methyltransferases. Lysine-368 is near the active site of citrate synthase, but removal of methylation has no effect on its activity. In mitochondria, it is possible that some or all of the enzymes of the citric acid cycle, including citrate synthase, are organized in metabolons to facilitate the channelling of substrates between participating enzymes. Thus, possible roles for the methylation of Lys-368 are in controlling substrate channelling itself, or in influencing protein-protein interactions in the metabolon. © 2017 The Authors FEBS Letters published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Cloning expression and analysis of phytochelatin synthase (pcs) gene from Anabaena sp. PCC 7120 offering multiple stress tolerance in Escherichia coli

International Nuclear Information System (INIS)

Chaurasia, Neha; Mishra, Yogesh; Rai, Lal Chand

2008-01-01

Phytochelatin synthase (PCS) is involved in the synthesis of phytochelatins (PCs), plays role in heavy metal detoxification. The present study describes for first time the functional expression and characterization of pcs gene of Anabaena sp. PCC 7120 in Escherichia coli in terms of offering protection against heat, salt, carbofuron (pesticide), cadmium, copper, and UV-B stress. The involvement of pcs gene in tolerance to above abiotic stresses was investigated by cloning of pcs gene in expression vector pGEX-5X-2 and its transformation in E. coli BL21 (DE3). The E. coli cells transformed with pGEX-5X-pcs showed better growth than control cells (pGEX-5X-2) under temperature (47 deg. C), NaCl (6% w/v), carbofuron (0.025 mg ml -1 ), CdCl 2 (4 mM), CuCl 2 (1 mM), and UV-B (10 min) exposure. The enhanced expression of pcs gene revealed by RT-PCR analysis under above stresses at different time intervals further advocates its role in tolerance against above abiotic stresses

The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

Directory of Open Access Journals (Sweden)

Mohammad H Dezfulian

Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

Science.gov (United States)

Davarniya, Behzad; Hu, Hao; Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F; Ropers, H Hilger; Najmabadi, Hossein

2015-01-01

Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

OpenAIRE

Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R

1994-01-01

We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E...

Novel class III phosphoribosyl diphosphate synthase: structure and properties of the tetrameric, phosphate-activated, non-allosterically inhibited enzyme from Methanocaldococcus jannaschii

DEFF Research Database (Denmark)

Kadziola, Anders; Jepsen, Clemens H; Johansson, Eva

2005-01-01

The prs gene encoding phosphoribosyl diphosphate (PRPP) synthase of the hyperthermophilic autotrophic methanogenic archaeon Methanocaldococcus jannaschii has been cloned and expressed in Escherichia coli. Subsequently, M.jannaschii PRPP synthase has been purified, characterised, crystallised, and...

A multilevel prediction of physiological response to challenge: Interactions among child maltreatment, neighborhood crime, endothelial nitric oxide synthase gene (eNOS), and GABA(A) receptor subunit alpha-6 gene (GABRA6).

Science.gov (United States)

Lynch, Michael; Manly, Jody Todd; Cicchetti, Dante

2015-11-01

Physiological response to stress has been linked to a variety of healthy and pathological conditions. The current study conducted a multilevel examination of interactions among environmental toxins (i.e., neighborhood crime and child maltreatment) and specific genetic polymorphisms of the endothelial nitric oxide synthase gene (eNOS) and GABA(A) receptor subunit alpha-6 gene (GABRA6). One hundred eighty-six children were recruited at age 4. The presence or absence of child maltreatment as well as the amount of crime that occurred in their neighborhood during the previous year were determined at that time. At age 9, the children were brought to the lab, where their physiological response to a cognitive challenge (i.e., change in the amplitude of the respiratory sinus arrhythmia) was assessed and DNA samples were collected for subsequent genotyping. The results confirmed that complex Gene × Gene, Environment × Environment, and Gene × Environment interactions were associated with different patterns of respiratory sinus arrhythmia reactivity. The implications for future research and evidence-based intervention are discussed.

The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

Science.gov (United States)

Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

2005-06-01

Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

De novo assembly of Eugenia uniflora L. transcriptome and identification of genes from the terpenoid biosynthesis pathway.

Science.gov (United States)

Guzman, Frank; Kulcheski, Franceli Rodrigues; Turchetto-Zolet, Andreia Carina; Margis, Rogerio

2014-12-01

Pitanga (Eugenia uniflora L.) is a member of the Myrtaceae family and is of particular interest due to its medicinal properties that are attributed to specialized metabolites with known biological activities. Among these molecules, terpenoids are the most abundant in essential oils that are found in the leaves and represent compounds with potential pharmacological benefits. The terpene diversity observed in Myrtaceae is determined by the activity of different members of the terpene synthase and oxidosqualene cyclase families. Therefore, the aim of this study was to perform a de novo assembly of transcripts from E. uniflora leaves and to annotation to identify the genes potentially involved in the terpenoid biosynthesis pathway and terpene diversity. In total, 72,742 unigenes with a mean length of 1048bp were identified. Of these, 43,631 and 36,289 were annotated with the NCBI non-redundant protein and Swiss-Prot databases, respectively. The gene ontology categorized the sequences into 53 functional groups. A metabolic pathway analysis with KEGG revealed 8,625 unigenes assigned to 141 metabolic pathways and 40 unigenes predicted to be associated with the biosynthesis of terpenoids. Furthermore, we identified four putative full-length terpene synthase genes involved in sesquiterpenes and monoterpenes biosynthesis, and three putative full-length oxidosqualene cyclase genes involved in the triterpenes biosynthesis. The expression of these genes was validated in different E. uniflora tissues. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

Science.gov (United States)

Rawal, H C; Singh, N K; Sharma, T R

2013-01-01

Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

Directory of Open Access Journals (Sweden)

H. C. Rawal

2013-01-01

Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

Influence of gibberellin and daminozide on the expression of terpene synthases and on monoterpenes in common sage (Salvia officinalis).

Science.gov (United States)

Schmiderer, Corinna; Grausgruber-Gröger, Sabine; Grassi, Paolo; Steinborn, Ralf; Novak, Johannes

2010-07-01

Common sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants, with antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, composed mainly of the monoterpenes 1,8-cineole, alpha-thujone, beta-thujone and camphor, is responsible for some of these effects. Gibberellins regulate diverse physiological processes in plants, such as seed germination, shoot elongation and cell division. In this study, we analyzed the effect of exogenously applied plant growth regulators, namely gibberellic acid (GA(3)) and daminozide, on leaf morphology and essential oil formation of two leaf stages during the period of leaf expansion. Essential oil content increased with increasing levels of gibberellins and decreased when gibberellin biosynthesis was blocked with daminozide. With increasing levels of gibberellins, 1,8-cineole and camphor contents increased. Daminozide blocked the accumulation of alpha- and beta-thujone. GA(3) at the highest level applied also led to a significant decrease of alpha- and beta-thujone. Monoterpene synthases are a class of enzymes responsible for the first step in monoterpene biosynthesis, competing for the same substrate geranylpyrophosphate. The levels of gene expression of the three most important monoterpene synthases in sage were investigated, 1,8-cineole synthase leading directly to 1,8-cineole, (+)-sabinene synthase responsible for the first step in the formation of alpha- and beta-thujone, and (+)-bornyl diphosphate synthase, the first step in camphor biosynthesis. The foliar application of GA(3) increased, while daminozide significantly decreased gene expression of the monoterpene synthases. The amounts of two of the end products, 1,8-cineole and camphor, were directly correlated with the levels of gene expression of the respective monoterpene synthases, indicating transcriptional control, while the formation of alpha- and beta

Contribution of granule bound starch synthase in kernel modification ...

African Journals Online (AJOL)

The role of gbssI and gbssII genes, encoding granule bound starch synthase enzyme I and II, respectively, in quality protein maize (QPM) were studied at different days after pollination (DAP). Total RNA was used for first strand cDNA synthesis using the ImpromIISriptTM reverse transcriptase. No detectable levels of gbssI ...

Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

Science.gov (United States)

Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

2018-02-16

For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

Methanogenic Paraffin Biodegradation: Alkylsuccinate Synthase Gene Quantification and Dicarboxylic Acid Production.

Science.gov (United States)

Oberding, Lisa K; Gieg, Lisa M

2018-01-01

Paraffinic n -alkanes (>C 17 ) that are solid at ambient temperature comprise a large fraction of many crude oils. The comparatively low water solubility and reactivity of these long-chain alkanes can lead to their persistence in the environment following fuel spills and pose serious problems for crude oil recovery operations by clogging oil production wells. However, the degradation of waxy paraffins under the anoxic conditions characterizing contaminated groundwater environments and deep subsurface energy reservoirs is poorly understood. Here, we assessed the ability of a methanogenic culture enriched from freshwater fuel-contaminated aquifer sediments to biodegrade the model paraffin n -octacosane (C 28 H 58 ). Compared with that in controls, the consumption of n -octacosane was coupled to methane production, demonstrating its biodegradation under these conditions. Smithella was postulated to be an important C 28 H 58 degrader in the culture on the basis of its high relative abundance as determined by 16S rRNA gene sequencing. An identified assA gene (known to encode the α subunit of alkylsuccinate synthase) aligned most closely with those from other Smithella organisms. Quantitative PCR (qPCR) and reverse transcription qPCR assays for assA demonstrated significant increases in the abundance and expression of this gene in C 28 H 58 -degrading cultures compared with that in controls, suggesting n -octacosane activation by fumarate addition. A metabolite analysis revealed the presence of several long-chain α,ω-dicarboxylic acids only in the C 28 H 58 -degrading cultures, a novel observation providing clues as to how methanogenic consortia access waxy hydrocarbons. The results of this study broaden our understanding of how waxy paraffins can be biodegraded in anoxic environments with an application toward bioremediation and improved oil recovery. IMPORTANCE Understanding the methanogenic biodegradation of different classes of hydrocarbons has important

Polyketide synthases from poison hemlock (Conium maculatum L.).

Science.gov (United States)

Hotti, Hannu; Seppänen-Laakso, Tuulikki; Arvas, Mikko; Teeri, Teemu H; Rischer, Heiko

2015-11-01

Coniine is a toxic alkaloid, the biosynthesis of which is not well understood. A possible route, supported by evidence from labelling experiments, involves a polyketide formed by the condensation of one acetyl-CoA and three malonyl-CoAs catalysed by a polyketide synthase (PKS). We isolated PKS genes or their fragments from poison hemlock (Conium maculatum L.) by using random amplification of cDNA ends (RACE) and transcriptome analysis, and characterized three full-length enzymes by feeding different starter-CoAs in vitro. On the basis of our in vitro experiments, two of the three characterized PKS genes in poison hemlock encode chalcone synthases (CPKS1 and CPKS2), and one encodes a novel type of PKS (CPKS5). We show that CPKS5 kinetically favours butyryl-CoA as a starter-CoA in vitro. Our results suggest that CPKS5 is responsible for the initiation of coniine biosynthesis by catalysing the synthesis of the carbon backbone from one butyryl-CoA and two malonyl-CoAs. © 2015 FEBS.

Genomewide analysis of MATE-type gene family in maize reveals ...

Indian Academy of Sciences (India)

Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

THE POLYMORPHISM OF THE SUS4 SUCROSE SYNTHASE DOMAIN SEQUENCES IN RUSSIAN, BELORUSSIAN AND KAZAKH POTATO CULTIVARS

Directory of Open Access Journals (Sweden)

M. A. Slugina

2016-01-01

Full Text Available The potato is one of the main strategic crops in the Russian Federation, Belarus and Kazakhstan. Currently, we have achieved significant advances in the understanding of metabolic mechanism of carbohydrate and interconversion «sucrose – starch» in potato tubers. Sucrose synthase (Sus is a key enzyme in the breakdown of sucrose. Sucrose synthase (Sus is catalyzing a reversible reaction of conversion sucrose and UDP into fructose and UDP-glucose. The identification and subsequent characterization of the genes encoding plant sucrose synthase is the first step towards understanding their physiological roles and metabolic mechanism involved in carbohydrate accumulation in potato tubers. In the present work the nucleotide and amino acid polymorphism of the Sus4 gene fragments containing sequences of the sucrose synthase domain were analyzed. Sus4 gene fragments (intron III – exon VI in 9 potato cultivars of Russian, Kazakh and Belarusian breeding were analyzed. The polymorphism of the Sus4 sucrose synthase domain sequences was first examined. The length of analyzed fragment varied from 977 b.p. (cultivars Favorit, Karasaiskii, Miras to 1013 b.p. (cultivars Zorochka, Manifest, Elisaveta, Bashkirskii. It was demonstrated that the examined sequences contained point mutations, as well as insertions and deletions. The common polymorphism level was 5.82%. It was shown that the examined sequences contained 58 SNPs and 4 indels. The most variable were introns IV (12.4% and V (9.18%. The most variable was exon IV. 7 allelic variants were detected. 6 different amino acid sequences specific to different varieties were also identified.

The variability of sesquiterpenes emitted from two Zea mays cultivars is controlled by allelic variation of two terpene synthase genes encoding stereoselective multiple product enzymes.

Science.gov (United States)

Köllner, Tobias G; Schnee, Christiane; Gershenzon, Jonathan; Degenhardt, Jörg

2004-05-01

The mature leaves and husks of Zea mays release a complex blend of terpene volatiles after anthesis consisting predominantly of bisabolane-, sesquithujane-, and bergamotane-type sesquiterpenes. The varieties B73 and Delprim release the same volatile constituents but in significantly different proportions. To study the molecular genetic and biochemical mechanisms controlling terpene diversity and distribution in these varieties, we isolated the closely related terpene synthase genes terpene synthase4 (tps4) and tps5 from both varieties. The encoded enzymes, TPS4 and TPS5, each formed the same complex mixture of sesquiterpenes from the precursor farnesyl diphosphate but with different proportions of products. These mixtures correspond to the sesquiterpene blends observed in the varieties B73 and Delprim, respectively. The differences in the stereoselectivity of TPS4 and TPS5 are determined by four amino acid substitutions with the most important being a Gly instead of an Ala residue at position 409 at the catalytic site of the enzyme. Although both varieties contain tps4 and tps5 alleles, their differences in terpene composition result from the fact that B73 has only a single functional allele of tps4 and no functional alleles of tps5, whereas Delprim has only a functional allele of tps5 and no functional alleles of tps4. Lack of functionality was shown to be attributable to frame-shift mutations or amino acid substitutions that greatly reduce the activity of their encoded proteins. Therefore, the diversity of sesquiterpenes in these two maize cultivars is strongly influenced by single nucleotide changes in the alleles of two terpene synthase genes.

Coordinated responses of phytochelatin synthase and metallothionein genes in black mangrove, Avicennia germinans, exposed to cadmium and copper

Energy Technology Data Exchange (ETDEWEB)

Gonzalez-Mendoza, Daniel [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico); Moreno, Adriana Quiroz [Unidad de biotecnologia, CICY, Merida, Yucatan (Mexico); Zapata-Perez, Omar [Departamento de Recursos del Mar, Cinvestav-Unidad Merida, Merida, Yucatan (Mexico)]. E-mail: ozapata@mda.cinvestav.mx

2007-08-01

To evaluate the role of phytochelatins and metallothioneins in heavy metal tolerance of black mangrove Avicennia germinans, 3-month-old seedlings were exposed to cadmium or copper for 30 h, under hydroponic conditions. Degenerate Mt2 and PCS primers were synthesized based on amino acid and nucleotide alignment sequences reported for Mt2 and PCS in other plant species found in GenBank. Total RNA was isolated from A. germinans leaves and two partial fragments of metallothionein and phytochelatin synthase genes were isolated. Gene expression was evaluated with reverse transcripatase-polymerase chain reaction (RT-PCR) amplification technique. Temporal analysis showed that low Cd{sup 2+} and Cu{sup 2+} concentrations caused a slight (but not significant) increase in AvMt2 expression after a 16 h exposure time, while AvPCS expression showed a significant increase under the same conditions but only after 4 h. Results strongly suggest that the rapid increase in AvPCS expression may contribute to Cd{sup 2+} and Cu{sup 2+} detoxification. Moreover, we found that A. germinans has the capacity to over-express both genes (AvMt2 and AvPCS), which may constitute a coordinated detoxification response mechanism targeting non-essential metals. Nonetheless, our results confirm that AvPCS was the most active gene involved in the regulation of essential metals (e.g., Cu{sup 2+}) in A. germinans leaves.

Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.)

Science.gov (United States)

Prasad, B. C. Narasimha; Kumar, Vinod; Gururaj, H. B.; Parimalan, R.; Giridhar, P.; Ravishankar, G. A.

2006-01-01

Capsaicin is a unique alkaloid of the plant kingdom restricted to the genus Capsicum. Capsaicin is the pungency factor, a bioactive molecule of food and of medicinal importance. Capsaicin is useful as a counterirritant, antiarthritic, analgesic, antioxidant, and anticancer agent. Capsaicin biosynthesis involves condensation of vanillylamine and 8-methyl nonenoic acid, brought about by capsaicin synthase (CS). We found that CS activity correlated with genotype-specific capsaicin levels. We purified and characterized CS (≈35 kDa). Immunolocalization studies confirmed that CS is specifically localized to the placental tissues of Capsicum fruits. Western blot analysis revealed concomitant enhancement of CS levels and capsaicin accumulation during fruit development. We determined the N-terminal amino acid sequence of purified CS, cloned the CS gene (csy1) and sequenced full-length cDNA (981 bp). The deduced amino acid sequence of CS from full-length cDNA was 38 kDa. Functionality of csy1 through heterologous expression in recombinant Escherichia coli was also demonstrated. Here we report the gene responsible for capsaicin biosynthesis, which is unique to Capsicum spp. With this information on the CS gene, speculation on the gene for pungency is unequivocally resolved. Our findings have implications in the regulation of capsaicin levels in Capsicum genotypes. PMID:16938870

Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

Science.gov (United States)

Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

2016-01-01

WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

Duplications and losses in gene families of rust pathogens highlight putative effectors

Directory of Open Access Journals (Sweden)

Amanda L. Pendleton

2014-06-01

Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

Diterpene synthases of the biosynthetic system of medicinally active diterpenoids in Marrubium vulgare

DEFF Research Database (Denmark)

Zerbe, Philipp; Chiang, Angela; Dullat, Harpreet

2014-01-01

Marrubium vulgare (Lamiaceae) is a medicinal plant whose major bioactive compounds, marrubiin and other labdane-related furanoid diterpenoids, have potential applications as anti-diabetics, analgesics or vasorelaxants. Metabolite and transcriptome profiling of M. vulgare leaves identified five...... different candidate diterpene synthases (diTPSs) of the TPS-c and TPS-e/f clades. We describe the in vitro and in vivo functional characterization of the M. vulgare diTPS family. In addition to MvEKS ent-kaurene synthase of general metabolism, we identified three diTPSs of specialized metabolism: MvCPS3...

Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

Science.gov (United States)

Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

2014-01-01

Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

DEFF Research Database (Denmark)

Christiansen, Michael W; Gregersen, Per L.

2014-01-01

-expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families.

Directory of Open Access Journals (Sweden)

Behzad Davarniya

Full Text Available Cognitive impairment or intellectual disability (ID is a widespread neurodevelopmental disorder characterized by low IQ (below 70. ID is genetically heterogeneous and is estimated to affect 1-3% of the world's population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID, we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831, encodes the metabotropic glutamate receptor1 (mGluR1. This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011. We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder.

The Role of a Novel TRMT1 Gene Mutation and Rare GRM1 Gene Defect in Intellectual Disability in Two Azeri Families

Science.gov (United States)

Kahrizi, Kimia; Musante, Luciana; Fattahi, Zohreh; Hosseini, Masoumeh; Maqsoud, Fariba; Farajollahi, Reza; Wienker, Thomas F.; Ropers, H. Hilger; Najmabadi, Hossein

2015-01-01

Cognitive impairment or intellectual disability (ID) is a widespread neurodevelopmental disorder characterized by low IQ (below 70). ID is genetically heterogeneous and is estimated to affect 1–3% of the world’s population. In affected children from consanguineous families, autosomal recessive inheritance is common, and identifying the underlying genetic cause is an important issue in clinical genetics. In the framework of a larger project, aimed at identifying candidate genes for autosomal recessive intellectual disorder (ARID), we recently carried out single nucleotide polymorphism-based genome-wide linkage analysis in several families from Ardabil province in Iran. The identification of homozygosity-by-descent loci in these families, in combination with whole exome sequencing, led us to identify possible causative homozygous changes in two families. In the first family, a missense variant was found in GRM1 gene, while in the second family, a frameshift alteration was identified in TRMT1, both of which were found to co-segregate with the disease. GRM1, a known causal gene for autosomal recessive spinocerebellar ataxia (SCAR13, MIM#614831), encodes the metabotropic glutamate receptor1 (mGluR1). This gene plays an important role in synaptic plasticity and cerebellar development. Conversely, the TRMT1 gene encodes a tRNA methyltransferase that dimethylates a single guanine residue at position 26 of most tRNAs using S-adenosyl methionine as the methyl group donor. We recently presented TRMT1 as a candidate gene for ARID in a consanguineous Iranian family (Najmabadi et al., 2011). We believe that this second Iranian family with a biallelic loss-of-function mutation in TRMT1 gene supports the idea that this gene likely has function in development of the disorder. PMID:26308914

The ACBP gene family in Rhodnius prolixus

DEFF Research Database (Denmark)

Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

2016-01-01

The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

Development of radiation-inducible promoters for use in nitric oxide synthase gene therapy of cancer

International Nuclear Information System (INIS)

Hirst, D.G.; Worthington, J.; Adams, C.; Robson, T.; Scott, S.D.

2003-01-01

Full text: The free radical nitric oxide (NO) at nM concentrations performs multiple signaling roles that are essential for survival. These processes are regulated via the enzymes nNOS and eNOS, but another isoform, inducible nitric oxide synthase (iNOS) is capable of generating much higher concentrations (mM) over longer periods, resulting in the generation of very toxic species such as peroxynitrite. At high concentrations NO has many of the characteristics of an ideal anticancer molecule: it is cytotoxic (pro-apoptotic via peroxynitrite), it is a potent chemical radiosensitizer, it is anti-angiogenic and anti-metastatic. Thus, we see iNOS gene therapy as a strategy for targeting the generation of high concentrations of NO to tumours for therapeutic benefit. iNOS gene therapy should be used in combination with radiotherapy; so it is logical that the use of a radiation-inducible promoter should be part of the targeting strategy. We have tested several candidate promoters in vitro and in vivo. The WAF1 promoter has many of the properties desirable for therapeutic use including: rapid 3-4 fold induction at X-ray doses of 2 and 4Gy and no significant leakiness. WAF1 also has the advantage of being inducible by hypoxia and by the final product, NO. We have also tested the synthetic CArG promoter and demonstrated that, in addition to a high level of radiation inducibility, it is also inducible by NO. We have also been able to demonstrate potent radiosensitization (SER 2.0-2.5) in tumour cells in vitro and in vivo using iNOS gene transfer with constitutive or radiation-inducible promoters. We have also tested the use of iNOS gene therapy in combination with cisplatin and shown significant enhancement

Aldosterone synthase gene polymorphism in alimentary obesity, metabolic syndrome components, some secondary forms of arterial hypertension, pathology of the adrenals glands core (literature review)

OpenAIRE

Koval, S.N.; Miloslavsky, D.K.; Snegurskaya, I.A.; Mysnichenko, O.V.; Penkova, M.Yu.

2017-01-01

Hormonal factors of adrenal origin belong to the pathophysiological mechanisms of the formation and progression of arterial hypertension (AH) and should be consi­dered while developing differentiated approaches to the treatment and prevention of hypertensive states, their primary, secondary and resistant forms. The first thing we should point up is aldosterone (AL), enzyme aldosterone synthase (AS), which takes a direct part in the formation of this hormone, as well as gene polymorphisms of A...

Identification of the 14-3-3 gene family in Rafflesia cantleyi

Science.gov (United States)

Rosli, Khadijah; Wan, Kiew-Lian

2018-04-01

Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

Selectable tolerance to herbicides by mutated acetolactate synthase genes integrated into the chloroplast genome of tobacco.

Science.gov (United States)

Shimizu, Masanori; Goto, Maki; Hanai, Moeko; Shimizu, Tsutomu; Izawa, Norihiko; Kanamoto, Hirosuke; Tomizawa, Ken-Ichi; Yokota, Akiho; Kobayashi, Hirokazu

2008-08-01

Strategies employed for the production of genetically modified (GM) crops are premised on (1) the avoidance of gene transfer in the field; (2) the use of genes derived from edible organisms such as plants; (3) preventing the appearance of herbicide-resistant weeds; and (4) maintaining transgenes without obstructing plant cell propagation. To this end, we developed a novel vector system for chloroplast transformation with acetolactate synthase (ALS). ALS catalyzes the first step in the biosynthesis of the branched amino acids, and its enzymatic activity is inhibited by certain classes of herbicides. We generated a series of Arabidopsis (Arabidopsis thaliana) mutated ALS (mALS) genes and introduced constructs with mALS and the aminoglycoside 3'-adenyltransferase gene (aadA) into the tobacco (Nicotiana tabacum) chloroplast genome by particle bombardment. Transplastomic plants were selected using their resistance to spectinomycin. The effects of herbicides on transplastomic mALS activity were examined by a colorimetric assay using the leaves of transplastomic plants. We found that transplastomic G121A, A122V, and P197S plants were specifically tolerant to pyrimidinylcarboxylate, imidazolinon, and sulfonylurea/pyrimidinylcarboxylate herbicides, respectively. Transplastomic plants possessing mALSs were able to grow in the presence of various herbicides, thus affirming the relationship between mALSs and the associated resistance to herbicides. Our results show that mALS genes integrated into the chloroplast genome are useful sustainable markers that function to exclude plants other than those that are GM while maintaining transplastomic crops. This investigation suggests that the resistance management of weeds in the field amid growing GM crops is possible using (1) a series of mALSs that confer specific resistance to herbicides and (2) a strategy that employs herbicide rotation.

Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

Science.gov (United States)

Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

2017-10-01

The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

Galactinol synthase transcriptional profile in two genotypes of Coffea canephora with contrasting tolerance to drought

Directory of Open Access Journals (Sweden)

Tiago Benedito Dos Santos

2015-06-01

Full Text Available Increased synthesis of galactinol and raffinose family oligosaccharides (RFOs has been reported in vegetative tissues in response to a range of abiotic stresses. In this work, we evaluated the transcriptional profile of a Coffea canephora galactinol synthase gene (CcGolS1 in two clones that differed in tolerance to water deficit in order to assess the contribution of this gene to drought tolerance. The expression of CcGolS1 in leaves was differentially regulated by water deficit, depending on the intensity of stress and the genotype. In clone 109A (drought-susceptible, the abundance of CcGolS1 transcripts decreased upon exposure to drought, reaching minimum values during recovery from severe water deficit and stress. In contrast, CcGolS1 gene expression in clone 14 (drought-tolerant was stimulated by water deficit. Changes in galactinol and RFO content did not correlate with variation in the steady-state transcript level. However, the magnitude of increase in RFO accumulation was higher in the tolerant cultivar, mainly under severe water deficit. The finding that the drought-tolerant coffee clone showed enhanced accumulation of CcGolS1 transcripts and RFOs under water deficit suggests the possibility of using this gene to improve drought tolerance in this important crop.

APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

NARCIS (Netherlands)

Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

1997-01-01

Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

Directory of Open Access Journals (Sweden)

Yi Yong-Zhu

2006-08-01

Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

Novel polyhydroxyalkanoate copolymers produced in Pseudomonas putida by metagenomic polyhydroxyalkanoate synthases.

Science.gov (United States)

Cheng, Jiujun; Charles, Trevor C

2016-09-01

Bacterially produced biodegradable polyhydroxyalkanoates (PHAs) with versatile properties can be achieved using different PHA synthases (PhaCs). This work aims to expand the diversity of known PhaCs via functional metagenomics and demonstrates the use of these novel enzymes in PHA production. Complementation of a PHA synthesis-deficient Pseudomonas putida strain with a soil metagenomic cosmid library retrieved 27 clones expressing either class I, class II, or unclassified PHA synthases, and many did not have close sequence matches to known PhaCs. The composition of PHA produced by these clones was dependent on both the supplied growth substrates and the nature of the PHA synthase, with various combinations of short-chain-length (SCL) and medium-chain-length (MCL) PHA. These data demonstrate the ability to isolate diverse genes for PHA synthesis by functional metagenomics and their use for the production of a variety of PHA polymer and copolymer mixtures.

Role of Endothelial Nitric Oxide Synthase Gene Polymorphisms in Predicting Aneurysmal Subarachnoid Hemorrhage in South Indian Patients

Directory of Open Access Journals (Sweden)

Linda Koshy

2008-01-01

Full Text Available Endothelial nitric oxide synthase (eNOS gene polymorphisms have been implicated as predisposing genetic factors that can predict aneurysmal subarachnoid hemorrhage (aSAH, but with controversial results from different populations. Using a case-control study design, we tested the hypothesis whether variants in eNOS gene can increase risk of aSAH among South Indian patients, either independently, or by interacting with other risk factors of the disease. We enrolled 122 patients, along with 224 ethnically matched controls. We screened the intron-4 27-bp VNTR, the promoter T-786C and the exon-7 G894T SNPs in the eNOS gene. We found marked interethnic differences in the genotype distribution of eNOS variants when comparing the South Indian population with the reported frequencies from Caucasian and Japanese populations. Genotype distributions in control and patient populations were found to be in Hardy-Weinberg equilibrium. In patients, the allele, genotype and estimated haplotype frequencies did not differ significantly from the controls. Multiple logistic regression indicated hypertension and smoking as risk factors for the disease, however the risk alleles did not have any interaction with these risk factors. Although the eNOS polymorphisms were not found to be a likely risk factor for aSAH, the role of factors such as ethnicity, gender, smoking and hypertension should be evaluated cautiously to understand the genotype to phenotype conversion.

Molecular cloning and characterization of two β-ketoacyl-acyl carrier protein synthase I genes from Jatropha curcas L.

Science.gov (United States)

Xiong, Wangdan; Wei, Qian; Wu, Pingzhi; Zhang, Sheng; Li, Jun; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

2017-07-01

The β-ketoacyl-acyl carrier protein synthase I (KASI) is involved in de novo fatty acid biosynthesis in many organisms. Two putative KASI genes, JcKASI-1 and JcKASI-2, were isolated from Jatropha curcas. The deduced amino acid sequences of JcKASI-1 and JcKASI-2 exhibit around 83.8% and 72.5% sequence identities with AtKASI, respectively, and both contain conserved Cys-His-Lys-His-Phe catalytic active sites. Phylogenetic analysis indicated that JcKASI-2 belongs to a clade with several KASI proteins from dicotyledonous plants. Both JcKASI genes were expressed in multiple tissues, most strongly in filling stage seeds of J. curcas. Additionally, the JcKASI-1 and JcKASI-2 proteins were both localized to the plastids. Expressing JcKASI-1 in the Arabidopsis kasI mutant rescued the mutant's phenotype and restored the fatty acid composition and oil content in seeds to wild-type, but expressing JcKASI-2 in the Arabidopsis kasI mutant resulted in only partial rescue. This implies that JcKASI-1 and JcKASI-2 exhibit partial functional redundancy and KASI genes play a universal role in regulating fatty acid biosynthesis, growth, and development in plants. Copyright © 2017 Elsevier GmbH. All rights reserved.

Nitric oxide synthase during early embryonic development in silkworm Bombyx mori: Gene expression, enzyme activity, and tissue distribution.

Science.gov (United States)

Kitta, Ryo; Kuwamoto, Marina; Yamahama, Yumi; Mase, Keisuke; Sawada, Hiroshi

2016-12-01

To elucidate the mechanism for embryonic diapause or the breakdown of diapause in Bombyx mori, we biochemically analyzed nitric oxide synthase (NOS) during the embryogenesis of B. mori. The gene expression and enzyme activity of B. mori NOS (BmNOS) were examined in diapause, non-diapause, and HCl-treated diapause eggs. In the case of HCl-treated diapause eggs, the gene expression and enzyme activity of BmNOS were induced by HCl treatment. However, in the case of diapause and non-diapause eggs during embryogenesis, changes in the BmNOS activity and gene expressions did not coincide except 48-60 h after oviposition in diapause eggs. The results imply that changes in BmNOS activity during the embryogenesis of diapause and non-diapause eggs are regulated not only at the level of transcription but also post-transcription. The distribution and localization of BmNOS were also investigated with an immunohistochemical technique using antibodies against the universal NOS; the localization of BmNOS was observed mainly in the cytoplasm of yolk cells in diapause eggs and HCl-treated diapause eggs. These data suggest that BmNOS has an important role in the early embryonic development of the B. mori. © 2016 Japanese Society of Developmental Biologists.

A novel haplotype of low-frequency variants in the aldosterone synthase gene among northern Han Chinese with essential hypertension.

Science.gov (United States)

Zhang, Hao; Li, Xueyan; Zhou, Li; Zhang, Keyong; Zhang, Qi; Li, Jingping; Wang, Ningning; Jin, Ming; Wu, Nan; Cong, Mingyu; Qiu, Changchun

2017-09-01

Low-frequency variants showed that there is more power to detect risk variants than to detect protective variants in complex diseases. Aldosterone plays an important role in the renin-angiotensin-aldosterone system, and aldosterone synthase catalyzes the speed-controlled steps of aldosterone biosynthesis. Polymorphisms of the aldosterone synthase gene (CYP11B2) have been reported to be associated with essential hypertension (EH). CYP11B2 polymorphisms such as -344T/C, have been extensively reported, but others are less well known. This study aimed to assess the association between human CYP11B2 and EH using a haplotype-based case-control study. A total of 1024 EH patients and 956 normotensive controls, which consist of north Han population peasants, were enrolled. Seven single nucleotide polymorphisms (SNPs) (rs28659182, rs10087214, rs73715282, rs542092383, rs4543, rs28491316, and rs7463212) covering the entire human CYP11B2 gene were genotyped as markers using the MassARRAY system. The major allele G frequency of rs542092383 was found to be risk against hypertension [odds ratio (OR) 3.478, 95% confidence interval (95% CI) 1.407-8.597, P = .004]. The AG genotype frequency of SNP rs542092383 was significantly associated with an increased risk of hypertension (OR 4.513, 95% CI 1.426-14.287, P = .010). In the haplotype-based case-control analysis, the frequency of the T-G-T haplotype was higher for EH patients than for controls (OR 5.729, 95% CI 1.889-17.371, P = .000495). All |D'| values of the seven SNPs were >0.9, and r values for rs28659182- rs10087214-rs28491316-rs7463212 SNPs were >0.8 and showed strong linkage intensity. Haplotype T-G-T may therefore be a useful genetic marker for EH.